WorldWideScience

Sample records for single-stranded dna-binding complex

  1. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  2. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  3. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  5. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  6. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  8. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  9. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  11. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  12. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  13. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  14. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  15. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  16. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  17. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  19. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  20. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange.

    Science.gov (United States)

    Qian, Yufeng; Johnson, Kenneth A

    2017-08-04

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  2. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  3. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  4. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  5. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  6. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  7. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  8. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  9. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  10. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  11. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  12. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  13. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  14. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  15. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris

    2012-01-01

    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  16. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  17. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  18. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  19. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  20. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  1. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  2. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  3. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  4. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  5. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  6. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  8. Enantiopure copper(II) complex of natural product rosin derivative: DNA binding, DNA cleavage and cytotoxicity.

    Science.gov (United States)

    Fei, Bao-Li; Yin, Bin; Li, Dong-Dong; Xu, Wu-Shuang; Lu, Yang

    2016-12-01

    To develop chiral anticancer drug candidates for molecular target DNA, the synthesis and characterization of a novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1) was carried out. The coordination geometry of the copper center is a distorted square-planar arrangement. The interactions of 1 and 2 with salmon sperm DNA were investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. All the results reveal that 1 and 2 interacted with DNA through intercalation and 2 exhibited a higher DNA binding ability. Further, 1 and 2 could cleave supercoiled pBR322 DNA by single strand and 2 displayed stronger cleavage ability in the presence of ascorbic acid. In vitro cytotoxicity of 1 and 2 against HeLa, SiHa, HepG-2 and A431 cancer cell lines was studied using CCK-8 assay. The results indicate that 2 had a superior cytotoxicity than 1 and the widely used drug cisplatin under identical conditions. Flow cytometry analysis demonstrates 2 produced death of HeLa cancer cells through an apoptotic pathway. Cell cycle analysis shows that 2 mainly arrested HeLa cells at the S phase. A novel enantiomerically pure copper(II) complex [Cu 1 Cl 2 ] (2) of an optically pure ligand N-(pyridin-2-ylmethylene) dehydroabietylamine (1), based on natural product rosin has been synthesized. 2 has the potential to act as effective anticancer drug.

  9. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  10. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  11. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  12. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  13. Green fluorescent protein fused to the C terminus of RAD51 specifically interferes with secondary DNA binding by the RAD51-ssDNA complex.

    Science.gov (United States)

    Kobayashi, Wataru; Sekine, Satoshi; Machida, Shinichi; Kurumizaka, Hitoshi

    2014-01-01

    Green fluorescent protein (GFP), fused to the N or C terminus of a protein of interest, is widely used to monitor the localization and mobility of proteins in cells. RAD51 is an essential protein that functions in mitotic DNA repair and meiotic chromosome segregation by promoting the homologous recombination reaction. A previous genetic study with Arabidopsis thaliana revealed that GFP fused to the C terminus of RAD51 (RAD51-GFP) inhibits mitotic DNA repair, but meiotic homologous recombination remained unaffected. To determine how the C-terminal GFP specifically inhibits mitotic DNA repair by RAD51, we purified rice RAD51A1-GFP and RAD51A2-GFP, and performed biochemical analyses. Interestingly, purified RAD51A1-GFP and RAD51A2-GFP are proficient in DNA binding and ATP hydrolysis. However, nucleoprotein complexes containing single-stranded DNA and RAD51A1-GFP or RAD51A2-GFP are significantly defective in binding to the second DNA molecule (secondary DNA binding), and consequently fail to catalyze homologous pairing. In contrast, RAD51A1-GFP and RAD51A2-GFP efficiently stimulated homologous pairing promoted by the meiosis-specific RAD51 isoform DMC1. These biochemical characteristics are well conserved in human RAD51-GFP. Therefore, GFP fused to the C terminus of RAD51 abolishes the homologous pairing activity of RAD51 by disrupting secondary DNA binding, but does not affect its DMC1-stimulating activity.

  14. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  15. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates

    Science.gov (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.

    2015-01-01

    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  16. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  17. Aryl-Substituted Ruthenium(II) Complexes: A Strategy for Enhanced Photocleavage and Efficient DNA Binding.

    Science.gov (United States)

    Abreu, Felipe Diógenes; Paulo, Tercio de F; Gehlen, Marcelo H; Ando, Rômulo A; Lopes, Luiz G F; Gondim, Ana Cláudia S; Vasconcelos, Mayron A; Teixeira, Edson H; Sousa, Eduardo Henrique Silva; de Carvalho, Idalina Maria Moreira

    2017-08-07

    Ruthenium polypyridine complexes have shown promise as agents for photodynamic therapy (PDT) and tools for molecular biology (chromophore-assisted light inactivation). To accomplish these tasks, it is important to have at least target selectivity and great reactive oxygen species (ROS) photogeneration: two properties that are not easily found in the same molecule. To prepare such new agents, we synthesized two new ruthenium complexes that combine an efficient DNA binding moiety (dppz ligand) together with naphthyl-modified (1) and anthracenyl-modified (2) bipyridine as a strong ROS generator bound to a ruthenium complex. The compounds were fully characterized and their photophysical and photochemical properties investigated. Compound 2 showed one of the highest quantum yields for singlet oxygen production ever reported (Φ Δ = 0.96), along with very high DNA binding (log K b = 6.78). Such photochemical behavior could be ascribed to the lower triplet state involving the anthracenyl-modified bipyridine, which is associated with easier oxygen quenching. In addition, the compounds exhibited moderate selectivity toward G-quadruplex DNA and binding to the minor groove of DNA, most likely driven by the pendant ligands. Interestingly, they also showed DNA photocleavage activity even upon exposure to a yellow light-emitting diode (LED). Regarding their biological activity, the compounds exhibited an exciting antibacterial action, particularly against Gram-positive bacteria, which was enhanced upon blue LED irradiation. Altogether, these results showed that our strategy succeeded in producing light-triggered DNA binding agents with pharmacological and biotechnological potential.

  18. Predicting DNA-binding proteins and binding residues by complex structure prediction and application to human proteome.

    Directory of Open Access Journals (Sweden)

    Huiying Zhao

    Full Text Available As more and more protein sequences are uncovered from increasingly inexpensive sequencing techniques, an urgent task is to find their functions. This work presents a highly reliable computational technique for predicting DNA-binding function at the level of protein-DNA complex structures, rather than low-resolution two-state prediction of DNA-binding as most existing techniques do. The method first predicts protein-DNA complex structure by utilizing the template-based structure prediction technique HHblits, followed by binding affinity prediction based on a knowledge-based energy function (Distance-scaled finite ideal-gas reference state for protein-DNA interactions. A leave-one-out cross validation of the method based on 179 DNA-binding and 3797 non-binding protein domains achieves a Matthews correlation coefficient (MCC of 0.77 with high precision (94% and high sensitivity (65%. We further found 51% sensitivity for 82 newly determined structures of DNA-binding proteins and 56% sensitivity for the human proteome. In addition, the method provides a reasonably accurate prediction of DNA-binding residues in proteins based on predicted DNA-binding complex structures. Its application to human proteome leads to more than 300 novel DNA-binding proteins; some of these predicted structures were validated by known structures of homologous proteins in APO forms. The method [SPOT-Seq (DNA] is available as an on-line server at http://sparks-lab.org.

  19. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    Energy Technology Data Exchange (ETDEWEB)

    Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

  20. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  1. C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.

    Science.gov (United States)

    Kushwaha, Ambuj K; Grove, Anne

    2013-01-24

    Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.

  2. Synthesis, characterization, DNA binding and cleavage studies of mixed-ligand copper (II complexes

    Directory of Open Access Journals (Sweden)

    M. Sunita

    2017-05-01

    Full Text Available New two copper complexes of type [Cu(Bzimpy(LH2O]SO4 (where L = 2,2′ bipyridine (bpy, and ethylene diamine (en, Bzimpy = 2,6-bis(benzimidazole-2ylpyridine have been synthesized and characterized by elemental analyses, molar conductance measurements, magnetic susceptibility measurements, mass, IR, electronic and EPR spectral studies. Based on elemental and spectral studies six coordinated geometries were assigned to the two complexes. DNA-binding properties of these metal complexes were investigated using absorption spectroscopy, fluorescence spectroscopy, viscosity measurements and thermal denaturation methods. Experimental studies suggest that the complexes bind to DNA through intercalation. These complexes also promote the cleavage of plasmid pBR322, in the presence of H2O2.

  3. Synthesis, characterization, anti-microbial, DNA binding and cleavage studies of Schiff base metal complexes

    Directory of Open Access Journals (Sweden)

    Poomalai Jayaseelan

    2016-09-01

    Full Text Available A novel Schiff base ligand has been prepared by the condensation between butanedione monoxime with 3,3′-diaminobenzidine. The ligand and metal complexes have been characterized by elemental analysis, UV, IR, 1H NMR, conductivity measurements, EPR and magnetic studies. The molar conductance studies of Cu(II, Ni(II, Co(II and Mn(II complexes showed non-electrolyte in nature. The ligand acts as dibasic with two N4-tetradentate sites and can coordinate with two metal ions to form binuclear complexes. The spectroscopic data of metal complexes indicated that the metal ions are complexed with azomethine nitrogen and oxyimino nitrogen atoms. The binuclear metal complexes exhibit octahedral arrangements. DNA binding properties of copper(II metal complex have been investigated by electronic absorption spectroscopy. Results suggest that the copper(II complex bind to DNA via an intercalation binding mode. The nucleolytic cleavage activities of the ligand and their complexes were assayed on CT-DNA using gel electrophoresis in the presence and absence of H2O2. The ligand showed increased nuclease activity when administered as copper complex and copper(II complex behave as efficient chemical nucleases with hydrogen peroxide activation. The anti-microbial activities and thermal studies have also been studied. In anti-microbial activity all complexes showed good anti-microbial activity higher than ligand against gram positive, gram negative bacteria and fungi.

  4. DNA binding and cleavage studies of copper(II) complexes with 2'-deoxyadenosine modified histidine moiety.

    Science.gov (United States)

    Borowska, Justyna; Sierant, Malgorzata; Sochacka, Elzbieta; Sanna, Daniele; Lodyga-Chruscinska, Elzbieta

    2015-09-01

    This work is focused on the study of DNA binding and cleavage properties of 2'-deoxyadenosines modified with ester/amide of histidine (his(6)dA ester, his(6)dA amide) and their copper(II) complexes. To determine the coordination mode of the complex species potentiometric and spectroscopic (UV-visible, CD, EPR) studies have been performed. The analysis of electronic absorption and fluorescence spectra has been used to find the nature of the interactions between the compounds and calf thymus DNA (CT-DNA). There is significant influence of the -NH2 and -OCH3 groups on binding of the ligands or the complexes to DNA. Only amide derivative and its complex reveal intercalative ability. In the case of his(6)dA ester and Cu(II)-his(6)dA ester the main interactions can be groove binding. DNA cleavage activities of the compounds have been examined by gel electrophoresis. The copper complexes have promoted the cleavage of plasmid DNA, but none of the ligands exhibited any chemical nuclease activity. The application of different scavengers of reactive oxygen species provided a conclusion that DNA cleavage caused by copper complexes might occur via hydrolytic pathway.

  5. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  6. A Cationic Smart Copolymer for DNA Binding

    Directory of Open Access Journals (Sweden)

    Tânia Ribeiro

    2017-11-01

    Full Text Available A new block copolymer with a temperature-responsive block and a cationic block was prepared by reversible addition-fragmentation chain transfer (RAFT polymerization, with good control of its size and composition. The first block is composed by di(ethylene glycol methyl ether methacrylate (DEGMA and oligo(ethylene glycol methyl ether methacrylate (OEGMA, with the ratio DEGMA/OEGMA being used to choose the volume phase transition temperature of the polymer in water, tunable from ca. 25 to above 90 °C. The second block, of trimethyl-2-methacroyloxyethylammonium chloride (TMEC, is positively charged at physiological pH values and is used for DNA binding. The coacervate complexes between the block copolymer and a model single strand DNA are characterized by fluorescence correlation spectroscopy and fluorescence spectroscopy. The new materials offer good prospects for biomedical application, for example in controlled gene delivery.

  7. DNA binding properties, histidine interaction and cytotoxicity studies of water soluble ruthenium(ii) terpyridine complexes.

    Science.gov (United States)

    Lazić, Dejan; Arsenijević, Aleksandar; Puchta, Ralph; Bugarčić, Živadin D; Rilak, Ana

    2016-03-21

    In this study, two representatives of previously synthesized ruthenium(ii) terpyridine complexes, i.e., [Ru(Cl-tpy)(en)Cl][Cl] (1) and [Ru(Cl-tpy)(dach)Cl][Cl] (2), were chosen and a detailed study of the kinetic parameters of their reactivity toward l-histidine (l-His), using the UV-Vis and (1)H NMR techniques, was developed. The inner molecular rearrangement from N3-coordinated l-His to the N1 bound isomer, observable in the NMR data, was corroborated by DFT calculations favoring N1 coordination by nearly 4 kcal mol(-1). These two ruthenium(ii) terpyridine complexes were investigated for their interactions with DNA employing UV-Vis spectroscopy, DNA viscosity measurements and fluorescence quenching measurements. The high binding constants obtained in the DNA binding studies (Kb = 10(4)-10(5) M(-1)) suggest a strong binding of the complexes to calf thymus (CT) DNA. Competitive studies with ethidium bromide (EB) showed that the complexes can displace DNA-bound EB, suggesting strong competition with EB (Ksv = 1.5-2.5 × 10(4) M(-1)). In fact, the results indicate that these complexes can bind to DNA covalently and non-covalently. In order to gain insight of the behavior of a neutral compound, besides the four previously synthesized cationic complexes [Ru(Cl-tpy)(en)Cl][Cl] (1), [Ru(Cl-tpy)(dach)Cl][Cl] (2), [Ru(Cl-tpy)(bpy)Cl][Cl] (3) and [Ru(tpy)Cl3] (P2), a new complex, [Ru(Cl-tpy)(pic)Cl] (4), was used in the biological studies. Their cytotoxicity was investigated against three different tumor cell lines, i.e., A549 (human lung carcinoma cell line), HCT116 (human colon carcinoma cell line), and CT26 (mouse colon carcinoma cell line), by the MTT assay. Complexes 1 and 2 showed higher activity than complexes 3, 4 and P2 against all the selected cell lines. The results on in vitro anticancer activity confirmed that only compounds that hydrolyze the monodentate ligand at a reasonable rate show moderate activity, provided that the chelate ligand is a hydrogen bond

  8. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  9. New silver(I) complex with diazafluorene based ligand: Synthesis, characterization, investigation of in vitro DNA binding and antimicrobial studies

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2017-07-01

    A novel diazafluorene based complex with silver, [Ag(dian)2 ] NO3 , where dian is N-(4,5-diazafluoren-9-ylidene)aniline, has been prepared and characterized by elemental analysis, IR spectroscopy, 1HNMR, UV-Vis spectroscopy and cyclic voltammetry. In order to explore the relationship between the structure and biological properties, DNA binding propensity and in vitro antibacterial property have also been studied. The mode of DNA-complex interaction has been investigated by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation, circular dichroism spectroscopy and cyclic voltammetry. The results reveal that the complex binds to CT-DNA in a moderate intercalation capability with the partial insertion of a planar dian ligand between the base stacks of double-stranded DNA with binding constant (Kb) of 2.4 × 105 M-1. The viscosities and CD spectra of the DNA provide strong evidence for the intercalation. An in vitro antibacterial efficacy of the Ag(I) complex on a series of Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) indicates that the complex exhibits a marked antibacterial activity. The minimum inhibitory concentrations of the complex indicate that it exhibits much higher antibacterial effect on standard bacterial strains of Escherichia coli and Staphylococcus aureus than those of silver nitrate, silver sulfadiazine. The bacterial inhibitions of the silver(I) complex are closely agreed to its DNA binding affinities.

  10. DNA binding, photo-induced DNA cleavage and cytotoxicity studies of lomefloxacin and its transition metal complexes

    Science.gov (United States)

    Ragheb, Mohamed A.; Eldesouki, Mohamed A.; Mohamed, Mervat S.

    2015-03-01

    This work was focused on a study of the DNA binding and cleavage properties of lomefloxacin (LMF) and its ternary transition metal complexes with glycine. The nature of the binding interactions between compounds and calf thymus DNA (CT-DNA) was studied by electronic absorption spectra, fluorescence spectra and thermal denaturation experiments. The obtained results revealed that LMF and its complexes could interact with CT-DNA via partial/moderate intercalative mode. Furthermore, the DNA cleavage activities of the compounds were investigated by gel electrophoresis. Mechanistic studies of DNA cleavage suggest that singlet oxygen (1O2) is likely to be the cleaving agent via an oxidative pathway, except for Cu(II) complex which proceeds via both oxidative and hydrolytic pathways. Antimicrobial and antitumor activities of the compounds were also studied against some kinds of bacteria, fungi and human cell lines.

  11. Studies of the silencing of Baculovirus DNA binding protein

    NARCIS (Netherlands)

    Quadt, I.; Lent, van J.W.M.; Knebel-Morsdorf, D.

    2007-01-01

    Baculovirus DNA binding protein (DBP) binds preferentially single-stranded DNA in vitro and colocalizes with viral DNA replication sites. Here, its putative role as viral replication factor has been addressed by RNA interference. Silencing of DBP in Autographa californica multiple

  12. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  13. Type III restriction endonuclease EcoP15I is a heterotrimeric complex containing one Res subunit with several DNA-binding regions and ATPase activity.

    Science.gov (United States)

    Wyszomirski, Karol H; Curth, Ute; Alves, Jürgen; Mackeldanz, Petra; Möncke-Buchner, Elisabeth; Schutkowski, Mike; Krüger, Detlev H; Reuter, Monika

    2012-04-01

    For efficient DNA cleavage, the Type III restriction endonuclease EcoP15I communicates with two inversely oriented recognition sites in an ATP-dependent process. EcoP15I consists of methylation (Mod) and restriction (Res) subunits forming a multifunctional enzyme complex able to methylate or to cleave DNA. In this study, we determined by different analytical methods that EcoP15I contains a single Res subunit in a Mod(2)Res stoichiometry. The Res subunit comprises a translocase (Tr) domain carrying functional motifs of superfamily 2 helicases and an endonuclease domain with a PD..D/EXK motif. We show that the isolated Tr domain retains ATP-hydrolyzing activity and binds single- and double-stranded DNA in a sequence-independent manner. To localize the regions of DNA binding, we screened peptide arrays representing the entire Res sequence for their ability to interact with DNA. We discovered four DNA-binding regions in the Tr domain and two DNA-binding regions in the endonuclease domain. Modelling of the Tr domain shows that these multiple DNA-binding regions are located on the surface, free to interact with DNA. Interestingly, the positions of the DNA-binding regions are conserved among other Type III restriction endonucleases.

  14. Cu(II) complexes of glyco-imino-aromatic conjugates in DNA binding ...

    Indian Academy of Sciences (India)

    Metal complexes have shown toxicity to the HeLa and MCF–7 cell lines. Morphological studies, western blot and FACS analysis are suggestive of apoptotic cell death induced by the metal complexes. Di-nuclear copper complexes were found to be better as compared to the mononuclear ones in binding, plasmid cleavage ...

  15. Effective DNA binding and cleaving tendencies of malonic acid coupled transition metal complexes

    Science.gov (United States)

    Pravin, Narayanaperumal; Utthra, Ponnukalai Ponya; Kumaravel, Ganesan; Raman, Natarajan

    2016-11-01

    Eight transition metal complexes were designed to achieve maximum biological efficacy. They were characterized by elemental analysis and various other spectroscopic techniques. The monomeric complexes were found to espouse octahedral geometry and non-electrolytic nature. The DNA interaction propensity of the complexes with calf thymus DNA (CT-DNA), studied at physiological pH by spectrophotometric, spectrofluorometric, cyclic voltammetry, and viscometric techniques revealed intercalation as the possible binding mode. Fascinatingly, the complexes were found to exhibit greater binding strength than that of the free ligands. A strong hypochromism and a slight red shift were exhibited by complex 5 among the other complexes. The intrinsic binding constant values of all the complexes compared to cisplatin reveal that they are excellent metallonucleases than that of cisplatin. The complexes were also shown to reveal displacement of the ethidium bromide, a strong intercalator using fluorescence titrations. Gel electrophoresis was used to divulge the competence of the complexes in cleaving the supercoiled pBR322 plasmid DNA. From the results, it is concluded that the complexes, especially 5, are excellent chemical nucleases in the presence of H2O2. Furthermore, the in vitro antimicrobial screening of the complexes exposes that these complexes are excellent antimicrobial agents. Overall the effect of coligands is evident from the results of all the investigations.

  16. Polyethyleneimine anchored copper(II) complexes: synthesis, characterization, in vitro DNA binding studies and cytotoxicity studies.

    Science.gov (United States)

    Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Akbarsha, Mohammad Abdulkader

    2015-01-01

    The water soluble polyethyleneimine-copper(II) complexes, [Cu(phen)(L-tyr)BPEI]ClO4 (where phen=1,10-phenanthroline, L-tyr=L-tyrosine and BPEI=branched polyethyleneimine) with various degree of copper(II) complex units in the polymer chain were synthesized and characterized by elemental analysis and electronic, FT-IR, EPR spectroscopic techniques. The binding of these complexes with CT-DNA was studied using UV-visible absorption titration, thermal denaturation, emission, circular dichroism spectroscopy and cyclic voltammetric methods. The changes observed in the physicochemcial properties indicated that the binding between the polymer-copper complexes and DNA was mostly through electrostatic mode of binding. Among these complexes, the polymer-copper(II) complex with the highest degrees of copper(II) complex units (higher degrees of coordination) showed higher binding constant than those with lower copper(II) complex units (lower degrees of coordination) complexes. The complex with the highest number of metal centre bound strongly due to the cooperative binding effect. Therefore, anticancer study was carried out using this complex. The cytotoxic activity for this complex on MCF-7 breast cancer cell line was determined adopting MTT assay, acridine orange/ethidium bromide (AO/EB) staining and comet assay techniques, which revealed that the cells were committed to specific mode of cell death either apoptosis or necrosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Synthesis, DNA binding, photo-induced DNA cleavage, cytotoxicity studies of a family of heavy rare earth complexes.

    Science.gov (United States)

    Chen, Gong-Jun; Wang, Zhi-Gang; Qiao, Xin; Xu, Jing-Yuan; Tian, Jin-Lei; Yan, Shi-Ping

    2013-10-01

    As a continuing investigation of our previous studies about the influence of the different rare earth metal ions on the bioactivity, a family of heavy rare earth metal complexes, [RE(acac)3(dpq)] (RE=Tb (1), Dy (2), Ho (3), Er (4), Tm (5), Yb (6), Lu (7)) and [RE(acac)3(dppz)]·CH3OH (RE=Tb (8), Dy (9), Ho (10), Er (11), Tm (12), Yb (13), Lu (14) viz. acetylacetonate (acac), dipyrido[3,2-d:20,30-f]quinoxaline (dpq), dipyrido[3,2-a:20,30-c] phenazine (dppz)), has been synthesized and their biological activities were also investigated. On the irradiation with UV-A light of 365nm or ambient light, all complexes exhibit efficient DNA cleavage activity via the mechanistic pathway involving the formation of singlet oxygen and hydroxyl radical as the reactive species. In addition, the in vitro cytotoxicity of these complexes on HeLa cells has been examined by MTT assay, which indicate that these compounds have the potential to act as effective anticancer drugs. The results of the above biological experiments also reveal that the choice of different rare earth metal ions has little influence on the DNA binding, DNA cleavage and cytotoxicity. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. The UV-damaged DNA binding protein mediates efficient targeting of the nucleotide excision repair complex to UV-induced photo lesions

    NARCIS (Netherlands)

    Moser, J; Volker, M; Kool, H; Alekseev, S; Vrieling, H; Yasui, A; van Zeeland, AA; Mullenders, LHF

    2005-01-01

    Previous studies point to the XPC-hHR23B complex as the principal initiator of global genome nucleotide excision repair (NER) pathway, responsible for the repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4 photoproducts (6-4PP) in human cells. However, the UV-damaged DNA binding

  19. Rhenium complexes of chromophore-appended dipicolylamine ligands: syntheses, spectroscopic properties, DNA binding and X-ray crystal structure

    International Nuclear Information System (INIS)

    Mullice, L.A.; Buurma, N.J.; Pope, S.J.A.; Laye, R.H.; Harding, L.P.

    2008-01-01

    The syntheses of two chromophore-appended dipicolylamine-derived ligands and their reactivity with penta-carbonyl-chloro-rhenium have been studied. The resultant complexes each possess the fac-Re(CO) 3 core. The ligands L 1 1-[bis(pyridine-2-yl-methyl)amino]methyl-pyrene and L 2 2-[bis(pyridine-2-yl-methyl)amino]methyl-quinoxaline were isolated via a one-pot reductive amination in moderate yield. The corresponding rhenium complexes were isolated in good yields and characterised by 1 H NMR, MS, IR and UV-Vis studies. X-Ray crystallographic data were obtained for fac-{Re(CO) 3 (L 1 )}(BF 4 ), C 34 H 26 BF 4 N 4 O 3 Re: monoclinic, P2(1)/c, a 18.327(2) Angstroms, α = 90.00 degrees, b 14.1537(14) Angstroms, β96.263(6) degrees, c = 23.511(3) Angstroms, γ 90.00 Angstroms, 6062.4(11) (Angstroms) 3 , Z=8. The luminescence properties of the ligands and complexes were also investigated, with the emission attributed to the appended chromophore in each case. Isothermal titration calorimetry suggests that fac-{Re(CO) 3 (L 1 )}(BF 4 ) self-aggregates cooperatively in aqueous solution, probably forming micelle-like aggregates with a cmc of 0.18 mM. Investigations into the DNA-binding properties of fac-{Re(CO) 3 (L 1 )}(BF 4 ) were undertaken and revealed that fac-{Re(CO) 3 (L 1 )}(BF 4 ) binding to fish sperm DNA (binding constant 1.5 ± 0.2 * 10 5 M -1 , binding site size 3.2 ± 0.3 base pairs) is accompanied by changes in the UV-Vis spectrum as typically observed for pyrene-based intercalators while the calorimetrically determined binding enthalpy (-14 ± 2 kcal mol -1 ) also agrees favourably with values as typically found for intercalators. (authors)

  20. Enthused research on DNA-binding and DNA-cleavage aptitude of mixed ligand metal complexes

    Science.gov (United States)

    Mahalakshmi, Rajkumar; Raman, Natarajan

    2013-08-01

    Five new Mn(II), Co(II), Ni(II), Cu(II) and Zn(II) mixed ligand complexes have been synthesized using a Schiff base precursor (obtained by the condensation of N-(4-aminophenyl)acetamide and 4-chlorobenzaldehyde) as main ligand and 1,10-phenanthroline as co-ligand. They have been characterized by microanalytical data, IR, UV-Vis, magnetic moment values, conductivity and electrochemical measurements. The spectral data reveal that all the complexes exhibit octahedral geometry. The high electrical conductance of the complexes supports their electrolytic nature. The monomeric nature of the complexes has been assessed from their magnetic susceptibility values. These complexes are better antimicrobial active agents than the free ligands. DNA (CT) binding properties of these complexes have been explored by UV-Vis., viscosity measurements, cyclic voltammetry, and differential pulse voltammetry measurements. The oxidative cleavage activity of the complexes has been studied using supercoiled pUC19 DNA by gel electrophoresis. The experimental results show that the complexes are good intercalators.

  1. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    Science.gov (United States)

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Synthesis, Cytotoxic Activity, and DNA Binding Properties of Copper (II) Complexes with Hesperetin, Naringenin, and Apigenin

    OpenAIRE

    Tan, Mingxiong; Zhu, Jinchan; Pan, Yingming; Chen, Zhenfeng; Liang, Hong; Liu, Huagang; Wang, Hengshan

    2009-01-01

    Complexes of copper (II) with hesperetin, naringenin, and apigenin of general composition [CuL2(H2O)2]⋅nH2O (1–3) have been synthesized and characterized by elemental analysis, UV-Vis, FT-IR, ESI-MS, and TG-DTG thermal analysis. The free ligands and the metal complexes have been tested in vitro against human cancer cell lines hepatocellular carcinoma (HepG-2), gastric carcinomas (SGC-7901), and cervical carcinoma (HeLa). Complexes 1 and 3 were found to exhibit growth inhibition of SGC-79...

  3. Synthesis, characterization, DNA-binding and cleavage studies of polypyridyl copper(II) complexes

    Science.gov (United States)

    Gubendran, Ammavasi; Rajesh, Jegathalaprathaban; Anitha, Kandasamy; Athappan, Periyakaruppan

    2014-10-01

    Six new mixed-ligand copper(II) complexes were synthesized namely [Cu(phen)2OAc]ClO4ṡH2O(1), [Cu(bpy)2OAc]ClO4ṡH2O(2), [Cu(o-ampacac)(phen)]ClO4(3), [Cu(o-ampbzac)(phen)]ClO4(4), [Cu(o-ampacac)(bpy)]ClO4(5), and [Cu(o-ampbzac)(bpy)]ClO4(6) (phen = 1,10-phenanthroline, bpy = 2, 2‧-bipyridine, o-ampacac = (Z)-4-(2-hydroxylamino)pent-3-ene-2-one,o-ampbzac = (Z)-4-(2-hydroxylamino)-4-phenylbut-3-ene-2-one)and characterized by UV-Vis, IR, EPR and cyclic voltammetry. Ligands were characterized by NMR spectra. Single crystal X-ray studies of the complex 1 shows Cu(II) ions are located in a highly distorted octahedral environment. Absorption spectral studies reveal that the complexes 1-6 exhibit hypochromicity during the interaction with DNA and binding constant values derived from spectral and electrochemical studies indicate that complexes 1, 2 and 3 bind strongly with DNA possibly by an intercalative mode. Electrochemical studies reveal that the complexes 1-4 prefer to bind with DNA in Cu(I) rather than Cu(II) form. The shift in the formal potentials E1/2 and CD spectral studies suggest groove or electrostatic binding mode for the complexes 4-6. Complex 1 can cleave supercoiled (SC) pUC18 DNA efficiently into nicked form II under photolytic conditions and into an open circular form (form II) and linear form (form III) in the presence of H2O2 at pH 8.0 and 37 °C, while the complex 2 does not cleave DNA under similar conditions.

  4. RNA and DNA binding of inert oligonuclear ruthenium(II) complexes in live eukaryotic cells.

    Science.gov (United States)

    Li, Xin; Gorle, Anil K; Ainsworth, Tracy D; Heimann, Kirsten; Woodward, Clifford E; Collins, J Grant; Keene, F Richard

    2015-02-28

    Confocal microscopy was used to study the intracellular localisation of a series of inert polypyridylruthenium(II) complexes with three eukaryotic cells lines - baby hamster kidney (BHK), human embryonic kidney (HEK-293) and liver carcinoma (Hep-G2). Co-staining experiments with the DNA-selective dye DAPI demonstrated that the di-, tri- and tetra-nuclear polypyridylruthenium(II) complexes that are linked by the bis[4(4'-methyl-2,2'-bipyridyl)]-1,12-dodecane bridging ligand ("bb12") showed a high degree of selectivity for the nucleus of the eukaryotic cells. Additional co-localisation experiments with the general nucleic acid stain SYTO 9 indicated that the ruthenium complexes showed a considerable preference for the RNA-rich nucleolus, rather than chromosomal DNA. No significant differences were observed in the intracellular localisation between the ΔΔ and ΛΛ enantiomers of the dinuclear complex. Cytotoxicity assays carried out over 72 hours indicated that the ruthenium complexes, particularly the tri- and tetra-nuclear species, were significantly toxic to the eukaryotic cells. However, when the activity of the least cytotoxic compound (the ΔΔ enantiomer of the dinuclear species) was determined over a 24 hour period, the results indicated that the ruthenium complex was approximately a 100-fold less toxic to liver and kidney cells than to Gram positive bacteria. Circular dichroism (CD) spectroscopy was used to examine the effect of the ΔΔ and ΛΛ enantiomers of the dinuclear complex on the solution conformations of RNA and DNA. The CD experiments indicated that the RNA maintained the A-type conformation, and the DNA the B-type structure, upon binding by the ruthenium complexes.

  5. DNA binding affinity of a macrocyclic copper(II) complex: Spectroscopic and molecular docking studies.

    Science.gov (United States)

    Shahabadi, Nahid; Hakimi, Mohammad; Morovati, Teimoor; Fatahi, Navid

    2017-08-03

    The interaction of a novel macrocyclic copper(II) complex, ([CuL(ClO 4 ) 2 ] that L is 1,3,6,10,12,15-hexaazatricyclo[13.3.1.1 6,10 ]eicosane) with calf thymus DNA (ct-DNA) was investigated by various physicochemical techniques and molecular docking at simulated physiological conditions (pH = 7.4). The absorption spectra of the Cu(II) complex with ct-DNA showed a marked hyperchroism with 10 nm blue shift. The intrinsic binding constant (K b ) was determined as 1.25 × 10 4 M -1 , which is more in keeping with the groove binding with DNA. Furthermore, competitive fluorimetric studies with Hoechst33258 have shown that Cu(II) complex exhibits the ability to displace the ct-DNA-bound Hoechst33258 indicating that it binds to ct-DNA in strong competition with Hoechst33258 for the groove binding. Also, no change in the relative viscosity of ct-DNA and fluorescence intensity of ct-DNA-MB complex in the present of Cu(II) complex is another evidence to groove binding. The thermodynamic parameters are calculated by van't Hoff equation, which demonstrated that hydrogen bonds and van der Waals interactions played major roles in the binding reaction. The experimental results were in agreement with the results obtained via molecular docking study.

  6. Synthesis, structural characterization, cytotoxic properties and DNA binding of a dinuclear copper(II) complex.

    Science.gov (United States)

    Ferreira, B J M Leite; Brandão, P; Meireles, M; Martel, Fátima; Correia-Branco, Ana; Fernandes, Diana M; Santos, T M; Félix, V

    2016-08-01

    In this study a novel dinuclear copper(II) complex with adenine and phenanthroline has been synthesized and its structure determined by single crystal X-ray diffraction. In the dinuclear complex [Cu₂(μ-adenine)₂(phen)₂(H2O)2](NO3)4·0.5H2O (phen=1,10-phenanthroline) (1) the two Cu(II) centres exhibit a distorted square pyramidal coordination geometry linked by two nitrogen donors from adenine bridges leading to a Cu-Cu distance of 3.242(3)Å. Intramolecular and intermolecular π⋯π interactions as well as an H-bonding network were observed. The antitumor capacity of the complex has been tested in vitro against human cancer cell lines, cervical carcinoma (HeLa) and colorectal adenocarcinoma (Caco-2), by metabolic tests, using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide as reagent. The complex 1 has remarkable low IC50 values of 0.87±0.06μM (HeLa) and 0.44±0.06μM (Caco-2), when compared with values for cisplatin against the same cell lines. The interaction of complex 1 with calf thymus DNA (CT DNA) was further investigated by absorption and fluorescence spectroscopic methods. A binding constant of 5.09×10(5)M(-1) was obtained from UV-vis absorption studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Newsilver complexes with bioactive glycine and nicotinamide molecules – characterization, DNA binding, antimicrobial and anticancer evaluation

    Czech Academy of Sciences Publication Activity Database

    Rendošová, M.; Vargová, Z.; Kuchár, J.; Sabolová, D.; Levoča, Š.; Kudláčová, J.; Paulíková, H.; Hudecová, D.; Helebrandtová, V.; Almáši, M.; Vilková, M.; Dušek, Michal; Bobáľová, D.

    2017-01-01

    Roč. 168, Mar (2017), s. 1-12 ISSN 0162-0134 Institutional support: RVO:68378271 Keywords : silver complex * antimicrobial effect * stability * cytotoxicity * intercalation * topo I and II inhibition assay Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 3.348, year: 2016

  8. Cu(II) complexes of glyco-imino-aromatic conjugates in DNA binding ...

    Indian Academy of Sciences (India)

    studied. Copper complexes were found to cleave the plasmid DNA in the absence of oxidizing or reducing ... double stranded DNA under physiological conditions ... 12h. Then the mixture was stirred at room tempe- rature for 24h followed by storing at 4. ◦. C. The solid product precipitated was filtered and washed several.

  9. The effect of metal and substituent on DNA binding, cleavage activity, and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex

    Science.gov (United States)

    Asadi, Zahra; Nasrollahi, Neda

    2017-11-01

    New water soluble Schiff base ligands [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol] (L1) and [N,Nʹ-bis(salicylidine)-1,3-diamino-2-propanol] (L2) and zinc (II) complex of L1: [N,Nʹ-bis{5-[(triphenylphosphonium percholorate)-methyl]salicylidine}-1,3-diamino-2-propanol]Zn(II) were synthesized and characterized by elemental analysis, FT-IR, 1HNMR and UV-Vis spectroscopy. In vitro DNA binding of the compounds were investigated by UV-Vis absorption spectroscopy, viscosity measurement, cyclic voltammetry, fluorescence spectroscopy, and gel electrophoresis. The present study aimed to investigate the effect of metal and substituent on DNA binding, cleavage activity and cytotoxicity of new synthesized Schiff base ligands and Zn(II) complex. The order of DNA binding affinity (Kb) calculated from the absorption spectroscopy was: ZnL1 > L2 > L1. Molecular docking studies explore more details on the mode of binding and binding energies. Although the compounds revealed strong DNA binding affinity but electrophoresis studies don't show any effects on the DNA structure and single or double strand breaks. The cytotoxicity experiments against human Hepatoma (HepG2) showed the order: L1 > ZnL1 > L2.

