
Sample records for single-stranded dna ssdna

  1. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.


    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  2. Improved single-strand DNA sizing accuracy in capillary electrophoresis.


    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B


    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  3. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela


    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  4. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias


    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.


    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  6. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.


    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  7. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket. (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter


    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  8. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket


    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter


    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  9. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux


    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  10. Biophysical characterization of the association of histones with single-stranded DNA. (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier


    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos


    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  12. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications (United States)

    Hong, Ka Lok


    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  13. The impact of base stacking on the conformations and electrostatics of single-stranded DNA. (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois


    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  15. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.


    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  16. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.


    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  17. Mechanochemical regulations of RPA's binding to ssDNA (United States)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie


    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  18. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams


    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  19. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities. (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce


    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  20. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi


    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  1. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter. (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi


    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  2. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy


    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried


    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  3. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan


    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  4. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool. (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita


    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  5. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W


    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  6. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia


    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  7. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.


    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata). (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian


    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  9. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  10. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  11. Programmable autonomous synthesis of single-stranded DNA (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng


    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  12. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.


    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  13. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA. (United States)

    Rogers, Cody M; Bochman, Matthew L


    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee


    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  15. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD


    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  16. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  17. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela


    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  18. Distinct circular single-stranded DNA viruses exist in different soil types. (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael


    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface. (United States)

    Akbari, Fahimeh; Foroutan, Masumeh


    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  20. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.


    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  1. Selection and application of ssDNA aptamers to detect active TB from sputum samples

    CSIR Research Space (South Africa)

    Rotherham, LS


    Full Text Available and Application of ssDNA Aptamers to Detect Active TB from Sputum Samples Lia S. Rotherham1,2, Charlotte Maserumule1,3, Keertan Dheda3, Jacques Theron2, Makobetsa Khati1,3* 1 Emerging Health Technologies Platform, Council for Scientific and Industrial Research...?50 times less than those for producing antibodies [25]. Aptamers have been raised against a wide variety of targets, from small human molecules and viral proteins to whole microorganisms [26]. Single-stranded DNA (ssDNA) aptamers are usually used...

  2. Graphene oxide modified light addressable potentiometric sensor and its application for ssDNA monitoring. (United States)

    Jia, Yunfang; Yin, Xue-Bo; Zhang, Jia; Zhou, Shuang; Song, Meng; Xing, Ke-Li


    A light addressable potentiometric sensor (LAPS) is a kind of silicon based semiconductor sensor, and surface modification is a fundamental problem for its application in biological fields. Graphene oxide (GO) based biochemically activated LAPS were proposed, called GO-LAPS. The GO-LAPS were applied to monitoring single strand DNA (ssDNA) probe immobilization and its hybridization with complementary ssDNA molecules of different chain lengths (30, 21 and 14 base pairs, respectively). It was discovered that the curves of LAPS' currents versus analyte concentrations for ssDNA probe binding and the target ssDNA hybridization were different. Explanations were proposed based on the semiconductor's surface-electric-field-effect and the electrical properties of ssDNA molecule. Moreover, comparisons between GO-LAPS and LAPS without GO modification were carried out. Enhanced response currents of GO-LAPS were reported experimentally and analyzed theoretically based on X-ray photoelectron spectroscopy (XPS) of GO-LAPS. The limitation of target ssDNA monitoring was 1 pM to 10 nM, which suggested that this LAPS based platform could be developed as a sensitive means for short chain ssDNA detection.

  3. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.


    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  4. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae. (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael


    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity. (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity* (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  7. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody. (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick


    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  8. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles. (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun


    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  9. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  10. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB). (United States)

    van Loon, Barbara; Samson, Leona D


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  11. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.


    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  12. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail:; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki


    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  13. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis. (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef


    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  14. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel


    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  15. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.