  10. Synthesis, structure, DNA binding and anticancer activity of mixed ligand ruthenium(II) complex

    Science.gov (United States)

    Gilewska, Agnieszka; Masternak, Joanna; Kazimierczuk, Katarzyna; Trynda, Justyna; Wietrzyk, Joanna; Barszcz, Barbara

    2018-03-01

    In order to obtain a potential chemotherapeutic which is not affected on the normal BALB/3T3 cell line, a new arene ruthenium(II) complex {[RuCl(L1)(η6-p-cymene)]PF6}2 · H2O has been synthesized by a direct reaction of precursor, [{(η6-p-cymene)Ru(μ-Cl)}2Cl2], with N,N-chelating ligand (L1 - 2,2‧-bis(4,5-dimethylimidazole). The compound has been fully characterized by elemental analysis, X-ray diffraction, IR, UV-Vis and 1H, 13C NMR spectroscopies. X-ray analysis have confirmed that the compound crystallized in the monoclinic group Cc as an inversion twin. The asymmetric unit contains two symmetrically independent cationic complexes [RuCl(L1)(η6-p-cymene)]+ whose charge is balanced by two PF6- counterions. The shape of each cationic coordination polyhedral can be described as a distorted dodecahedron and shows a typical piano-stool geometry. In addition, an analysis of the crystal structure and the Hirshfeld surface analysis were used to detect and visualize important hydrogen bonds and intermolecular interaction. Moreover, the antiproliferative behavior of the obtained complex was assayed against three human cells: MV-4-11, LoVo, MCF-7 and BALB/3T3 - normal mice fibroblast cells. To predict a binding mode, a potential interaction of ruthenium complex with calf thymus DNA (CT-DNA) has been explored using UV absorption and circular dichroism (CD).

  11. Strong inhibition of thioredoxin reductase by highly cytotoxic gold(I) complexes. DNA binding studies.

    Science.gov (United States)

    Ortego, Lourdes; Cardoso, Fátima; Martins, Soraia; Fillat, María F; Laguna, Antonio; Meireles, Margarida; Villacampa, M Dolores; Gimeno, M Concepción

    2014-01-01

    Biological properties of a series of aminophosphine-thiolate gold(I) complexes [Au(SR)(PPh2NHpy)] [Ph2PNHpy=2-(diphenylphosphinoamino)pyridine; HSR=2-mercaptopyridine (2-HSpy) (3), 2-mercaptonicotinic acid (2-H2-mna) (4), 2-thiouracil (2-HTU) (5) or 2-thiocytosine (2-HTC) (6)] and [Au(SR){PPh2NH(Htrz)}] [Ph2PNH(Htrz)=3-(diphenylphosphinoamino)-1,2,4-triazole]; HSR=2-mercaptopyridine (2-HSpy) (7), 2-thiocytosine (2-HTC) (8) or 6-thioguanine (6-HTG) (9) have been studied. Their antitumor properties have been tested in vitro against two tumor human cell lines, HeLa (derived from cervical cancer) and MCF-7 (derived from breast cancer), using a metabolic activity test (3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide, MTT). Some of them showed excellent cytotoxic activity. With the aim to obtain more information about the mechanisms of action of these derivatives, the interactions of complexes 3, 5, 7 and 9 with thioredoxin reductase in HeLa cells were studied. They showed a potent inhibition of thioredoxin reductase activity. In order to complete this study, interactions of the complexes with calf thymus (CT-) DNA and with different bacterial DNAs, namely the plasmid pEMBL9 and the promoter region of the furA (ferric uptake regulator A) gene from Anabaena sp. PCC 7120 were investigated. Although interactions of complexes with CT-DNA have been verified, none of them cause significant changes in its structure. © 2013.

  12. Two novel copper complexes of 2,2'-bipyridine: evaluation of the DNA binding and cytotoxic activity.

    Science.gov (United States)

    Fei, Bao-Li; Li, Wen; Xu, Wu-Shuang; Li, Yang-Guang; Long, Jian-Ying; Liu, Qing-Bo; Shao, Kui-Zhan; Su, Zhong-Min; Sun, Wei-Yin

    2013-08-05

    Two novel copper-2,2'-bipyridine complexes [Cu(SAL)(2,2'-bipy)ClO4]2 (1) and [Cu(μ2-O)(2,2'-bipy)NO3]2 (2) (HSAL=salicylaldehyde) were synthesized and characterized by X-ray single-crystal diffraction, elemental analysis and IR spectra. The interactions of the complexes with salmon sperm DNA were investigated by viscosity analysis, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral (Kb=3.00×10(5)M(-1) (1), 3.49×10(5)M(-1)(2)), emission spectral ((Ksv) 3.33×10(4)M(-1) (1), 3.40×10(4)M(-1) (2)), and viscosity measurements reveal that 1 and 2 interact with DNA through intercalation. In fluorimetric studies, the enthalpy (ΔH>0) and entropy (ΔS>0) changes of the reactions between the Cu (II) complexes with DNA demonstrate hydrophobic interactions. In addition, CD study indicates the Cu (II) complexes cause a more B-like to a more A-like conformational change upon binding DNA. All the experimental results show that the interaction mode of the two complexes was greatly affected by the coordination environments of Cu (II) centers. Their in vitro cytotoxicity towards five selected tumor cell lines HepG-2, HeLa, NCI-H460, MCF-7 and HL-60 has been evaluated by MTT method, and 2 exhibits higher growth inhibition of the selected cell lines at concentration of 50 μM, this result is identical with their DNA binding ability order. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Synthesis and DNA binding/cleavage of mononuclear copper(II) phenanthroline/bipyridine proline complexes.

    Science.gov (United States)

    Reddy, Pulimamidi R; Raju, Nomula; Manjula, Pallerla; Reddy, Karnati V G

    2007-07-01

    The complexes [Cu(II)(phen)(L-Pro)(H2O)]+ ClO4(-) (1; phen = 1,10-phenanthroline) and [Cu(II)(bipy)(L-Pro)(H2O)]+ ClO4(-) (2; bipy = 2,2'-bipyridine) were synthesized and characterized by IR, magnetic susceptibility, UV/VIS, EPR, ESI-MS, elemental analysis, and theoretical calculations. The metal center was found in a square-pyramidal geometry. UV/VIS, thermal-denaturation, and fluorescence-spectroscopic studies were conducted to assess the interaction of the complexes with CT-DNA. An intercalative mode of binding was found, with intrinsic binding constants (Kb) of 3.86x10(3) and 4.6x10(3) M(-1) and Stern-Volmer quenching constants (K) of 0.15 and 0.11 for 1 and 2, respectively. Interestingly, none of the Cu(II) complexes was able to cleave pUC-19 DNA, which is attributed to the absence of a Pro amide H-atom and inhibition of the formation of an OH radical from the axially coordinated H2O molecule.

  14. Synthesis, micellization behavior, antimicrobial and intercalative DNA binding of some novel surfactant copper(II) complexes containing modified phenanthroline ligands.

    Science.gov (United States)

    Nagaraj, Karuppiah; Ambika, Subramanian; Rajasri, Shanmugasundaram; Sakthinathan, Subramanian; Arunachalam, Sankaralingam

    2014-10-01

    The novel surfactant copper(II) complexes, [Cu(ip)2DA](ClO4)21, [Cu(dpqc)2DA](ClO4)22, [Cu(dppn)2DA](ClO4)23, where ip=imidazo[4,5-f][1,10]phenanthroline, dpqc=dipyrido[3,2-a:2',4'-c](6,7,8,9-tetrahydro)phenazine, dppn=benzo[1]dipyrido[3,2-a':2',3'-c]phenazine and DA-dodecylamine, were synthesized and characterized by physico-chemical and spectroscopic methods. In these complexes 1-3, the geometry of copper metal ions was described as square pyramidal. The critical micelle concentration (CMC) value of these surfactant copper(II) complexes in aqueous solution was found out from conductance measurements. Specific conductivity data at different temperatures served for the evaluation of the temperature-dependent CMC and the thermodynamics of micellization (ΔGm°, ΔHm° and ΔSm°). The binding interaction of these complexes with DNA (calf thymus DNA) in Tris buffer was studied by physico-chemical techniques. In the presence of the DNA UV-vis spectrum of complexes showed red shift of the absorption band along with significant hypochromicity indicating intercalation of our complexes with nucleic acids. Competitive binding study with ethidium bromide (EB) shows that the complexes exhibit the ability to displace the nucleic acid-bound EB indicating that the complexes bind to nucleic acids in strong competition with EB for the intercalative binding site. Observed changes in the circular dichoric spectra of DNA in the presence of surfactant complexes support the strong binding of complexes with DNA. CV results also confirm this mode of binding. Some significant thermodynamic parameters of the binding of the titled complexes to DNA have also been determined. The results reveal that the extent of DNA binding of 3 was greater than that of 1 and 2. The antibacterial and antifungal screening tests of these complexes have shown good results compared to its precursor chloride complexes. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. In vitro DNA binding studies of the sweetening agent saccharin and its copper(II) and zinc(II) complexes.

    Science.gov (United States)

    Icsel, Ceyda; Yilmaz, Veysel T

    2014-01-05

    The interactions of fish sperm DNA (FS-DNA) with the sodium salt of sweetener saccharin (sacH) and its copper and zinc complexes, namely [M(sac)2(H2O)4]·2H2O (M=Cu(II) or Zn(II)) were studied by using UV-Vis titration, fluorometric competition, thermal denaturation, viscosity and gel electrophoresis measurements. The intrinsic binding constants (Kb) obtained from absorption titrations were estimated to be 2.86 (±0.06)×10(4)M(-1) for Na(sac), 6.67 (±0.12)×10(4)M(-1) for Cu-sac and 4.01 (±0.08)×10(4)M(-1) for Zn-sac. The Cu-sac complex binds to FS-DNA via intercalation with a KA value of 50.12 (±0.22)×10(4)M(-1) as evidenced by competitive binding studies with ethidium bromide. Moreover, competition experiments with Hoechst 33258 are indicative of a groove binding mode of Na(sac) and Zn-sac with binding constants of 3.13 (±0.16)×10(4)M(-1) and 5.25 (±0.22)×10(4)M(-1), respectively. The spectroscopic measurements indicate a moderate DNA binding affinity of Na(sac) and its metal complexes. The suggested binding modes are further confirmed by the thermal denaturation and viscosity measurements. In addition, Cu-sac and Zn-sac show weak ability to damage to pBR322 supercoiled plasmid DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Non-enolisable Knoevenagel condensate appended Schiff bases-metal (II) complexes: Spectral characteristics, DNA-binding and nuclease activities

    Science.gov (United States)

    Gubendran, Ammavasi; Kesavan, Mookkandi Palsamy; Ayyanaar, Srinivasan; Mitu, Liviu; Athappan, Periyakaruppan; Rajesh, Jegathalaprathaban

    2017-06-01

    New Schiff base complexes [Cu(L1)Cl] (1), [Ni(L1)Cl] (2), [Zn(L1)Cl] (3), and [Fe(L2)H2OCl] (4) {L1 = (4E)-3-(2-hydroxybenzylidene)-4-(2-hydroxyphenylimino)pentan-2-one, L2 = 2,2‧-(1E,1‧E)-(3-(2-hydroxybenzylidene)-pentane-2,4-diylidene)bis(azan-1-yl-1 idene)diphenol} have been synthesized and characterized by elemental analysis, UV-Vis, IR, FAB-mass, EPR, spectral studies and electrochemical studies, the ligands L1 &L2 were characterized by 1H and 13C NMR spectra. Complex 1 show a visible spectral d-d band near 600 nm and display cyclic voltammetric quasireversible response for the Cu(II)/Cu(I) couple vs Ag/AgCl in DMSO. The EPR spectrum of 1 show g‖ > g⊥ suggesting a square planar geometry around copper with dx2 - y2 as the ground state. The mass spectral results have confirmed the proposed structure for complexes 1-4. DNA binding properties of these complexes 1-4 have been investigated by absorption titrations, cyclic voltammetric studies and circular dichroism studies. On titration with DNA, the complexes 1-4 show hypochromism at the MLCT band (13-31%) with a red shift of 1-8 nm in the electronic spectrum and positive shift of voltammetric E1/2 in the CV studies are in favour of intercalative binding. CD spectra of 1 showed an increase in molar ellipticity (θ278) of the positive band with a minor red shift indicating the transition of B-form of DNA to A like form. DNA cleavage studies of complexes 1 and 4 with pUC18 DNA were studied by gel electrophoresis and complex 4 cleaves supercoiled pUC18 DNA in an oxidative manner in the presence of H2O2 and on photo irradiation at 312 nm.

  17. NMR studies on DNA binding specificity of the lac repressor

    NARCIS (Netherlands)

    Kopke Salinas, Roberto

    2005-01-01

    The thesis describes NMR structures of two protein-DNA complexes. The first structure shows how the protein, the DNA binding domain of lac repressor, recognizes its natural DNA binding site, by adaptation and read out of the nucleotide sequence. The second one shows how the DNA binding specificity

  18. Synthesis and thermal studies of tetraaza macrocylic ligand and its transition metal complexes. DNA binding affinity of copper complex.

    Science.gov (United States)

    Saif, M; Mashaly, Mahmoud M; Eid, Mohamed F; Fouad, R

    2011-09-01

    A Tetraaza Macrocylic Ligand (H2L) and its complexes, [Cd(H2L)(OH2)2](NO3)(2)·1/2OH2 (I), [Co(H2L)(OH2)](NO3)(2)·1/2OH2 (II), [Cu(H2L)(NO3)2]·3/2OH2 (III) and [Ni(H2L)(NO3)(OH2)]NO3·OH2 (IV), have been synthesized and characterized on the basis of elemental analysis, molar conductivity, 1H NMR, UV-vis, FT-IR and mass spectroscopy. All results confirm that the prepared compounds have 1:1 metal-to-ligand stoichiometry, octahedral configuration and the ligand behaves as a neutral tetradendate towards the metal ions. [CdL(OH2)2] (V), [CoL(OH2)2] (VI), [CuL(OH2)2] (VII) and [Ni(H2L)(NO3)2] (VIII) were synthesized pyrolytically in solid state from corresponding compounds (I-IV). Analytical results of complexes (V-VIII) show that the ligand behaves either as a neutral tetradendate or dianionic tetradentate ligand towards the metal ions. The binding of H2L and its copper complex (III) to DNA has been investigated by ultraviolet absorption spectroscopy. The experiments indicate that H2L and its copper complex (III) can bind to DNA through an intercalative mode. The H2L and its copper complex (III) exhibited anti-tumor activity against Ehrlich Acites Carcinoma (E.A.C) at the concentration of 100 μg/ml. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  20. Synthesis, characterization, X-ray crystal structure, DFT calculation, DNA binding, and antimicrobial assays of two new mixed-ligand copper(II) complexes

    Science.gov (United States)

    Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Mohamadi, Maryam; Suarez, Sebastian; Baggio, Ricardo; Khaleghi, Moj; Torkzadeh-Mahani, Masoud; Mostafavi, Ali

    2015-05-01

    Two new Cu(II) complexes, [Cu(L)(phen)] (1), [Cu(L)(bipy)] (2), where L2- = (3-methoxy-2oxidobenzylidene)benzohydrazidato, phen = 1,10 phenanthroline, and bipy = 2,2‧ bipyridine, were prepared and fully characterized using elemental analyses, FT-IR, molar conductivity, and electronic spectra. The structures of both complexes were also determined by X-ray diffraction. It was found that, both complexes possessed square pyramidal coordination environment in which, Cu(II) ions were coordinated by donor atoms of HL and two nitrogens of heterocyclic bases. Computational studies were performed using DFT calculations at B3LYP/6-311+G(d,p) level of theory. DNA binding activities of these complexes were also investigated using electronic absorption, competitive fluorescence titration and cyclic voltammetry studies. The obtained results indicated that binding of the complexes to DNA was of intercalative mode. Furthermore, antimicrobial activities of these compounds were screened against microorganisms.

  1. Synthesis, molecular docking and DNA binding studies of phthalimide-based copper(II) complex: In vitro antibacterial, hemolytic and antioxidant assessment

    Science.gov (United States)

    Arif, Rizwan; Nayab, Pattan Sirajuddin; Ansari, Istikhar A.; Shahid, M.; Irfan, Mohammad; Alam, Shadab; Abid, Mohammad; Rahisuddin

    2018-05-01

    In the present research work, we prepared N-substituted phthalimide, 2-(-(2-(2-(2-(1,3-dioxoisoindoline-2-yl-ethylamino)ethylamino)ethyl)isoindoline-1,3-dione (DEEI) and its copper(II) complex. The ligand (DEEI) and its Cu(II) complex were structurally identified using absorption, FTIR, NMR, electron spin resonance, X-ray diffraction spectral studies, thermogravimetric and elemental analyses. The electronic spectrum and magnetic moment value proposed that Cu(II) complex has square planar geometry. The DNA interaction ability of the ligand (DEEI) and Cu(II) complex was studied by means of absorption and fluorescence spectrophotometer, viscosity measurements, cyclic voltammetery, and circular dichroism methods. The extent of DNA binding (Kb) with Calf thymus (Ct-DNA) follows the order of Cu(II) complex (1.11 × 106 M-1) > DEEI (1.0 × 105 M-1), indicating that Cu(II) complex interact with Ct-DNA through groove binding mode and more sturdily than ligand (DEEI). Interestingly, in silico predictions were corroborated with in vitro DNA binding studies. The antibacterial evaluation of these compounds was screened against a panel of bacterial strains Pseudomonas aeruginosa (MTCC 2453), Salmonella enterica (MTCC 3224), Streptococcus pneumoniae (MTCC 655), Enterococcus faecalis (MTCC 439), Klebsiella pneumonia and Escherichia coli (ATCC 25922). The results showed that the copper(II) complex has significant antibacterial potential (IC50 = 0.0019 μg/mL) against Salmonella enteric comparable with ligand (DEEI) and standard drug ciprofloxacin. Growth curve study of Cu(II) complex against only three bacterial strains S. enterica, E. faecalis and S. pneumoniae showed its bactericidal nature. Cu(II) complex showed less than 2% hemolysis on human RBCs indicating its non toxic nature. The results of antioxidant assay demonstrated that scavenging activity of Cu(II) complex is higher as compared to ligand and ascorbic acid as standard.

  2. Multispectroscopic DNA-Binding studies and antimicrobial evaluation of new mixed-ligand Silver(I) complex and nanocomplex: A comparative study

    Science.gov (United States)

    Movahedi, Elaheh; Rezvani, Ali Reza

    2018-05-01

    A novel mixed-ligand Ag(I) complex, , has been synthesized and characterized by the elemental analysis, IR spectroscopy and 1HNMR. In the formula, dian and phen are N-(4,5-diazafluoren-9-ylidene)aniline and 1,10-phenanthroline, respectively. This complex also has been prepared at nano size by sonochemical technique and characterized by the FTIR and scanning electron microscopy (SEM). To evaluate the biological preferences of the Ag(I) complex and nanocomplex and verify the relationships between the structure and biological function, in vitro DNA binding and antibacterial experiments have been carried out. DNA-complex interaction has been pursued by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation and circular dichroism spectroscopy in the physiological pH. Each compound displays significant binding trend to the CT-DNA. The mode of binding to the CT-DNA probably is a moderate intercalation mode with the partial insertion of the planar ligands between the base stacks of double-stranded DNA. The relative viscosities and circular dichroism spectra of the CT-DNA with the complex solutions, confirm the intense interactions of the Ag(I) complex and nanocomplex with DNA. An in vitro antibacterial test of the complex and nanocomplex on a series of the Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and the Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) shows a remarkable antibacterial feature of the Ag(I) complex. The MIC values (minimum inhibitory concentration) of the compounds compare with silver nitrate and silver sulfadiazine. The bacterial inhibitions of the Ag(I) complex and nanocomplex are agreed to their DNA binding affinities.

  3. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. DNA binding and cleavage studies of new sulfasalazine-derived dipeptide Zn(II) complex: Validation for specific recognition with 5 Prime -TMP

    Energy Technology Data Exchange (ETDEWEB)

    Tabassum, Sartaj, E-mail: tsartaj62@yahoo.com [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India); Al-Asbahy, Waddhaah M.; Afzal, Mohd.; Shamsi, Manal; Arjmand, Farukh [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India)

    2012-11-15

    A new water soluble complex [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O, 1 derived from dipeptide (glycyl glycine) and sulfasalazine was synthesized and characterized by spectroscopic (IR, UV-vis, NMR, ESI-MS) and analytical methods. The in vitro DNA binding studies of complex 1 with calf-thymus DNA were carried out by employing various biophysical methods and molecular docking technique which reveals strong electrostatic binding via phosphate backbone of DNA helix, in addition to partial intercalation. To gain further insight into the molecular recognition at the target site, interaction studies of complex 1 with 5 Prime -TMP and 5 Prime -GMP were carried out by UV-vis titration which was validated by {sup 1}H and {sup 31}P NMR with 5 Prime -TMP, which implicate the preferential selectivity of 1 towards N3 of thymine. Complex 1 is accessible to minor groove of DNA and cleaved pBR322 DNA via hydrolytic pathway (validated by T4 ligase assay). - Graphical abstract: Synthesis, characterization, DNA binding and cleavage studies of [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O (1) containing glycyl glycine and sulfasalazine ligand. Complex 1 recognize minor groove of DNA and show hydrolytic DNA cleavage. Highlights: Black-Right-Pointing-Pointer Novel Zn(II) complex 1 bearing bioactive glycyl glycine and sulfasalazine ligand scaffold. Black-Right-Pointing-Pointer Cleavage activity of 1 was enhanced in presence of activators: H{sub 2}O{sub 2}>MPA>GSH>Asc. Black-Right-Pointing-Pointer Complex 1 recognize minor groove as depicted in the cleavage pattern and molecular docking. Black-Right-Pointing-Pointer Complex 1 cleaves pBR322 DNA via hydrolytic mechanism and validated by T4 DNA ligase experiments.

  5. Synthesis, spectroscopic characterization and antimicrobial activity of binuclear metal complexes of a new asymmetrical Schiff base ligand: DNA binding affinity of copper(II) complexes

    Science.gov (United States)

    Shebl, Magdy

    2014-01-01

    The 1:1 condensation of o-acetoacetylphenol and 1,2-diaminopropane under condition of high dilution gives the mono-condensed Schiff base, (E)-3-(1-aminopropan-2-ylimino)-1-(2-hydroxyphenyl)butan-1-one. The mono-condensed Schiff base has been used for further condensation with isatin to obtain the new asymmetrical dicompartmental Schiff base ligand, (E)-3-(2-((E)-4-(2-hydroxyphenyl)-4-oxobutan-2-ylideneamino) propylimino)indolin-2-one (H3L) with a N2O3 donor set. Reactions of the ligand with metal salts give a series of new binuclear complexes. The ligand and its metal complexes were characterized by elemental analyses, IR, 1H and 13C NMR, electronic, ESR and mass spectra, conductivity and magnetic susceptibility measurements as well as thermal analyses. The analytical and spectroscopic tools showed that the complexes can be formulated as: [(HL)(VO)2(SO4)(H2O)]·4H2O, [(HL)Fe2Cl4(H2O)3]·EtOH, [(HL)Fe2(ox)Cl2(H2O)3]·2H2O, [(L)M2(OAc)(H2O)m]·nH2O; M = Co, Ni or Cu, m = 4, 0 and n = 2, 3, [(HL)Cu2Cl]Cl·6H2O and [(L)(UO2)2(OAc)(H2O)3]·6H2O. The metal complexes exhibited octahedral geometrical arrangements except copper complexes that exhibited tetrahedral geometries and uranyl complex in which the metal ion is octa-coordinated. The Schiff base and its metal complexes were evaluated for antimicrobial activity against Gram positive bacteria (Staphylococcus aureus), Gram negative bacteria (Escherichia coli) and fungi (Candida albicans and Aspergillus flavus). The ligand and some of its complexes were found to be biologically active. The DNA-binding properties of the copper complexes (6 and 7) have been investigated by electronic absorption, fluorescence and viscosity measurements. The results obtained indicate that these complexes bind to DNA via an intercalation binding mode with an intrinsic binding constant, Kb of 1.34 × 104 and 2.5 × 104 M-1, respectively.

  6. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  7. Identification of DNA-binding protein target sequences by physical effective energy functions: free energy analysis of lambda repressor-DNA complexes.

    Directory of Open Access Journals (Sweden)

    Caselle Michele

    2007-09-01

    Full Text Available Abstract Background Specific binding of proteins to DNA is one of the most common ways gene expression is controlled. Although general rules for the DNA-protein recognition can be derived, the ambiguous and complex nature of this mechanism precludes a simple recognition code, therefore the prediction of DNA target sequences is not straightforward. DNA-protein interactions can be studied using computational methods which can complement the current experimental methods and offer some advantages. In the present work we use physical effective potentials to evaluate the DNA-protein binding affinities for the λ repressor-DNA complex for which structural and thermodynamic experimental data are available. Results The binding free energy of two molecules can be expressed as the sum of an intermolecular energy (evaluated using a molecular mechanics forcefield, a solvation free energy term and an entropic term. Different solvation models are used including distance dependent dielectric constants, solvent accessible surface tension models and the Generalized Born model. The effect of conformational sampling by Molecular Dynamics simulations on the computed binding energy is assessed; results show that this effect is in general negative and the reproducibility of the experimental values decreases with the increase of simulation time considered. The free energy of binding for non-specific complexes, estimated using the best energetic model, agrees with earlier theoretical suggestions. As a results of these analyses, we propose a protocol for the prediction of DNA-binding target sequences. The possibility of searching regulatory elements within the bacteriophage λ genome using this protocol is explored. Our analysis shows good prediction capabilities, even in absence of any thermodynamic data and information on the naturally recognized sequence. Conclusion This study supports the conclusion that physics-based methods can offer a completely complementary

  8. Evaluation of DNA binding, DNA cleavage, protein binding, radical scavenging and in vitro cytotoxic activities of ruthenium(II) complexes containing 2,4-dihydroxy benzylidene ligands.

    Science.gov (United States)

    Mohanraj, Maruthachalam; Ayyannan, Ganesan; Raja, Gunasekaran; Jayabalakrishnan, Chinnasamy

    2016-12-01

    The new ruthenium(II) complexes with hydrazone ligands, 4-Methyl-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL(1)), 4-Methoxy-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL(2)), 4-Bromo-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL(3)), were synthesized and characterized by various spectro analytical techniques. The molecular structures of the ligands were confirmed by single crystal X-ray diffraction technique. The DNA binding studies of the ligands and complexes were examined by absorption, fluorescence, viscosity and cyclic voltammetry methods. The results indicated that the ligands and complexes could interact with calf thymus DNA (CT-DNA) through intercalation. The DNA cleavage activity of the complexes was evaluated by gel electrophoresis assay, which revealed that the complexes are good DNA cleaving agents. The binding interaction of the ligands and complexes with bovine serum albumin (BSA) was investigated using fluorescence spectroscopic method. Antioxidant studies showed that the complexes have a strong radical scavenging properties. Further, the cytotoxic effect of the complexes examined on cancerous cell lines showed that the complexes exhibit significant anticancer activity. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. SODs, DNA binding and cleavage studies of new Mn(III) complexes with 2-((3-(benzyloxy)pyridin-2-ylimino)methyl)phenol

    Science.gov (United States)

    Shivakumar, L.; Shivaprasad, K.; Revanasiddappa, Hosakere D.

    2013-04-01

    Newly synthesized ligand [2-((3-(benzyloxy)pyridin-2-ylimino)methyl)phenol] (Bpmp) react with manganese(II) to form mononuclear complexes [Mn(phen)(Bpmp)(CH3COO)(H2O)]·4H2O (1), (phen = 1,10-phenanthroline) and [Mn(Bpmp)2(CH3COO)(H2O)]·5H2O (2). These complexes were characterized by elemental analysis, IR, 1H NMR, Mass, UV-vis spectral studies. Molar conductance and thermogravimetric analysis of these complexes were also recorded. The in vitro SOD mimic activity of Mn(III) complexes were carried out and obtained with good result. The DNA-binding properties of the complexes 1 and 2 were investigated by UV-spectroscopy, fluorescence spectroscopy and viscosity measurements. The spectral results suggest that the complexes 1 and 2 can bind to Calf thymus DNA by intercalation mode. The cleavage properties of these complexes with super coiled pUC19 have been studied using the gel electrophoresis method, wherein both complexes 1 and 2 displayed chemical nuclease activity in the absence and presence of H2O2via an oxidative mechanism. All the complexes inhibit the growth of both Gram positive and Gram negative bacteria to competent level. The MIC was determined by microtiter method.

  10. New transition metal complexes of 2,4-dihydroxybenzaldehyde benzoylhydrazone Schiff base (H2dhbh): Synthesis, spectroscopic characterization, DNA binding/cleavage and antioxidant activity

    Science.gov (United States)

    Aboafia, Seyada A.; Elsayed, Shadia A.; El-Sayed, Ahmed K. A.; El-Hendawy, Ahmed M.

    2018-04-01

    New complexes [VO2(Hdhbh)] (1), [VO(phen)(dhbh)].1.5H2O (2), [Zn(Hdhbh)2] (3), [MoO2(dhbh)(D)] (D = H2O (4) or MeOH (5)), [Ru(PPh3)(dhbh)Cl(H2O)] (6), and [Pd(Hdhbh)Cl]·H2O (7) (H2dhbh = Schiff base derived from 2,4-dihydroxybenzaldehyde and benzoylhydrazone) have been isolated and characterized by IR, 1H NMR, Mass, UV-Visible and ESR spectroscopy. They were also investigated by cyclic voltammetry, thermal and magnetic measurements and the structure of complex cis-[MoO2(dhbh)(H2O)] (4) was solved by X-ray crystallography. Analytical data showed that H2dhbh behaves as monobasic/or dibasic tridentate ligand via phenolate O, azomethine N and amide O/or deprotonated amide O atoms. Antioxidant activity of the complexes has been evaluated against DPPH (2,2-diphenyl-1-picrylhydrazyl) radical and it has been found that oxovandium (IV) complex (2) displays the highest radical scavenging potency comparable to ascorbic acid as a standard antioxidant. The DNA binding properties of the ligand and its complexes have been investigated by electronic spectroscopy together with DNA cleavage by gel electrophoresis whose results showed also that vanadium (IV) complex (2) has a significant oxidative cleavage among other complexes.

  11. DNA-binding, catalytic oxidation, C—C coupling reactions and antibacterial activities of binuclear Ru(II thiosemicarbazone complexes: Synthesis and spectral characterization

    Directory of Open Access Journals (Sweden)

    Arumugam Manimaran

    2012-07-01

    Full Text Available New hexa-coordinated binuclear Ru(II thiosemicarbazone complexes of the type {[(B(EPh3(COClRu]2L} (where, E = P or As; B = PPh3 or AsPh3 or pyridine; L = mononucleating NS donor of N-substituted thiosemicarbazones have been synthesized and characterized by elemental analysis, FT-IR, UV–vis and 31P{1H} NMR cyclic voltammetric studies. The DNA-binding studies of Ru(II complexes with calf thymus DNA (CT-DNA were investigated by UV–vis, viscosity measurements, gel-electrophoresis and fluorescence spectroscopy. The new complexes have been used as catalysts in C—C coupling reaction and in the oxidation of alcohols to their corresponding carbonyl compounds by using NMO as co-oxidant and molecular oxygen (O2 atmosphere at ambient temperature. Further, the new binucleating thiosemicarbazone ligands and their Ru(II complexes were also screened for their antibacterial activity against Klebsiella pneumoniae, Shigella sp., Micrococcus luteus, Escherichia coli and Salmonella typhi. From this study, it was found out that the activity of the complexes almost reaches the effectiveness of the conventional bacteriocide.

  12. Experimental and theoretical studies on the DNA-binding of cationic yttrium(III) complex containing 2,2‧-bipyridine

    Science.gov (United States)

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Akbari, Alireza; Mirkazehi-Rigi, Sohaila

    2015-03-01

    The interaction of DNA with [Y(bpy)(OH2)6]+3, where bpy is 2,2‧-bipyridine has been studied at physiological pH in Tris-HCl buffer. Fluorescence and absorption spectroscopy, agarose gel electrophoresis as well as EB quenching experiments are used to study DNA binding of the complex. The results reveal that DNA have the strong ability to bind with Y(III) complex. The binding constant, Kb and the Stern-Volmer quenching constant, KSV are determined. For characterization of the binding mode between the Y(III) complex and DNA various procedures such as: iodide quenching assay, salt effect and thermodynamical investigation are used. The results suggest that minor groove binding should be the interaction mode of complex to DNA. A gel electrophoresis assay demonstrates the ability of the complex to cleave the DNA via oxidative pathway. Electronic structure of [Y(bpy)(OH2)6]+3 was also carried out applying the density functional theory (DFT) method and applied to explain some obtained experimental observations.

  13. DNA binding, DNA cleavage and BSA interaction of a mixed-ligand copper(II) complex with taurine Schiff base and 1,10-phenanthroline.

    Science.gov (United States)

    Li, Lianzhi; Guo, Qiong; Dong, Jianfang; Xu, Tao; Li, Jinghong

    2013-08-05

    The DNA-binding properties and DNA-cleavage activities of a Cu(II) complex, [Cu(sal-tau(phen)]·1.5H2O (sal-tau=a Schiff base derived from salicylaldehyde and taurine, phen=1,10-phenanthroline), have been investigated by using UV-Vis absorption, fluorescence, circular dichroism (CD) spectra and agarose gel electrophoresis. Results indicated that this Cu(II) complex can bind to calf thymus DNA (CT-DNA) via an intercalative mode and shows efficient cleavage activity in the absence and presence of reducer. Its intrinsic binding constant Kb (1.66×10(4)M(-1)) was calculated by absorption spectra and its linear Stern-Volmer quenching constant K(sq) (3.05) was obtained from florescence spectroscopy, as well as the cleaving reaction rate constant k1 (2.0×10(-4)s(-1)) was acquired from agarose gel electrophoresis. Meanwhile, the interactions of the complex with BSA have also been studied by spectroscopy. Results showed that the complex could quench the intrinsic fluorescence of bovine serum albumin (BSA) remarkably through a static quenching process, and induce a conformational change with the loss of helical stability of protein. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. The effects of linear assembly of two carbazole groups on acid-base and DNA-binding properties of a ruthenium(II) complex

    Science.gov (United States)

    Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi

    2013-07-01

    A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy = 2,2-bipyridine, Hbcpip = 2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5 ± 1.4) × 105 M-1 in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived.

  15. DNA binding propensity and nuclease efficacy of biosensitive Schiff base complexes containing pyrazolone moiety: Synthesis and characterization

    Science.gov (United States)

    Paulpandiyan, Rajakkani; Raman, Natarajan

    2016-12-01

    A series of novel Co(II), Cu(II), Ni(II) and Zn(II) complexes (1-8) were synthesized from pyrazolone precursor Schiff base(s), obtained by the condensation of 4-amino-2,3-dimethyl-1-phenyl-3-pyrazolin-5-one (4-aminoantipyrine) with cinnamaldehyde/benzaldehyde and respective metal(II) chloride. They have been characterized by elemental analysis, magnetic susceptibility, molar conductance measurements, UV-Vis., IR, NMR, ESI mass spectra and EPR studies. These complexes show lower conductance values, supporting their non-electrolytic nature. Spectroscopic and other analytical data of the complexes suggest octahedral geometry. The binding properties of these complexes with DNA have been explored by electronic absorption spectra, cyclic voltammetry and viscosity measurements which reveal that the complexes have the ability to interact with calf thymus DNA (CT DNA) by intercalative mode. The binding constant (Kb) values clearly signify that the complex 1 has more intercalating ability than other complexes. DNA cleavage efficacy of these complexes with pUC18 DNA has been investigated by gel electrophoresis technique. All the complexes have been found to promote cleavage of pUC18 DNA from the super coiled form I to the open circular form II in presence of hydrogen peroxide. The in vitro antibacterial and antifungal assay, investigated by Minimum Inhibitory Concentration (MIC) method indicates that these complexes are good antimicrobial agents against various pathogens.

  16. DNA-binding, spectroscopic and antimicrobial studies of palladium(II) complexes containing 2,2'-bipyridine and 1-phenylpiperazine

    Science.gov (United States)

    Shoukry, Azza A.; Mohamed, Mervat S.

    2012-10-01

    With the purpose of evaluating the ability of Pd(II) complex to interact with DNA molecule as the main biological target, two new complexes [Pd(bpy)(OH2)2] (1) and [Pd(Phenpip)(OH2)2] (2), where (bpy = 2,2'-bipyridine; Phenpip = 1-phenylpiperazine), have been synthesized and the binding properties of these complexes with CT-DNA were investigated. The intrinsic binding constants (Kb) calculated from UV-Vis absorption studies were 3.78 × 103 M-1 and 4.14 × 103 M-1 for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated ΔTm was nearly 5 °C for each complex. All the results suggest an electrostatic and/or groove binding mode for the interaction between the complexes and CT-DNA. The redox behavior of the two complexes in the absence and in the presence of calf thymus DNA has been investigated by cyclic voltammetry. The cyclic voltammogram exhibits one quasi-reversible redox wave. The change in E1/2, ΔEp and Ipc/Ipa supports that the two complexes exhibit strong binding to calf thymus DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the intensity of DNA bands. The two complexes have been screened for their antimicrobial activities using the disc diffusion method against some selected Gram-positive and Gram-negative bacteria. The activity data showed that both complexes were more active against Gram-negative than Gram-positive bacteria. It may be concluded that the antimicrobial activity of the compounds is related to cell wall structure of bacteria.

  17. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  18. Fluorescent and ultraviolet-visible spectroscopy studies on the antioxidation and DNA binding properties of binuclear Tb(III) complexes.

    Science.gov (United States)

    Liu, Yongchun; Jiang, Xinhui; Yang, Zhengyin; Zheng, Xudong; Liu, Jianning; Zhou, Tianlin

    2010-09-01

    Tb(III) complexes were prepared from Tb(NO(3))(3)·6H(2)O and four Schiff-base ligands derived from 8-hydroxyquinoline-2-carboxaldehyde with aroylhydrazines. X-ray crystal and other structural analyses indicate that Tb(III) and every ligand can form a binuclear Tb(III) complex with 1:1 metal-to-ligand stoichiometry and nine-coordination at the Tb(III) center. Viscosity titration experiments and fluorescent and ultraviolet-visible (UV-Vis) spectroscopy results indicate that all the Tb(III) complexes can bind to Calf thymus DNA through intercalation with the binding constants at the order of magnitude of 10(6)-10(7) M(-1), and they may be used as potential anticancer drugs, but complexes containing active phenolic hydroxy groups may have stronger antitumor activities. Antioxidation results indicate that all the Tb(III) complexes have strong abilities of scavenging hydroxyl radicals and superoxide radicals, but complexes containing active phenolic hydroxy groups show stronger scavenging effects on hydroxyl radicals and complexes containing N-heteroaromatic substituent show stronger scavenging effects on superoxide radicals. However, Tb(III) emission with these systems is not observed, for these ligands rather are quenchers and unable to sensitize this metal ion.

  19. Experimental and molecular modeling studies on the DNA-binding of diazacyclam-based acrocyclic copper complex.

    Science.gov (United States)

    Shahabadi, Nahid; Hakimi, Mohammad; Morovati, Teimoor; Falsafi, Monireh; Fili, Soraya Moradi

    2017-02-01

    The interaction of a new macrocyclic copper complex, [CuL(NO 3 ) 2 ] in which L is 1,3,6,10,12,15-hexaaza tricyclo[13.3.1.1 6,10 ] eicosane was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated the complex interacted with ct-DNA in a groove binding mode while the binding constant of UV-vis and the number of binding sites were 1.0±0.2×10 4 Lmol -1 and 1.01, respectively. The fluorometric studies showed that the reaction between the complex with ct-DNA is exothermic (ΔH=14.85kJmol -1 ; ΔS=109.54Jmol -1 K -1 ). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of DNA in the presence of [CuL(NO 3 ) 2 ] complex. Furthermore, the complex induces detectable changes in the viscosity of DNA. The molecular modeling results illustrated that the complex strongly binds to groove of DNA. Experimental and molecular modeling results showed that Cu(II) complex bound to DNA by a groove binding mode. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Retinoblastoma-binding protein 1 has an interdigitated double Tudor domain with DNA binding activity.

    Science.gov (United States)

    Gong, Weibin; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2014-02-21

    Retinoblastoma-binding protein 1 (RBBP1) is a tumor and leukemia suppressor that binds both methylated histone tails and DNA. Our previous studies indicated that RBBP1 possesses a Tudor domain, which cannot bind histone marks. In order to clarify the function of the Tudor domain, the solution structure of the RBBP1 Tudor domain was determined by NMR and is presented here. Although the proteins are unrelated, the RBBP1 Tudor domain forms an interdigitated double Tudor structure similar to the Tudor domain of JMJD2A, which is an epigenetic mark reader. This indicates the functional diversity of Tudor domains. The RBBP1 Tudor domain structure has a significant area of positively charged surface, which reveals a capability of the RBBP1 Tudor domain to bind nucleic acids. NMR titration and isothermal titration calorimetry experiments indicate that the RBBP1 Tudor domain binds both double- and single-stranded DNA with an affinity of 10-100 μM; no apparent DNA sequence specificity was detected. The DNA binding mode and key interaction residues were analyzed in detail based on a model structure of the Tudor domain-dsDNA complex, built by HADDOCK docking using the NMR data. Electrostatic interactions mediate the binding of the Tudor domain with DNA, which is consistent with NMR experiments performed at high salt concentration. The DNA-binding residues are conserved in Tudor domains of the RBBP1 protein family, resulting in conservation of the DNA-binding function in the RBBP1 Tudor domains. Our results provide further insights into the structure and function of RBBP1.

  1. ct-DNA Binding and Antibacterial Activity of Octahedral Titanium (IV Heteroleptic (Benzoylacetone and Hydroxamic Acids Complexes

    Directory of Open Access Journals (Sweden)

    Raj Kaushal

    2016-01-01

    Full Text Available Five structurally related titanium (IV heteroleptic complexes, [TiCl2(bzac(L1–4] and [TiCl3(bzac(HL5]; bzac = benzoylacetonate; L1–5 = benzohydroximate (L1, salicylhydroximate (L2, acetohydroximate (L3, hydroxyurea (L4, and N-benzoyl-N-phenyl hydroxylamine (L5, were used for the assessment of their antibacterial activities against ten pathogenic bacterial strains. The titanium (IV complexes (1–5 demonstrated significant level of antibacterial properties as measured using agar well diffusion method. UV-Vis absorption spectroscopic technique was applied, to get a better insight into the nature of binding between titanium (IV complexes with calf thymus DNA (ct-DNA. On the basis of the results of UV-Vis absorption spectroscopy, the interaction between ct-DNA and the titanium (IV complexes is likely to occur through the same mode. Results indicated that titanium (IV complex can bind to calf thymus DNA (ct-DNA via an intercalative mode. The intrinsic binding constant (Kb was calculated by absorption spectra by using Benesi-Hildebrand equation. Further, Gibbs free energy was also calculated for all the complexes.

  2. Copper(II) complexes with 4-hydroxyacetophenone-derived acylhydrazones: Synthesis, characterization, DNA binding and cleavage properties

    Science.gov (United States)

    Gup, Ramazan; Gökçe, Cansu; Aktürk, Selçuk

    2015-01-01

    Two new Cu(II) complexes of Schiff base-hydrazone ligands, hydroxy-N‧-[(1Z)-1-(4-hydroxyphenyl)ethylidene]benzohydrazide [H3L1] and ethyl 2-(4-(1-(2-(4-(2-ethoxy-2-oxoethoxy)benzoyl)hydrazono)ethyl)phenoxy)acetate (HL2) have been synthesized and then characterized by microcopy and spectral studies. X-ray powder diffraction illustrates that [Cu(L2)2] complex is crystalline in nature whereas [Cu(H2L1)2]·2H2O has an amorphous structure. Binding of the copper complexes with Calf thymus DNA (CT-DNA) has been investigated by UV-visible spectra, exhibiting non-covalent binding to CT-DNA. DNA cleavage experiments have been also investigated by agarose gel electrophoresis in the presence and absence of an oxidative agent (H2O2). The effect of complex concentration on the DNA cleavage reaction has been also studied. Both copper complexes show nuclease activity, which significantly depends on concentrations of the complexes, in the presence of H2O2 through oxidative mechanism whereas they slightly cleavage DNA in the absence an oxidative agent.

  3. Cytotoxic activity, albumin and DNA binding of new copper(II) complexes with chalcone-derived thiosemicarbazones.

    Science.gov (United States)

    Da Silva, Jeferson G; Recio Despaigne, Angel A; Louro, Sonia R W; Bandeira, Cristiano C; Souza-Fagundes, Elaine M; Beraldo, Heloisa

    2013-07-01

    [Cu(HL)Cl2] complexes of chalcone-derived thiosemicarbazones were obtained with 3-phenyl-1-pyridin-2-ylprop-2-en-1-one thiosemicarbazone (HPyCTPh), complex (1), 3-(4-chlorophenyl)-1-pyridin-2-ylprop-2-en-1-one thiosemicarbazone (HPyCT4ClPh), complex (2), 3-(4-bromophenyl)-1-pyridin-2-ylprop-2-en-1-one thiosemicarbazone (HPyCT4BrPh), complex (3), and 3-(4-nitrophenyl-1-pyridin-2-ylprop-2-en-1-one thiosemicarbazone (HPyCT4NO2Ph), complex (4). 1-3 showed interaction with bovine serum albumin (BSA) and deoxyribonucleic acid from calf thymus (CT-DNA). The cytotoxic activities of the thiosemicarbazones and complexes (1-4) were tested against HL60 (wild type human promyelocytic leukemia), Jurkat (human immortalized line of T lymphocyte), MDA-MB 231 (human breast carcinoma) and HCT-116 (human colorectal carcinoma) tumor cell lineages. Upon coordination to copper(II) cytotoxicity significantly increased in Jurkat, MDA-MB 231 and HCT-116 cells. Unlike the free thiosemicarbazones, 1-4 induced DNA fragmentation in solid tumor cells indicating their pro-apoptotic potential. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  4. DNA binding and gel electrophoresis studies of a copper (II) complex containing mixed aliphatic and aromatic dinitrogen ligands.

    Science.gov (United States)

    Shahabadi, Nahid; Darabi, Farivash; Maghsudi, Maryam; Kashanian, Soheila

    2010-06-01

    The interaction of a novel mixed ligand copper (II) complex, [Cu(N-N)(L)(EtOH)](NO(3))(2) . 2H(2)O, in which N-N indicates 2,9-dimethyl-1,10-phenanthroline and L indicates N,N-dimethyltrimethylenediamine with calf thymus DNA was investigated by absorption, circular dichroism, voltammetric, and viscosimetric techniques. The absorption spectra of the complex with calf thymus DNA showed a marked hypochromism in the pi --> pi* and metal to ligand charge transfer (MLCT) transitions, with no obvious red shift attributed to a partial intercalation. The intrinsic binding constant (K(b)) was determined as 2 x 10(5) M(-1). There was slight to appreciable changes in the relative viscosity of DNA, which is consistent with enhanced hydrophobic interaction of the methyl-substituted phen ring and partial intercalation mode of binding. Electrochemical studies showed a decrease in the peak current, which is ascribed to the strong binding between Cu (II) complex and DNA. The fluorescence spectral characteristics showed that the Cu (II) complex is able to displace the methylene blue bound to DNA, but not as complete as intercalative molecules. It is remarkable that this mixed ligand complex, in contrast to [Cu(2,9-dmp)(2)](+) (2,9-dmp = 2,9-dimethyl-1,10-phenanthroline), which fails to cleave DNA, has ability to cleave the supercoiled plasmid DNA.

  5. Biochemical investigation of yttrium(III) complex containing 1,10-phenanthroline: DNA binding and antibacterial activity.

    Science.gov (United States)

    Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Moodi, Asieh; Niroomand, Sona

    2013-03-05

    Characterization of the interaction between yttrium(III) complex containing 1,10-phenanthroline as ligand, [Y(phen)2Cl(OH2)3]Cl2⋅H2O, and DNA has been carried out by UV absorption, fluorescence spectra and viscosity measurements in order to investigate binding mode. The experimental results indicate that the yttrium(III) complex binds to DNA and absorption is decreasing in charge transfer band with the increase in amount of DNA. The binding constant (Kb) at different temperatures as well as thermodynamic parameters, enthalpy change (ΔH°) and entropy change (ΔS°), were calculated according to relevant fluorescent data and Vant' Hoff equation. The results of interaction mechanism studies, suggested that groove binding plays a major role in the binding of the complex and DNA. The activity of yttrium(III) complex against some bacteria was tested and antimicrobial screening tests shown growth inhibitory activity in the presence of yttrium(III) complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Synthesis and Characterization of the Ligand Based on Benzimidazole and Its Copper Complex: DNA Binding and Antioxidant Activity

    OpenAIRE

    Wu, Huilu; Kou, Fan; Jia, Fei; Liu, Bin; Yuan, Jingkun; Bai, Ying

    2011-01-01

    A new copper(II) complex with formulae of [Cu(buobb)2](pic)2, where buobb stands for the ligand of 1,3-bis(1- butylbenzimidazol-2-yl)-2-oxopropane and pic represents 2,4,6-trinitrophenol, has been synthesized and characterized by elemental analyses, molar conductivity, IR, UV-Vis spectra measurements, and cyclic voltammetry. The crystal structure of the copper(II) complex has been determined by X-ray single-crystal diffraction. The coordination environment around each copper(II) atom can be d...

  7. Mononuclear Pd(II) complex as a new therapeutic agent: Synthesis, characterization, biological activity, spectral and DNA binding approaches

    Science.gov (United States)

    Saeidifar, Maryam; Mirzaei, Hamidreza; Ahmadi Nasab, Navid; Mansouri-Torshizi, Hassan

    2017-11-01

    The binding ability between a new water-soluble palladium(II) complex [Pd(bpy)(bez-dtc)]Cl (where bpy is 2,2‧-bipyridine and bez-dtc is benzyl dithiocarbamate), as an antitumor agent, and calf thymus DNA was evaluated using various physicochemical methods, such as UV-Vis absorption, Competitive fluorescence studies, viscosity measurement, zeta potential and circular dichroism (CD) spectroscopy. The Pd(II) complex was synthesized and characterized using elemental analysis, molar conductivity measurements, FT-IR, 1H NMR, 13C NMR and electronic spectra studies. The anticancer activity against HeLa cell lines demonstrated lower cytotoxicity than cisplatin. The binding constants and the thermodynamic parameters were determined at different temperatures (300 K, 310 K and 320 K) and shown that the complex can bind to DNA via electrostatic forces. Furthermore, this result was confirmed by the viscosity and zeta potential measurements. The CD spectral results demonstrated that the binding of Pd(II) complex to DNA induced conformational changes in DNA. We hope that these results will provide a basis for further studies and practical clinical use of anticancer drugs.

  8. Synthesis, structure characterization, DNA binding, and cleavage properties of mononuclear and tetranuclear cluster of copper(II) complexes.

    Science.gov (United States)

    Vafazadeh, Rasoul; Hasanzade, Naime; Heidari, Mohammad Mehdi; Willis, Anthony C

    2015-01-01

    Two copper(II) complexes, cluster 1, and mononuclear 2, have been synthesized by reacting acetylacetone and benzohydrazide (1:1 ratio for 1 and 1:2 ratio for 2) with CuCl(2) in a methanol solution. In 2, which is a new complex, the ligand acts as a tetradentate which binds the metal ion via two amide-O atoms and two imine-N atoms providing an N(2)O(2) square-planar around the copper(II) ion. The absorption spectra data evidence strongly suggested that the two copper(II) compounds could interact with CT-DNA (intrinsic binding constant, K(b) = 0.45×10(4) M-1 for 1 and K(b) = 2.39×10(4) M-1 for 2). The super coiled plasmid pBR322 DNA cleavage ability was studied with 1 and 2 in the presence and absence of H(2)O(2) as an oxidant. In both the absence and the presence of an oxidizing agent, complex 2 exhibited no nuclease activity. However, even in the absence of an oxidant, complex 1 exhibited significant DNA cleavage activity.

  9. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    Science.gov (United States)

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH 2 groups (CONH 2 -SWNT) exhibited very strong interactions between the CONH 2 -SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  10. Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase.

    Science.gov (United States)

    Khopde, Sujata; Biswas, Esther E; Biswas, Subhasis B

    2002-12-17

    Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.

  11. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    fluoroquinolone complexes. Mohan N ... DNA-binding properties of Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements as well as their HS DNA cleavage properties by means of agarose gel ...

  12. DNA Binding Proteins of the Filamentous Phages CTXφ and VGJφ of Vibrio cholerae▿

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Ferrán, Beatriz; Izquierdo, Yovanny; Fando, Rafael; Campos, Javier

    2009-01-01

    The native product of open reading frame 112 (orf112) and a recombinant variant of the RstB protein, encoded by Vibrio cholerae pathogen-specific bacteriophages VGJφ and CTXφ, respectively, were purified to more than 90% homogeneity. Orf112 protein was shown to specifically bind single-stranded genomic DNA of VGJφ; however, RstB protein unexpectedly bound double-stranded DNA in addition to the single-stranded genomic DNA. The DNA binding properties of these proteins may explain their requirement for the rolling circle replication of the respective phages and RstB's requirement for single-stranded-DNA chromosomal integration of CTXφ phage dependent on XerCD recombinases. PMID:19617366

  13. DNA binding proteins of the filamentous phages CTXphi and VGJphi of Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Ferrán, Beatriz; Izquierdo, Yovanny; Fando, Rafael; Campos, Javier

    2009-09-01

    The native product of open reading frame 112 (orf112) and a recombinant variant of the RstB protein, encoded by Vibrio cholerae pathogen-specific bacteriophages VGJphi and CTXphi, respectively, were purified to more than 90% homogeneity. Orf112 protein was shown to specifically bind single-stranded genomic DNA of VGJphi; however, RstB protein unexpectedly bound double-stranded DNA in addition to the single-stranded genomic DNA. The DNA binding properties of these proteins may explain their requirement for the rolling circle replication of the respective phages and RstB's requirement for single-stranded-DNA chromosomal integration of CTXphi phage dependent on XerCD recombinases.

  14. (Carboxydiamine)Pt(II) complexes of a combretastatin A-4 analogous chalcone: the influence of the diamine ligand on DNA binding and anticancer effects

    Czech Academy of Sciences Publication Activity Database

    Zoldakova, M.; Biersack, B.; Kostrhunová, Hana; Ahmad, A.; Padhye, S.; Sarkar, F.H.; Schobert, R.; Brabec, Viktor

    2011-01-01

    Roč. 2, č. 6 (2011), s. 493-499 ISSN 2040-2503 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : platinum * DNA binding * anticancer effects Subject RIV: BO - Biophysics Impact factor: 2.800, year: 2011

  15. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  16. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. RecO protein initiates DNA recombination and strand annealing through two alternative DNA binding mechanisms.

    Science.gov (United States)

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey

    2014-10-17

    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Synthesis, characterization, DNA binding, cleavage activity, cytotoxicity and molecular docking of new nano water-soluble [M(5-CH₂PPh₃-3,4-salpyr)](ClO₄)₂ (M = Ni, Zn) complexes.

    Science.gov (United States)

    Mandegani, Zeinab; Asadi, Zahra; Asadi, Mozaffar; Karbalaei-Heidari, Hamid Reza; Rastegari, Banafsheh

    2016-04-21

    Some new water soluble complexes [N,N'-bis{5-[(triphenyl phosphonium chloride)-methyl]salicylidine}-3,4-diaminopyridine] M(ii), which are formulated as nano-[Zn(5-CH2PPh3-3,4-salpyr)](ClO4)2 (), [Zn(5-CH2PPh3-3,4-salpyr)](ClO4)2 (), nano-[Ni(5-CH2PPh3-3,4-salpyr)](ClO4)2 (), [Ni(5-CH2PPh3-3,4-salpyr)](ClO4)2 (), and [N,N'-bis{5-[(triphenyl phosphonium chloride)-methyl]salicylidine}-2,3-diaminopyridine]Ni(ii) [Ni(5-CH2PPh3-2,3-salpyr)](ClO4)2 () have been isolated and characterized by elemental analysis, FT-IR, (1)H NMR, (13)C NMR, (31)P NMR, and UV-vis spectroscopy. The morphology and size of the nano complexes were determined using FE-SEM and TEM. In vitro DNA binding studies were investigated by UV-vis absorption spectroscopy, viscosity measurements, CD spectroscopy, cyclic voltammetry, emission spectra and gel electrophoresis, which suggest that the metal complexes act as efficient DNA binders. The absorption spectroscopy of the compounds with DNA reveals that the DNA binding affinity (Kb) has this order: > > > > > Ligand. The metal complexes show DNA binding stronger than the ligand, which is expected due to the nature of the metal. The nano complexes display DNA binding stronger than the other complexes which is related to the effect of size on binding affinity and the Ni(ii) complexes reveal DNA binding stronger than the corresponding Zn(ii) analogues, which is expected due to their z* effect and geometry. The prominent double strand DNA cleavage abilities of compound are observed in the absence of H2O2 with efficiencies of more than 50% even at 70 μM complex concentration. Surprisingly, Zn(ii) complexes (compounds & ) exhibit a higher cytotoxicity (IC50: 7.3 & 10.9 μM at 24 h; IC50: 4.6 & 8.7 μM at 48 h) against human hepatoma (HepG2) and HeLa cell lines than the Ni(ii) complexes (compounds , & ) and 5-fluorouracil as control in spite of their inability to cleave DNA. Finally, DNA binding interactions were performed by docking studies. Density functional

  19. DNA-binding, topoisomerases I and II inhibition and in vitro cytotoxicity of ruthenium(II) polypyridyl complexes: [Ru(dppz)2L](2+) (L=dppz-11-CO2Me and dppz).

    Science.gov (United States)

    He, Xiaojun; Jin, Lianhe; Tan, Lifeng

    2015-01-25

    Two ruthenium(II) polypyridyl complexes, [Ru(dppz)2dppz-11-CO2Me](ClO4)2 (Ru1) and [Ru(dppz)3](ClO4)2 (Ru2), have been synthesized and characterized. The spectral characteristics of Ru1 and Ru2 were investigated by fluorescence spectroscopy and revealed that both complexes were sensitive to solvent polarity. The binding properties of the two complexes towards calf-thymus DNA (CT-DNA) have been investigated by different spectrophotometric methods and viscosity measurements, indicating that both complexes bind to CT-DNA by means of intercalation, but with different binding affinities. Topoisomerase inhibition and DNA strand passage assay demonstrates that the two complexes are dual inhibitors of topoisomerases I and IIa. On the other hand, the cytotoxicity of both complexes has been evaluated by MTT assays and Giemsa staining experiments. The main results reveal that the ester functional group has a significant effect on the DNA-binding affinities and topoisomerases inhibition effects of Ru1 and Ru2, and further advance our knowledge on the DNA-binding and topoisomerase inhibition by Ru(II) complexes. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. V-shaped ligand 1,3-bis(1-ethylbenzimidazol-2-yl)-2-thiapropane and manganese(II), cobalt(II) and copper(II) complexes: Synthesis, crystal structure, DNA-binding properties and antioxidant activities.

    Science.gov (United States)

    Wu, Huilu; Yang, Zaihui; Wang, Fei; Peng, Hongping; Zhang, Han; Wang, Cuiping; Wang, Kaitong

    2015-07-01

    A V-shaped ligand 1,3-bis(1-ethylbenzimidazol-2-yl)-2-thiapropane (bebt) and its transition metal complexes, [Mn(bebt)(pic)2]·CH3OH (pic=picrate) 1, [Co(bebt)2](pic)22 and [Cu(bebt)2](pic)2·2DMF 3, have been synthesized and characterized. The coordinate forms of complexes 1 and 2 are basically alike, which can be described as six-coordinated distorted octahedron. The geometric structure around Cu(II) atom can be described as distorted tetrahedral in complex 3. The DNA-binding properties of the ligand bebt and complexes have been investigated by electronic absorption, fluorescence, and viscosity measurements. The results suggest that bebt and complexes bind to DNA via an intercalative binding mode and the order of the binding affinity is 1DNA-binding properties are also discussed. Moreover, the complex 3 possess significant antioxidant activity against superoxide and hydroxyl radicals, and the scavenging effects of it are stronger than standard mannitol and vitamin C. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Synthesis, spectroscopic, molecular orbital calculation, cytotoxic, molecular docking of DNA binding and DNA cleavage studies of transition metal complexes with N-benzylidene-N'-salicylidene-1,1-diaminopropane

    Science.gov (United States)

    Al-Mogren, Muneerah M.; Alaghaz, Abdel-Nasser M. A.; Elbohy, Salwa A. H.

    2013-10-01

    Eight mononuclear chromium(III), manganese(II), iron(III), cobalt(II), nickel(II), copper(II), zinc(II) and cadmium(II) complexes of Schiff's base ligand were synthesized and determined by different physical techniques. The complexes are insoluble in common organic solvents but soluble in DMF and DMSO. The measured molar conductance values in DMSO indicate that the complexes are non-electrolytic in nature. All the eight metal complexes have been fully characterized with the help of elemental analyses, molecular weights, molar conductance values, magnetic moments and spectroscopic data. The analytical data helped to elucidate the structure of the metal complexes. The Schiff base is found to act as tridentate ligand using N2O donor set of atoms leading to an octahedral geometry for the complexes around all the metal ions. Quantum chemical calculations were performed with semi-empirical method to find the optimum geometry of the ligand and its complexes. Additionally in silico, the docking studies and the calculated pharmacokinetic parameters show promising futures for application of the ligand and complexes as high potency agents for DNA binding activity. The interaction of the complexes with calf thymus DNA (CT-DNA) has been investigated by UV absorption method, and the mode of CT-DNA binding to the complexes has been explored. Furthermore, the DNA cleavage activity by the complexes was performed. The Schiff base and their complexes have been screened for their antibacterial activity against bacterial strains [Staphylococcus aureus (RCMB010027), Staphylococcus epidermidis (RCMB010024), Bacillis subtilis (RCMB010063), Proteous vulgaris (RCMB 010085), Klebsiella pneumonia (RCMB 010093) and Shigella flexneri (RCMB 0100542)] and fungi [(Aspergillus fumigates (RCMB 02564), Aspergillus clavatus (RCMB 02593) and Candida albicans (RCMB05035)] by disk diffusion method. All the metal complexes have potent biocidal activity than the free ligand.

  2. UV-induced DNA-binding proteins in human cells

    International Nuclear Information System (INIS)

    Glazer, P.M.; Greggio, N.A.; Metherall, J.E.; Summers, W.C.

    1989-01-01

    To investigate the response of human cells to DNA-damaging agents such as UV irradiation, the authors examined nuclear protein extracts of UV-irradiated HeLa cells for the presence of DNA-binding proteins. Electrophoretically separated proteins were transferred to a nitrocellulose filter that was subsequently immersed in a binding solution containing radioactively labeled DNA probes. Several DNA-binding proteins were induced in HeLa cells after UV irradiation. These included proteins that bind predominantly double-stranded DNA and proteins that bind both double-stranded and single-stranded DNA. The binding proteins were induced in a dose-dependent manner by UV light. Following a dose of 12 J/m 2 , the binding proteins in the nuclear extracts increased over time to a peak in the range of 18 hr after irradiation. Experiments with metabolic inhibitors (cycloheximide and actinomycin D) revealed that de novo synthesis of these proteins is not required for induction of the binding activities, suggesting that the induction is mediated by protein modification

  3. Solution structure and DNA binding of the zinc-finger domain from DNA ligase IIIalpha.

    Science.gov (United States)

    Kulczyk, Arkadiusz W; Yang, Ji-Chun; Neuhaus, David

    2004-08-13

    DNA ligase IIIalpha carries out the final ligation step in the base excision repair (BER) and single strand break repair (SSBR) mechanisms of DNA repair. The enzyme recognises single-strand nicks and other damage features in double-stranded DNA, both through the catalytic domain and an N-terminal domain containing a single zinc finger. The latter is homologous to other zinc fingers that recognise damaged DNA, two in the N terminus of poly(adenosine-ribose)polymerase and three in the N terminus of the Arabidopsis thaliana nick-sensing DNA 3'-phosphoesterase. Here, we present the solution structure of the zinc-finger domain of human DNA ligase IIIalpha, the first structure of a finger from this group. It is related to that of the erythroid transcription factor GATA-1, but has an additional N-terminal beta-strand and C-terminal alpha-helix. Chemical shift mapping using a DNA ligand containing a single-stranded break showed that the DNA-binding surface of the DNA-ligase IIIalpha zinc finger is substantially different from that of GATA-1, consistent with the fact that the two proteins recognise very different features in the DNA. Likely implications for DNA binding are discussed.

  4. Synthesis, DNA-binding and photocleavage studies of Ru(II ...

    Indian Academy of Sciences (India)

    Administrator

    ligands to evaluate and understand the factors that determine the DNA-binding mode are necessary. Thus it is ... further understanding the DNA-binding and effi- ciency of DNA recognized and cleaved by Ru(II) complexes .... Titration experiments were performed by using a fixed Ru(II) complex concentration, The complex-.

  5. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  6. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  7. DNA binding specificities of Escherichia coli Cas1–Cas2 integrase drive its recruitment at the CRISPR locus

    Science.gov (United States)

    Moch, Clara; Fromant, Michel; Blanquet, Sylvain

    2017-01-01

    Abstract Prokaryotic adaptive immunity relies on the capture of fragments of invader DNA (protospacers) followed by their recombination at a dedicated acceptor DNA locus. This integrative mechanism, called adaptation, needs both Cas1 and Cas2 proteins. Here, we studied in vitro the binding of an Escherichia coli Cas1–Cas2 complex to various protospacer and acceptor DNA molecules. We show that, to form a long-lived ternary complex containing Cas1–Cas2, the acceptor DNA must carry a CRISPR locus, and the protospacer must not contain 3΄-single-stranded overhangs longer than 5 bases. In addition, the acceptor DNA must be supercoiled. Formation of the ternary complex is synergistic, in such that the binding of Cas1–Cas2 to acceptor DNA is reinforced in the presence of a protospacer. Mutagenesis analysis at the CRISPR locus indicates that the presence in the acceptor plasmid of the palindromic motif found in CRISPR repeats drives stable ternary complex formation. Most of the mutations in this motif are deleterious even if they do not prevent cruciform structure formation. The leader sequence of the CRISPR locus is fully dispensable. These DNA binding specificities of the Cas1–Cas2 integrase are likely to play a major role in the recruitment of this enzyme at the CRISPR locus. PMID:28034956

  8. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  9. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  10. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  11. New non detrimental DNA binding mutants of the Escherichia coli initiator protein DnaA

    DEFF Research Database (Denmark)

    Asklund, Marlene; Atlung, Tove

    2004-01-01

    The initiator protein DnaA has several unique DNA-binding features. It binds with high affinity as a monomer to the nonamer DnaA box. In the ATP form, DnaA binds cooperatively to the low-affinity ATP-DnaA boxes, and to single-stranded DNA in the 13mer region of the origin. We have carried out...... an extensive mutational analysis of the DNA-binding domain of the Escherichia coli DnaA protein using mutagenic PCR. We analyzed mutants exhibiting more or less partial activity by selecting for complementation of a dnaA(Ts) mutant strain at different expression levels of the new mutant proteins. The selection...... gave rise to 30 single amino acid substitutions and, including double substitutions, more than 100 mutants functional in initiation of chromosome replication were characterized. The analysis indicated that all regions of the DNA-binding domain are involved in DNA binding, but the most important amino...

  12. Quantification of transcription factor-DNA binding affinity in a living cell.

    Science.gov (United States)

    Belikov, Sergey; Berg, Otto G; Wrange, Örjan

    2016-04-20

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [(3)H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. DNA binding and cleavage activity of a structurally characterized Ni ...

    Indian Academy of Sciences (India)

    1375–1381. c Indian Academy of Sciences. DOI 10.1007/s12039-015-0900-4. DNA binding and cleavage activity of a structurally characterized Ni(II). Schiff base complex. SARAT CHANDRA KUMARa, ABHIJIT PALa, MERRY MITRAa,. V M MANIKANDAMATHAVANb, CHIA -HER LINc, BALACHANDRAN UNNI NAIRb,∗.

  14. DNA binding and cleavage activity of a structurally characterized Ni ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 8. DNA binding and cleavage activity of a structurally characterized Ni(II) Schiff base complex. Sarat Chandra Kumar Abhijit Pal Merry Mitra V M Manikandamathavan Chia -Her Lin Balachandran Unni Nair Rajarshi Ghosh. Regular Articles Volume 127 ...

  15. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  16. New palladium(II) and platinum(II) 5,5-diethylbarbiturate complexes with 2-phenylpyridine, 2,2'-bipyridine and 2,2'-dipyridylamine: synthesis, structures, DNA binding, molecular docking, cellular uptake, antioxidant activity and cytotoxicity.

    Science.gov (United States)

    Icsel, Ceyda; Yilmaz, Veysel T; Kaya, Yunus; Samli, Hale; Harrison, William T A; Buyukgungor, Orhan

    2015-04-21

    Novel palladium(ii) and platinum(ii) complexes of 5,5-diethylbarbiturate (barb) with 2-phenylpyridine (Hppy), 2,2'-bipyridine (bpy) and 2,2'-dipyridylamine (dpya) have been prepared and characterized by elemental analysis, IR, UV-Vis, NMR and ESI-MS. Single-crystal diffraction measurements show that complex consists of binuclear [Pd2(μ-barb-κN,O)2(ppy-κN,C)2] moieties, while complexes are mononuclear, [M(barb-κN)2(L-κN,N')] (L = bpy or dpya). has a composition of [Pt(dpya-κN,N')2][Ag(barb-κN)2]2·4H2O and was assumed to have a structure of [Pt(barb-κN)(Hppy-κN)(ppy-κN,C)]·3H2O. The complexes were found to exhibit significant DNA binding affinity by a non-covalent binding mode, in accordance with molecular docking studies. In addition, complexes and displayed strong binding with supercoiled pUC19 plasmid DNA. Cellular uptake studies were performed to assess the subcellular localization of the selected complexes. A moderate radical scavenging activity of and was confirmed by DPPH and ABTS tests. Complexes , , and showed selectivity against HT-29 (colon) cell line.

  17. Structure of a Novel DNA-binding Domain of Helicase-like Transcription Factor (HLTF) and Its Functional Implication in DNA Damage Tolerance.

    Science.gov (United States)

    Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi

    2015-05-22

    HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. DNA binding and cleavage activity by a mononuclear iron (II) Schiff ...

    Indian Academy of Sciences (India)

    DNA binding and cleavage activity by a mononuclear iron(II)Schiff base complex: Synthesis and structural characterization. Abhijit Pal Bhaskar ... Iron(II); Schiff base; X-ray structure; DNA binding; DNA cleavage. ... Spectroscopic and hydrodynamic investigations revealed intercalative mode of binding of 1 with DNA. 1 is also ...

  19. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  20. Synthesis and DNA binding studies of Ni(II), Co(II), Cu(II) and Zn(II) metal complexes of N 1,N 5-bis[pyridine-2-methylene]-thiocarbohydrazone Schiff-base ligand

    Science.gov (United States)

    Tiwari, A. D.; Mishra, A. K.; Mishra, S. B.; Mamba, B. B.; Maji, B.; Bhattacharya, S.

    2011-09-01

    The thiocarbohydrazone Schiff-base ligand with a nitrogen and sulphur donor was synthesized through condensation of pyridine-2-carbaldehyde and thiocarbohydrazide. Schiff-base ligands have the ability to conjugate with metal salts. A series of metal complexes with a general formula [MCl 2(H 2L)]· nH 2O (M dbnd Ni, Co, Cu and Zn) were synthesized by forming complexes of the N 1,N 5-bis[pyridine-2-methylene]-thiocarbohydrazone (H 2L) Schiff-base ligand. These metal complexes and ligand were characterized by using ultraviolet-visible (UV-Vis), Fourier Transform Infrared (FT-IR), 1H and 13C NMR spectroscopy and mass spectroscopy, physicochemical characterization, CHNS and conductivity. The biological activity of the synthesized ligand was investigated by using Escherichia coli DNA as target. The DNA interaction of the synthesized ligand and complexes on E. coli plasmid DNA was investigated in the aqueous medium by UV-Vis spectroscopy and the binding constant ( Kb) was calculated. The DNA binding studies showed that the metal complexes had an improved interaction due to trans-geometrical isomers of the complexes than ligand isomers in cis-positions.

  1. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  2. Regular square planer bis-(4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione)/copper(II) complex: Trans/cis-DFT isomerization, crystal structure, thermal, solvatochromism, hirshfeld surface and DNA-binding analysis

    Science.gov (United States)

    Hema, M. K.; Karthik, C. S.; Warad, Ismail; Lokanath, N. K.; Zarrouk, Abdelkader; Kumara, Karthik; Pampa, K. J.; Mallu, P.

    2018-04-01

    Trans-[Cu(O∩O)2] complex, O∩O = 4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione was reported with high potential toward CT-DNA binder. The solved XRD-structure of complex indicated a perfect regular square-planer geometry around the Cu(II) center. The trans/cis-DFT-isomerization calculation supported the XRD seen in reflecting the trans-isomer as the kinetic-favor isomer. The desired complex structure was also characterized by conductivity measurement, CHN-elemental analyses, MS, EDX, SEM, UV-Vis., FT-IR, HAS and TG/DTG. The Solvatochromism behavior of the complex was evaluated using four different polar solvents. MPE and Hirshfeld surface analysis (HSA) come to an agreement that fluoride and thiophene protons atoms are with suitable electro-potential environment to form non-classical H-bonds of type CThsbnd H⋯F. The DNA-binding properties were investigated by viscosity tests and spectrometric titrations, the results revealed the complex as strong calf-thymus DNA binder. High intrinsic-binding constants value ∼1.8 × 105 was collected.

  3. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair.

    Science.gov (United States)

    de Laat, W L; Appeldoorn, E; Sugasawa, K; Weterings, E; Jaspers, N G; Hoeijmakers, J H

    1998-08-15

    The human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a defined polarity; a strong ssDNA interaction domain of hRPA is positioned at the 5' side of its binding region, a weak ssDNA-binding domain resides at the 3' side. Polarity appears crucial for positioning of the excision repair nucleases XPG and ERCC1-XPF on the DNA. With the 3'-oriented side of hRPA facing a duplex ssDNA junction, hRPA interacts with and stimulates ERCC1-XPF, whereas the 5'-oriented side of hRPA at a DNA junction allows stable binding of XPG to hRPA. Our data pinpoint hRPA to the undamaged strand during nucleotide excision repair. Polarity of hRPA on ssDNA is likely to contribute to the directionality of other hRPA-dependent processes as well.

  4. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  5. Synthesis, DNA binding and cleavage activities of copper (II) thiocyanate complex with 4-(N,N-dimethylamino)pyridine and N,N-dimethylformamide.