    Barany, F; Boeke, J D


    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  16. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der


    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  17. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples. (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J


    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  18. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample. (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao


    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  19. RADX interacts with single-stranded DNA to promote replication fork stability

    DEFF Research Database (Denmark)

    Schubert, Lisa; Ho, Teresa; Hoffmann, Saskia


    has an essential genome maintenance role, protecting ssDNA regions from nucleolytic degradation and providing a recruitment platform for proteins involved in responses to replication stress and DNA damage. Here, we identify the uncharacterized protein RADX (CXorf57) as an ssDNA-binding factor in human...... cells. RADX binds ssDNA via an N-terminal OB fold cluster, which mediates its recruitment to sites of replication stress. Deregulation of RADX expression and ssDNA binding leads to enhanced replication fork stalling and degradation, and we provide evidence that a balanced interplay between RADX and RPA...

  20. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  1. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.


    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  2. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri. (United States)

    Van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S; Britton, Robert A


    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution.

  3. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae. (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E


    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  4. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail:


    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  5. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii. (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten


    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  6. Effects of single-stranded DNA binding proteins on primer extension by telomerase. (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim


    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  7. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores. (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  8. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.


    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  9. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B


    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  10. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.


    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  11. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin


    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  12. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ (United States)

    Gray, J.W.; Pinkel, D.


    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  13. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler


    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  14. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud


    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  15. Electric light scattering from single-stranded DNA in linear polyacrylamide solutions. (United States)

    Todorov, R; Starchev, K; Stoylov, S P


    The electric light scattering (ELS) of ssDNA (calf thymus, 10 kbp, 55 micrograms/mL) in denaturing polyacrylamide (PAA) solutions was studied as a function of applied sinusoidal electric field and polymer concentration. Electric fields of strengths up to 300 V/cm and of frequencies between 100 and 5000 Hz were applied. It was found that the ELS effect increases with the field strength and decreases at high frequencies. The dependence of the ELS effect of ssDNA on polymer concentration passes through a maximum at 1% PAA. The relaxation times of decay of the ELS effect increase with increasing polymer concentrations. It was demonstrated that ELS is a useful method for investigation of ssDNA behavior in the course of pulse-field electrophoresis in polymer solutions.

  16. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)


    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  17. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks. (United States)

    Pachkowski, Brian; Nakamura, Jun


    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  18. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding. (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath


    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  19. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana. (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L


    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  20. Characterization of Circular ssDNA Viruses within the Echinoderm Nanobiome (United States)

    Jackson, E.; Bistolas, K. S.; Hewson, I.


    Viral metagenomics has revealed a great diversity and presence of circular single-stranded(ss) DNA viruses most similar to the viral family Circoviridae in various environments both ambient and host. These viruses are an emerging paradigm in viral discovery amongst aquatic invertebrates mainly from the sub-phlya Crustacea and to a lesser extent the phylum Echinodermata. This parasite-host relationship is furthered here with the discovery of circo-like viruses extracted from the tissue of members from the family Holothuroidea (sea cucumbers). Verification and presence of these viruses within the tissue of the host was confirmed through rigorous genome architecture screening and PCR amplification of the rep gene from unamplified viral DNA extracts. Phylogenetic analysis of the rep gene reveals high similarity to circular ssDNA viruses from environmental metagenomic surveys of marine habitats. The significance of these findings is changing the perception and understanding of circular ssDNA viruses by broadening the known host range and blurring certain defining characteristics established by their pathogenic counterparts. Aside from discover and characterization, the potential ecological impacts of ssDNA viruses upon their host remains relatively unknown and further investigations should aim to determine the pathology, route of infection, and ecological implications of viral infection.

  1. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis. (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef


    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  2. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.


    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  3. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach. (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan


    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  4. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody. (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua


    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  5. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein. (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V


    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Characterization of the Single Stranded DNA Binding Protein SsbB Encoded in the Gonoccocal Genetic Island

    NARCIS (Netherlands)

    Jain, Samta; Zweig, Maria; Peeters, Eveline; Siewering, Katja; Hackett, Kathleen T.; Dillard, Joseph P.; van der Does, Chris


    Background: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in

  7. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.


    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  8. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles. (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng


    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  9. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted


    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  10. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    Directory of Open Access Journals (Sweden)

    Alexandra Peacock-Villada

    Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

  11. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora. (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E


    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  12. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.


    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  13. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.


    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  14. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA (United States)

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.


    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  15. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.