    Science.gov (United States)

    Chen, Feng-juan; Xu, Min; Xi, Pin-xian; Liu, Hong-yang; Zeng, Zheng-zhi

    2011-10-15

    Two novel copper(II) thiocyanate complexes with 4-(N,N-dimethylamino) pyridine and N,N-dimethylformamide (1) and with 4-(N,N-dimethylamino) pyridine (2) have been synthesized and characterized. The crystal and molecular structures of complexes 1 and 2 were determined by single-crystal X-ray diffraction. Antioxidative activity tests in vitro showed that complex 1 has significant antioxidative activity against hydroxyl free radicals from the Fenton reaction and also oxygen free radicals, which is better than standard antioxidants like vitamin C and mannitol. The interaction of complex 1 with calf thymus DNA was investigated by spectroscopic, cyclic voltammetry, and viscosity measurements. Results suggest that complex 1 can bind to DNA via partial intercalation mode. Moreover, complex 1 has been found to cleavage of plasmid DNA pBR322. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Variation in DNA binding constants with a change in geometry of ternary copper(II) complexes with N2O donor Schiff base and cyanate or dicyanamide

    Science.gov (United States)

    Jana, Subrata; Santra, Ramesh Chandra; Das, Saurabh; Chattopadhyay, Shouvik

    2014-09-01

    Two new copper(II) complexes, [Cu(L)(OCN)] (1) and [CuL(dca)]n (2), where HL = 2-(-(2-(diethylamino)ethylimino)methyl)naphthalen-1-ol, dca = N(CN)2-, have been synthesized and characterized by elemental analysis, IR, UV-VIS spectroscopy and single crystal X-ray diffraction studies. Complex 1 has square planar and complex 2 square pyramidal geometries in solid state around metal centre. Interactions of the complexes with calf thymus DNA (CT DNA) were studied by UV-VIS spectroscopy. Binding constant and site size of interaction were determined. Binding site size and intrinsic binding constant K revealed complex 1 interacted with calf thymus DNA better than complex 2.

  7. Synthesis, spectral, dna binding and cleavage properties of ruthenium(II Schiff base complexes containing PPh3/AsPh3 as co-ligands

    Directory of Open Access Journals (Sweden)

    Sathiyaraj Subbaiyan

    2014-01-01

    Full Text Available A dihydroxybenzaldehyde Schiff base ligands (L1-L3 and its ruthenium(II complexes, have been synthesized and characterized on the basis of elemental analysis, 1H, 13C, 31P NMR, mass spectra, UV-vis and IR spectra. The binding of ruthenium(II complexes have been investigated by UV-vis absorption spectroscopy. The experiment reveals that all the compounds can bind to DNA through an electrostatic mode and intrinsic binding constant (Kb has been estimated under similar set of experimental conditions. Absorption spectral study indicate that the ruthenium(II complexes has intrinsic binding constant in the range of 1.6-8.6 X 104 M-1. The complex [Ru(CO(PPh32(L3] bind more strongly than that of the other complexes. In addition, DNA cleavage property were tested for all ruthenium(II complexes.

  8. Hyperoxia increases AP-1 DNA binding in rat brain.

    Science.gov (United States)

    Tong, LiQi; Toliver-Kinsky, Tracy; Rassin, David; Werrbach-Perez, Karin; Perez-Polo, J Regino

    2003-01-01

    Oxidative stress appears to contribute to neurodegenerative outcomes after ischemia, hypoxia, and hyperoxia. The AP-1 transcription factor is made up of a family of regulatory proteins that can be activated by oxidative stress. In the present study, we examined AP-1 DNA binding activity in terms of specific participating AP-1 proteins in rat brain after hyperoxia. Male Sprague-Dawley rats were exposed to 100% oxygen under isobaric conditions over time. The AP-1 DNA binding activity present in the rat hippocampus and basal forebrain was characterized by electrophoretic mobility shift analysis (EMSA) and the participating AP-1 proteins identified by immunodepletion/supershift and Western blotting analyses. The Fos and Jun proteins were localized by immunohistochemistry to hippocampus. There were significant increases in AP-1 DNA binding in both hippocampus and basal forebrain after hyperoxia. There was also a significant increase in c-Jun protein levels and the proportion of c-Jun present in AP-1 DNA binding complexes in hippocampal nuclei after hyperoxia. These results suggest that AP-1 activation via c-Jun binding to DNA is an important component of brain responses to oxidative stress.

  9. Mixed-ligand copper(ii) Schiff base complexes: the role of the co-ligand in DNA binding, DNA cleavage, protein binding and cytotoxicity.

    Science.gov (United States)

    Lian, Wen-Jing; Wang, Xin-Tian; Xie, Cheng-Zhi; Tian, He; Song, Xue-Qing; Pan, He-Ting; Qiao, Xin; Xu, Jing-Yuan

    2016-05-31

    Four novel mononuclear Schiff base copper(ii) complexes, namely, [Cu(L)(OAc)]·H2O (), [Cu(HL)(C2O4)(EtOH)]·EtOH (), [Cu(L)(Bza)] () and [Cu(L)(Sal)] () (HL = 1-(((2-((2-hydroxypropyl)amino)ethyl)imino)methyl)naphthalene-2-ol), Bza = benzoic acid, Sal = salicylic acid), were synthesized and characterized by X-ray crystallography, elemental analysis and infrared spectroscopy. Single-crystal diffraction analysis revealed that all the complexes were mononuclear molecules, in which the Schiff base ligand exhibited different coordination modes and conformations. The N-HO and O-HO inter- and intramolecular hydrogen bonding interactions linked these molecules into multidimensional networks. Their interactions with calf thymus DNA (CT-DNA) were investigated by UV-visible and fluorescence spectrometry, as well as by viscosity measurements. The magnitude of the Kapp values of the four complexes was 10(5), indicating a moderate intercalative binding mode between the complexes and DNA. Electrophoresis results showed that all these complexes induced double strand breaks of pUC19 plasmid DNA in the presence of H2O2 through an oxidative pathway. In addition, the fluorescence spectrum of human serum albumin (HSA) with the complexes suggested that the quenching mechanism of HSA by the complexes was a static process. Moreover, the antiproliferative activity of the four complexes against HeLa (human cervical carcinoma) and HepG-2 (human liver hepatocellular carcinoma) cells evaluated by colorimetric cell proliferation assay and clonogenic assay revealed that all four complexes had improved cytotoxicity against cancer cells. Inspiringly, complex , with salicylic acid as the auxiliary ligand, displayed a stronger anticancer activity, suggesting that a synergistic effect of the Schiff base complex and the nonsteroidal anti-inflammatory drug may be involved in the cell killing process. The biological features of mixed-ligand copper(ii) Schiff base complexes and how acetic auxiliary

  10. Fluorescence Titrations of Bio-relevant Complexes with DNA: Synthesis, Structural Investigation, DNA Binding/Cleavage, Antimicrobial and Molecular Docking Studies.

    Science.gov (United States)

    Arun, Thesingu Rajan; Subramanian, Ramasamy; Packianathan, Seemon; Raman, Natarajan

    2015-07-01

    In the present work, we attempted to develop new metal complexes (Cu(II), Co(II), Ni(II) and Zn(II)) of the imine ligand which was synthesized from 9,10-phenanthrenequinone and para-anisidine. With an intention to make the complexes most stable, very special chelating amino acid has been coordinated to the metal centre. The resultant metal complexes have been characterized by variety of techniques including FT-IR, UV-Vis., (1)H NMR, (13)C NMR, powder XRD, EPR and mass spectral studies. The interaction of the complexes with DNA has been effectively examined and explored by fluorescence titration, UV-Vis absorption, viscometer titration, cyclic voltammetry (CV) and differential pulse voltammetry. Moreover, molecular docking analysis has been performed to understand the nature of binding of the complexes with DNA. These studies prove that CT DNA interaction of the complexes follows intercalation mode. The metal complexes exhibit effective cleavage of pUC19 DNA by an oxidative cleavage mechanism. The antimicrobial screening indicates that these complexes are good antimicrobial agents against various organisms.

  11. Antitumor trans-N-heterocyclic carbene-amine-Pt(II) complexes: synthesis of dinuclear species and exploratory investigations of DNA binding and cytotoxicity mechanisms.

    Science.gov (United States)

    Chtchigrovsky, Mélanie; Eloy, Laure; Jullien, Hélène; Saker, Lina; Ségal-Bendirdjian, Evelyne; Poupon, Joel; Bombard, Sophie; Cresteil, Thierry; Retailleau, Pascal; Marinetti, Angela

    2013-03-14

    A series of bimetallic [(NHC)PtX2]2(diamine) complexes have been prepared as a new chemotype for potential anticancer agents. These complexes display an uncommon set of structural features as far as they combine two bifunctional, trans-configured platinum centers. They display cytotoxic activities in the micromolar range on many cancerous cell lines and do not cross-react with cisplatin in A2780/DDP cell lines. They bind slowly to double-stranded DNAs, giving monoadducts as the major products. Pathways for cellular toxicity have been investigated for both mono- and bimetallic trans-(NHC)PtX2(amine) complexes. It has been highlighted that, unlike cisplatin, these complexes do not induce cell cycle arrest. They trigger apoptosis in A2780 cells by a pathway involving translocation of apoptosis-inducing factor and caspase 12 to the nucleus. Moreover, bimetallic complexes may induce necrosis.

  12. Radiation damage to DNA-binding proteins

    International Nuclear Information System (INIS)

    Culard, G.; Eon, S.; DeVuyst, G.; Charlier, M.; Spotheim-Maurizot, M.

    2003-01-01

    The DNA-binding properties of proteins are strongly affected upon irradiation. The tetrameric lactose repressor (a dimer of dimers) losses its ability to bind operator DNA as soon as at least two damages per protomer of each dimer occur. The monomeric MC1 protein losses its ability to bind DNA in two steps : i) at low doses only the specific binding is abolished, whereas the non-specific one is still possible; ii) at high doses all binding vanishes. Moreover, the DNA bending induced by MC1 binding is less pronounced for a protein that underwent the low dose irradiation. When the entire DNA-protein complexes are irradiated, the observed disruption of the complexes is mainly due to the damage of the proteins and not to that of DNA. The doses necessary for complex disruption are higher than those inactivating the free protein. This difference, larger for MC1 than for lactose repressor, is due to the protection of the protein by the bound DNA. The oxidation of the protein side chains that are accessible to the radiation-induced hydroxyl radicals seems to represent the inactivating damage

  13. Synthesis, characterization and DNA-binding studies on La(III) and Ce(III) complexes containing ligand of N-phenyl-2-pyridinecarboxamide.

    Science.gov (United States)

    He, Xin-Qian; Lin, Qiu-Yue; Hu, Rui-Ding; Lu, Xiao-Hong

    2007-09-01

    La(III) and Ce(III) complexes containing ligand of N-phenyl-2-pyridinecarboxamide (HL) were synthesized and characterized by elemental analyses, conductivity measurement, IR spectra and thermal analysis. The general formulas of the complexes were [Ln(HL)(3)(H(2)O)(2)](NO(3))(3).2H(2)O [Ln=La(III), Ce(III)]. The results indicated that the oxygen of carbonyl and the nitrogen of pyridyl coordinated to Ln(III), and there were also two water molecules taking part in coordination. Ln(III) and HL formed 1:3 chelate complexes and the coordination number was eight. The interaction between the complexes and DNA was studied by means of UV-vis spectra, fluorescence spectra, SERS spectra and agarose gel electrophoresis. The results showed that complexes can bind to DNA. The binding ability decreased in following order: La(III) complex, Ce(III) complex, and HL. The interaction modes between DNA and the three compounds were found to be mainly intercalative.

  14. A new ternary copper(II) complex derived from 2-(2'-pyridyl)benzimidazole and glycylglycine: synthesis, characterization, DNA binding and cleavage, antioxidation and HSA interaction.

    Science.gov (United States)

    Fu, Xia-Bing; Lin, Zi-Hua; Liu, Hai-Feng; Le, Xue-Yi

    2014-03-25

    A new ternary copper(II)-dipeptide complex [Cu(glygly)(HPB)(Cl)]⋅2H2O (glygly=glycylglycine anion, HPB=2-(2'-pyridyl)benzimidazole) has been synthesized and characterized. The DNA interaction of the complex was studied by spectroscopic methods, viscosity, and electrophoresis measurements. The antioxidant activity was also investigated using the pyrogallol autoxidation assay. Besides, the interaction of the complex with human serum albumin (HSA) in vitro was examined by multispectroscopic techniques. The complex partially intercalated to CT-DNA with a high binding constant (Kb=7.28×10(5) M(-1)), and cleaved pBR322 DNA efficiently via an oxidative mechanism in the presence of Vc, with the HO· and O2(-) as the active species, and the SOD as a promoter. Furthermore, the complex shows a considerable SOD-like activity with the IC50 value of 3.8386 μM. The complex exhibits desired binding affinity to HSA, in which hydrogen bond or vander Waals force played a major role. The alterations of HSA secondary structure induced by the complex were confirmed by UV-visible, CD, synchronous fluorescence and 3D fluorescence spectroscopy. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. A new ternary copper(II) complex derived from 2-(2";-pyridyl)benzimidazole and glycylglycine: Synthesis, characterization, DNA binding and cleavage, antioxidation and HSA interaction

    Science.gov (United States)

    Fu, Xia-Bing; Lin, Zi-Hua; Liu, Hai-Feng; Le, Xue-Yi

    2014-03-01

    A new ternary copper(II)-dipeptide complex [Cu(glygly)(HPB)(Cl)]ṡ2H2O (glygly = glycylglycine anion, HPB = 2-(2";-pyridyl)benzimidazole) has been synthesized and characterized. The DNA interaction of the complex was studied by spectroscopic methods, viscosity, and electrophoresis measurements. The antioxidant activity was also investigated using the pyrogallol autoxidation assay. Besides, the interaction of the complex with human serum albumin (HSA) in vitro was examined by multispectroscopic techniques. The complex partially intercalated to CT-DNA with a high binding constant (Kb = 7.28 × 105 M-1), and cleaved pBR322 DNA efficiently via an oxidative mechanism in the presence of Vc, with the HO· and O2-rad as the active species, and the SOD as a promoter. Furthermore, the complex shows a considerable SOD-like activity with the IC50 value of 3.8386 μM. The complex exhibits desired binding affinity to HSA, in which hydrogen bond or vander Waals force played a major role. The alterations of HSA secondary structure induced by the complex were confirmed by UV-visible, CD, synchronous fluorescence and 3D fluorescence spectroscopy.

  16. Synthesis of mononuclear copper(II) complexes of acyclic Schiff's base ligands: Spectral, structural, electrochemical, antibacterial, DNA binding and cleavage activity

    Science.gov (United States)

    Jayamani, Arumugam; Thamilarasan, Vijayan; Sengottuvelan, Nallathambi; Manisankar, Paramasivam; Kang, Sung Kwon; Kim, Young-Inn; Ganesan, Vengatesan

    2014-03-01

    The mononuclear copper(II) complexes (1&2) of ligands L1 [N,N";-bis(2-hydroxy-5-methylbenzyl)-1,4-bis(3-iminopropyl)piperazine] or L2 [N,N";-bis(2-hydroxy-5-bromobenzyl)-1,4-bis(3-iminopropyl) piperazine] have been synthesized and characterised. The single crystal X-ray study had shown that ligands L1 and L2 crystallize in a monoclinic crystal system with P21/c space group. The mononuclear copper(II) complexes show one quasireversible cyclic voltammetric response near cathodic region (-0.77 to -0.85 V) in DMF assignable to the Cu(II)/Cu(I) couple. Binding interaction of the complexes with calf thymus DNA (CT DNA) investigated by absorption studies and fluorescence spectral studies show good binding affinity to CT DNA, which imply both the copper(II) complexes can strongly interact with DNA efficiently. The copper(II) complexes showed efficient oxidative cleavage of plasmid pBR322 DNA in the presence of 3-mercaptopropionic acid as reducing agent through a mechanistic pathway involving formation of singlet oxygen as the reactive species. The Schiff bases and their Cu(II) complexes have been screened for antibacterial activities which indicates that the complexes exhibited higher antimicrobial activity than the free ligands.

  17. Antioxidant, DNA binding and nuclease activities of heteroleptic copper(II) complexes derived from 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols and diimines

    Science.gov (United States)

    Ravichandran, J.; Gurumoorthy, P.; Imran Musthafa, M. A.; Kalilur Rahiman, A.

    2014-12-01

    A series of heteroleptic copper(II) complexes of the type [CuL1-4(diimine)](ClO4)2 (1-8) [L1-4 = 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols, and diimine = 2,2‧-bipyridyl (bpy) or 1,10-phenanthroline (phen)], have been synthesized and characterized by spectroscopic methods. The IR spectra of complexes indicate the presence of uncoordinated perchlorate anions and the electronic spectra revealed the square pyramidal geometry with N4O coordination environment around copper(II) nuclei. Electrochemical studies of the mononuclear complexes evidenced one-electron irreversible reduction wave in the cathodic region. The EPR spectra of complexes with g|| (2.206-2.214) and A|| (154-172 × 10-4 cm-1) values support the square-based CuN3O coordination chromophore and the presence of unpaired electron localized in dx-y ground state. Antioxidant studies against DPPH revealed effective radical scavenging properties of the synthesized complexes. Binding studies suggest that the heteroleptic copper(II) complexes interact with calf thymus DNA (CT-DNA) through minor-groove and electrostatic interaction, and all the complexes display pronounced nuclease activity against supercoiled pBR322 DNA.

  18. DNA binding and biological activity of mixed ligand complexes of Cu(II, Ni(II and Co(II with quinolones and N donor ligand

    Directory of Open Access Journals (Sweden)

    S.M M Akram

    2015-10-01

    Full Text Available  AbstractMixed ligand complexes of  Cu(II, Ni(II and Co(II have been synthesized by using levofloxacin and bipyridyl and characterized using spectral and analytical techniques. The binding behavior of the Ni(II and Cu(II complexes with herring sperm DNA(Hs-DNA were determined using electronic absorption titration, viscometric measurements and cyclic voltammetry measurements. The binding constant calculated  for Cu(II and Ni(II complexes are 2.0 x 104 and 4.0 x 104 M-1 respectively. Detailed analysis reveals that these metal complexes interact with DNA through intercalative binding mode. The nuclease activity of  Cu(II and Ni(II complexes with ct-DNA was carried out using agarose gel electrophoresis technique. The antioxidant activities for the synthesized complexes have been tested and the antibacterial activity for Ni(II complex was also checked.Key words: Intercalation, hypochromism, red shift and  peak potential.

  19. Design, synthesis and DNA binding activities of late first row transition metal(II) complexes of bi- functional tri - and tetratopic imines

    Science.gov (United States)

    Netalkar, Priya P.; Kamath, Anupama; Netalkar, Sandeep P.; Revankar, Vidyanand K.

    2012-11-01

    A series of novel Co(II), Ni(II), Cu(II) and Zn(II) complexes of tri and tetratopic hydrazones have been prepared. Ligands L1H2 and L2H2 were synthesized by the condensation of 2-formylphenoxyacetic acid with 2-hydrazinobenzothiazole and 2-hydroxy-3-hydrazinebenzopyrazine, respectively. The prepared complexes were characterized by the analytical and spectral techniques. All the complexes were found to be monomeric in nature with octahedral geometry. Both ligands were found to be electrochemically active in the working potential range showing single electron transfer process attributed to the deprotonation of carboxylic group of the 2-formylphenoxyacetic acid. The potency of the ligand and its complexes as antimicrobial agents has been investigated and made to interact with Escherichia coli DNA to investigate the binding/cleaving ability by absorption, hydrodynamic and electrophoresis studies.

  20. DNA binding, DNA cleavage and cytotoxicity studies of a new water soluble copper(II) complex: the effect of ligand shape on the mode of binding.

    Science.gov (United States)

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Roshanfekr, Hamideh; Shahabadi, Nahid; Mansouri, Ghobad

    2012-02-01

    The interaction of native calf thymus DNA (CT-DNA) with [Cu(ph(2)phen)(phen-dione)Cl]Cl was studied at physiological pH by spectrophotometric, spectrofluorometric, circular dichroism, and viscometric techniques. Considerable hypochromicity and red shift are observed in the UV absorption band of the Cu complex. Binding constants (K(b)) of DNA with the complex were calculated at different temperatures. Thermodynamic parameters, enthalpy and entropy changes were calculated according to Van't Hoff equation, which indicated that reaction is predominantly enthalpically driven. All these results indicate that Cu(II) complex interacts with CT-DNA via intercalative mode. Also, this new complex induced cleavage in pUC18 plasmid DNA as indicated in gel electrophoresis and showed excellent antitumor activity against K562 (human chronic myeloid leukemia) and human T lymphocyte carcinoma-Jurkat cell lines. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Synthesis and Structural Investigation of New Bio-Relevant Complexes of Lanthanides with 5-Hydroxyflavone: DNA Binding and Protein Interaction Studies

    Directory of Open Access Journals (Sweden)

    Alexandra-Cristina Munteanu

    2016-12-01

    Full Text Available In the present work, we attempted to develop new metal coordination complexes of the natural flavonoid 5-hydroxyflavone with Sm(III, Eu(III, Gd(III, Tb(III. The resultant hydroxo complexes have been characterized by a variety of spectroscopic techniques, including fluorescence, FT-IR, UV-Vis, EPR and mass spectral studies. The general chemical formula of the complexes is [Ln(C15H9O33(OH2(H2Ox]·nH2O, where Ln is the lanthanide cation and x = 0 for Sm(III, x = 1 for Eu(III, Gd(III, Tb(III and n = 0 for Sm(III, Gd(III, Tb(III, n = 1 for Eu(III, respectively. The proposed structures of the complexes were optimized by DFT calculations. Theoretical calculations and experimental determinations sustain the proposed structures of the hydroxo complexes, with two molecules of 5-hydroxyflavone acting as monoanionic bidentate chelate ligands. The interaction of the complexes with calf thymus DNA has been explored by fluorescence titration and UV-Vis absorption binding studies, and revealed that the synthesized complexes interact with DNA with binding constants (Kb ~ 104. Human serum albumin (HSA and transferrin (Tf binding studies have also been performed by fluorescence titration techniques (fluorescence quenching studies, synchronous fluorescence spectra. The apparent association constants (Ka and thermodynamic parameters have been calculated from the fluorescence quenching experiment at 299 K, 308 K, and 318 K. The quenching curves indicate that the complexes bind to HSA with smaller affinity than the ligand, but to Tf with higher binding affinities than the ligand.

  2. The meloxicam complexes of Co(II) and Zn(II): Synthesis, crystal structures, photocleavage and in vitro DNA-binding

    Science.gov (United States)

    Sanatkar, Tahereh Hosseinzadeh; Hadadzadeh, Hassan; Simpson, Jim; Jannesari, Zahra

    2013-10-01

    Two neutral mononuclear complexes of Co(II) and Zn(II) with the non-steroidal anti-inflammatory drug meloxicam (H2mel, 4-hydroxy-2-methyl-N-(5-methyl-2-thiazolyl)-2H-1,2-benzothiazine-3-carboxammide-1,1-dioxide), [Co(Hmel)2(EtOH)2] (1), and [Zn(Hmel)2(EtOH)2] (2), were synthesized and characterized by elemental analysis, IR and UV-Vis spectroscopy and their solid-state structures were studied by single-crystal diffraction. The complexes have a distorted octahedral geometry around the metal atom. The experimental data indicate that the meloxicam acts as a deprotonated bidentate ligand (through the amide oxygen and the nitrogen atom of the thiazolyl ring) in the complexes, and a strong intramolecular hydrogen bond between the amide N-H function and the enolate O atom stabilizes the ZZZ conformation of meloxicam ligands. Absorption, fluorescence spectroscopy and cyclic voltammetry have been used to investigate the binding of the complexes with fish sperm DNA (FS-DNA). Additionally, the photocleavage studies have been also used to investigate the binding of the complexes with plasmid DNA. The interaction of the complexes with DNA was monitored by a blue shift and hyperchromism in the UV-Vis spectra attributed to an electrostatic binding mode. A competitive study with ethidium bromide (EB) has shown that the complexes can displace the DNA-bound EB indicating that they bind to DNA in strong competition with EB. The experimental results show that the complexes can cleave pUC57 plasmid DNA.

  3. DNA-Binding Studies of Some Potential Antitumor 2,2'-bipyridine Pt(II)/Pd(II) Complexes of piperidinedithiocarbamate. Their Synthesis, Spectroscopy and Cytotoxicity.

    Science.gov (United States)

    Mansouri-Torshizi, Hassan; Eslami-Moghadam, Mahboube; Divsalar, Adeleh; Saboury, Ali-Akbar

    2011-12-01

    In this study two platinum(II) and palladium(II) complexes of the type [M(bpy)(pip-dtc)]NO3 (where M=Pt(II) or Pd(II), bpy=2,2'-bipyridine, pip-dtc=piperidinedithiocarbamate) were synthesized by reaction between diaquo-2,2'-bipyridine Pt(II)/Pd(II) nitrate and sodium salt of dithiocarbamate. These cationic water soluble complexes were characterized by elemental analysis, molar conductance, IR, electronic and 1H NMR spectroscopic studies. The cyclic dithiocarbamate was found to coordinate as bidentate fasion with Pt(II) or Pd(II) center. Their biological activities were tested against chronic myelogenous leukemia cell line, K562, at micromolar concentration. The obtained cytotoxic concentration (IC50) values were much lower than cisplatin. The interaction of these complexes with highly polymerized calf thymus DNA (ct-DNA) was extensively studied by means of electronic absorption, fluorescence, circular dichroism and other measurements. The experimental results, thermodynamic and binding parameters, suggested that these complexes cooperatively bind to DNA presumably via intercalation. Moreover, the tendency of the Pt(II) complex to interact with DNA was more than that of Pd(II) complex.

  4. New DNA-binding radioprotectors

    Science.gov (United States)

    Martin, Roger

    The normal tissue damage associated with cancer radiotherapy has motivated the development at Peter Mac of a new class of DNA-binding radioprotecting drugs that could be applied top-ically to normal tissues at risk. Methylproamine (MP), the lead compound, reduces radiation induced cell kill at low concentrations. For example, experiments comparing the clonogenic survival of transformed human keratinocytes treated with 30 micromolar MP before and dur-ing various doses of ionising radiation, with the radiation dose response for untreated cells, indicate a dose reduction factor (DRF) of 2. Similar survival curve experiments using various concentrations of MP, with parallel measurements of uptake of MP into cell nuclei, have en-abled the relationship between drug uptake and extent of radioprotection to be established. Radioprotection has also been demonstrated after systemic administration to mice, for three different endpoints, namely lung, jejunum and bone marrow (survival at 30 days post-TBI). The results of pulse radiolysis studies indicated that the drugs act by reduction of transient radiation-induced oxidative species on DNA. This hypothesis was substantiated by the results of experiments in which MP radioprotection of radiation-induced DNA double-strand breaks, assessed as -H2AX foci, in the human keratinocyte cell line. For both endpoints, the extent of radioprotection increased with MP concentration up to a maximal value. These results are consistent with the hypothesis that radioprotection by MP is mediated by attenuation of the extent of initial DNA damage. However, although MP is a potent radioprotector, it becomes cytotoxic at higher concentrations. This limitation has been addressed in an extensive program of lead optimisation and some promising analogues have emerged from which the next lead will be selected. Given the clinical potential of topical radioprotection, the new analogues are being assessed in terms of delivery to mouse oral mucosa. This is

  5. Photodynamic effect of light-harvesting, long-lived triplet excited state Ruthenium(II)-polyimine-coumarin complexes: DNA binding, photocleavage and anticancer studies.

    Science.gov (United States)

    Nomula, Raju; Wu, Xueyan; Zhao, Jianzhang; Munirathnam, Nagegownivari R

    2017-10-01

    Two coumarin based Ru II -polyimine complexes (Ru-1 and Ru-2) showing intense absorption of visible light and long-lived triplet excited states (~12-15μs) were used for study of the interaction with DNA. The binding of the complexes with CT-DNA were studied by UV-vis, fluorescence and time-resolved nanosecond transient absorption (ns-TA) spectroscopy. The results suggesting that the complexes interact with CT-DNA by intercalation mode of binding, showing the binding constants (K b ) 6.47×10 4 for Ru-1 and 5.94×10 4 M -1 for Ru-2, in contrast no such results were found for Ru-0. The nanosecond transient absorption spectra of these systems in the presence of CT-DNA showing a clear perturbation in the bleaching region was observed compare to buffer alone. Visible light photoirradiation DNA cleavage was investigated for these complexes by treating with the supercoiled pUC19 DNA and irradiated at 450nm. The reactive species produced upon irradiation of current agents is singlet oxygen ( 1 O 2 ), which results in the generation of other reactive oxygen species (ROS). The complexes shown efficient cleavage activity, converted complete supercoiled DNA to nicked circular at as low as 20μM concentration in 30min of light irradiation time. Significant amount of linear form was generated by Ru-1 at the same conditions. Even though Ru-0 has significant 1 O 2 quantum yield but shown lower cleavage activity compared to other two analogs is due the miserable interaction (binding) with DNA. The cytotoxicity in vitro of the complexes toward HeLa, BEL-7402 and MG-63 cells was assessed by MTT assay. The cellular uptake was observed on BEL-7402 cells under fluorescence microscope. The complexes shown appreciable cytotoxicity towards the cancer cell lines. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Spectral characterization, optical band gap calculations and DNA binding of some binuclear Schiff-base metal complexes derived from 2-amino-ethanoic acid and acetylacetone

    Science.gov (United States)

    Hussien, Mostafa A.; Nawar, Nagwa; Radwan, Fatima M.; Hosny, Nasser Mohammed

    2015-01-01

    Bi-nuclear metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H2L) resulted from the condensation of 2-amino-ethanoic acid (glycine) and acetylacetone have been synthesized and characterized by elemental analyses, Raman spectra, FT-IR, ES-MS, UV-Vis., 1H NMR, ESR, thermal analyses (TG, DTG and DTA) and magnetic measurements. The results showed that, the Schiff base ligand can bind two metal ions in the same time. It coordinates to the first metal ion as mono-negative bi-dentate through azomethine nitrogen and enolic carbonyl after deprotonation. At the same time, it binds to the second metal ion via carboxylate oxygen after deprotonation. The thermodynamic parameters E∗, ΔH∗, ΔG∗ and ΔS∗ have been calculated by Coats-Redfern (CR) and Horowitz-Metzger (HM) methods. The optical band gaps of the isolated complexes have been calculated from absorption spectra and the results indicated semi-conducting nature of the investigated complexes. The interactions between the copper (II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA.

  7. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  8. Synthesis, DNA binding, cellular DNA lesion and cytotoxicity of a series of new benzimidazole-based Schiff base copper(II) complexes.

    Science.gov (United States)

    Paul, Anup; Anbu, Sellamuthu; Sharma, Gunjan; Kuznetsov, Maxim L; Koch, Biplob; Guedes da Silva, M Fátima C; Pombeiro, Armando J L

    2015-12-14

    A series of new benzimidazole containing compounds 2-((1-R-1-H-benzimidazol-2-yl)phenyl-imino)naphthol HL(1-3) (R = methyl, ethyl or propyl, respectively) have been synthesized by Schiff base condensation of 2-(1-R-1-H-benzo[d]imidazol-2-yl)aniline and 2-hydroxy-1-naphthaldehyde. The reactions of HL(1-3) with Cu(NO3)2·2.5H2O led to the corresponding copper(II) complexes [Cu(L)(NO3)] 1-3. All the compounds were characterized by conventional analytical techniques and, for 1 and 3, also by single-crystal X-ray analysis. The interactions of complexes 1-3 with calf thymus DNA were studied by absorption and fluorescence spectroscopic techniques and the calculated binding constants (K(b)) are in the range of 3.5 × 10(5) M(-1)-3.2 × 10(5) M(-1). Complexes 1-3 effectively bind DNA through an intercalative mode, as proved by molecular docking studies. The binding affinity of the complexes decreases with the size increase of the N-alkyl substituent, in the order of 1 > 2 > 3, which is also in accord with the calculated LUMO(complex) energies. They show substantial in vitro cytotoxic effect against human lung (A-549), breast (MDA-MB-231) and cervical (HeLa) cancer cell lines. Complex 1 exhibits a significant inhibitory effect on the proliferation of the A-549 cancer cells. The antiproliferative efficacy of 1 has also been analysed by a DNA fragmentation assay, fluorescence activated cell sorting (FACS) and nuclear morphology using a fluorescence microscope. The possible mode for the apoptosis pathway of 1 has also been evaluated by a reactive oxygen species (ROS) generation study.

  9. Synthesis, characterization, and DNA binding and cleavage properties of copper(II)-tryptophanphenyl-alanine-1,10-phenanthroline/2,2'-bipyridine complexes.

    Science.gov (United States)

    Reddy, Pulimamidi R; Raju, Nomula; Satyanarayana, Battu

    2011-01-01

    The mononuclear dipeptide-based Cu(II) complexes [Cu(II) (trp-phe)(phen)(H₂O)] ⋅ ClO₄ (1) and [Cu(II) (trp-phe)(bpy)(H₂O)] ⋅ ClO₄ (2) (trp-phe=tryptophanphenylalanine, phen=1,10-phenanthroline, bpy=2,2'-bipyridine) were isolated, and their interaction with DNA was studied. They exhibit intercalative mode of interaction with DNA. The intercalative interaction was quantified by Stern-Volmer quenching constant (K(sq) =0.14 for 1 and 0.08 for 2). The Cu(II) complexes convert supercoiled plasmid DNA into its nicked circular form hydrolytically at physiological conditions at a concentration as low as 5 μM (for 1) and 10 μM (for 2). The DNA hydrolysis rates at a complex concentration of 50 μM were determined as 1.74 h(-1) (R=0.985) for 1 and 0.65 h(-1) (R=0.965) for 2. The rate enhancement in the range of 2.40-4.10×10⁷-fold compared to non-catalyzed double-stranded DNA is significant. This was attributed to the presence of a H(2) O molecule in the axial position of the Cu complexes. Copyright © 2011 Verlag Helvetica Chimica Acta AG, Zürich.

  10. Metal based biologically active compounds: Design, synthesis, DNA binding and antidiabetic activity of 6-methyl-3-formyl chromone derived hydrazones and their metal (II) complexes.

    Science.gov (United States)

    Philip, Jessica Elizabeth; Shahid, Muhammad; Prathapachandra Kurup, M R; Velayudhan, Mohanan Puzhavoorparambil

    2017-10-01

    Two chromone hydrazone ligands HL 1 and HL 2 were synthesized and characterized by elemental analyses, IR, 1 H NMR & 13 C NMR, electronic absorption and mass spectra. The reactions of the chromone hydrazones with transition metals such as Ni, Cu, and Zn (II) salts of acetate afforded mononuclear metal complexes. Characterization and structure elucidation of the prepared chromone hydrazone metal (II) complexes were done by elemental, IR, electronic, EPR spectra and thermo gravimetric analyses as well as conductivity and magnetic susceptibility measurements. The spectroscopic data showed that the ligand acts as a mono basic bidentate with coordination sites are azomethine nitrogen and hydrazonic oxygen, and they exhibited distorted geometry. The biological studies involved antidiabetic activity i.e. enzyme inhibition of α-amylase and α-glucosidase, Calf Thymus - DNA (CT-DNA) interaction and molecular docking. Potential capacity of synthesized compounds to inhibit the α-amylase and α-glucosidase activity was assayed whereas DNA interaction studies were carried out with the help UV-Vis absorption titration and viscosity method. The docking studies of chromone hydrazones show that they are minor groove binders. Complexes were found to be good DNA - intercalates. Chromone hydrazones and its transition metal complexes have shown comparable antidiabetic activity with a standard drug acarbose. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Synthesis, Characterization and DNA-Binding Properties of The Novel Mononuclear Zn(II, Cd(II, and Mn(II Complexes with Pantoprazole.

    Directory of Open Access Journals (Sweden)

    Wessam N. El-Sayed

    2016-04-01

    Full Text Available A   novel   mononuclear   Mn(II,   Zn(II   and   Cd(II   complexes of pantoprazole   (PA   was synthesized  and characterized  by elemental analysis,  molar conductivity,  magnetic susceptibility   measurements,   IR,  UV-visible  spectral  studies,  and  thermal  analysis.  The electronic spectra along with magnetic data suggest octahedral geometry for Mn(II, Zn(II and Cd(II complexes.  PA acts as an anionic bi-dentate ligand being coordinated by (S=O oxygen and benzimdazolyl nitrogen atoms. The interaction of the complexes with calf thymus DNA (CT-DNA was monitored by blue shift and hyperchromism in the UV-vis spectra. The observed  intrinsic  binding  constants  together  with  structural  analysis  of  the  complexes indicate  the groove  binding. The binding constants were determined at 303°K, 308°K and 313°K.  A thermodynamic analysis showed that the reaction is spontaneous with ΔG being negative. The enthalpy ΔH and the entropy ΔS of reactions were all determined.

  12. Toxicity in tumor cells, DNA binding mode, and resistance to decomposition by sulfur nucleophiles of new dinuclear bifunctional trans-Pt-II complexes containing long alkane linkers

    Czech Academy of Sciences Publication Activity Database

    Prachařová, J.; Nováková, Olga; Kašpárková, Jana; Gibson, J.; Brabec, Viktor

    2013-01-01

    Roč. 85, č. 2 (2013), s. 343-354 ISSN 0033-4545 R&D Projects: GA ČR(CZ) GD301/09/H004 Institutional support: RVO:68081707 Keywords : PLATINUM ANTITUMOR COMPLEXES * INTERSTRAND CROSS-LINKS * GEOMETRIC ISOMERISM Subject RIV: BO - Biophysics Impact factor: 3.112, year: 2013

  13. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    Science.gov (United States)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  14. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  15. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  16. Study on potential antitumor mechanism of a novel Schiff base copper(II) complex: synthesis, crystal structure, DNA binding, cytotoxicity and apoptosis induction activity.