    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  16. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  17. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can


    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  18. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi


    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  19. Magnetic nanoparticle clusters as actuators of ssDNA release. (United States)

    Banchelli, M; Nappini, S; Montis, C; Bonini, M; Canton, P; Berti, D; Baglioni, P


    One of the major areas of research in nanomedicine is the design of drug delivery systems with remotely controllable release of the drug. Despite the enormous progress in the field, this aspect still poses a challenge, especially in terms of selectivity and possible harmful interactions with biological components other than the target. We report an innovative approach for the controlled release of DNA, based on clusters of core-shell magnetic nanoparticles. The primary nanoparticles are functionalized with a single-stranded oligonucleotide, whose pairing with a half-complementary strand in solution induces clusterization. The application of a low frequency (6 KHz) alternating magnetic field induces DNA melting with the release of the single strand that induces clusterization. The possibility of steering and localizing the magnetic nanoparticles, and magnetically actuating the DNA release discloses new perspectives in the field of nucleic-acid based therapy.

  20. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.


    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  1. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong


    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  2. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages. (United States)

    Kodaira, K; Godson, N G; Taketo, A


    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  3. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen


    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  4. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Directory of Open Access Journals (Sweden)

    Yu-Ming Chang

    Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  5. RNA binding to APOBEC3G induces the disassembly of functional deaminase complexes by displacing single-stranded DNA substrates (United States)

    Polevoda, Bogdan; McDougall, William M.; Tun, Bradley N.; Cheung, Michael; Salter, Jason D.; Friedman, Alan E.; Smith, Harold C.


    APOBEC3G (A3G) DNA deaminase activity requires a holoenzyme complex whose assembly on nascent viral reverse transcripts initiates with A3G dimers binding to ssDNA followed by formation of higher-order A3G homo oligomers. Catalytic activity is inhibited when A3G binds to RNA. Our prior studies suggested that RNA inhibited A3G binding to ssDNA. In this report, near equilibrium binding and gel shift analyses showed that A3G assembly and disassembly on ssDNA was an ordered process involving A3G dimers and multimers thereof. Although, fluorescence anisotropy showed that A3G had similar nanomolar affinity for RNA and ssDNA, RNA stochastically dissociated A3G dimers and higher-order oligomers from ssDNA, suggesting a different modality for RNA binding. Mass spectrometry mapping of A3G peptides cross-linked to nucleic acid suggested ssDNA only bound to three peptides, amino acids (aa) 181–194 in the N-terminus and aa 314–320 and 345–374 in the C-terminus that were part of a continuous exposed surface. RNA bound to these peptides and uniquely associated with three additional peptides in the N- terminus, aa 15–29, 41–52 and 83–99, that formed a continuous surface area adjacent to the ssDNA binding surface. The data predict a mechanistic model of RNA inhibition of ssDNA binding to A3G in which competitive and allosteric interactions determine RNA-bound versus ssDNA-bound conformational states. PMID:26424853

  6. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)


    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  7. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik


    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  8. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.


    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  9. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  10. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.


    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  11. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4


    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  12. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange. (United States)

    Qian, Yufeng; Johnson, Kenneth A


    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB-ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB) 30 and (SSB) 60 , defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB) 60 and (SSB) 30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 10 9 m -1 s -1 ) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles. (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha


    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  14. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.


    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  15. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles. (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng


    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  16. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)


    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  17. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems. (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela


    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  18. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system. (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus


    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  19. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.


    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  20. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA. (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi


    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  1. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration. (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei


    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  2. Complex shapes self-assembled from single-stranded DNA tiles. (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng


    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  3. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.


    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  4. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail:


    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  5. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.


    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  6. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop. (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S


    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  7. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija


    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  8. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids. (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R


    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  9. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.


    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  10. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor. (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling


    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  11. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  12. Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target

    Energy Technology Data Exchange (ETDEWEB)

    Mulepati, Sabin [Johns Hopkins Univ., Baltimore, MD (United States); Heroux, Annie; Bailey, Scott [Johns Hopkins Univ., Baltimore, MD (United States)


    In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of protein subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.

  13. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI. (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O


    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  14. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio


    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  15. Direct imaging of hexaamine-ruthenium(III) in domain boundaries in monolayers of single-stranded DNA

    DEFF Research Database (Denmark)

    Grubb, Mikala; Wackerbarth, Hainer; Wengel, J.


    We describe adsorption and identification of the binding sites of [Ru(NH3)(6)](3+) (RuHex) molecules in a closely packed monolayer of a 13-base ss-DNA on Au(111) electrodes by electrochemical in situ scanning tunneling microscopy (STM), cyclic voltammetry and interfacial capacitance data. In situ...

  16. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  17. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.


    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  18. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris


    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  19. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold. (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G


    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  20. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity. (United States)

    Monnet, Jordan; Kozelka, Jiří


    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Hydration of ds-DNA and ss-DNA by neutron quasielastic scattering. (United States)

    Bastos, M; Castro, V; Mrevlishvili, G; Teixeira, J


    Quasielastic neutron scattering measurements were performed in hydrated samples of ds-DNA and ss-DNA. The samples were hydrated in a high relative humidity atmosphere, and their final water content was 0.559 g H(2)O/g ds-DNA and 0.434 g H(2)O/g ss-DNA. The measurements were performed at 8 and 5.2 A for the ds-DNA sample, and at 5.2 A for the ss-DNA sample. The temperature was in both cases 298 K. Analysis of the obtained data indicates that in the ds-DNA sample we can distinguish two types of protons-those belonging to water molecules strongly attached to the ds-DNA surface and another fraction belonging to water that diffuses isotropically in a sphere of radius 2.8 A, with a local diffusion coefficient of 2.2 x 10(-5) cm(2) s(-1). For ss-DNA, on the other hand, no indication was found of motionally restricted or confined water. Further, the fraction of protons strongly attached to the ds-DNA surface corresponds to 0.16 g H(2)O/g ds-DNA, which equals the amount of water that is released by ds-DNA upon thermal denaturation, as studied by one of us (G.M.) by differential scanning calorimetry. This value also equals the difference between the critical hydration values of ds-DNA and ss-DNA, also determined by DSC. These results represent, thus, a completely independent measurement of water characteristics and behavior in ds- and ss-DNA at critical hydration values, and therefore substantiate the previous suggestions/conclusions of the results obtained by calorimetry.

  2. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.


    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  3. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.


    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  4. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager


    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  5. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.


    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  6. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.


    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  7. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  8. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.


    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  9. Specific growth rate and multiplicity of infection affect high-cell-density fermentation with bacteriophage M13 for ssDNA production. (United States)

    Kick, Benjamin; Hensler, Samantha; Praetorius, Florian; Dietz, Hendrik; Weuster-Botz, Dirk


    The bacteriophage M13 has found frequent applications in nanobiotechnology due to its chemically and genetically tunable protein surface and its ability to self-assemble into colloidal membranes. Additionally, its single-stranded (ss) genome is commonly used as scaffold for DNA origami. Despite the manifold uses of M13, upstream production methods for phage and scaffold ssDNA are underexamined with respect to future industrial usage. Here, the high-cell-density phage production with Escherichia coli as host organism was studied in respect of medium composition, infection time, multiplicity of infection, and specific growth rate. The specific growth rate and the multiplicity of infection were identified as the crucial state variables that influence phage amplification rate on one hand and the concentration of produced ssDNA on the other hand. Using a growth rate of 0.15 h -1 and a multiplicity of infection of 0.05 pfu cfu -1 in the fed-batch production process, the concentration of pure isolated M13 ssDNA usable for scaffolded DNA origami could be enhanced by 54% to 590 mg L -1 . Thus, our results help enabling M13 production for industrial uses in nanobiotechnology. Biotechnol. Bioeng. 2017;114: 777-784. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana. (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef


    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  11. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata


    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  12. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.


    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  13. Selection and Application of ssDNA Aptamers against Clenbuterol Hydrochloride Based on ssDNA Library Immobilized SELEX. (United States)

    Duan, Nuo; Gong, Wenhui; Wu, Shijia; Wang, Zhouping


    Clenbuterol hydrochloride (CLB) is often abused as additive feed for livestock to decrease adipose tissue deposition and to increase growth rate. It raises a potential risk to human health through the consumption of animal product. In this study, aptamers with higher affinity and specificity were screened through 16 selection rounds based on the ssDNA library immobilized systematic evolution of ligands by exponential enrichment (SELEX) technique. After cloning and sequencing, five aptamer candidates were picked out for affinity and specificity assays based on a graphene oxide (GO) adsorption method. The results showed that the aptamer CLB-2 binds specifically against CLB with a dissociation constant, K d , value of 76.61 ± 12.70 nM. In addition, an aptamer-based fluorescence bioassay was established for CLB analysis. The correlation between the CLB concentration and fluorescent signal was found to be linear within the range of 0.10 to 50 ng/mL with a limit of detection of 0.07 ng/mL. It has been further applied for the determination of CLB in pork samples, showing its great potential for sensitive analysis in food safety control.