    Science.gov (United States)

    Qiao, Xin; Ma, Zhong-Ying; Xie, Cheng-Zhi; Xue, Fei; Zhang, Yan-Wen; Xu, Jing-Yuan; Qiang, Zhao-Yan; Lou, Jian-Shi; Chen, Gong-Jun; Yan, Shi-Ping

    2011-05-01

    A new cytotoxic copper(II) complex with Schiff base ligand [Cu(II)(5-Cl-pap)(OAc)(H(2)O)]·2H(2)O (1) (5-Cl-pap=N-2-pyridiylmethylidene-2-hydroxy-5-chloro-phenylamine), was synthesized and structurally characterized by X-ray diffraction. Single-crystal analysis revealed that the copper atom shows a 4+1 pyramidal coordination, a water oxygen appears in the apical position, and three of the basal positions are occupied by the NNO tridentate ligand and the fourth by an acetate oxygen. The interaction of Schiff base copper(II) complex 1 with DNA was investigated by UV-visible spectra, fluorescence spectra and agarose gel electrophoresis. The apparent binding constant (K(app)) value of 6.40×10(5) M(-1) for 1 with DNA suggests moderate intercalative binding mode. This copper(II) complex displayed efficient oxidative cleavage of supercoiled DNA, which might indicate that the underlying mechanism involve hydroxyl radical, singlet oxygen-like species, and hydrogen peroxide as reactive oxygen species. In addition, our present work showed the antitumor effect of 1 on cell cycle and apoptosis. Flow cytometric analysis revealed that HeLa cells were arrested in the S phase after treatment with 1. Fluorescence microscopic observation indicated that complex 1 can induce apoptosis of HeLa cells, whose process was mediated by intrinsic mitochondrial apoptotic pathway owing to the activation of caspase-9 and caspase-3. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. One-pot synthesis of a new 2-substituted 1,2,3-triazole 1-oxide derivative from dipyridyl ketone and isonitrosoacetophenone hydrazone: Nickel(II) complex, DNA binding and cleavage properties.

    Science.gov (United States)

    Gup, Ramazan; Erer, Oktay; Dilek, Nefise

    2017-04-01

    An efficient and simple one-pot synthesis of a new 1,2,3-triazole-1-oxide via reaction between isonitrosoacetophenone hydrazone and dipyridyl ketone in the EtOH/AcOH at room temperature has been developed smoothly in high yield. The reaction proceeds via metal salt free, in-situ formation of asymmetric azine followed by cyclization to provide 1,2,3-triazole 1-oxide compound. It has been structurally characterized. The 1:1 ratio reaction of the 1,2,3-triazole 1-oxide ligand with nickel(II) chloride gives the mononuclear complex [Ni(L)(DMF)Cl 2 ], hexa-coordinated within an octahedral geometry. Characterization of the 1,2,3-triazole compound and its Ni(II) complex with FTIR, 1 H and 13 C NMR, UV-vis and elemental analysis also confirms the proposed structures of the compounds. The interactions of the compounds with Calf thymus DNA (CT-DNA) have been investigated by UV-visible spectra and viscosity measurements. The results suggested that both ligand and Ni(II) complex bind to DNA in electrostatic interaction and/or groove binding, also with a slight partial intercalation in the case of ligand. DNA cleavage experiments have been also investigated by agarose gel electrophoresis in the presence and absence of an oxidative agent (H 2 O 2 ). Both 1,2,3-triazole 1-oxide ligand and its nickel(II) complex show nuclease activity in the presence of hydrogen peroxide. DNA binding and cleavage affinities of the 1,2,3-triazole 1-oxide ligand is stronger than that of the Ni(II) complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. In Vitro DNA-Binding, Anti-Oxidant and Anticancer Activity of Indole-2-Carboxylic Acid Dinuclear Copper(II Complexes

    Directory of Open Access Journals (Sweden)

    Xiangcong Wang

    2017-01-01

    Full Text Available Indole-2-carboxylic acid copper complex (ICA-Cu was successfully prepared and characterized through elemental analysis, IR, UV-Vis, 1H-NMR, TG analysis, and molar conductance, and its molecular formula was [Cu2(C9H6O2N4(H2O2]·2H2O. The binding ability of ICA-Cu to calf thymus DNA (CT-DNA was examined by fluorescence spectrometry and the viscosity method. The results indicated that, upon the addition of increasing amounts of CT-DNA, the excitation and emission intensity of ICA-Cu decreased obviously and the excitation spectra shifted towards a long wavelength. ICA-Cu could displace ethidium bromide (EB from the EB-DNA system, making the fluorescence intensity of the EB-DNA system decrease sharply; the quenching constant KSV value was 3.99 × 104 M−1. The emission intensity of the ICA-Cu-DNA system was nearly constant, along with the addition of Na+ in a series of concentrations. The fluorescence of the complex could be protected after the complex interacted with DNA. A viscosity measurement further supported the result that the ICA-Cu complex may interact with DNA in an intercalative binding mode. The antioxidant activities of ICA-Cu were evaluated by a 2,2-diphenyl-1-picrylhydrazyl (DPPH assay, a hydroxyl radical (OH scavenging assay, and a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS assay. The ICA-Cu exhibited the highest inhibitory effects on the ABTS radical (94% inhibition at 60 µM, followed by OH and DPPH radicals (the degrees of inhibition being 71% and 56%, respectively. The in vitro cytotoxicity activity of ICA-Cu against two human breast cancer cell lines, MDA-MB-231 and MCF-7, was investigated by 3-[4,5-dimethyltiazol2-yl]-2.5-diphenyl-tetrazolium bromide (MTT assay and cellular morphological analysis. The results showed that, upon increasing the concentration of ICA-Cu, an increase was observed in growth-inhibitory activity and the inhibition percentage were greater than 90% at 20 µM in both cell lines. Also

  19. In Vitro DNA-Binding, Anti-Oxidant and Anticancer Activity of Indole-2-Carboxylic Acid Dinuclear Copper(II) Complexes.

    Science.gov (United States)

    Wang, Xiangcong; Yan, Maocai; Wang, Qibao; Wang, Huannan; Wang, Zhengyang; Zhao, Jiayi; Li, Jing; Zhang, Zhen

    2017-01-20

    Indole-2-carboxylic acid copper complex (ICA-Cu) was successfully prepared and characterized through elemental analysis, IR, UV-Vis, ¹H-NMR, TG analysis, and molar conductance, and its molecular formula was [Cu₂(C₉H₆O₂N)₄(H₂O)₂]·2H₂O. The binding ability of ICA-Cu to calf thymus DNA (CT-DNA) was examined by fluorescence spectrometry and the viscosity method. The results indicated that, upon the addition of increasing amounts of CT-DNA, the excitation and emission intensity of ICA-Cu decreased obviously and the excitation spectra shifted towards a long wavelength. ICA-Cu could displace ethidium bromide (EB) from the EB-DNA system, making the fluorescence intensity of the EB-DNA system decrease sharply; the quenching constant K SV value was 3.99 × 10⁴ M -1 . The emission intensity of the ICA-Cu-DNA system was nearly constant, along with the addition of Na⁺ in a series of concentrations. The fluorescence of the complex could be protected after the complex interacted with DNA. A viscosity measurement further supported the result that the ICA-Cu complex may interact with DNA in an intercalative binding mode. The antioxidant activities of ICA-Cu were evaluated by a 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay, a hydroxyl radical (OH) scavenging assay, and a 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS) assay. The ICA-Cu exhibited the highest inhibitory effects on the ABTS radical (94% inhibition at 60 µM), followed by OH and DPPH radicals (the degrees of inhibition being 71% and 56%, respectively). The in vitro cytotoxicity activity of ICA-Cu against two human breast cancer cell lines, MDA-MB-231 and MCF-7, was investigated by 3-[4,5-dimethyltiazol2-yl]-2.5-diphenyl-tetrazolium bromide (MTT) assay and cellular morphological analysis. The results showed that, upon increasing the concentration of ICA-Cu, an increase was observed in growth-inhibitory activity and the inhibition percentage were greater than 90% at 20 µM in both cell

  20. Complex structure of the DNA-binding domain of AdpA, the global transcription factor in Streptomyces griseus, and a target duplex DNA reveals the structural basis of its tolerant DNA sequence specificity.

    Science.gov (United States)

    Yao, Ming Dong; Ohtsuka, Jun; Nagata, Koji; Miyazono, Ken-Ichi; Zhi, Yuehua; Ohnishi, Yasuo; Tanokura, Masaru

    2013-10-25

    AdpA serves as the global transcription factor in the A-factor regulatory cascade, controlling the secondary metabolism and morphological differentiation of the filamentous bacterium Streptomyces griseus. AdpA binds to over 500 operator regions with the consensus sequence 5'-TGGCSNGWWY-3' (where S is G or C, W is A or T, Y is T or C, and N is any nucleotide). However, it is still obscure how AdpA can control hundreds of genes. To elucidate the structural basis of this tolerant DNA recognition by AdpA, we focused on the interaction between the DNA-binding domain of AdpA (AdpA-DBD), which consists of two helix-turn-helix motifs, and a target duplex DNA containing the consensus sequence 5'-TGGCGGGTTC-3'. The crystal structure of the AdpA-DBD-DNA complex and the mutant analysis of AdpA-DBD revealed its unique manner of DNA recognition, whereby only two arginine residues directly recognize the consensus sequence, explaining the strict recognition of G and C at positions 2 and 4, respectively, and the tolerant recognition of other positions of the consensus sequence. AdpA-DBD confers tolerant DNA sequence specificity to AdpA, allowing it to control hundreds of genes as a global transcription factor.

  1. Usf1, a suppressor of the circadian Clock mutant, reveals the nature of the DNA-binding of the CLOCK:BMAL1 complex in mice

    Science.gov (United States)

    Shimomura, Kazuhiro; Kumar, Vivek; Koike, Nobuya; Kim, Tae-Kyung; Chong, Jason; Buhr, Ethan D; Whiteley, Andrew R; Low, Sharon S; Omura, Chiaki; Fenner, Deborah; Owens, Joseph R; Richards, Marc; Yoo, Seung-Hee; Hong, Hee-Kyung; Vitaterna, Martha H; Bass, Joseph; Pletcher, Mathew T; Wiltshire, Tim; Hogenesch, John; Lowrey, Phillip L; Takahashi, Joseph S

    2013-01-01

    Genetic and molecular approaches have been critical for elucidating the mechanism of the mammalian circadian clock. Here, we demonstrate that the ClockΔ19 mutant behavioral phenotype is significantly modified by mouse strain genetic background. We map a suppressor of the ClockΔ19 mutation to a ∼900 kb interval on mouse chromosome 1 and identify the transcription factor, Usf1, as the responsible gene. A SNP in the promoter of Usf1 causes elevation of its transcript and protein in strains that suppress the Clock mutant phenotype. USF1 competes with the CLOCK:BMAL1 complex for binding to E-box sites in target genes. Saturation binding experiments demonstrate reduced affinity of the CLOCKΔ19:BMAL1 complex for E-box sites, thereby permitting increased USF1 occupancy on a genome-wide basis. We propose that USF1 is an important modulator of molecular and behavioral circadian rhythms in mammals. DOI: http://dx.doi.org/10.7554/eLife.00426.001 PMID:23580255

  2. DNA binding, cytotoxicity and apoptosis induction activity of a mixed-ligand copper(II) complex with taurine Schiff base and imidazole

    Science.gov (United States)

    Li, Mei; kong, Lin Lin; Gou, Yi; Yang, Feng; Liang, Hong

    2014-07-01

    A novel binuclear copper(II) complex (complex 1) with taurine Schiff base and imidazole has been synthesized and structurally characterized by single crystal X-ray diffraction, elemental analysis, ESI-MS spectrometry, UV-vis and IR spectroscopy. Single-crystal analysis revealed that 1 displays the sulfonate-bridged dinuclear copper(II) centers. Both copper atoms are five-coordinated and exhibit slightly distorted square pyramidal geometries. Each of copper atom is surrounded by three oxygen atoms and one nitrogen atom from different taurine Schiff base ligands, and one nitrogen atom from one imidazole ligand. The interaction between 1 and calf thymus DNA (CT-DNA) was investigated by UV-vis, fluorescence, circular dichroism (CD) spectra and agarose gel electrophoresis. The experimental results indicated that 1 could bind to CT-DNA via an intercalative mode and show efficient cleavage activity. In addition, 1 showed an antitumor effect on cell cycle and apoptosis. Flow cytometric analysis revealed that MGC-803 cells were arrested in the S phase after treatment with 1. Fluorescence microscopic observation indicated that 1 could induce apoptosis of MGC-803 cells.

  3. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    s12039-016-1125-x. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity of lanthanide(III) complexes of 2-benzoylpyridine acetylhydrazone. KARREDDULA RAJA, AKKILI SUSEELAMMA and KATREDDI HUSSAIN REDDY. ∗.

  4. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  5. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  6. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino......-terminal DNA binding domain, is capable of Rad51 delivery to DNA but is deficient in DNA annealing. Results from chromatin immunoprecipitation experiments find that rad52-R70A associates with DNA double-strand breaks and promotes recruitment of Rad51 as efficiently as wild-type Rad52. Analysis of gene...... conversion intermediates reveals that rad52-R70A cells can mediate DNA strand invasion but are unable to complete the recombination event. These results provide evidence that DNA binding by the evolutionarily conserved amino terminus of Rad52 is needed for the capture of the second DNA end during homologous...

  7. Agrobacterium tumefaciens VirC2 enhances T-DNA transfer and virulence through its C-terminal ribbon-helix-helix DNA-binding fold.

    Science.gov (United States)

    Lu, Jun; den Dulk-Ras, Amke; Hooykaas, Paul J J; Glover, J N Mark

    2009-06-16

    Agrobacterium tumefaciens VirC2 stimulates processing of single-stranded T-DNA that is translocated into plants to induce tumor formation, but how VirC2 functions is unclear. Here, we report the 1.7-A X-ray crystal structure of its trypsin-resistant C-terminal domain, VirC2(82-202), which reveals a form of the ribbon-helix-helix (RHH) DNA-binding fold contained within a single polypeptide chain. DNA-binding assays and mutagenesis indicate that VirC2 uses this RHH fold to bind double-stranded DNA but not single-stranded DNA. Mutations that severely affect VirC2 DNA binding are highly deleterious for both T-DNA transfer into yeast and the virulence of A. tumefaciens in different plants including Nicotiana glauca and Kalanchoe daigremontiana. These data suggest that VirC2 enhances T-DNA transfer and virulence through DNA binding with its RHH fold. The RHH fold of VirC2 is the first crystal structure representing a group of predicted RHH proteins that facilitate endonucleolytic processing of DNA for horizontal gene transfer.

  8. Agrobacterium tumefaciens VirC2 enhances T-DNA transfer and virulence through its C-terminal ribbon–helix–helix DNA-binding fold

    Science.gov (United States)

    Lu, Jun; den Dulk-Ras, Amke; Hooykaas, Paul J. J.; Glover, J. N. Mark

    2009-01-01

    Agrobacterium tumefaciens VirC2 stimulates processing of single-stranded T-DNA that is translocated into plants to induce tumor formation, but how VirC2 functions is unclear. Here, we report the 1.7-Å X-ray crystal structure of its trypsin-resistant C-terminal domain, VirC282–202, which reveals a form of the ribbon-helix-helix (RHH) DNA-binding fold contained within a single polypeptide chain. DNA-binding assays and mutagenesis indicate that VirC2 uses this RHH fold to bind double-stranded DNA but not single-stranded DNA. Mutations that severely affect VirC2 DNA binding are highly deleterious for both T-DNA transfer into yeast and the virulence of A. tumefaciens in different plants including Nicotiana glauca and Kalanchoe daigremontiana. These data suggest that VirC2 enhances T-DNA transfer and virulence through DNA binding with its RHH fold. The RHH fold of VirC2 is the first crystal structure representing a group of predicted RHH proteins that facilitate endonucleolytic processing of DNA for horizontal gene transfer. PMID:19482939

  9. Werner helicase wings DNA binding

    OpenAIRE

    Hoadley, Kelly A.; Keck, James L.

    2010-01-01

    In this issue of Structure, Kitano et al. describe the structure of the DNA-bound winged-helix domain from the Werner helicase. This structure of a RecQ/DNA complex offers insights into the DNA unwinding mechanisms of RecQ family helicases.

  10. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  11. Microwave-assisted synthesis of mixed ligands organotin(IV) complexes of 1,10-phenanthroline and l-proline: Physicochemical characterization, DFT calculations, chemotherapeutic potential validation by in vitro DNA binding and nuclease activity.

    Science.gov (United States)

    Nath, Mala; Mridula; Kumari, Ranjana

    2017-09-01

    Diorganotin(IV) and triphenyltin(IV) derivatives of L-proline (HPro) having general formula R 2 Sn(Pro) 2 (R=n-Bu (1), Ph (2)) and Ph 3 Sn(Pro) (3), respectively, and the mixed ligands di-/triorganotin(IV) derivatives of L-proline and 1,10-phenanthroline (phen) with general formula [R 2 Sn(Pro)(Phen)Cl] and [R 3 Sn(Pro)(Phen)] (where R=Me (4 and 7), n-Bu (5 and 8), Ph (6 and 9)), respectively, have been synthesized by microwave-assisted method and characterized by elemental analysis, IR, NMR ( 1 H, 13 C and 119 Sn) and DART-mass spectral studies. The results suggest bicapped tetrahedron or a skew trapezoidal-bipyramid geometry for R 2 Sn(Pro) 2 , a distorted tetrahedral geometry for Ph 3 Sn(Pro) and a distorted octahedral geometry for [R 2 Sn(Pro)(Phen)Cl] and [Ph 3 Sn(Pro)(Phen)] around the Sn atom, and the same has been validated by density functional theory calculations (DFT). In vitro DNA binding studies of 1-9 have been investigated by UV-Vis, fluorescence and circular dichroism titrations, viscosity and DNA melting experiments. The observed hypochromic shift in UV-Vis and fluorescence studies evidenced a partial intercalative mode of binding of complexes to CT-DNA. The binding affinity and quenching ability have been quantified in terms of intrinsic binding constant (K b ) and Stern-Volmer quenching constant (Ksv). The determined values suggest that di- and triorganotin(IV) derivatives of L-proline possess lesser affinity to bind with CT-DNA in comparison to the mixed ligands di-/triorganotin(IV) derivatives of L-proline and 1,10-phenanthroline. The partial intercalative mode of binding of these complexes with CT DNA has also been supported by a change in the viscosity and melting point of DNA as well as a change in the intensity of positive and negative bands in circular dichroism spectra. The cleavage studies by agarose gel electrophoresis indicate effective cleavage of supercoiled plasmid DNA into its nicked form by all the complexes and even to its linear

  12. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  13. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  14. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    Science.gov (United States)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

  15. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Directory of Open Access Journals (Sweden)

    Yu-Ming Chang

    Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  16. A constitutive damage specific DNA-binding protein is synthesized at higher levels in UV-irradiated primate cells

    International Nuclear Information System (INIS)

    Hirschfeld, S.; Levine, A.S.; Ozato, K.; Protic, M.

    1990-01-01

    Using a DNA band shift assay, we have identified a DNA-binding protein complex in primate cells which is present constitutively and has a high affinity for UV-irradiated, double-stranded DNA. Cells pretreated with UV light, mitomycin C, or aphidicolin have higher levels of this damage-specific DNA-binding protein complex, suggesting that the signal for induction can either be damage to the DNA or interference with cellular DNA replication. Physiochemical modifications of the DNA and competition analysis with defined substrates suggest that the most probable target site for the damage-specific DNA-binding protein complex is a 6-4'-(pyrimidine-2'-one)-pyrimidine dimer: specific binding could not be detected with probes which contain -TT- cyclobutane dimers, and damage-specific DNA binding did not decrease after photoreactivation of UV-irradiated DNA. This damage-specific DNA-binding protein complex is the first such inducible protein complex identified in primate cells. Cells from patients with the sun-sensitive cancer-prone disease, xeroderma pigmentosum (group E), are lacking both the constitutive and the induced damage-specific DNA-binding activities. These findings suggest a possible role for this DNA-binding protein complex in lesion recognition and DNA repair of UV-light-induced photoproducts

  17. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  18. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  19. DNA binding properties of the small cascade subunit Csa5.

    Directory of Open Access Journals (Sweden)

    Michael Daume

    Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.

  20. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    Science.gov (United States)

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  2. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  3. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.

    2017-01-01

    Roč. 148, č. 11 (2017), s. 2011- 2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  4. Biochemical studies on the DNA binding function of the cyclic-amp reactor protein of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Angulo, J.A.

    1986-01-01

    The cAMP receptor protein (CRP) is an allosteric protein in which binding of cAMP effects a conformational change with a consequent increased affinity for DNA. Binding of double-stranded deoxyribopolynucleotides and calf thymus DNA by cAMP-CRP confers protection against attack by trypsin, subtilisin, Staph. aureus V8 protease and clostripain. Of the single-stranded deoxy- and ribopolynucleotides tested, only r(I)/sub n/ and r(A)/sub n/ gave significant protection against attack by these proteases. In the absence of cAMP, CRP is resistant to proteolysis. Incubation of CRP-DNA with trypsin results in the accumulation of two novel fragments. CRP-DNA is partially sensitive to digestion by chymotrypsin but resistant to attack by subtilisin, the Staph. aureus V8 protease and clostripain. Cleavage of CRP-DNA to fragments is accompanied by the loss of /sup 3/H-cAMP binding activity. Modification of the arginines with phenylglyoxal or butanedione results in loss of DNA binding activity. cAMP-CRP incorporates more /sup 14/C-phenylglyoxal than unliganded CRP. Titration of the arginines with /sup 14/C-phenylglyoxal to where over 90% of the DNA binding activity is lost results in incorporation of one mole of reagent per mole of subunit.

  5. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  6. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  7. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  8. Plasticity of BRCA2 function in homologous recombination: genetic interactions of the PALB2 and DNA binding domains.

    Directory of Open Access Journals (Sweden)

    Nicolas Siaud

    2011-12-01

    Full Text Available The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR. Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations.

  9. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  10. Identification and characterization of the DNA-binding domain of the multifunctional PutA flavoenzyme.

    Science.gov (United States)

    Gu, Dan; Zhou, Yuzhen; Kallhoff, Verena; Baban, Berevan; Tanner, John J; Becker, Donald F

    2004-07-23

    The PutA flavoprotein from Escherichia coli is a transcriptional repressor and a bifunctional enzyme that regulates and catalyzes proline oxidation. PutA represses transcription of genes putA and putP by binding to the control DNA region of the put regulon. The objective of this study is to define and characterize the DNA binding domain of PutA. The DNA binding activity of PutA, a 1320 amino acid polypeptide, has been localized to N-terminal residues 1-261. After exploring a potential DNA-binding region and an N-terminal deletion mutant of PutA, residues 1-90 (PutA90) were determined to contain DNA binding activity and stabilize the dimeric structure of PutA. Cell-based transcriptional assays demonstrate that PutA90 functions as a transcriptional repressor in vivo. The dissociation constant of PutA90 with the put control DNA was estimated to be 110 nm, which is slightly higher than that of the PutA-DNA complex (K(d) approximately 45 nm). Primary and secondary structure analysis of PutA90 suggested the presence of a ribbon-helix-helix DNA binding motif in residues 1-47. To test this prediction, we purified and characterized PutA47. PutA47 is shown to purify as an apparent dimer, to exhibit in vivo transcriptional activity, and to bind specifically to the put control DNA. In gel-mobility shift assays, PutA47 was observed to bind cooperatively to the put control DNA with an overall dissociation constant of 15 nm for the PutA47-DNA complex. Thus, N-terminal residues 1-47 are critical for DNA-binding and the dimeric structure of PutA. These results are consistent with the ribbon-helix-helix family of transcription factors.

  11. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  12. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Interaction of zinc and cobalt with dipeptides and their DNA binding ...

    Indian Academy of Sciences (India)

    Unknown

    , characterization and solu- tion studies of complexes mimicking the zinc core in zinc fingers and establishing the DNA binding.14–18. As part of our efforts to create a simple small mole- cule model and its ability to recognize DNA, the in-.

  14. DNA binding and cleavage activity of a structurally characterized Ni(II)

    Indian Academy of Sciences (India)

    1375–1381. c Indian Academy of Sciences. DOI 10.1007/s12039-015-0900-4. DNA binding and cleavage activity of a structurally characterized Ni(II). Schiff base complex. SARAT CHANDRA KUMARa, ABHIJIT PALa, MERRY MITRAa,. V M MANIKANDAMATHAVANb, CHIA -HER LINc, BALACHANDRAN UNNI NAIRb,∗.

  15. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Synthesis of new piperazine derived Cu(II)/Zn(II) metal complexes, their DNA binding studies, electrochemistry and anti-microbial activity: Validation for specific recognition of Zn(II) complex to DNA helix by interaction with thymine base

    Science.gov (United States)

    Bhat, Irshad-ul-Haq; Tabassum, Sartaj

    2009-06-01

    New 3,4:9,10-dibenzo-2,11-dihydroxy-1,12-bispiperazine-5,8-dioxododecane complexes [C 24H 36N 4O 6Cu] ( 1), [C 24H 32N 4O 4Zn] ( 2) have been synthesized and characterized by elemental analysis, IR, NMR, Mass, EPR, UV-vis spectroscopy and molar conductance measurements. The complexes are non-ionic in nature and possess octahedral geometry around Cu 2+, Zn 2+ central metal ions. The binding studies of 1 and 2 with calf thymus DNA (CT-DNA) were investigated by UV-vis, fluorescence, cyclic voltammetery and viscosity measurements. The calculated binding constant Kb for 1 and 2 obtained from UV-vis absorption studies was 7.6 × 10 3 M -1, 80.8 × 10 4 M -1, respectively. The intrinsic binding constants were also estimated to be 7.0 × 10 4 M -1 and 7.53 × 10 5 M -1 for 1 and 2, respectively by using emission titrations. These experimental results suggest that complexes are groove binders and interact to CT-DNA with different affinities. Both the complexes in presence and absence of CT-DNA show quasireversible wave corresponding to Cu II/Cu I and Zn II/Zn I redox couple. The changes in E1/2, Δ E, Ipa/ Ipc ascertain the interaction of 1 and 2 with CT-DNA. Further, decrease in viscosity of CT-DNA with increasing concentration of complexes was observed. In vitro, antimicrobial activity against fungi A. brassicicola, A. niger and bacteria E. coli, P. aeruginosa of complexes were carried out, which indicate that complex 2 is more active against both fungal and bacterial strains as shown by % inhibition data.

  17. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  18. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  19. Synthesis, crystal structure, DNA binding and molecular docking studies of zinc(II) carboxylates

    Science.gov (United States)

    Muhammad, Niaz; Ikram, Muhammad; Wadood, Abdul; Rehman, Sadia; Shujah, Shaukat; Erum; Ghufran, Mehreen; Rahim, Shahnaz; Shah, Muzamil; Schulzke, Carola

    2018-02-01

    New zinc(II) carboxylate complexes [Zn(3-F-C6H4CH2COO)2]n (1), [Zn3(3-F-C6H4CH2COO)6(Phen)2] (2) and [Zn3(3-F-C6H4CH2COO)6(bipy)2] (3) were synthesized and characterized by atomic absorption, single crystal structural analysis and IR studies. Complex 1 crystallizes as a coordination polymer constituting a web of μ - η1,η1 carboxylate bridged tetrahedral zinc centers. Complexes 2 and 3 comprise trinuclear zinc centers with two terminal fivefold coordinated slightly distorted square-pyramidal and central sixfold coordinated octahedral zinc centers. The complexes were also assessed for their DNA binding ability by UV/- Vis spectroscopy and their behavior rationalized theoretically by molecular docking studies. A DNA binding study has shown groove binding interactions with the complexes.

  20. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    Science.gov (United States)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  1. Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Kylie L. Gorringe

    2008-11-01

    Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.

  2. Synthesis and enantiopreferential DNA-binding profile of late 3d transition metal R- and S-enantiomeric complexes derived from N,N-bis-(1-benzyl-2-ethoxyethane): Validation of R-enantiomer of copper(II) complex as a human topoisomerase II inhibitor.

    Science.gov (United States)

    Arjmand, Farukh; Sharma, Girish Chandra; Muddassir, Mohd; Tabassum, Sartaj

    2011-08-01

    To evaluate the biological preference of chiral drug candidates for molecular target DNA, new potential metal-based chemotherapeutic agents 1-3 (a and b) of late 3d transition metals Ni(II), Cu(II), and Zn(II), respectively, derived from (R)- and (S)-2-amino-2-phenylethanol with CH(2) CH(2)  linker were synthesized and thoroughly characterized. Interaction studies of 1-3 (a and b) with calf thymus DNA in Tris buffer were studied by electronic absorption titrations, luminescence titrations, cyclic voltammetry, and circular dichroism. The results reveal that the extent of DNA binding of R-enantiomer of copper 1a was highest in comparison to rest of the complexes via electrostatic interaction mode. The nuclease activity of 1(a and b) with supercoiled pBR322 DNA was further examined by gel electrophoresis, which reveals that complex 1a exhibits a remarkable DNA cleavage activity (concentration dependent) with pBR322DNA, and the cleavage activity of both enantiomers of complex 1 was significantly enhanced in the presence of activators. The activating efficiency follows the order Asc > H(2) O(2) > MPA for 1a, and reverse order was observed for 1b, because of the differences in enantioselectivity and conformation. Further, it was observed that cleavage reaction involves singlet oxygen species and superoxide radicals via oxidative cleavage mechanism. In addition, complex 1a exhibits significant inhibitory effects on the topoisomerase II (topo II) activity at a very low concentration ∼24 μM, which suggest that complex 1a is indeed catalytic inhibitor or (poison) of human topo II. Copyright © 2011 Wiley-Liss, Inc.

  3. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  4. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  5. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  6. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  7. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  8. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  9. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  10. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  11. Characterization of the RstB2 protein, the DNA-binding protein of CTXϕ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Marrero, Karen; Trigueros, Sonia; Fando, Rafael

    2014-06-01

    The low abundant protein RstB2, encoded in the RS2 region of CTXϕ, is essential for prophage formation. However, the only biochemical activity so far described is the single/double-stranded DNA-binding capacity of that protein. In this paper, a recombinant RstB2 (rRstB2) protein was overexpressed in E. coli with a yield of 58.4 mg l(-1) in shaken cultures, LB broth. The protein, purified to homogeneity, showed an identity with rRstB2 by peptide mass fingerprinting. The apparent molecular weight of the RstB2 native protein suggests that occurs mostly as a monomer in solution. The monomers were able of reacting immediately upon exposure to DNA molecules. After a year of storage at -20 °C, the protein remains biologically active. Bioinformatics analysis of the amino acid sequence of RstB2 predicts the C-end of this protein to be disordered and highly flexible, like in many other single-stranded DNA-binding proteins. When compared with the gVp of M13, conserved amino acids are found at structurally or functionally important relative positions. These results pave the way for additional studies of structure and molecular function of RstB2 for the biology of CTXϕ.

  12. Context influences on TALE–DNA binding revealed by quantitative profiling

    Science.gov (United States)

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  13. Context influences on TALE-DNA binding revealed by quantitative profiling.

    Science.gov (United States)

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  14. Antigenic and structural conservation of herpesvirus DNA-binding proteins.

    Science.gov (United States)

    Littler, E; Yeo, J; Killington, R A; Purifoy, D J; Powell, K L

    1981-10-01

    Previously, we have shown a common antigen of several herpesviruses (pseudorabies virus, equine abortion virus and bovine mammillitis virus) to be antigenically related to the major DNA-binding proteins of herpes simplex virus types 1 and 2. In this study we have purified the cross-reacting polypeptide from cells infected with pseudorabies virus, equine abortion virus and bovine mammillitis virus and shown the cross-reacting protein to be a major DNA-binding protein for each virus. Tryptic peptide analysis of the cross-reacting DNA-binding proteins of all five viruses has shown structural similarities. The proteins thus were shown to share common antigenic sites, to have similar biological properties and to have a highly conserved amino acid sequence. This unexpected similarity between proteins from diverse herpes viruses suggests an essential and fundamental role of the major DNA-binding protein in herpes virus replication.

  15. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E; Krogsdam, A M; Jorgensen, H F

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  16. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia

    2017-01-01

    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  17. Unexpected regiospecific formation and DNA binding of new 3 ...

    Indian Academy of Sciences (India)

    this stabilization for a double- to single-stranded form morphing of DNA is a rise of the transition tempera- ture, Tm. The experiment is accomplished by comparing. Tm of DNA in the solution without and with the inter- calator, whilst monitoring some property dependent on the DNA helical structure, e.g., UV absorbance.

  18. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  19. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  20. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  1. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  2. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  3. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  4. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  5. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  6. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  7. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  8. Synthesis and structural characterization of ternary Cu (II) complexes of glycine with 2,2'-bipyridine and 2,2'-dipyridylamine. The DNA-binding studies and biological activity.

    Science.gov (United States)

    Mohamed, Mervat S; Shoukry, Azza A; Ali, Ayat G

    2012-02-01

    In this study two new complexes [Cu(bpy)(Gly)Cl]·2H(2)O (1) and [Cu(dpa)(Gly)Cl]·2H(2)O (2) (bpy=2,2'-bipyridine; dpa=2,2'-dipyridylamine, Gly=glycine) have been synthesized and characterized by elemental analysis, IR, TGA, UV-vis and magnetic susceptibility measurements. The binding properties of the complexes with CT-DNA were investigated by electronic absorption spectra. The intrinsic binding constants (K(b)) calculated from UV-vis absorption studies were 1.84 × 10(3) M(-1) and 3.1 × 10(3) M(-1) for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated ΔT(m) was nearly 5 °C for each complex. All the results suggest that the interaction modes between the complexes and CT-DNA were electrostatic and/or groove binding. The redox behavior of the two complexes was investigated by cyclic voltammetry. Both complexes, in presence and absence of CT-DNA show a quasi-reversible wave corresponding to Cu(II)/Cu(I) redox couple. The change in E(1/2), ΔE and I(pc)/I(pa) ascertain the interaction of complexes 1 and 2 with CT-DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the mobility and intensity of DNA bands. In addition, the antitumor activity of the complexes was tested on two cancer cell lines; the breast cancer (MCF7) and the human hepatocellular carcinoma (HEPG2), as well as one normal cell line; the human normal melanocytes (HFB4). The results showed that complex 1 was more potent antitumor agent than complex 2. The in-vitro antimicrobial activity of the two complexes was carried out using the disc diffusion method against different species of pathogenic bacteria and fungi. The activity data showed that complex 2 was more active in inhibiting the growth of the tested organisms. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Synthesis and structural characterization of ternary Cu (II) complexes of glycine with 2,2'-bipyridine and 2,2'-dipyridylamine. The DNA-binding studies and biological activity

    Science.gov (United States)

    Mohamed, Mervat S.; Shoukry, Azza A.; Ali, Ayat G.

    2012-02-01

    In this study two new complexes [Cu(bpy)(Gly)Cl]·2H 2O ( 1) and [Cu(dpa)(Gly)Cl]·2H 2O ( 2) (bpy = 2,2'-bipyridine; dpa = 2,2'-dipyridylamine, Gly = glycine) have been synthesized and characterized by elemental analysis, IR, TGA, UV-vis and magnetic susceptibility measurements. The binding properties of the complexes with CT-DNA were investigated by electronic absorption spectra. The intrinsic binding constants ( Kb) calculated from UV-vis absorption studies were 1.84 × 10 3 M -1 and 3.1 × 10 3 M -1 for complexes 1 and 2 respectively. Thermal denaturation has been systematically studied by spectrophotometric method and the calculated Δ Tm was nearly 5 °C for each complex. All the results suggest that the interaction modes between the complexes and CT-DNA were electrostatic and/or groove binding. The redox behavior of the two complexes was investigated by cyclic voltammetry. Both complexes, in presence and absence of CT-DNA show a quasi-reversible wave corresponding to Cu II/Cu I redox couple. The change in E1/2, Δ E and Ipc/ Ipa ascertain the interaction of complexes 1 and 2 with CT-DNA. Further insight into the binding of complexes with CT-DNA has been made by gel electrophoresis, where the binding of complexes is confirmed through decreasing the mobility and intensity of DNA bands. In addition, the antitumor activity of the complexes was tested on two cancer cell lines; the breast cancer (MCF7) and the human hepatocellular carcinoma (HEPG2), as well as one normal cell line; the human normal melanocytes (HFB4). The results showed that complex 1 was more potent antitumor agent than complex 2. The in-vitro antimicrobial activity of the two complexes was carried out using the disc diffusion method against different species of pathogenic bacteria and fungi. The activity data showed that complex 2 was more active in inhibiting the growth of the tested organisms.

  10. Crystal structure, DNA binding, cleavage, antioxidant and antibacterial studies of Cu(II), Ni(II) and Co(III) complexes with 2-((furan-2-yl)methylimino)methyl)-6-ethoxyphenol Schiff base

    Science.gov (United States)

    Venkateswarlu, Kadtala; Kumar, Marri Pradeep; Rambabu, Aveli; Vamsikrishna, Narendrula; Daravath, Sreenu; Rangan, Krishnan; Shivaraj

    2018-05-01

    Three novel binary metal complexes; 1 [Cu(L)2], 2 [Ni(L)2] and 3 [Co(L)3] where, L (2-(((furan-2-yl) methylimino)methyl)-6-ethoxyphenol, C14H15NO3), were synthesized and characterized by various spectral techniques. Based on spectral studies square planar geometry is assigned for Cu(II) and Ni(II) complexes, whereas Co(III) owned octahedral geometry. Ligand, [Cu(L)2] and [Ni(L)2] are crystallized and found to be monoclinic crystal systems. CT-DNA absorption binding studies revealed that the complexes show good binding propensity (Kb = 5.02 × 103 M-1, 2.77 × 103 M-1, 1.63 × 104 M-1 for 1, 2 and 3 respectively). The role of these complexes in the oxidative and photolytic cleavage of supercoiled pBR322 DNA was studied and found that the complexes cleave the pBR322 DNA effectively. The catalytic ability of 1, 2 and 3 follows the order: 3 > 1 >2. Antioxidant studies of the new complexes revealed that they exhibit significant antioxidant activity against DPPH radical. The Schiff base and its metal complexes have been screened for antibacterial studies by Minimum Inhibitory Concentration method. It is observed that all metal complexes showed more activity than free ligand.

  11. NMR characterization of the DNA binding properties of a novel Hoechst 33258 analogue peptide building block

    DEFF Research Database (Denmark)

    Bunkenborg, Jakob; Behrens, Carsten; Jacobsen, Jens Peter

    2002-01-01

    A novel aryl-bis-benzimidazole amino acid analogue of the DNA-binding compound Hoechst 33258 has recently been designed for incorporation in peptide combinatorial libraries by replacing the N-methylpiperazine group with a carboxyl group and the hydroxy group with an amino-methyl group. The DNA......-binding properties of the aryl-bis-benzimidazole monomer with the C-terminus derivatized with 3-(dimethylamino)-propylamine has been investigated in this paper by (1)H NMR studies of two different complexes with two different DNA sequences: A(5) d(5'-GCCA(5)CG-3'):d(5'-CGT(5)GGC-3') and A(3)T(3) d(5'-CGA(3)T(3)CG-3...

  12. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  13. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  14. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Ruoxi [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Wang, Dang; Cai, Kaimei; Zhang, Huan [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China); Xie, Lilan; Li, Yi [College of Life Science and Technology, Wuhan Institute of Bioengineering, Wuhan 430415 (China); Chen, Huanchun; Xiao, Shaobo [State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070 (China)

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.

  15. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    International Nuclear Information System (INIS)

    Zhang, Ruoxi; Fang, Liurong; Wang, Dang; Cai, Kaimei; Zhang, Huan; Xie, Lilan; Li, Yi; Chen, Huanchun; Xiao, Shaobo

    2015-01-01

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9). Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.

  16. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  17. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  18. DNA binding and photocleavage properties and apoptosis-inducing activities of a ruthenium porphyrin complex [(Py-3')TPP-Ru(phen)2Cl]Cl and its heterometallic derivatives.

    Science.gov (United States)

    Liu, Yanan; Chen, Tianfeng; Wong, Yum-Shing; Mei, Wen-Jie; Huang, Xiao-Mei; Yang, Fang; Liu, Jie; Zheng, Wen-Jie

    2010-02-12

    The interactions of a ruthenium porphyrin complex [(Py-3')TPP-Ru(phen)(2)Cl]Cl (phen=1,10-phenanthroline, (Py-3')TPP=5-(3'-pyridyl-10,15,20-triphenylporphyrin) (1) and its heterometallic derivatives, [Ni(Py-3')TPP-Ru(phen)(2)Cl][PF(6)] (2) and [Cu(Py-3')TPP-Ru(phen)(2)Cl][PF(6)] (3), with calf thymus DNA have been investigated by spectroscopic and viscosity measurements in this study. The results showed that these synthetic complexes can bind to double strand helix DNA in groove binding mode, and the intrinsic binding constants of complexes 1, 2 and 3, as calculated according to the decay of the Soret absorption, are (1.35+/-0.5) x10(5)M(-1) (s=4.2), (1.29+/-0.5)x10(5)M(-1) (s=5.6) and (1.22+/-0.5)x10(5)M(-1) (s=6.2) (s is the binding-site size), respectively, which are consistent with those obtained from ethidium bromide-quenching experiments. Further investigations on the photocleavage properties of these complexes on plasmid pBR 322 DNA showed that complexes 1, 2 and 3 could cleave single chain DNA and convert DNA molecules from supercoiled form to the nicked form. As determined by MTT assay, the complexes were also identified as potent antiproliferative agents against A375 human melanoma cells, MCF-7 human breast adrenocarcinoma cells, Colo201 human colon adenocarcinoma cells and HepG2 human liver cancer cells. Complex 1 inhibits the growth of A375 cells through induction of apoptotic cell death and G0/G1 cell cycle arrest. Further investigation on intracellular mechanisms indicated that Complex 1 induced depletion of mitochondrial membrane potential (DeltaPsi(m)) in A375 cells through regulating the expression of pro-survival and pro-apoptotic Bcl-2 family members. Our results suggest that ruthenium porphyrin complexes could be candidates for further evaluation as chemopreventive and chemotherapeutic agents for human cancers. Copyright (c) 2009 Elsevier Ireland Ltd. All rights reserved.

  19. Synthesis, spectroscopic, thermal and molecular modeling studies of Zn2+, Cd2+and UO22+complexes of Schiff bases containing triazole moiety. Antimicrobial, anticancer, antioxidant and DNA binding studies.

    Science.gov (United States)

    Gaber, Mohamed; El-Ghamry, Hoda A; Fathalla, Shaimaa K; Mansour, Mohammed A

    2018-02-01

    A novel series of Zn 2+ , Cd 2+ and UO 2 2+ complexes of ligands namely 1-[(5-mercapto-1H-1,2,4-triazole-3-ylimino) methyl]naphthalene-2-ol (HL 1 ) and [(1H-1,2,4-triazole-3-ylimino) methyl] naphthalene-2-ol (HL 2 ) have been prepared and characterized by different analytical and spectral techniques. The stoichiometry, stereochemistry, conductivity measurements and mode of bonding of the complexes have been elucidated. Accurate comparison of the IR spectra of the ligands with their metal chelates proved the involvement of nitrogen atoms of the azomethine group and/or triazole ring in chelation in addition to the deprotonated hydroxyl oxygen. The UV-Vis and molar conductance data supported the octahedral geometry for the metal complexes. TGA technique has been used to study the thermal decomposition way of the metal complexes and the thermo kinetic parameters were estimated. Valuable information is obtained from calculations of molecular parameters using the molecular modeling techniques. The interaction between the metal complexes and CT-DNA has been studied from which the binding constants (k b ) were calculated. The Schiff bases and their metal chelates have shown potent antimicrobial, antioxidant and antitumor activities. The antitumor activities of the compounds have been tested in vitro against HEPG2 cell line and in silico by the molecular docking analysis with the VEGFR-2 receptor responsible for angiogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Mechanisms of DNA binding and regulation of Bacillus anthracis DNA primase.

    Science.gov (United States)

    Biswas, Subhasis B; Wydra, Eric; Biswas, Esther E

    2009-08-11

    DNA primases are pivotal enzymes in chromosomal DNA replication in all organisms. In this article, we report unique mechanistic characteristics of recombinant DNA primase from Bacillus anthracis. The mechanism of action of B. anthracis DNA primase (DnaG(BA)) may be described in several distinct steps as follows. Its mechanism of action is initiated when it binds to single-stranded DNA (ssDNA) in the form of a trimer. Although DnaG(BA) binds to different DNA sequences with moderate affinity (as expected of a mobile DNA binding protein), we found that DnaG(BA) bound to the origin of bacteriophage G4 (G4ori) with approximately 8-fold higher affinity. DnaG(BA) was strongly stimulated (>or=75-fold) by its cognate helicase, DnaB(BA), during RNA primer synthesis. With the G4ori ssDNA template, DnaG(BA) formed short (primers in the absence of DnaB(BA). The presence of DnaB(BA) increased the rate of primer synthesis. The observed stimulation of primer synthesis by cognate DnaB(BA) is thus indicative of a positive effector role for DnaB(BA). By contrast, Escherichia coli DnaB helicase (DnaB(EC)) did not stimulate DnaG(BA) and inhibited primer synthesis to near completion. This observed effect of E. coli DnaB(EC) is indicative of a strong negative effector role for heterologous DnaB(EC). We conclude that DnaG(BA) is capable of interacting with DnaB proteins from both B. anthracis and E. coli; however, between DnaB proteins derived from these two organisms, only the homologous DNA helicase (DnaB(BA)) acted as a positive effector of primer synthesis.

  1. Effects of copper ions on DNA binding and cytotoxic activity of a chiral salicylidene Schiff base.

    Science.gov (United States)

    Fei, Bao-Li; Xu, Wu-Shuang; Tao, Hui-Wen; Li, Wen; Zhang, Yu; Long, Jian-Ying; Liu, Qing-Bo; Xia, Bing; Sun, Wei-Yin

    2014-03-05

    A chiral Schiff base HL N-(5-bromo-salicylaldehyde)dehydroabietylamine (1) and its chiral dinuclear copper complex [Cu2L4]·4DMF (2) have been synthesized and fully characterized. The interactions of 1 and 2 with salmon sperm DNA have been investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral (Kb=3.30 × 10(5)M(-)(1) (1), 6.63 × 10(5)M(-)(1)(2)), emission spectral (Ksv=7.58 × 10(3)M(-)(1) (1), 1.52 × 10(4)M(-)(1) (2)), and viscosity measurements reveal that 1 and 2 interact with DNA through intercalation and 2 exhibits a higher DNA binding ability. In addition, CD study indicates 2 cause a more evident perturbation on the base stacking and helicity of B-DNA upon binding to it. In fluorimetric studies, the enthalpy (ΔH>0) and entropy (ΔS>0) changes of the reactions between the compounds with DNA demonstrate hydrophobic interactions. 1 and 2 were also screened for their cytotoxic ability and 2 demonstrates higher growth inhibition of the selected cancer cells at concentration of 50 μM, this result is identical with their DNA binding ability order. All the experimental results show that the involvement of Cu (II) centers has some interesting effect on DNA binding ability and cytotoxicity of the chiral Schiff base. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Synthesis, Crystal Structure and in vitro DNA Binding Studies of Combretastatin A-4 Analogue

    Directory of Open Access Journals (Sweden)

    Masood Ahmad Rizvi

    2015-12-01

    Full Text Available Synthesis of a novel Combretastatin A-4 analogue using Schiff’s reaction of benzil and 4-aminoantipyrine has been achieved under solvent free conditions. The structure of compound was examined spectroscopically and confirmed from single crystal diffraction studies. The synthesized Combretastatin A-4 analogue was investigated for its DNA binding ability as the plausible mechanism for its antitumor activity. The binding propensity of the synthesized compound with calf-thymus (CT DNA was monitored with absorption and emission spectrophotometric titrations. The calculations predict a binding constant of 7.24×104 for the complex of the synthesized compound with CT DNA which is comparable in magnitude to that of DNA binding of bactericidal drug enoxacin and typical intercalation indicator ethidium bromide (EB. Competitive binding studies of the synthesized compound with EB using fluorescence titration reveal that it displaces the DNA-bound EB and binds in intercalative mode which was further supported by circular dichroism (CD spectroscopy. The probable site and binding energy of the compound with DNA was further theoretically investigated by molecular docking studies. The significant DNA binding ability of the synthesized Combretastatin A4 analogue as revealed from this study could be related to the anticancer activity of the Combretastatin A4.

  3. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  4. Cytotoxic platinum coordination compounds. DNA binding agents

    Czech Academy of Sciences Publication Activity Database

    Brabec, Viktor; Hrabina, O.; Kašpárková, Jana

    2017-01-01

    Roč. 351, č. 2017 (2017), s. 2-31 ISSN 0010-8545 R&D Projects: GA ČR GA17-09436S Institutional support: RVO:68081707 Keywords : interstrand cross-links * nucleotide excision-repair * pt-ii complex Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 13.324, year: 2016

  5. DNA-Binding Study of Tetraaqua-bis(p-nitrobenzoatocobalt(II Dihydrate Complex: [Co(H2O4(p-NO2C6H4COO2]·2H2O

    Directory of Open Access Journals (Sweden)

    Hacali Necefoglu

    2007-06-01

    Full Text Available The interaction of [Co(H2O4(p-NO2C6H4COO2]. 2H2O with sheep genomicDNA has been investigated by spectroscopic studies and electrophoresis measurements.The interaction between cobalt(II p-nitrobenzoate and DNA has been followed by gelelectrophoresis while the concentration of the complex was increased from 0 to 14 mM.The spectroscopic study and electrophoretic experiments support the fact that the complexbinds to DNA by intercalation via p-nitrobenzoate into the base pairs of DNA. Themobility of the bands decreased as the concentration of complex was increased, indicatingthat there was increase in interaction between the metal ion and DNA.

  6. DNA binding mode of the cis and trans geometries of new antitumor nonclassical platinum complexes containing piperidine, piperazine or 4-picoline ligand in cell-free media. Relations to their activity in cancer cell lines

    Czech Academy of Sciences Publication Activity Database

    Kašpárková, Jana; Marini, Victoria; Najajreh, Y.; Gibson, D.; Brabec, Viktor

    2003-01-01

    Roč. 42, č. 20 (2003), s. 6321-6332 ISSN 0006-2960 R&D Projects: GA AV ČR IAA5004101; GA AV ČR KJB5004301; GA ČR GA305/01/0418 Institutional research plan: CEZ:AV0Z5004920 Keywords : cross links * DNA * nonclassical platinum complexes Subject RIV: BO - Biophysics Impact factor: 3.922, year: 2003

  7. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  8. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  9. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  10. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  11. Structural, vibrational, NMR, quantum chemical, DNA binding and ...

    Indian Academy of Sciences (India)

    Structural, vibrational, NMR, quantum chemical, DNA binding and protein docking studies of two flexible imine oximes. YUNUS KAYAa,b. aDepartment of Chemistry, Faculty of Arts and Sciences, Uludag University, 16059 Bursa, Turkey. bDepartment of Chemistry, Faculty of Natural Sciences, Architecture, and Engineering, ...

  12. Synthesis, DNA binding and cytotoxic evaluation of aminoquinoline ...

    Indian Academy of Sciences (India)

    DNA binding studies of selected isomeric compounds showed interaction withDNA via intercalation mode with higher binding affinity of 4-substituted quinolines rather than 2-substituted counterparts. Further, all compounds were screened for cytotoxic activity against three human cancer cell lines,among them compound 2c ...

  13. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  14. A Ru(II) complex with 2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5- f][1,10]phenanthroline: Synthesis, characterization, and acid-base and DNA-binding properties

    Science.gov (United States)

    Gao, Jie; Wang, Zhi-Ping; Yuan, Cui-Li; Jia, Hai-Shun; Wang, Ke-Zhi

    2011-09-01

    A new Ru(II) complex of [Ru(bpy) 2(Hmspip)]Cl 2 {in which bpy = 2,2'-bipyridine, Hmspip = 2-(4-(methylsulfonyl)phenyl)-1 H-imidazo[4,5- f][1,10]phenanthroline} have been synthesized and characterized. The ground- and excited-state acid-base properties of [Ru(bpy) 2(Hmspip)]Cl 2 and its parent complex of [Ru(bpy) 2(Hpip)]Cl 2 {Hpip = 2-phenyl-1H-imidazo[4,5- f][1,10]phenanthroline} have been studied by UV-visible (UV-vis) and emission spectrophotometric pH titrations. [Ru(bpy) 2(Hmspip)]Cl 2 acts as a calf thymus DNA intercalators with a binding constant of 4.0 × 10 5 M -1 in buffered 50 mM NaCl, as evidenced by UV-vis and luminescence titrations, steady-state emission quenching by [Fe(CN) 6] 4-, DNA competitive binding with ethidium bromide, reverse salt titrations and viscosity measurements.

  15. NAD+ Modulates p53 DNA Binding Specificity and Function

    Science.gov (United States)

    McLure, Kevin G.; Takagi, Masatoshi; Kastan, Michael B.

    2004-01-01

    DNA damage induces p53 DNA binding activity, which affects tumorigenesis, tumor responses to therapies, and the toxicities of cancer therapies (B. Vogelstein, D. Lane, and A. J. Levine, Nature 408:307-310, 2000; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Both transcriptional and transcription-independent activities of p53 contribute to DNA damage-induced cell cycle arrest, apoptosis, and aneuploidy prevention (M. B. Kastan et al., Cell 71:587-597, 1992; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Small-molecule manipulation of p53 DNA binding activity has been an elusive goal, but here we show that NAD+ binds to p53 tetramers, induces a conformational change, and modulates p53 DNA binding specificity in vitro. Niacinamide (vitamin B3) increases the rate of intracellular NAD+ synthesis, alters radiation-induced p53 DNA binding specificity, and modulates activation of a subset of p53 transcriptional targets. These effects are likely due to a direct effect of NAD+ on p53, as a molecule structurally related to part of NAD+, TDP, also inhibits p53 DNA binding, and the TDP precursor, thiamine (vitamin B1), inhibits intracellular p53 activity. Niacinamide and thiamine affect two p53-regulated cellular responses to ionizing radiation: rereplication and apoptosis. Thus, niacinamide and thiamine form a novel basis for the development of small molecules that affect p53 function in vivo, and these results suggest that changes in cellular energy metabolism may regulate p53. PMID:15509798

  16. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  17. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  18. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  19. The highest affinity DNA element bound by Pbx complexes in t(1;19) leukemic cells fails to mediate cooperative DNA-binding or cooperative transactivation by E2a-Pbx1 and class I Hox proteins - evidence for selective targetting of E2a-Pbx1 to a subset of Pbx-recognition elements.

    Science.gov (United States)

    Knoepfler, P S; Kamps, M P

    1997-05-29

    Oncoprotein E2a-Pbx1 contains the N-terminal transactivation domains of E2a and the majority of the homeodomain protein, Pbx1. Using recombinant proteins, both Pbx1 and E2a-Pbx1 heterodimerize with Hox proteins on bipartite elements, Pbx1 binding a 5' TGAT core and Class I Hox proteins binding adjacent 3' TAAT, TTAT, or TGAT cores. In contrast to these in vitro results, nuclear extracts from E2a-Pbx1-transformed cells assemble an abundant Pbx-containing complex on TGATTGAT that excludes E2a-Pbx1, suggesting that an uncharacterized in vivo partner discriminates between E2a-Pbx1 and Pbx proteins, distinguishing it from Hox proteins. Here, we describe the DNA-binding properties of this complex, and identify TGATTGAC (PCE; Pbx Consensus Element) as its optimal recognition motif. In vitro, the PCE fails to bind heterodimers of Class I Hox proteins plus either Pbx1 or E2a-Pbx1. Likewise, in vivo, the PCE fails to mediate cooperative transactivation by E2a-Pbx1 plus Class I Hox proteins. Thus, the PCE binds a Pbx dimer partner that behaves unlike Class I Hox proteins. Competition analysis indicates that the Pbx-containing complex that binds the PCE also binds the TGATTGAT Pbx-Hox element and binds promoter elements required for tissue-specific expression of a number of cellular genes. Thus, different Pbx partners dictate targetting of Pbx heterodimers to related DNA motifs that differ in the sequence of their 3' half-sites, and E2a-Pbx1 heterodimerizes with only a subset of Pbx partners, restricting its potential DNA targets.

  20. Four new dinuclear Cu(ii) hydrazone complexes using various organic spacers: syntheses, crystal structures, DNA binding and cleavage studies and selective cell inhibitory effect towards leukemic and normal lymphocytes.

    Science.gov (United States)

    Banerjee, Sambuddha; Mondal, Susmita; Sen, Soma; Das, Saurabh; Hughes, David L; Rizzoli, Corrado; Desplanches, Cédric; Mandal, Chitra; Mitra, Samiran

    2009-09-14

    Syntheses and crystal structures of four new hydrazone-based Cu(ii) complexes, [{Cu(L(1))(H(2)O)}(2)(mu-pyraz)](ClO(4))(2) (), [{Cu(L(1))(OClO(3))}(2)(mu-4,4'-bipy)] (), [{Cu(L(2)H)}(mu-pyraz){Cu(L(2)H)(OClO(3))}].(ClO(4)) () and [{Cu(L(2))}(2)(mu-bpe)] () [L(1)H = condensation product of benzhydrazide and pyridine-2-carbaldehyde and L(2)H(2) = condensation product of benzoyl acetone and benzhydrazide], bridged by various organic spacers [pyrazine (pyraz), 4,4'-bipyridine (4,4'-bipy) and 1,2-di(4-pyridyl)ethane (bpe)] are reported in this paper. The single-crystal X-ray crystallographic studies reveal that all are dinuclear units where and form strong intermolecular H-bonding to form sheets of interconnected ions, whereas forms sheets of dinuclear chains through pi-pi interactions; in , molecules are linked only through van der Waals interactions. The variable-temperature magnetic moment studies reveal that and show antiferromagnetic coupling between the Cu(ii) centers at lower temperatures. The binding ability of with calf thymus DNA [CT-DNA] is reported using various spectroscopic studies (UV-Vis titration, circular dichroism and fluorescence). The binding constants of with CT-DNA, as calculated by different methodologies, are of the order of 10(5) M(-1). The mode of interaction between and CT-DNA has been predicted using circular dichroic (CD) spectroscopy, where it has been shown that most probably interacts with DNA via intercalation between the base pairs leading to a change in B-DNA conformation. is also able to cleave supercoiled (SC) plasmid DNA pUC19 in a time and dose dependent manner as demonstrated by agarose gel electrophoresis, and also demonstrates its potential to cleave the SC plasmid DNA via both oxidative and hydrolytic mechanisms. Approximately 50% of leukemic cells are found to be dead when two representative leukemic cell lines are exposed to ( approximately 80 muM) even for 24 h as determined by different cell cytotoxicity assays

  1. NMR assignments for the amino-terminal residues of trp repressor and their role in DNA binding

    International Nuclear Information System (INIS)

    Arrowsmith, C.H.; Carey, J.; Treat-Clemons, L.; Jardetzky, O.

    1989-01-01

    The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile arms. Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well

  2. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  4. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  5. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  6. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  7. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  9. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  10. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  11. Investigating the DNA-binding ability of GATA-1-N-terminal zinc finger

    International Nuclear Information System (INIS)

    Wong, R.; Newton, A.; Crossley, M.; Mackay, J.

    2001-01-01

    Erythroid transcription factor GATA-1 interacts with both DNA and other proteins through its zinc finger domains (ZnFs). While it has been known for me time that the C-terminal ZnF binds DNA at GATA sites, only recently has it been observed that the N-terminal finger (NF) is capable of interacting with GATC sites. Further, a number of naturally occurring mutations in NF (V205M, G208S, R216Q, D218G) that lead to anaemia and thrombocytopenia have been identified. We are interested in characterising the NF-DNA interaction and determining the effects of mutation upon this interaction. Using nuclear magnetic resonance (NMR) spectroscopy, we have observed an interaction between recombinant NF and a 16-mer DNA duplex containing a core GATC sequence. This result forms the basis from which residues in NF involved in DNA binding can be identified, and work is being carried out to improve the quality of the NMR data with the aim of determining the solution structure of the NF-DNA complex. The DNA-binding affinity of both wild-type and mutant NFs mentioned above is also being investigated using isothermal titration calorimetry. These data suggest that the strength of the interaction between NF and the 16-mer DNA duplex is in the sub-micromolar range, and comparisons between the DNA-binding affinities of the NF mutants are being made. Together, these studies will help us to understand how GATA-1 acts as a transcriptional regulator and how mutations in NF domain of GATA-1 may lead to blood disorders

  12. The inhibition of anti-DNA binding to DNA by nucleic acid binding polymers.

    Directory of Open Access Journals (Sweden)

    Nancy A Stearns

    Full Text Available Antibodies to DNA (anti-DNA are the serological hallmark of systemic lupus erythematosus (SLE and can mediate disease pathogenesis by the formation of immune complexes. Since blocking immune complex formation can attenuate disease manifestations, the effects of nucleic acid binding polymers (NABPs on anti-DNA binding in vitro were investigated. The compounds tested included polyamidoamine dendrimer, 1,4-diaminobutane core, generation 3.0 (PAMAM-G3, hexadimethrine bromide, and a β-cylodextrin-containing polycation. As shown with plasma from patients with SLE, NABPs can inhibit anti-DNA antibody binding in ELISA assays. The inhibition was specific since the NABPs did not affect binding to tetanus toxoid or the Sm protein, another lupus autoantigen. Furthermore, the polymers could displace antibody from preformed complexes. Together, these results indicate that NABPs can inhibit the formation of immune complexes and may represent a new approach to treatment.

  13. Structural evidence suggests that antiactivator ExsD from Pseudomonas aeruginosa is a DNA binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Bernhards, R.C.; Robinson, H.; Jing, X.; Vogelaar, N. J.; Schubot, F. D.

    2009-03-01

    The opportunistic pathogen P. aeruginosa utilizes a type III secretion system (T3SS) to support acute infections in predisposed individuals. In this bacterium, expression of all T3SS-related genes is dependent on the AraC-type transcriptional activator ExsA. Before host contact, the T3SS is inactive and ExsA is repressed by the antiactivator protein ExsD. The repression, thought to occur through direct interactions between the two proteins, is relieved upon opening of the type III secretion (T3S) channel when secretion chaperone ExsC sequesters ExsD. We have solved the crystal structure of ?20ExsD, a protease-resistant fragment of ExsD that lacks only the 20 amino terminal residues of the wild-type protein at 2.6 {angstrom}. Surprisingly the structure revealed similarities between ExsD and the DNA binding domain of transcriptional repressor KorB. A model of an ExsD-DNA complex constructed on the basis of this homology produced a realistic complex that is supported by the prevalence of conserved residues in the putative DNA binding site and the results of differential scanning fluorimetry studies. Our findings challenge the currently held model that ExsD solely acts through interactions with ExsA and raise new questions with respect to the underlying mechanism of ExsA regulation.

  14. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  15. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  16. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  17. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  18. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  19. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  20. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  1. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  2. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  3. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  4. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  5. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  6. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  7. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  8. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  9. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  10. Identification of novel DNA binding proteins using DNA affinity chromatography-pulldown

    OpenAIRE

    Jutras, Brandon L; Verma, Ashutosh; Stevenson, Brian

    2012-01-01

    Methods are presented through which one may isolate and identify novel bacterial DNA-binding proteins. Briefly, the DNA sequence of interest is affixed to beads, then incubated with bacterial cytoplasmic extract. Washes with buffers containing non-specific DNA and low salt concentrations will remove non-adhering and low-specificity DNA-binding proteins, while subsequent washes with higher salt concentrations will elute more specific DNA-binding proteins. Eluted proteins may then be identified...

  11. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  12. Multiple DNA-binding modes for the ETS family transcription factor PU.1.

    Science.gov (United States)

    Esaki, Shingo; Evich, Marina G; Erlitzki, Noa; Germann, Markus W; Poon, Gregory M K

    2017-09-29

    The eponymous DNA-binding domain of ETS ( E 26 t ransformation- s pecific) transcription factors binds a single sequence-specific site as a monomer over a single helical turn. Following our previous observation by titration calorimetry that the ETS member PU.1 dimerizes sequentially at a single sequence-specific DNA-binding site to form a 2:1 complex, we have carried out an extensive spectroscopic and biochemical characterization of site-specific PU.1 ETS complexes. Whereas 10 bp of DNA was sufficient to support PU.1 binding as a monomer, additional flanking bases were required to invoke sequential dimerization of the bound protein. NMR spectroscopy revealed a marked loss of signal intensity in the 2:1 complex, and mutational analysis implicated the distal surface away from the bound DNA as the dimerization interface. Hydroxyl radical DNA footprinting indicated that the site-specifically bound PU.1 dimers occupied an extended DNA interface downstream from the 5'-GGAA-3' core consensus relative to its 1:1 counterpart, thus explaining the apparent site size requirement for sequential dimerization. The site-specifically bound PU.1 dimer resisted competition from nonspecific DNA and showed affinities similar to other functionally significant PU.1 interactions. As sequential dimerization did not occur with the ETS domain of Ets-1, a close structural homolog of PU.1, 2:1 complex formation may represent an alternative autoinhibitory mechanism in the ETS family at the protein-DNA level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  14. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  15. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  17. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  18. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  19. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  20. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  1. Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.

    Directory of Open Access Journals (Sweden)

    Nina Winter

    Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.

  2. Structures of the Ets Protein DNA-binding Domains of Transcription Factors Etv1, Etv4, Etv5, and Fev: DETERMINANTS OF DNA BINDING AND REDOX REGULATION BY DISULFIDE BOND FORMATION.

    Science.gov (United States)

    Cooper, Christopher D O; Newman, Joseph A; Aitkenhead, Hazel; Allerston, Charles K; Gileadi, Opher

    2015-05-29

    Ets transcription factors, which share the conserved Ets DNA-binding domain, number nearly 30 members in humans and are particularly involved in developmental processes. Their deregulation following changes in expression, transcriptional activity, or by chromosomal translocation plays a critical role in carcinogenesis. Ets DNA binding, selectivity, and regulation have been extensively studied; however, questions still arise regarding binding specificity outside the core GGA recognition sequence and the mode of action of Ets post-translational modifications. Here, we report the crystal structures of Etv1, Etv4, Etv5, and Fev, alone and in complex with DNA. We identify previously unrecognized features of the protein-DNA interface. Interactions with the DNA backbone account for most of the binding affinity. We describe a highly coordinated network of water molecules acting in base selection upstream of the GGAA core and the structural features that may account for discrimination against methylated cytidine residues. Unexpectedly, all proteins crystallized as disulfide-linked dimers, exhibiting a novel interface (distant to the DNA recognition helix). Homodimers of Etv1, Etv4, and Etv5 could be reduced to monomers, leading to a 40-200-fold increase in DNA binding affinity. Hence, we present the first indication of a redox-dependent regulatory mechanism that may control the activity of this subset of oncogenic Ets transcription factors. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  4. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  5. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  6. Structures of the Ets Protein DNA-binding Domains of Transcription Factors Etv1, Etv4, Etv5, and Fev

    Science.gov (United States)

    Cooper, Christopher D. O.; Newman, Joseph A.; Aitkenhead, Hazel; Allerston, Charles K.; Gileadi, Opher

    2015-01-01

    Ets transcription factors, which share the conserved Ets DNA-binding domain, number nearly 30 members in humans and are particularly involved in developmental processes. Their deregulation following changes in expression, transcriptional activity, or by chromosomal translocation plays a critical role in carcinogenesis. Ets DNA binding, selectivity, and regulation have been extensively studied; however, questions still arise regarding binding specificity outside the core GGA recognition sequence and the mode of action of Ets post-translational modifications. Here, we report the crystal structures of Etv1, Etv4, Etv5, and Fev, alone and in complex with DNA. We identify previously unrecognized features of the protein-DNA interface. Interactions with the DNA backbone account for most of the binding affinity. We describe a highly coordinated network of water molecules acting in base selection upstream of the GGAA core and the structural features that may account for discrimination against methylated cytidine residues. Unexpectedly, all proteins crystallized as disulfide-linked dimers, exhibiting a novel interface (distant to the DNA recognition helix). Homodimers of Etv1, Etv4, and Etv5 could be reduced to monomers, leading to a 40–200-fold increase in DNA binding affinity. Hence, we present the first indication of a redox-dependent regulatory mechanism that may control the activity of this subset of oncogenic Ets transcription factors. PMID:25866208

  7. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  8. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  9. Evolutionary dynamics of DNA-binding sites and direct target genes of a floral master regulatory transcription factor [ChIP-Seq

    NARCIS (Netherlands)

    Muiño, J.M.; Bruijn, de S.A.; Vingron, Martin; Angenent, G.C.; Kaufmann, K.

    2015-01-01

    Plant development is controlled by transcription factors (TFs) which form complex gene-regulatory networks. Genome-wide TF DNA-binding studies revealed that these TFs have several thousands of binding sites in the Arabidopsis genome, and may regulate the expression of many genes directly. Given the

  10. Pushing the limit: synthesis, photophysical and DNA binding studies of a NIR-emitting Ru(II)-polypyridyl probe with 'light switch' behaviour.

    Science.gov (United States)

    Elmes, Robert B P; Kitchen, Jonathan A; Williams, D Clive; Gunnlaugsson, Thorfinnur

    2012-06-14

    The new Ru(II) polypyridyl complex 1 was synthesised using microwave irradiation from the new polypyridyl ligand 2'DipyTAP', and its photophysical properties, and DNA binding abilities were investigated using various spectroscopic techniques; and 1 was shown to act as a 'NIR molecular light switch' for DNA with an emission window between 680 and 860 nm.

  11. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models*

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-01-01

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. PMID:26912662

  12. Quantification of Cooperativity in Heterodimer-DNA Binding Improves the Accuracy of Binding Specificity Models.

    Science.gov (United States)

    Isakova, Alina; Berset, Yves; Hatzimanikatis, Vassily; Deplancke, Bart

    2016-05-06

    Many transcription factors (TFs) have the ability to cooperate on DNA elements as heterodimers. Despite the significance of TF heterodimerization for gene regulation, a quantitative understanding of cooperativity between various TF dimer partners and its impact on heterodimer DNA binding specificity models is still lacking. Here, we used a novel integrative approach, combining microfluidics-steered measurements of dimer-DNA assembly with mechanistic modeling of the implicated protein-protein-DNA interactions to quantitatively interrogate the cooperative DNA binding behavior of the adipogenic peroxisome proliferator-activated receptor γ (PPARγ):retinoid X receptor α (RXRα) heterodimer. Using the high throughput MITOMI (mechanically induced trapping of molecular interactions) platform, we derived equilibrium DNA binding data for PPARγ, RXRα, as well as the PPARγ:RXRα heterodimer to more than 300 target DNA sites and variants thereof. We then quantified cooperativity underlying heterodimer-DNA binding and derived an integrative heterodimer DNA binding constant. Using this cooperativity-inclusive constant, we were able to build a heterodimer-DNA binding specificity model that has superior predictive power than the one based on a regular one-site equilibrium. Our data further revealed that individual nucleotide substitutions within the target site affect the extent of cooperativity in PPARγ:RXRα-DNA binding. Our study therefore emphasizes the importance of assessing cooperativity when generating DNA binding specificity models for heterodimers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Crystal structure and DNA-binding property of the ATPase domain of bacterial mismatch repair endonuclease MutL from Aquifex aeolicus.

    Science.gov (United States)

    Fukui, Kenji; Iino, Hitoshi; Baba, Seiki; Kumasaka, Takashi; Kuramitsu, Seiki; Yano, Takato

    2017-09-01

    DNA mismatch repair (MMR) system corrects mismatched bases that are generated mainly by DNA replication errors. The repair system excises the error-containing single-stranded region and enables the re-synthesis of the strand. In the early reactions of MMR, MutL endonuclease incises the newly-synthesized/error-containing strand of the duplex to initiate the downstream excision reaction. MutL endonuclease consists of the N-terminal ATPase and C-terminal endonuclease domains. In this study, we report the crystal structure of the ATPase domain of MutL endonuclease from Aquifex aeolicus. The overall structure of the domain was similar to those of human MutL homologs and Escherichia coli MutL, although E. coli MutL has no endonuclease activity. The ATPase domain was comprised of two subdomains: the N-terminal ATP-binding subdomain and the C-terminal α-β sandwich subdomain. Site-directed mutagenesis experiment identified DNA-interacting eight basic amino acid residues, which were distributed across both the two subdomains and formed a DNA-binding cleft. Docking simulation between the structures of the ATPase and endonuclease domains generated a reliable model structure for the full-length A. aeolicus MutL, which satisfies our previous result of small-angle X-ray scattering analysis. On the basis of the model structure and further experimental results, we concluded that the two separate DNA-binding sites in the full-length A. aeolicus MutL simultaneously bind a dsDNA molecule. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Synthesis, Characterization and DNA Binding Activity of a Potential DNA Intercalator

    International Nuclear Information System (INIS)

    Siti Norain Harun; Yaakob Razak; Haslina Ahmad

    2016-01-01

    A novel complex, (Ru(dppz) 2 (p-MOPIP)) 2+ (dppz = dipyrido-(3,2-a:20,30-c]phenazine, p-MOPIP = 2-(4-methoxyphenyl) imidazo(4,5-f)(1,10]phenanthroline) has been synthesized and characterized by elemental analysis, 1 H Nuclear Magnetic Resonance spectroscopy, mass spectrometry, Fourier Transform Infrared analysis, Ultra Violet visible and fluorescence spectroscopy. Herein, the complex was designed by adding p-MOPIP as an intercalating ligand and dppz as the ancillary ligand. The DNA binding properties of the complex with Calf Thymus DNA (CT-DNA) were investigated using spectroscopic methods. The UV-visible absorption band observed at 460 nm corresponded to the metal-to-ligand charge transfer (MLCT) while bands at 358 and 281 nm corresponded to intra-ligand (IL) π-π * transitions of the ligand scaffold in p-MOPIP and dppz. The intrinsic binding constant, K b for this complex was 1.67x10 6 M -1 and this suggested that this complex, (Ru(dppz) 2 (p-MOPIP)) 2+ bound to DNA via the intercalative mode. Interestingly, the interaction of this complex with CT-DNA also had a molecular light switch effect. (author)

  15. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  16. Antimicrobial activity, cytotoxicity and DNA binding studies of carbon dots

    Science.gov (United States)

    Jhonsi, Mariadoss Asha; Ananth, Devanesan Arul; Nambirajan, Gayathri; Sivasudha, Thilagar; Yamini, Rekha; Bera, Soumen; Kathiravan, Arunkumar

    2018-05-01

    In recent years, quantum dots (QDs) are one of the most promising nanomaterials in life sciences community due to their unexploited potential in biomedical applications; particularly in bio-labeling and sensing. In the advanced nanomaterials, carbon dots (CDs) have shown promise in next generation bioimaging and drug delivery studies. Therefore the knowledge of the exact nature of interaction with biomolecules is of great interest to designing better biosensors. In this study, the interaction between CDs derived from tamarind and calf thymus DNA (ct-DNA) has been studied by vital spectroscopic techniques, which revealed that the CDs could interact with DNA via intercalation. The apparent association constant has been deduced from the absorption spectral changes of ct-DNA-CDs using the Benesi-Hildebrand equation. From the DNA induced emission quenching experiments the apparent DNA binding constant of the CDs (Kapp) have also been evaluated. Furthermore, we have analyzed the antibacterial and antifungal activity of CDs using disc diffusion assay method which exhibited excellent activity against E. coli and C. albicans with inhibition zone in the range of 7-12 mm. The biocompatible nature of CDs was confirmed by an in vitro cytotoxicity test on L6 normal rat myoblast cells by using MTT assay. The cell viability is not affected till the high dosage of CDs (200 μg/mL) for >48 h. As a consequence of the work, future development of CDs for microbial control and DNA sensing among the various biomolecules is possible in view of emerging biofields.

  17. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  18. An overview of the prediction of protein DNA-binding sites.

    Science.gov (United States)

    Si, Jingna; Zhao, Rui; Wu, Rongling

    2015-03-06

    Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.

  19. An Overview of the Prediction of Protein DNA-Binding Sites

    Directory of Open Access Journals (Sweden)

    Jingna Si

    2015-03-01

    Full Text Available Interactions between proteins and DNA play an important role in many essential biological processes such as DNA replication, transcription, splicing, and repair. The identification of amino acid residues involved in DNA-binding sites is critical for understanding the mechanism of these biological activities. In the last decade, numerous computational approaches have been developed to predict protein DNA-binding sites based on protein sequence and/or structural information, which play an important role in complementing experimental strategies. At this time, approaches can be divided into three categories: sequence-based DNA-binding site prediction, structure-based DNA-binding site prediction, and homology modeling and threading. In this article, we review existing research on computational methods to predict protein DNA-binding sites, which includes data sets, various residue sequence/structural features, machine learning methods for comparison and selection, evaluation methods, performance comparison of different tools, and future directions in protein DNA-binding site prediction. In particular, we detail the meta-analysis of protein DNA-binding sites. We also propose specific implications that are likely to result in novel prediction methods, increased performance, or practical applications.

  20. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Differential roles for Fos and Jun in DNA-binding: redox-dependent and independent functions.

    Science.gov (United States)

    Ng, L; Forrest, D; Curran, T

    1993-01-01

    The Fos and Jun family of transcription factors contain an invariant sequence motif lysine-cysteine-arginine (KCR) in the highly conserved DNA-binding region. Reduction of the cysteine residue is necessary to facilitate DNA-binding. Here, we examined the potential dual roles of the flanking lysine and arginine residues in influencing the redox reactivity of the cysteine and the DNA-binding activity of Fos and Jun. Two sets of Fos and Jun mutants were generated: the KCR and KSR series representing proteins capable of redox-dependent and redox-independent DNA-binding activity, respectively. Mutation of the lysine in Fos-Jun heterodimers had no obvious effect on the redox reactivity of the cysteine, suggesting that lysine is not essential in this respect. However, mutation of the arginine but not lysine, in both the KCR and the KSR series abolished DNA-binding activity. Thus, the arginine but not the lysine residue in the KCR motif is critical for both redox-dependent and redox-independent functions in DNA-binding. Surprisingly, the triple substitution, ISI, exhibited high levels of DNA-binding activity. This demonstrates that the effects of amino acid substitutions can be highly dependent on context and that non-basic amino acids can function efficiently in DNA-binding. Analysis of combinations of wild-type and mutant Fos and Jun proteins indicated that Fos was dominant in dictating the DNA-binding ability of Fos-Jun heterodimers. This suggests that the lysine and arginine residues in the KCR region of Fos are not equivalent to those in Jun and that they interact with DNA differently. Images PMID:8290340

  2. Roles of the human Rad51 L1 and L2 loops in DNA binding.

    Science.gov (United States)

    Matsuo, Yusuke; Sakane, Isao; Takizawa, Yoshimasa; Takahashi, Masayuki; Kurumizaka, Hitoshi

    2006-07-01

    The human Rad51 protein, a eukaryotic ortholog of the bacterial RecA protein, is a key enzyme that functions in homologous recombination and recombinational repair of double strand breaks. The Rad51 protein contains two flexible loops, L1 and L2, which are proposed to be sites for DNA binding, based on a structural comparison with RecA. In the present study, we performed mutational and fluorescent spectroscopic analyses on the L1 and L2 loops to examine their role in DNA binding. Gel retardation and DNA-dependent ATP hydrolysis measurements revealed that the substitution of the tyrosine residue at position 232 (Tyr232) within the L1 loop with alanine, a short side chain amino acid, significantly decreased the DNA-binding ability of human Rad51, without affecting the protein folding or the salt-induced, DNA-independent ATP hydrolysis. Even the conservative replacement with tryptophan affected the DNA binding, indicating that Tyr232 is involved in DNA binding. The importance of the L1 loop was confirmed by the fluorescence change of a tryptophan residue, replacing the Asp231, Ser233, or Gly236 residue, upon DNA binding. The alanine replacement of phenylalanine at position 279 (Phe279) within the L2 loop did not affect the DNA-binding ability of human Rad51, unlike the Phe203 mutation of the RecA L2 loop. The Phe279 side chain may not be directly involved in the interaction with DNA. However, the fluorescence intensity of the tryptophan replacing the Rad51-Phe279 residue was strongly reduced upon DNA binding, indicating that the L2 loop is also close to the DNA-binding site.

  3. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  4. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  5. SIRT6 Acts as a Negative Regulator in Dengue Virus-Induced Inflammatory Response by Targeting the DNA Binding Domain of NF-κB p65

    Directory of Open Access Journals (Sweden)

    Pengcheng Li

    2018-04-01

    Full Text Available Dengue virus (DENV is a mosquito-borne single-stranded RNA virus causing human disease with variable severity. The production of massive inflammatory cytokines in dengue patients has been associated with dengue disease severity. However, the regulation of these inflammatory responses remains unclear. In this study, we report that SIRT6 is a negative regulator of innate immune responses during DENV infection. Silencing of Sirt6 enhances DENV-induced proinflammatory cytokine and chemokine production. Overexpression of SIRT6 inhibits RIG-I-like receptor (RLR and Toll-like receptor 3 (TLR3 mediated NF-κB activation. The sirtuin core domain of SIRT6 is required for the inhibition of NF-κB p65 function. SIRT6 interacts with the DNA binding domain of p65 and competes with p65 to occupy the Il6 promoter during DENV infection. Collectively, our study demonstrates that SIRT6 negatively regulates DENV-induced inflammatory response via RLR and TLR3 signaling pathways.

  6. DNA binding induces conformational transition within human DNA topoisomerase I in solution.

    Science.gov (United States)

    Oleinikov, Vladimir; Sukhanova, Alyona; Mochalov, Konstantin; Ustinova, Olga; Kudelina, Irina; Bronstein, Igor; Nabiev, Igor

    2002-01-01

    We employed Raman and circular dichroism (CD) spectroscopy to probe the molecular structure of 68-kDa recombinant human DNA topoisomerase I (TopoI) in solution, in a complex with a 16-bp DNA fragment containing a camptothecin-enhanced TopoI cleavage site, and in a ternary complex with this oligonucleotide and topotecan. Raman spectroscopy reveals a TopoI secondary structure transition and significant changes in the hydrogen bonding of the tyrosine residues induced by the DNA binding. CD spectroscopy confirms the Raman data and identifies a DNA-induced (>7%) decrease of the TopoI alpha helix accompanied by at least a 6% increase of the beta structure. The Raman DNA molecular signatures demonstrated a bandshift that is expected for a net change in the environment of guanine C6 [double bond] O groups from pairing to solvent exposure. The formation of a ternary cleavage complex with TopoI, DNA, and topotecan as probed by CD spectroscopy reveals neither additional modifications of the TopoI secondary structure nor of the oligonucleotide structure, compared to the TopoI-oligonucleotide complex. Copyright 2002 Wiley Periodicals, Inc.

  7. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  8. OCT4: dynamic DNA binding pioneers stem cell pluripotency.

    Science.gov (United States)

    Jerabek, Stepan; Merino, Felipe; Schöler, Hans Robert; Cojocaru, Vlad

    2014-03-01

    OCT4 was discovered more than two decades ago as a transcription factor specific to early embryonic development. Early studies with OCT4 were descriptive and looked at determining the functional roles of OCT4 in the embryo as well as in pluripotent cell lines derived from embryos. Later studies showed that OCT4 was one of the transcription factors in the four-factor cocktail required for reprogramming somatic cells into induced pluripotent stem cells (iPSCs) and that it is the only factor that cannot be substituted in this process by other members of the same protein family. In recent years, OCT4 has emerged as a master regulator of the induction and maintenance of cellular pluripotency, with crucial roles in the early stages of differentiation. Currently, mechanistic studies look at elucidating the molecular details of how OCT4 contributes to establishing selective gene expression programs that define different developmental stages of pluripotent cells. OCT4 belongs to the POU family of proteins, which have two conserved DNA-binding domains connected by a variable linker region. The functions of OCT4 depend on its ability to recognize and bind to DNA regulatory regions alone or in cooperation with other transcription factors and on its capacity to recruit other factors required to regulate the expression of specific sets of genes. Undoubtedly, future iPSC-based applications in regenerative medicine will benefit from understanding how OCT4 functions. Here we provide an integrated view of OCT4 research conducted to date by reviewing the different functional roles for OCT4 and discussing the current progress in understanding their underlying molecular mechanisms. This article is part of a Special Issue entitled: Chromatin and epigenetic regulation of animal development. © 2013.

  9. AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.

    Science.gov (United States)

    Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard

    2018-03-12

    The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  11. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  12. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  13. Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis

    National Research Council Canada - National Science Library

    Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W

    2005-01-01

    A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...

  14. Structure/Function Studies of the Androgen Receptor DNA-Binding Region

    National Research Council Canada - National Science Library

    Rastinejad, Fraydoon

    2004-01-01

    .... The research goals associated with this study are to characterize the structural and functional aspects of the AR in order to uncover the potential of its domains, and in particular the DNA-binding...

  15. Structure/Function Studies of the Androgen Receptor DNA-Binding Region

    National Research Council Canada - National Science Library

    Rastinejad, Fraydoon

    2003-01-01

    .... The research goals associated with this study are to characterize the structural and functional aspects of the AR in order to uncover the potential of its domains, and in particular the DNA-binding...

  16. Facilitated Unbinding via Multivalency-Enabled Ternary Complexes: New Paradigm for Protein-DNA Interactions.

    Science.gov (United States)

    Chen, Tai-Yen; Cheng, Yu-Shan; Huang, Pei-San; Chen, Peng

    2018-01-25

    free CueR proteins can facilitate the unbinding of the incumbent one on DNA through either assisted dissociation or direct substitution. Greene's group studied the unbinding of RPAs from single-stranded DNA using total internal reflection fluorescence microscopy and DNA curtain techniques. The fluorescence intensity versus time traces show faster decay with higher wild-type RPA concentrations, indicating that DNA-bound RPAs can undergo a concentration-facilitated exchange when encountering excess free RPA. van Oijen's group investigated the leading/lagging-strand polymerase exchange events in the bacteriophage T7 and E. coli replication systems using a combination of single-molecule fluorescence microscopy and DNA-flow-stretching assay. The processivity was observed to have larger decrease when the concentration of the Y526F polymerase mutant increases, indicating that the unbinding of the polymerase is also concentration-dependent. Using stroboscopic imaging and single-molecule tracking, Chen's group further advanced their study into living bacterial cells. They found CueR, as well as its homologue ZntR, shows concentration-enhanced unbinding from its DNA-binding site in vivo. Mechanistic consensus has emerged from these in vitro and in vivo single-molecule studies that encompass a range of proteins with distinct biological functions. It involves multivalent contacts between protein and DNA. The multivalency enables the formation of ternary complexes as intermediates, which subsequently give rise to concentration-enhanced protein unbinding. As multivalent contacts are ubiquitous among DNA-interacting proteins, this multivalency-enabled facilitated unbinding mechanism thus provides a potentially general mechanistic paradigm in regulating protein-DNA interactions.

  17. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Characterization and DNA-binding specificities of Ralstonia TAL-like effectors

    KAUST Repository

    Li, Lixin

    2013-07-01

    Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.

  19. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    Directory of Open Access Journals (Sweden)

    Long Qian

    2016-10-01

    Full Text Available The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  20. Thermodynamics of the DNA binding of phenothiazinium dyes toluidine blue O, azure A and azure B

    International Nuclear Information System (INIS)

    Paul, Puja; Suresh Kumar, Gopinatha

    2013-01-01

    Highlights: • DNA binding of toluidine blue O, azure A and azure B was driven by negative enthalpy and positive entropy changes. • The DNA binding affinity of the dyes varied as toluidine blue O > azure A > azure B. • The small heat capacity changes indicated hydrophobic contribution in the binding process. • The salt dependent study suggested involvement of weak electrostatic interactions. • DNA thermal stabilization varied as toluidine blue O > azure A > azure B. -- Abstract: The DNA binding of toluidine blue O (TBO), azure A and azure B was characterised by isothermal titration calorimetry, differential scanning calorimetry and thermal melting studies. The DNA binding affinity of TBO was the highest followed by azure A and azure B. The binding in each case was exothermic with a positive entropy change. The affinity of the binding decreased as the [Na + ] concentration increased. The non electrostatic contribution to the standard Gibbs energy remained the same over the range of (10 to 100) mM [Na + ]. The negative change in heat capacity of the binding revealed a substantial hydrophobic contribution in the DNA binding of these dyes. An enthalpy–entropy compensation was observed in each system. The binding of these dyes stabilised the DNA against thermal strand separation. The energetics of the DNA binding of these dyes correlate well with the structural data that suggest their utility as potential DNA targeting agents

  1. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  2. Structural Evidence Suggests that the Antiactivator ExsD from Pseudomonas aeruginosa is a DNA binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Bernhards, R.; Jing, X; Vogelaar, N; Robinson, H; Schubot, F

    2009-01-01

    The opportunistic pathogen P. aeruginosa utilizes a type III secretion system (T3SS) to support acute infections in predisposed individuals. In this bacterium, expression of all T3SS-related genes is dependent on the AraC-type transcriptional activator ExsA. Before host contact, the T3SS is inactive and ExsA is repressed by the antiactivator protein ExsD. The repression, thought to occur through direct interactions between the two proteins, is relieved upon opening of the type III secretion (T3S) channel when secretion chaperone ExsC sequesters ExsD. We have solved the crystal structure of {Delta}20ExsD, a protease-resistant fragment of ExsD that lacks only the 20 amino terminal residues of the wild-type protein at 2.6 {angstrom}. Surprisingly the structure revealed similarities between ExsD and the DNA binding domain of transcriptional repressor KorB. A model of an ExsD-DNA complex constructed on the basis of this homology produced a realistic complex that is supported by the prevalence of conserved residues in the putative DNA binding site and the results of differential scanning fluorimetry studies. Our findings challenge the currently held model that ExsD solely acts through interactions with ExsA and raise new questions with respect to the underlying mechanism of ExsA regulation.

  3. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  4. Synthesis, crystal structure and electrochemical and DNA binding studies of oxygen bridged-copper(II) carboxylate

    Science.gov (United States)

    Iqbal, Muhammad; Ali, Saqib; Tahir, Muhammad Nawaz; Muhammad, Niaz; Shah, Naseer Ali; Sohail, Manzar; Pandarinathan, Vedapriya

    2015-08-01

    A new binuclear O-bridged Cu(II) complex with 4-chlorophenyl acetate and 2,2‧-bipyridine has been synthesized and characterized using FT-IR, powder and single crystal XRD and electrochemical solution studies. The results revealed that the two penta-coordinated Cu(II) centers are linked by two carboxylate ligands in end-on bonding fashion. The coordination geometry is slightly distorted square pyramidal (SP) with bridging oxygen atoms occupying the apical position and other ligands lying in the equatorial plane. The striking difference in Cu-O bond distance of the bridging oxygen atom in the complex may be responsible for the SP geometry of Cu(II) ion. The complex gave rise to metal centered irreversible electro-activity where one electron Cu(II)/Cu(III) oxidation process and a single step two electron Cu(II)/Cu(0) reduction process was observed. The redox processes were found predominantly adsorption controlled. The values of diffusion coefficient and heterogeneous rate constant for oxidation process were 6.98 × 10-7 cm2 s-1 and 4.60 × 10-5 cm s-1 while the corresponding values for reduction were 5.30 × 10-8 cm2 s-1 and 5.41 × 10-6 cm s-1, respectively. The formal potential and charge transfer coefficient were also calculated. The DNA-binding ability was explored through cyclic voltammetry and UV-Visible spectroscopy. Diminution in the value of Do for oxidation indicated the binding of the complex with DNA corresponding to Kb = 8.58 × 104 M-1. UV-Visible spectroscopy yielded ε = 49 L mol-1 cm-1 and Kb = 2.96 × 104 M-1. The data of both techniques support each other. The self-induced redox activation of the complex, as indicated by cyclic voltammetry heralds its potential applications in redox catalysis and anticancer activity.

  5. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  6. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  7. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  8. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  9. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  10. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  11. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  12. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  13. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  14. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  15. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    Science.gov (United States)

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Insights into structural and functional diversity of Dof (DNA binding with one finger) transcription factor.

    Science.gov (United States)

    Gupta, S; Malviya, N; Kushwaha, H; Nasim, J; Bisht, N C; Singh, V K; Yadav, D

    2015-03-01

    The structural, functional and in-silico studies of Dof transcription factor attempted so far reveals immense opportunity to analyze the plant genomes in terms of number of Dof genes and discuss in light of the evolution. The multiple functions of Dof genes needs to explored for crop improvement. Transcription factors play a very vital role in gene regulation at transcriptional level and are being extensively studied across phylas. In recent years, sequencing of plant genomes has led to genome-wide identification and characterizations of diverse types of plant-specific transcription factor gene family providing key insights into their structural and functional diversity. The DNA binding with one finger (Dof), a class belonging to C2H2-type zinc finger family proteins, is a plant-specific transcription factor having multiple roles such as seed maturation and germination, phytohormone and light-mediated regulation and plant responses to biotic and abiotic stresses. Dof proteins are present across plant lineage, from green algae to higher angiosperm, and represent a unique class of transcription factor having bifunctional binding activities, with both DNA and proteins, to regulate the complex transcriptional machinery in plant cells. The structural and functional diversity of the Dof transcription factor family along with the bioinformatics analysis highlighting the phylogeny of Dof families is reviewed in light of its importance in plant biotechnology for crop improvement.

  17. Study on a hidden protein-DNA binding in salmon sperm DNA sample by dynamic kinetic capillary isoelectric focusing

    Energy Technology Data Exchange (ETDEWEB)

    Liang Liang; Dou Peng; Dong Mingming; Ke Xiaokang; Bian Ningsheng [School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Liu Zhen, E-mail: zhenliu@nju.edu.cn [School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)

    2009-09-14

    Nuclease P1 is an important enzyme that hydrolyzes RNA or single-stranded DNA into nucleotides, and complete digestion is an essential basis for assays based on this enzyme. To digest a doubled-stranded DNA, the enzyme is usually combined with heat denaturing, which breaks doubled-stranded DNA into single strands. This paper presents an un-expected phenomenon that nuclease P1, in combination with heat denaturing, fails to completely digest a DNA sample extracted from salmon sperm. Under the experimental conditions used, at which nuclease P1 can completely digest calf thymus DNA, the digestion yield of salmon sperm DNA was only 89.5%. Spectrometric measurement indicated that a total protein of 4.7% is present in the DNA sample. To explain the reason for this phenomenon, the dynamic kinetic capillary isoelectric focusing (DK-CIEF) approach proposed previously, which allows for the discrimination of different types of protein-DNA interactions and the measurement of the individual dissociation rate constants, was modified and applied to examine possible protein-DNA interactions involved. It was found that a non-specific DNA-protein binding occurs in the sample, the dissociation rate constant for which was measured to be 7.05 {+-} 0.83 x 10{sup -3} s{sup -1}. The formation of DNA-protein complex was suggested to be the main reason for the incomplete digestion of the DNA sample. The modified DK-CIEF approach can be applied as general DNA samples, with the advantages of fast speed and low sample consumption.

  18. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  19. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2

    International Nuclear Information System (INIS)

    Nakatani, Miyuki; Ito, Jumpei; Koyama, Riko; Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Kuroda, Shun'ichi; Maturana, Andrés D.

    2016-01-01

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. -- Highlights: •Enigma Homolog 1 (ENH1) is a scaffold protein. •ENH1 binds to inhibitor of DNA binding 2 (Id2) in myoblasts. •ENH1 overexpression overcomes the Id2's repression of myogenesis. •The Id2-ENH1 complex play an important role in the activation of myogenesis.

  20. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2

    Energy Technology Data Exchange (ETDEWEB)

    Nakatani, Miyuki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Ito, Jumpei [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Japan Society for the Promotion of Science, Tokyo, 102-0083 (Japan); Koyama, Riko [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Iijima, Masumi; Yoshimoto, Nobuo [The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Niimi, Tomoaki [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); Kuroda, Shun' ichi [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan); The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka, 567-0047 (Japan); Maturana, Andrés D., E-mail: maturana@agr.nagoya-u.ac.jp [Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Nagoya, 464-8106 (Japan)

    2016-05-27

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. -- Highlights: •Enigma Homolog 1 (ENH1) is a scaffold protein. •ENH1 binds to inhibitor of DNA binding 2 (Id2) in myoblasts. •ENH1 overexpression overcomes the Id2's repression of myogenesis. •The Id2-ENH1 complex play an important role in the activation of myogenesis.

  1. Heterochiral Jun and Fos bZIP peptides form a coiled-coil heterodimer that is competent for DNA binding.

    Science.gov (United States)

    Kamada, Rui; Nakagawa, Natsumi; Oyama, Taiji; Sakaguchi, Kazuyasu

    2017-07-01

    Coiled coils, consisting of at least two α-helices, have important roles in the regulation of transcription, cell differentiation, and cell growth. Peptides composed of d-amino acids (d-peptides) have received great attention for their potential in biomedical applications, because they give large diversity for the design of peptidyl drug and are more resistant to proteolytic digestion than l-peptides. However, the interactions between l-peptides/l-protein and d-peptides in the formation of complex are poorly understood. In this study, stereoisomer-specific peptides were constructed corresponding to regions of the basic-leucine-zipper domains of Jun and Fos proteins. basic-leucine-zipper domains consist of an N-terminal basic domain, which is responsible for DNA binding, and a C-terminal domain that enables homodimerization or heterodimerization via formation of a coiled-coil. By combining peptides with different stereochemistries, the d-l heterochiral Jun-Fos heterodimer formation induced DNA binding by the basic domains of Jun-Fos. Our study provides new insight into the interaction between l-peptide and d-peptide enantiomers for developing d-peptide materials and drugs. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd.

  2. Spectral characterization and DNA binding properties of lanthanide(III)

    African Journals Online (AJOL)

    Spectral data of complexes suggest that the ligand binds metal ion through pyridine- nitrogen, azomethine-nitrogen and amido-oxygen donor atoms. Electrochemical behaviour of metal complexes was investigated by using cyclic voltammetry. The complexes undergo quasi-reversible one electron reduction. The binding ...

  3. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  4. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features

    Directory of Open Access Journals (Sweden)

    Rianon Zaman

    2017-01-01

    Full Text Available DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  5. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

    2005-01-01

    . The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding......The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites...

  6. Synthesis, characterization, crystal structure and DNA-binding study ...

    Indian Academy of Sciences (India)

    BOLIN

    The results suggest that neutral complexes 2a and 2b bind to DNA in an intercalative mode. On the other hand, cationic complexes 1a and 1b interact with DNA via weak intercalative or groove binding mode. (NOTE: See more examples of Graphical Abstracts in Journal website, http://www.ias.ac.in/chemsci/index.html under ...

  7. Synthesis, characterization, crystal structure and DNA-binding study ...

    Indian Academy of Sciences (India)

    BOLIN

    SYNOPSIS. Synthesis and characterization of four mononuclear eight coordinated cadmium(II) complexes with newly explored carboxamide derivatives and study of interaction with calf-thymus DNA are reported. The results suggest that neutral complexes 2a and 2b bind to DNA in an intercalative mode. On the other hand, ...

  8. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    All the complexes show excellent efficiency of cleaving DNA than respective fluoroquinolones. Brine shrimp lethality bioassay has been performed to check the cytotoxic activity. The IC50 values of the complexes are in the range of 6.27 to 16.05 μg mL. −1 . Keywords. Ruthenium; fluoroquinolone; LC50; partial intercalation; ...

  9. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  10. Non-DNA binding, dominant-negative, human PPARγ mutations cause lipodystrophic insulin resistance

    Science.gov (United States)

    Agostini, Maura; Schoenmakers, Erik; Mitchell, Catherine; Szatmari, Istvan; Savage, David; Smith, Aaron; Rajanayagam, Odelia; Semple, Robert; Luan, Jian'an; Bath, Louise; Zalin, Anthony; Labib, Mourad; Kumar, Sudhesh; Simpson, Helen; Blom, Dirk; Marais, David; Schwabe, John; Barroso, Inês; Trembath, Richard; Wareham, Nicholas; Nagy, Laszlo; Gurnell, Mark; O'Rahilly, Stephen; Chatterjee, Krishna

    2006-01-01

    Summary PPARγ is essential for adipogenesis and metabolic homeostasis. We describe mutations in the DNA and ligand binding domains of human PPARγ in lipodystrophic, severe insulin resistance. These receptor mutants lack DNA binding and transcriptional activity but can translocate to the nucleus, interact with PPARγ coactivators and inhibit coexpressed wild-type receptor. Expression of PPARγ target genes is markedly attenuated in mutation-containing versus receptor haploinsufficent primary cells, indicating that such dominant-negative inhibition operates in vivo. Our observations suggest that these mutants restrict wild-type PPARγ action via a non-DNA binding, transcriptional interference mechanism, which may involve sequestration of functionally limiting coactivators. PMID:17011503

  11. Are many Z-DNA binding proteins actually phospholipid-binding proteins?

    OpenAIRE

    Krishna, P; Kennedy, B P; Waisman, D M; van de Sande, J H; McGhee, J D

    1990-01-01

    We used a Z-DNA affinity column to isolate a collection of Z-DNA binding proteins from a high salt extract of Escherichia coli. We identified one of the major Z-DNA binding proteins of this fraction, not as a protein involved in gene regulation or genetic recombination, but rather as an outer membrane porin protein. We then showed that several other known phospholipid-binding proteins (bovine lung annexins and human serum lipoproteins) also bind much more tightly to Z-DNA than to B-DNA. In al...

  12. Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

    Science.gov (United States)

    Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

    2015-01-30

    Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  14. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  15. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  16. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  17. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  18. Analysis of major histocompatibility complex class II gene in water voles using capillary electrophoresis-single stranded conformation polymorphism

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Galan, M.; Charbonnel, N.; Cosson, J.-F.

    2005-01-01

    Roč. 5, č. 1 (2005), s. 173-176 ISSN 1471-8278 Institutional research plan: CEZ:AV0Z6093917 Keywords : water vole * population genetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.219, year: 2005

  19. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.

    Science.gov (United States)

    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M

    2011-11-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation.

  20. Kaposi's Sarcoma-Associated Herpesvirus Rta Tetramers Make High-Affinity Interactions with Repetitive DNA Elements in the Mta Promoter To Stimulate DNA Binding of RBP-Jk/CSL ▿ †

    Science.gov (United States)

    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M.

    2011-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the “CANT repeat.” CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation. PMID:21880753

  1. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  2. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  3. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  4. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  5. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  6. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  7. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast.

    Directory of Open Access Journals (Sweden)

    Zsolt Kelemen

    Full Text Available The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs. Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences.

  8. Cyclodextrin-peptide conjugates for sequence specific DNA binding

    Czech Academy of Sciences Publication Activity Database

    García, Y. R.; Zelenka, Jan; Pabon, Y. V.; Iyer, A.; Buděšínský, Miloš; Kraus, Tomáš; Smith, C. I. E.; Madder, A.

    2015-01-01

    Roč. 13, č. 18 (2015), s. 5273-5278 ISSN 1477-0520 R&D Projects: GA MŠk LD12019 Institutional support: RVO:61388963 Keywords : crystal structure * inclusion complex * click chemistry Subject RIV: CC - Organic Chemistry Impact factor: 3.559, year: 2015

  9. Synthesis, characterization, crystal structure and DNA-binding study ...

    Indian Academy of Sciences (India)

    Treatment of perchlorate or nitrate salt of cadmium(II) with carboxamide derivatives (L) generated four novel mononuclear metal complexes, represented as [Cd(L)₄](ClO₄)₂ (1a and 1b) and [Cd(L)₂(ONO₂)₂] (2a and 2b) in appreciable yields (L = L¹ = N-(furan-2-ylmethyl)-2-pyridine carboxamide and L = L² ...

  10. Prediction of DNA-binding specificity in zinc finger proteins

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... respective DNA can help to generate engineered zinc fingers for therapeutic purposes involving genome targeting. Exploring the structure–function relationships of the existing zinc finger–DNA complexes can aid in predicting the probable zinc .... tered to a defined family based on binding data. How-.

  11. Unexpected regiospecific formation and DNA binding of new 3 ...

    Indian Academy of Sciences (India)

    products intercalated into calf thymus (CT) DNA, and displaced ethidium bromide (EB) from a CT DNA–EB complex. Intrinsic binding ... obtainable from haloacyl derivatives and thioureas.12–14. A drawback of this method was a limited ..... DNA strands separate.33 We monitored the DNA helix denaturation as a function of ...

  12. Structure of a new DNA-binding domain which regulates pathogenesis in a wide variety of fungi.

    Science.gov (United States)

    Lohse, Matthew B; Rosenberg, Oren S; Cox, Jeffery S; Stroud, Robert M; Finer-Moore, Janet S; Johnson, Alexander D

    2014-07-22

    WOPR-domain proteins are found throughout the fungal kingdom where they function as master regulators of cell morphology and pathogenesis. Genetic and biochemical experiments previously demonstrated that these proteins bind to specific DNA sequences and thereby regulate transcription. However, their primary sequence showed no relationship to any known DNA-binding domain, and the basis for their ability to recognize DNA sequences remained unknown. Here, we describe the 2.6-Å crystal structure of a WOPR domain in complex with its preferred DNA sequence. The structure reveals that two highly conserved regions, separated by an unconserved linker, form an interdigitated β-sheet that is tilted into the major groove of DNA. Although the main interaction surface is in the major groove, the highest-affinity interactions occur in the minor groove, primarily through a deeply penetrating arginine residue. The structure reveals a new, unanticipated mechanism by which proteins can recognize specific sequences of DNA.

  13. Radiation-induced oxidative damage to the DNA-binding domain of the lactose repressor

    Czech Academy of Sciences Publication Activity Database

    Gillard, N.; Goffinont, S.; Buré, C.; Davídková, Marie; Maurizot, J. C.; Cadene, M.; Spotheim-Maurizot, M.

    2007-01-01

    Roč. 403, part 3 (2007), s. 463-472 ISSN 0264-6021 R&D Projects: GA MŠk 1P05OC085 Institutional research plan: CEZ:AV0Z10480505 Keywords : ionizing radiation * oxidative damage * DNA binding domain * lac repressor Subject RIV: CE - Biochemistry Impact factor: 4.009, year: 2007

  14. enDNA-Prot: Identification of DNA-Binding Proteins by Applying Ensemble Learning

    Directory of Open Access Journals (Sweden)

    Ruifeng Xu

    2014-01-01

    Full Text Available DNA-binding proteins are crucial for various cellular processes, such as recognition of specific nucleotide, regulation of transcription, and regulation of gene expression. Developing an effective model for identifying DNA-binding proteins is an urgent research problem. Up to now, many methods have been proposed, but most of them focus on only one classifier and cannot make full use of the large number of negative samples to improve predicting performance. This study proposed a predictor called enDNA-Prot for DNA-binding protein identification by employing the ensemble learning technique. Experiential results showed that enDNA-Prot was comparable with DNA-Prot and outperformed DNAbinder and iDNA-Prot with performance improvement in the range of 3.97–9.52% in ACC and 0.08–0.19 in MCC. Furthermore, when the benchmark dataset was expanded with negative samples, the performance of enDNA-Prot outperformed the three existing methods by 2.83–16.63% in terms of ACC and 0.02–0.16 in terms of MCC. It indicated that enDNA-Prot is an effective method for DNA-binding protein identification and expanding training dataset with negative samples can improve its performance. For the convenience of the vast majority of experimental scientists, we developed a user-friendly web-server for enDNA-Prot which is freely accessible to the public.

  15. DNA binding and cleavage activity by a mononuclear iron(II)Schiff ...

    Indian Academy of Sciences (India)

    Spectroscopic and hydrodynamic investigations revealed intercalative mode of binding of 1 with DNA. 1 is also found to induce oxidative cleavage of the supercoiled pUC 18 DNA to its nicked circular form in a concentration dependent manner. Keywords. Iron(II); Schiff base; X-ray structure; DNA binding; DNA cleavage. 1.

  16. Imidazolium tagged acridines: Synthesis, characterization and applications in DNA binding and anti-microbial activities

    Science.gov (United States)

    Raju, Gembali; Vishwanath, S.; Prasad, Archana; Patel, Basant K.; Prabusankar, Ganesan

    2016-03-01

    New water soluble 4,5-bis imidazolium tagged acridines have been synthesized and structurally characterized by multinuclear NMR and single crystal X-ray diffraction techniques. The DNA binding and anti-microbial activities of these acridine derivatives were investigated by fluorescence and far-UV circular dichroism studies.

  17. DNA binding proteins explore multiple local configurations during docking via rapid rebinding

    NARCIS (Netherlands)

    Ganji, M.; Docter, M.W.; Le Grice, Stuart F J; Abbondanzieri, E.A.

    2016-01-01

    Finding the target site and associating in a specific orientation are essential tasks for DNA-binding proteins. In order to make the target search process as efficient as possible, proteins should not only rapidly diffuse to the target site but also dynamically explore multiple local

  18. A Potential Structural Switch for Regulating DNA-Binding by TEAD Transcription Factors.

    Science.gov (United States)

    Lee, Dong-Sun; Vonrhein, Clemens; Albarado, Diana; Raman, C S; Veeraraghavan, Sudha

    2016-06-19

    TEA domain (TEAD) transcription factors are essential for the normal development of eukaryotes and are the downstream effectors of the Hippo tumor suppressor pathway. Whereas our earlier work established the three-dimensional structure of the highly conserved DNA-binding domain using solution NMR spectroscopy, the structural basis for regulating the DNA-binding activity remains unknown. Here, we present the X-ray crystallographic structure and activity of a TEAD mutant containing a truncated L1 loop, ΔL1 TEAD DBD. Unexpectedly, the three-dimensional structure of the ΔL1 TEAD DBD reveals a helix-swapped homodimer wherein helix 1 is swapped between monomers. Furthermore, each three-helix bundle in the domain-swapped dimer is a structural homolog of MYB-like domains. Our investigations of the DNA-binding activity reveal that although the formation of the three-helix bundle by the ΔL1 TEAD DBD is sufficient for binding to an isolated M-CAT-like DNA element, multimeric forms are deficient for cooperative binding to tandemly duplicated elements, indicating that the L1 loop contributes to the DNA-binding activity of TEAD. These results suggest that switching between monomeric and domain-swapped forms may regulate DNA selectivity of TEAD proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. DNA binding, anti-tumour activity and reactivity toward cell thiols of ...

    Indian Academy of Sciences (India)

    DNA binding; anti-tumour activity; acridin-9-ylalkenoic derivatives, glutathione. 1. Introduction. Acridine is one of the most commonly ... intercalators to interfere adversely with DNA strand cleavage.1,8 The cytotoxic effect of most ... O Salem et al. In our previous work12 we studied new acridine– thiazolidinone derivatives and ...

  20. Human TFDP3, a novel DP protein, inhibits DNA binding and transactivation by E2F

    DEFF Research Database (Denmark)

    Qiao, Huan; Di Stefano, Luisa; Tian, Chan

    2006-01-01

    The two known DP proteins, TFDP1 and -2, bind E2Fs to form heterodimers essential for high affinity DNA binding and efficient transcriptional activation/repression. Here we report the identification of a new member of the DP family, human TFDP3. Despite the high degree of sequence similarity, TFD...

  1. SOS Induction by Stabilized Topoisomerase IA Cleavage Complex Occurs via the RecBCD Pathway▿ †

    OpenAIRE

    Sutherland, Jeanette H.; Cheng, Bokun; Liu, I-Fen; Tse-Dinh, Yuk-Ching

    2008-01-01

    Accumulation of mutant topoisomerase I cleavage complex can lead to SOS induction and cell death in Escherichia coli. The single-stranded break associated with mutant topoisomerase I cleavage complex is converted to double-stranded break, which then is processed by the RecBCD pathway, followed by association of RecA with the single-stranded DNA.

  2. Characterization of in vivo DNA-binding events of plant transcription factors by ChIP-seq

    NARCIS (Netherlands)

    Mourik, Van Hilda; Muiño, J.M.; Pajoro, Alice; Angenent, G.C.; Kaufmann, Kerstin

    2015-01-01

    Chromatin immunoprecipitation followed by next-generation sequencing (ChIP-seq) is a powerful technique for genome-wide identification of in vivo binding sites of DNA-binding proteins. The technique had been used to study many DNA-binding proteins in a broad variety of species. The basis of the

  3. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nelson Laura D

    2012-06-01

    Full Text Available Abstract Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024. EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated

  4. Multiple DNA Binding Proteins Contribute to Timing of Chromosome Replication in E. coli

    Science.gov (United States)

    Riber, Leise; Frimodt-Møller, Jakob; Charbon, Godefroid; Løbner-Olesen, Anders

    2016-01-01

    Chromosome replication in Escherichia coli is initiated from a single origin, oriC. Initiation involves a number of DNA binding proteins, but only DnaA is essential and specific for the initiation process. DnaA is an AAA+ protein that binds both ATP and ADP with similar high affinities. DnaA associated with either ATP or ADP binds to a set of strong DnaA binding sites in oriC, whereas only DnaAATP is capable of binding additional and weaker sites to promote initiation. Additional DNA binding proteins act to ensure that initiation occurs timely by affecting either the cellular mass at which DNA replication is initiated, or the time window in which all origins present in a single cell are initiated, i.e. initiation synchrony, or both. Overall, these DNA binding proteins modulate the initiation frequency from oriC by: (i) binding directly to oriC to affect DnaA binding, (ii) altering the DNA topology in or around oriC, (iii) altering the nucleotide bound status of DnaA by interacting with non-coding chromosomal sequences, distant from oriC, that are important for DnaA activity. Thus, although DnaA is the key protein for initiation of replication, other DNA-binding proteins act not only on oriC for modulation of its activity but also at additional regulatory sites to control the nucleotide bound status of DnaA. Here we review the contribution of key DNA binding proteins to the tight regulation of chromosome replication in E. coli cells. PMID:27446932

  5. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

    Science.gov (United States)

    Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

    2017-06-15

    African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently

  6. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  7. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  9. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  10. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  11. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. In-depth study of DNA binding of Cys2His2 finger domains in testis zinc-finger protein.

    Directory of Open Access Journals (Sweden)

    Chun-Chi Chou

    Full Text Available Previously, we identified that both fingers 1 and 2 in the three Cys2His2 zinc-finger domains (TZD of testis zinc-finger protein specifically bind to its cognate DNA; however, finger 3 is non-sequence-specific. To gain insights into the interaction mechanism, here we further investigated the DNA-binding characteristics of TZD bound to non-specific DNAs and its finger segments bound to cognate DNA. TZD in non-specific DNA binding showed smaller chemical shift perturbations, as expected. However, the direction of shift perturbation, change of DNA imino-proton NMR signal, and dynamics on the 15N backbone atom significantly differed between specific and non-specific binding. Using these unique characteristics, we confirmed that the three single-finger segments (TZD1, TZD2 and TZD3 and the two-finger segment (TZD23 non-specifically bind to the cognate DNA. In comparison, the other two-finger segment (TZD12 binding to the cognate DNA features simultaneous non-specific and semi-specific binding, both slowly exchanged in terms of NMR timescale. The process of TZD binding to the cognate DNA is likely stepwise: initially TZD non-specifically binds to DNA, then fingers 1 and 2 insert cooperatively into the major groove of DNA by semi-specific binding, and finally finger 3 non-specifically binds to DNA, which promotes the specific binding on fingers 1 and 2 and stabilizes the formation of a specific TZD-DNA complex.

  13. Designing, structural elucidation, comparison of DNA binding, cleavage, radical scavenging activity and anticancer activity of copper(I) complex with 5-dimethyl-2-phenyl-4-[(pyridin-2-ylmethylene)-amino]-1,2-dihydro-pyrazol-3-one Schiff base ligand.

    Science.gov (United States)

    Sathiyaraj, Subbaiyan; Sampath, Krishnan; Butcher, Ray J; Pallepogu, Raghavaiah; Jayabalakrishnan, Chinnasamy

    2013-06-01

    A novel copper(I) Schiff base complex has been synthesized and fully characterized by spectral, analytical and structural modes. Single crystal X-ray diffraction studies revealed that the copper(I) complex [CuCl(PPh3)L] has a distorted tetrahedral geometry around the central copper(I) ion. The interaction of the ligand and the complex with CT-DNA has been explored by absorption titration method which revealed that the compounds could interact with CT-DNA through intercalation. A gel electrophoresis assay demonstrated the ability of the complex to cleave the pBR322 DNA. The antioxidative properties showed that the copper(I) complex has a strong radical-scavenging potency than ligands. Further the cytotoxic effect of the compounds examined on cancerous cell lines showed that the complex exhibited substantial anticancer activity. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. DNA-binding studies of AV-153, an antimutagenic and DNA repair-stimulating derivative of 1,4-dihydropiridine.

    Science.gov (United States)

    Buraka, E; Chen, C Yu-Chian; Gavare, M; Grube, M; Makarenkova, G; Nikolajeva, V; Bisenieks, I; Brūvere, I; Bisenieks, E; Duburs, G; Sjakste, N

    2014-09-05

    The ability to intercalate between DNA strands determines the cytotoxic activity of numerous anticancer drugs. Strikingly, intercalating activity was also reported for some compounds considered to be antimutagenic. The aim of this study was to determine the mode of interaction of DNA with the antimutagenic and DNA repair-stimulating dihydropyridine (DHP) AV-153. DNA and AV-153 interactions were studied by means of UV/VIS spectroscopy, fluorimetry and infrared spectroscopy. Compound AV-153 is a 1,4 dihydropyridine with ethoxycarbonyl groups in positions 3 and 5. Computer modeling of AV-153 and DNA interactions suggested an ability of the compound to dock between DNA strands at a single strand break site in the vicinity of two pyrimidines, which was confirmed in the present study. AV-153 evidently interacted with DNA, as addition of DNA to AV-153 solutions resulted in pronounced hyperchromic and bathochromic effects on the spectra. Base modification in a plasmid by peroxynitrite only minimally changed binding affinity of the compound; however, induction of single-strand breaks using Fenton's reaction greatly increased binding affinity. The affinity did not change when the ionic strength of the solution was changed from 5 to 150 mM NaCl, although it increased somewhat at 300 mM. Neither was it influenced by temperature changes from 25 to 40°C, however, it decreased when the pH of the solution was changed from 7.4 to 4.7. AV-153 competed with EBr for intercalation sites in DNA: 116 mM of the compound caused a two-fold decrease in fluorescence intensity. FT-IR spectral data analyses indicated formation of complexes between DNA and AV-153. The second derivative spectra analyses indicated interaction of AV-153 with guanine, cytosine and thymine bases, but no interaction with adenine was detected. The antimutagenic substance AV-153 appears to intercalate between the DNA strands at the site of a DNA nick in the vicinity of two pyrimidines. Copyright © 2014 Elsevier

  15. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  17. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2‧-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity

    Science.gov (United States)

    Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-01

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.

  18. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2'-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity.

    Science.gov (United States)

    Hasan, Md Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-05

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2=3-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2=4-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy=2,2'-bipyridine, Phen=1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, (1)H NMR, (13)C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH∼7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4>3>1>2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4',6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87μM respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  20. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  1. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  2. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  3. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  4. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  5. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  6. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    Science.gov (United States)

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  7. Both HMG boxes in Hmo1 are essential for DNA binding in vitro and in vivo.

    Science.gov (United States)

    Higashino, Ayako; Shiwa, Yuh; Yoshikawa, Hirofumi; Kokubo, Tetsuro; Kasahara, Koji

    2015-01-01

    Hmo1, a member of the high mobility group B family proteins in Saccharomyces cerevisiae, associates with the promoters of ribosomal protein genes (RPGs) to direct accurate transcriptional initiation. Here, to identify factors involved in the binding of Hmo1 to its targets and the mechanism of Hmo1-dependent transcriptional initiation, we developed a novel reporter system using the promoter of the RPG RPS5. A genetic screen did not identify any factors that influence Hmo1 binding, but did identify a number of mutations in Hmo1 that impair its DNA binding activity in vivo and in vitro. These results suggest that Hmo1 binds to its target promoters autonomously without any aid of additional factors. Furthermore, characterization of Hmo1 mutants showed that the box A domain plays a pivotal role in DNA binding and may be required for the recognition of structural properties of target promoters that occur in native chromatin.

  8. Zinc fingers, zinc clusters, and zinc twists in DNA-binding protein domains

    International Nuclear Information System (INIS)

    Vallee, B.L.; Auld, D.S.; Coleman, J.E.

    1991-01-01

    The authors recognize three distinct motifs of DNA-binding zinc proteins: (i) zinc fingers, (ii) zinc clusters, and (iii) zinc twists. Until very recently, x-ray crystallographic or NMR three-dimensional structure analyses of DNA-binding zinc proteins have not been available to serve as standards of reference for the zinc binding sites of these families of proteins. Those of the DNA-binding domains of the fungal transcription factor GAL4 and the rat glucocorticoid receptor are the first to have been determined. Both proteins contain two zinc binding sites, and in both, cysteine residues are the sole zinc ligands. In GAL4, two zinc atoms are bound to six cysteine residues which form a zinc cluster akin to that of metallothionein; the distance between the two zinc atoms of GAL4 is ∼3.5 angstrom. In the glucocorticoid receptor, each zinc atom is bound to four cysteine residues; the interatomic zinc-zinc distance is ∼13 angstrom, and in this instance, a zinc twist is represented by a helical DNA recognition site located between the two zinc atoms. Zinc clusters and zinc twists are here recognized as two distinctive motifs in DNA-binding proteins containing multiple zinc atoms. For native zinc fingers, structural data do not exist as yet; consequently, the interatomic distances between zinc atoms are not known. As further structural data become available, the structural and functional significance of these different motifs in their binding to DNA and other proteins participating in the transmission of the genetic message will become apparent

  9. Non-DNA binding, dominant-negative, human PPARγ mutations cause lipodystrophic insulin resistance

    OpenAIRE

    Agostini, Maura; Schoenmakers, Erik; Mitchell, Catherine; Szatmari, Istvan; Savage, David; Smith, Aaron; Rajanayagam, Odelia; Semple, Robert; Luan, Jian'an; Bath, Louise; Zalin, Anthony; Labib, Mourad; Kumar, Sudhesh; Simpson, Helen; Blom, Dirk

    2006-01-01

    PPARgamma is essential for adipogenesis and metabolic homeostasis. We describe mutations in the DNA and ligand binding domains of human PPARgamma in lipodystrophic, severe insulin resistance. These receptor mutants lack DNA binding and transcriptional activity but can translocate to the nucleus, interact with PPARgamma coactivators and inhibit coexpressed wild-type receptor. Expression of PPARgamma target genes is markedly attenuated in mutation-containing versus receptor haploinsufficent pri...

  10. Sulfhydryl group content of chicken progesterone receptor: effect of oxidation on DNA binding activity

    International Nuclear Information System (INIS)

    Peleg, S.; Schrader, W.T.; O'Malley, B.W.

    1988-01-01

    DNA binding activity of chicken progesterone receptor B form (PRB) and A form (PRA) has been examined. This activity is strongly dependent upon the presence of thiols in the buffer. Stability studies showed that PRB was more sensitive to oxidation that was PRA. Receptor preparations were fractionated by DNA-cellulose chromatography to DNA-positive and DNA-negative subpopulations, and sulfhydryl groups were quantified on immunopurified receptor by labeling with [ 3 H]-N-ethylmaleimide. Labeling of DNA-negative receptors with [ 3 H]-N-ethylmaleimide showed 21-23 sulfhydryl groups on either PRA or PRB form when the proteins were reduced and denatured. A similar number was seen without reduction if denatured DNA-positive receptor species were tested. In contrast, the DNA-negative PRB had only 10-12 sulfhydryl groups detectable without reduction. A similar number (12-13 sulfhydryl groups) was found for PRA species that lost DNA binding activity after exposure to a nonreducing environment in vitro. The authors conclude that the naturally occurring receptor forms unable to bind to DNA, as well as receptor forms that have lost DNA binding activity due to exposure to nonreducing environment in vitro, contain 10-12 oxidized cysteine residues, likely present as disulfide bonds. Since they were unable to reduce the disulfide bonds when the native DNA-negative receptor proteins were treated with dithiothreitol (DTT), they speculate that irreversible loss of DNA binding activity of receptor in vitro is due to oxidation of cysteine residues that are not accessible to DTT in the native state

  11. Sequence-specific DNA binding by glucocorticoid receptor "zinc finger peptides".

    OpenAIRE

    Archer, T K; Hager, G L; Omichinski, J G

    1990-01-01

    Steroid hormone receptors can activate or repress transcription from responsive loci by binding to DNA. We have examined the mechanism of DNA binding by individually synthesizing the putative "zinc finger peptides" from the rat glucocorticoid receptor. Atomic absorption studies show that the peptides will bind zinc on an equimolar basis, and circular dichroism experiments demonstrate a significant alteration in secondary structure in the presence of zinc. The results from a series of experime...

  12. On the prediction of DNA-binding proteins only from primary sequences: A deep learning approach.

    Directory of Open Access Journals (Sweden)

    Yu-Hui Qu

    Full Text Available DNA-binding proteins play pivotal roles in alternative splicing, RNA editing, methylating and many other biological functions for both eukaryotic and prokaryotic proteomes. Predicting the functions of these proteins from primary amino acids sequences is becoming one of the major challenges in functional annotations of genomes. Traditional prediction methods often devote themselves to extracting physiochemical features from sequences but ignoring motif information and location information between motifs. Meanwhile, the small scale of data volumes and large noises in training data result in lower accuracy and reliability of predictions. In this paper, we propose a deep learning based method to identify DNA-binding proteins from primary sequences alone. It utilizes two stages of convolutional neutral network to detect the function domains of protein sequences, and the long short-term memory neural network to identify their long term dependencies, an binary cross entropy to evaluate the quality of the neural networks. When the proposed method is tested with a realistic DNA binding protein dataset, it achieves a prediction accuracy of 94.2% at the Matthew's correlation coefficient of 0.961. Compared with the LibSVM on the arabidopsis and yeast datasets via independent tests, the accuracy raises by 9% and 4% respectively. Comparative experiments using different feature extraction methods show that our model performs similar accuracy with the best of others, but its values of sensitivity, specificity and AUC increase by 27.83%, 1.31% and 16.21% respectively. Those results suggest that our method is a promising tool for identifying DNA-binding proteins.

  13. Toward the development of metal-based synthetic nucleases: DNA binding and oxidative DNA cleavage of a mixed copper(II) complex with N-(9H-purin-6-yl)benzenesulfonamide and 1,10-phenantroline. Antitumor activity in human Caco-2 cells and Jurkat T lymphocytes. Evaluation of p53 and Bcl-2 proteins in the apoptotic mechanism.

    Science.gov (United States)

    García-Giménez, José Luis; González-Alvarez, Marta; Liu-González, Malva; Macías, Benigno; Borrás, Joaquín; Alzuet, Gloria

    2009-06-01

    The complex [Cu(N9-ABS)(phen)2].3.6H2O, H2N9-ABS = N-(9H-purin-6-yl)benzenesulfonamide and phen = 1,10-phenanthroline, has been synthesized and then characterized with the aid of X-ray diffraction, analytical, and spectroscopic techniques. The geometry of Cu(II) is distorted square pyramidal with the equatorial positions occupied by three N atoms from two phenantroline molecules and one N atom from the adenine ring of the sulfonamide ligand. The interaction of the complex with DNA was studied by means of viscosity measurements and fluorescence spectroscopy. The results pointed to a classic intercalation of the complex between the DNA base pairs. The complex was found to be a very efficient agent of plasmid DNA cleavage in the presence of ascorbate. Both the kinetics and the mechanism of the cleavage reaction were studied. In addition, the cytotoxic properties of the complex were evaluated in human Jurkat T and Caco-2 cell lines. The cytotoxicity of the compound was higher than that of the reference ([Cu(phen)2]2+). The mechanism and type of cell death induced by the compound was determined by flow cytometry and Hoechst dye staining. The compound demonstrated a significant ability to induce cell death by apoptosis. The apoptosis induced by [Cu(N9-ABS)(phen)2].3.6H2O was associated with an increase in p53 protein levels while those of Bcl-2 were reduced.

  14. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  15. Estrogen receptor diminishes DNA-binding activities of chicken GATA-1 and CACCC-binding proteins.

    Science.gov (United States)

    Holth, L T; Sun, J M; Coutts, A S; Murphy, L C; Davie, J R

    1997-12-01

    The estrogen receptor (ER) repressed erythroid differentiation and erythroid-specific gene expression. In this study, we investigated the effect of ER alpha (referred to throughout as ER) on DNA-binding activities of transcription factors involved in regulating the expression of erythroid-specific genes, and, in particular, the histone H5 gene. Using electrophoretic mobility shift assays, we found that in the presence of rabbit reticulocyte lysate, human ER reduced the binding activities of chicken immature erythrocyte nuclear extracted proteins to GATA and CACCC sites in the H5 promoter and enhancer. In contrast, the binding activities of NF1 and Sp1 were not affected by ER. Binding of ER to an estrogen response element was enhanced by addition of rabbit reticulocyte lysate. This lysate was also necessary for ER to diminish the DNA-binding activity of GATA-1. These results suggest that additional factor(s) are necessary for full ER function. Both GATA-1 and CACCC-binding proteins are critical for the developmentally regulated expression of erythroid-specific genes. We hypothesize that interference in DNA-binding activities of GATA-1 and CACCC-binding proteins is the mechanism by which the ER inhibits regulation of these genes.

  16. Specificity of cellular DNA-binding sites of microbial populations in a Florida reservoir

    International Nuclear Information System (INIS)

    Paul, J.H.; Pichard, S.L.

    1989-01-01

    The substrate specificity of the DNA-binding mechanism(s) of bacteria in a Florida reservoir was investigated in short- and long-term uptake studies with radiolabeled DNA and unlabeled competitors. Thymine oligonucleotides ranging in size from 2 base pairs to 19 to 24 base pairs inhibited DNA binding in 20-min incubations by 43 to 77%. Deoxynucleoside monophosphates, thymidine, and thymine had little effect on short-term DNA binding, although several of these compounds inhibited the uptake of the radiolabel from DNA in 4-h incubations. Inorganic phosphate and glucose-1-phosphate inhibited neither short- nor long-term binding of [ 3 H]- or [ 32 P]DNA, indicating that DNA was not utilized as a phosphorous source in this reservoir. RNA inhibited both short- and long-term radiolabeled DNA uptake as effectively as unlabeled DNA. Collectively these results indicate that aquatic bacteria possess a generalized nuclei acid uptake/binding mechanism specific for compounds containing phosphodiester bonds and capable of recognizing oligonucleotides as short as dinucleotides. This binding site is distinct from nucleoside-, nucleotide-, phosphomonoester-, and inorganic phosphate-binding sites. Such a nucleic acid-binding mechanism may have evolved for the utilization of extracellular DNA (and perhaps RNA), which is abundant in many marine and freshwater environments

  17. Functional importance of the DNA binding activity of Candida albicans Czf1p.

    Directory of Open Access Journals (Sweden)

    Ivana Petrovska

    Full Text Available The human opportunistic pathogen Candida albicans undergoes a reversible morphological transition between the yeast and hyphal states in response to a variety of signals. One such environmental trigger is growth within a semisolid matrix such as agar medium. This growth condition is of interest because it may mimic the growth of C. albicans in contact with host tissue during infection. During growth within a semisolid matrix, hyphal growth is positively regulated by the transcriptional regulator Czf1p and negatively by a second key transcriptional regulator, Efg1p. Genetic studies indicate that Czf1p, a member of the zinc-cluster family of transcriptional regulators, exerts its function by opposing the inhibitory influence of Efg1p on matrix-induced filamentous growth. We examined the importance of the two known activities of Czf1p, DNA-binding and interaction with Efg1p. We found that the two activities were separable by mutation allowing us to demonstrate that the DNA-binding activity of Czf1p was essential for its role as a positive regulator of morphogenesis. Surprisingly, however, interactions with Efg1p appeared to be largely dispensable. Our studies provide the first evidence of a key role for the DNA-binding activity of Czf1p in the morphological yeast-to-hyphal transition triggered by matrix-embedded growth.

  18. Identification of a polyoxometalate inhibitor of the DNA binding activity of Sox2.

    Science.gov (United States)

    Narasimhan, Kamesh; Pillay, Shubhadra; Bin Ahmad, Nor Rizal; Bikadi, Zsolt; Hazai, Eszter; Yan, Li; Kolatkar, Prasanna R; Pervushin, Konstantin; Jauch, Ralf

    2011-06-17

    Aberrant expression of transcription factors is a frequent cause of disease, yet drugs that modulate transcription factor protein-DNA interactions are presently unavailable. To this end, the chemical tractability of the DNA binding domain of the stem cell inducer and oncogene Sox2 was explored in a high-throughput fluorescence anisotropy screen. The screening revealed a Dawson polyoxometalate (K(6)[P(2)Mo(18)O(62)]) as a direct and nanomolar inhibitor of the DNA binding activity of Sox2. The Dawson polyoxometalate (Dawson-POM) was found to be selective for Sox2 and related Sox-HMG family members when compared to unrelated paired and zinc finger DNA binding domains. [(15)N,(1)H]-Transverse relaxation optimized spectroscopy (TROSY) experiments coupled with docking studies suggest an interaction site of the POM on the Sox2 surface that enabled the rationalization of its inhibitory activity. The unconventional molecular scaffold of the Dawson-POM and its inhibitory mode provides strategies for the development of drugs that modulate transcription factors.

  19. Dissecting the role of the ϕ29 terminal protein DNA binding residues in viral DNA replication.

    Science.gov (United States)

    Holguera, Isabel; Muñoz-Espín, Daniel; Salas, Margarita

    2015-03-11

    Phage ϕ29 DNA replication takes place by a protein-priming mechanism in which the viral DNA polymerase catalyses the covalent linkage of the initiating nucleotide to a specific serine residue of the terminal protein (TP). The N-terminal domain of the ϕ29 TP has been shown to bind to the host DNA in a sequence-independent manner and this binding is essential for the TP nucleoid localisation and for an efficient viral DNA replication in vivo. In the present work we have studied the involvement of the TP N-terminal domain residues responsible for DNA binding in the different stages of viral DNA replication by assaying the in vitro activity of purified TP N-terminal mutant proteins. The results show that mutation of TP residues involved in DNA binding affects the catalytic activity of the DNA polymerase in initiation, as the Km for the initiating nucleotide is increased when these mutant proteins are used as primers. Importantly, this initiation defect was relieved by using the ϕ29 double-stranded DNA binding protein p6 in the reaction, which decreased the Km of the DNA polymerase for dATP about 130-190 fold. Furthermore, the TP N-terminal domain was shown to be required both for a proper interaction with the DNA polymerase and for an efficient viral DNA amplification. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods.

    Science.gov (United States)

    Qu, Kaiyang; Han, Ke; Wu, Song; Wang, Guohua; Wei, Leyi

    2017-09-22

    DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF), is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  1. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods

    Directory of Open Access Journals (Sweden)

    Kaiyang Qu

    2017-09-01

    Full Text Available DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF, is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  2. Human papillomavirus type 16 E7 protein inhibits DNA binding by the retinoblastoma gene product.

    Science.gov (United States)

    Stirdivant, S M; Huber, H E; Patrick, D R; Defeo-Jones, D; McAvoy, E M; Garsky, V M; Oliff, A; Heimbrook, D C

    1992-05-01

    The human papillomavirus E7 gene can transform murine fibroblasts and cooperate with other viral oncogenes in transforming primary cell cultures. One biochemical property associated with the E7 protein is binding to the retinoblastoma tumor suppressor gene product (pRB). Biochemical properties associated with pRB include binding to viral transforming proteins (E1A, large T, and E7), binding to cellular proteins (E2F and Myc), and binding to DNA. The mechanism by which E7 stimulates cell growth is uncertain. However, E7 binding to pRB inhibits binding of cellular proteins to pRB and appears to block the growth-suppressive activity of pRB. We have found that E7 also inhibits binding of pRB to DNA. A 60-kDa version of pRB (pRB60) produced in reticulocyte translation reactions or in bacteria bound quantitatively to DNA-cellulose. Recombinant E7 protein used at a 1:1 or 10:1 molar ratio with pRB60 blocked 50 or greater than 95% of pRB60 DNA-binding activity, respectively. A mutant E7 protein (E7-Ala-24) with reduced pRB60-binding activity exhibited a parallel reduction in its blocking of pRB60 binding to DNA. An E7(20-29) peptide that blocks binding of E7 protein to pRB60 restored the DNA-binding activity of pRB60 in the presence of E7. Peptide E7(2-32) did not block pRB60 binding to DNA, while peptide E7(20-57) and an E7 fragment containing residues 1 to 60 partially blocked DNA binding. E7 species containing residues 3 to 75 were fully effective at blocking pRB60 binding to DNA. These studies indicate that E7 protein specifically blocks pRB60 binding to DNA and suggest that the E7 region responsible for this property lies between residues 32 and 75. The functional significance of these observations is unclear. However, we have found that a point mutation in pRB60 that impairs DNA-binding activity also blocks the ability of pRB60 to inhibit cell growth. This correlation suggests that the DNA-binding activity of retinoblastoma proteins contributes to their biological

  3. Chiral copper(II) complex based on natural product rosin derivative as promising antitumour agent.

    Science.gov (United States)

    Fei, Bao-Li; Huang, Zhi-Xiang; Xu, Wu-Shuang; Li, Dong-Dong; Lu, Yang; Gao, Wei-Lin; Zhao, Yue; Zhang, Yu; Liu, Qing-Bo

    2016-07-01

    To evaluate the biological preference of chiral drug candidates for molecular target DNA, the synthesis and characterization of a chiral copper(II) complex (2) of a chiral ligand N,N'-(pyridin-2-ylmethylene) dehydroabietylamine (1) was carried out. The interactions of 1 and 2 with salmon sperm DNA were investigated by viscosity measurements, UV, fluorescence and circular dichroism (CD) spectroscopic techniques. Absorption spectral, emission spectral and viscosity analysis reveal that 1 and 2 interacted with DNA through intercalation and 2 exhibited a higher DNA binding ability. In the absence/presence of ascorbic acid, 1 and 2 cleaved supercoiled pBR322 DNA by single-strand and 2 displayed stronger DNA cleavage ability. In addition, in vitro cytotoxicity of 1 and 2 against HeLa, SiHa, HepG-2 and A431 cancer cell lines study show that they exhibited effective cytotoxicity against the tested cell lines, notably, 2 showed a superior cytotoxicity than the widely used drug cisplatin under identical conditions, indicating it has the potential to act as effective anticancer drug. Flow cytometry analysis indicates 2 produced death of HeLa cancer cells through an apoptotic pathway. Cell cycle analysis demonstrates that 2 mainly arrested HeLa cells at the S phase. The study represents the first step towards understanding the mode of the promising chiral rosin-derivative based copper complexes as chemotherapeutics. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Synthesis, spectral and quantum chemical studies and use of (E)-3-[(3,5-bis(trifluoromethyl)phenylimino)methyl]benzene-1,2-diol and its Ni(II) and Cu(II) complexes as an anion sensor, DNA binding, DNA cleavage, anti-microbial, anti-mutagenic and anti-cancer agent

    Science.gov (United States)

    Ünver, Hüseyin; Boyacıoğlu, Bahadır; Zeyrek, Celal Tuğrul; Yıldız, Mustafa; Demir, Neslihan; Yıldırım, Nuray; Karaosmanoğlu, Oğuzhan; Sivas, Hülya; Elmalı, Ayhan

    2016-12-01

    We report the synthesis of a novel Schiff base (E)-3-[(3,5-bis(trifluoromethyl) phenylimino)methyl] benzene-1,2-diol from the reaction of 2,3-dihydroxybenzaldehyde with 3,5-bis(trifluoromethyl)aniline, and its Ni(II) and Cu(II) complexes. The molecular structure of the Schiff base was experimentally determined using X-ray single-crystal data and was compared to the structure predicted by theoretical calculations using density functional theory (DFT), Hartree-Fock (HF) and Möller-Plesset second-order perturbation (MP2). In addition, nonlinear optical (NLO) effects of the compound was predicted using DFT. The antimicrobial activities of the compounds were investigated for their minimum inhibitory concentration. UV-Vis spectroscopy studies of the interactions between the compounds and calf thymus DNA (CT-DNA) showed that the compounds interacts with CT-DNA via intercalative binding. A DNA cleavage study showed that the Cu(II) complex cleaved DNA without any external agents. The compounds inhibited the base pair mutation in the absence of S9 with high inhibition rate. In addition, in vitro cytotoxicity of the Ni(II) complex towards HepG2 cell line was assayed by the MTT method. Also, the colorimetric response of the Schiff base in DMSO to the addition of equivalent amount of anions (F-, Br-, I-, CN-, SCN-, ClO4-, HSO4-, AcO-, H2PO4-, N3- and OH-) was investigated. In this regard, while the addition of F-, CN-, AcO- and OH- anions into the solution containing Schiff base resulted in a significant color change, the addition of Br-, I-, SCN-, ClO4-, HSO4-, H2PO4- and N3- anions resulted in no color change. The most discernable color change in the Schiff base was caused by CN-, which demonstrated that the ligand can be used to selectively detect CN-.

  5. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  6. DNA binding domains and nuclear localization signal of LEDGF: contribution of two helix-turn-helix (HTH)-like domains and a stretch of 58 amino acids of the N-terminal to the trans-activation potential of LEDGF.

    Science.gov (United States)

    Singh, Dhirendra P; Kubo, E; Takamura, Y; Shinohara, T; Kumar, A; Chylack, Leo T; Fatma, N

    2006-01-20

    Lens epithelium derived growth factor (LEDGF), a nuclear protein, plays a role in regulating the transcription of stress-associated genes such as heat shock proteins by binding to consensus core DNA sequences nAGGn or nGAAn or their repeats, and in doing so helps to provide cyto-protection. However, additional information is required to identify the specific structural features of LEDGF involved in gene transcription. Here we have investigated the functional domains activating and repressing DNA-binding modules, by using a DNA binding assay and trans-activation experiments performed by analyzing proteins prepared from deletion constructs. The results disclosed the DNA-binding domain of N-terminal LEDGF mapped between amino acid residues 5 and 62, a 58 amino acid residue stretch PWWP domain which binds to stress response elements (STRE; A/TGGGGA/T). C-terminal LEDGF contains activation domains, an extensive loop-region (aa 418-530) with two helix-turn-helix (HTH)-like domains, and binds to a heat shock element (HSE; nGAAn). A trans-activation assay using Hsp27 promoter revealed that both HTH domains contribute in a cooperative manner to the trans-activation potential of LEDGF. Interestingly, removal of N-terminal LEDGF (aa 1-187) significantly enhances the gene activation potential of C-terminal LEDGF (aa 199-530); thus the N-terminal domain (aa 5-62), exhibits auto-transcriptional repression activity. It appears that this domain is involved in stabilizing the LEDGF-DNA binding complex. Collectively, our results demonstrate that LEDGF contains three DNA-binding domains, which regulate gene expression depending on cellular microenvironment and thus modify the physiology of cells to maintain cellular homeostasis.

  7. Solution structure of the Arabidopsis thaliana telomeric repeat-binding protein DNA binding domain: a new fold with an additional C-terminal helix.

    Science.gov (United States)

    Sue, Shih-Che; Hsiao, Hsin-Hao; Chung, Ben C-P; Cheng, Ying-Hsien; Hsueh, Kuang-Lung; Chen, Chung Mong; Ho, Chia Hsing; Huang, Tai-Huang

    2006-02-10

    The double-stranded telomeric repeat-binding protein (TRP) AtTRP1 is isolated from Arabidopsis thaliana. Using gel retardation assays, we defined the C-terminal 97 amino acid residues, Gln464 to Val560 (AtTRP1(464-560)), as the minimal structured telomeric repeat-binding domain. This region contains a typical Myb DNA-binding motif and a C-terminal extension of 40 amino acid residues. The monomeric AtTRP1(464-560) binds to a 13-mer DNA duplex containing a single repeat of an A.thaliana telomeric DNA sequence (GGTTTAG) in a 1:1 complex, with a K(D) approximately 10(-6)-10(-7) M. Nuclear magnetic resonance (NMR) examination revealed that the solution structure of AtTRP1(464-560) is a novel four-helix tetrahedron rather than the three-helix bundle structure found in typical Myb motifs and other TRPs. Binding of the 13-mer DNA duplex to AtTRP1(464-560) induced significant chemical shift perturbations of protein amide resonances, which suggests that helix 3 (H3) and the flexible loop connecting H3 and H4 are essential for telomeric DNA sequence recognition. Furthermore, similar to that in hTRF1, the N-terminal arm likely contributes to or stabilizes DNA binding. Sequence comparisons suggested that the four-helix structure and the involvement of the loop residues in DNA binding may be features unique to plant TRPs.

  8. Intramolecular Binding of the Rad9 C Terminus in the Checkpoint Clamp Rad9-Hus1-Rad1 Is Closely Linked with Its DNA Binding.

    Science.gov (United States)

    Takeishi, Yukimasa; Iwaya-Omi, Rie; Ohashi, Eiji; Tsurimoto, Toshiki

    2015-08-07

    The human checkpoint clamp Rad9-Hus1-Rad1 (9-1-1) is loaded onto chromatin by its loader complex, Rad17-RFC, following DNA damage. The 120-amino acid (aa) stretch of the Rad9 C terminus (C-tail) is unstructured and projects from the core ring structure (CRS). Recent studies showed that 9-1-1 and CRS bind DNA independently of Rad17-RFC. The DNA-binding affinity of mutant 9(ΔC)-1-1, which lacked the Rad9 C-tail, was much higher than that of wild-type 9-1-1, suggesting that 9-1-1 has intrinsic DNA binding activity that manifests in the absence of the C-tail. C-tail added in trans interacted with CRS and prevented it from binding to DNA. We narrowed down the amino acid sequence in the C-tail necessary for CRS binding to a 15-aa stretch harboring two conserved consecutive phenylalanine residues. We prepared 9-1-1 mutants containing the variant C-tail deficient for CRS binding, and we demonstrated that the mutant form restored DNA binding as efficiently as 9(ΔC)-1-1. Furthermore, we mapped the sequence necessary for TopBP1 binding within the same 15-aa stretch, demonstrating that TopBP1 and CRS share the same binding region in the C-tail. Indeed, we observed their competitive binding to the C-tail with purified proteins. The importance of interaction between 9-1-1 and TopBP1 for DNA damage signaling suggests that the competitive interactions of TopBP1 and CRS with the C-tail will be crucial for the activation mechanism. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. An abundant DNA binding protein from the hyperthermophilic archaeon Sulfolobus shibatae affects DNA supercoiling in a temperature-dependent fashion.

    Science.gov (United States)

    Xue, H; Guo, R; Wen, Y; Liu, D; Huang, L

    2000-07-01

    The DNA binding protein Ssh10b, a member of the Sac10b family, has been purified from the hyperthermophilic archaeon Sulfolobus shibatae. Ssh10b constitutes about 4% of the cellular protein. Electrophoretic mobility shift assays showed that Ssh10b first bound a double-stranded DNA fragment with an estimated binding size of approximately approximately 12 bp, forming distinct shifts, until the DNA was coated with the protein. Binding of more Ssh10b resulted in the formation of smears of lower mobilities. The migration pattern of the smearing Ssh10b-DNA complexes was affected by temperature, whereas that of complexes associated with the distinct shifts was not. Interestingly, Ssh10b was capable of constraining negative DNA supercoils in a temperature-dependent fashion. While the ability of the protein to constrain supercoils was weak at 25 degrees C, it was enhanced substantially at 45 degrees C or higher temperatures (up to 80 degrees C). Taken together, our data suggest that archaeal proteins of the Sac10b family may affect the topology of chromosomal DNA in thermophilic archaea at their growth temperatures.

  10. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Mechanism of Iron-Dependent Repressor (IdeR Activation and DNA Binding: A Molecular Dynamics and Protein Structure Network Study.

    Directory of Open Access Journals (Sweden)

    Soma Ghosh

    2015-12-01

    Full Text Available Metalloproteins form a major class of enzymes in the living system that are involved in crucial biological functions such as catalysis, redox reactions and as 'switches' in signal transductions. Iron dependent repressor (IdeR is a metal-sensing transcription factor that regulates free iron concentration in Mycobacterium tuberculosis. IdeR is also known to promote bacterial virulence, making it an important target in the field of therapeutics. Mechanistic details of how iron ions modulate IdeR such that it dimerizes and binds to DNA is not understood clearly. In this study, we have performed molecular dynamic simulations and integrated it with protein structure networks to study the influence of iron on IdeR structure and function. A significant structural variation between the metallated and the non-metallated system is observed. Our simulations clearly indicate the importance of iron in stabilizing its monomeric subunit, which in turn promotes dimerization. However, the most striking results are obtained from the simulations of IdeR-DNA complex in the absence of metals, where at the end of 100ns simulations, the protein subunits are seen to rapidly dissociate away from the DNA, thereby forming an excellent resource to investigate the mechanism of DNA binding. We have also investigated the role of iron as an allosteric regulator of IdeR that positively induces IdeR-DNA complex formation. Based on this study, a mechanistic model of IdeR activation and DNA binding has been proposed.

  12. Data for increase of Lymantria dispar male survival after topical application of single-stranded RI