  14. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der


    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  15. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores. (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei


    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  16. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage. (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime


    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  17. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.


    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  18. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol. (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  19. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude


    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  20. Double-stranded DNA dissociates into single strands when dragged into a poor solvent. (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E


    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  1. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  2. Comment on "Monomer Dynamics in Double- and Single-Stranded DNA Polymers"


    Tothova, J.; Brutovsky, B.; Lisy, V.


    It is discussed that the kinetics observed by Shusterman et al. [Phys. Rev. Lett. 92, 048303] for long dsDNA is not the Rouse one and, in fact, the macromolecule behaves (approximately) as the Zimm polymer.

  3. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin. (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo


    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  4. Determination of nanogram quantities of osmium-labeled single stranded DNA by differential pulse stripping voltammetry

    Czech Academy of Sciences Publication Activity Database

    Kizek, René; Havran, Luděk; Fojta, Miroslav; Paleček, Emil


    Roč. 55, 1/2 (2002), s. 199-121 ISSN 1567-5394 R&D Projects: GA ČR GV204/97/K084; GA ČR GA204/00/D049; GA AV ČR IAA4004108 Institutional research plan: CEZ:AV0Z5004920 Keywords : differential pulse stripping voltammetry * microdetermination of DNA * chemical modification of DNA Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  5. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  6. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.


    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  7. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)


    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  8. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.


    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  9. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio


    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  10. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate. (United States)

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav


    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  12. Oligo(dT) is not a correct native PAGE marker for single-stranded DNA

    Czech Academy of Sciences Publication Activity Database

    Kejnovská, Iva; Kypr, Jaroslav; Vorlíčková, Michaela


    Roč. 353, č. 3 (2007), s. 776-779 ISSN 0006-291X R&D Projects: GA AV ČR(CZ) IAA4004201; GA AV ČR(CZ) IAA1004201 Institutional research plan: CEZ:AV0Z50040702 Keywords : polyacrylamide gel electrophoresis * DNA length markers * oligo(dT) Subject RIV: BO - Biophysics Impact factor: 2.749, year: 2007

  13. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian


    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  14. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.


    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  15. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA. (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B


    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  17. Single stranded loops of quadruplex DNA as key benchmark for testing nucleic acids force fields

    Czech Academy of Sciences Publication Activity Database

    Fadrná, E.; Špačková, Naďa; Sarzynska, J.; Koča, J.; Orozco, M.; Cheatham III, T.E.; Kulinski, T.; Šponer, Jiří


    Roč. 5, č. 9 (2009), s. 2514-2530 ISSN 1549-9618 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA quadruplex * MD simulation * force fields Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  18. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo


    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  19. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines. (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao


    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  20. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain. (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut


    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  1. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.


    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  2. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.


    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  3. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  4. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.


    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  5. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.


    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  6. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak


    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  7. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers


    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.


    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  8. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr


    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  9. Screening and Identification of ssDNA Aptamer for Human GP73

    Directory of Open Access Journals (Sweden)

    Jingchun Du


    Full Text Available As one tumor marker of HCC, Golgi Protein 73 (GP73 is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens.

  10. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H


    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  11. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.


    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  12. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA. (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J


    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  13. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.


    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  14. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira


    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  15. A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine. (United States)

    Basso, Marcos Fernando; da Silva, José Cleydson Ferreira; Fajardo, Thor Vinícius Martins; Fontes, Elizabeth Pacheco Batista; Zerbini, Francisco Murilo


    Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Cytogenetic Markers, DNA Single-Strand Breaks, Urinary Metabolites, and DNA Repair Rates in Styrene-Exposed Lamination Workers

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Tuimala, J.; Štětina, R.; Kumar, R.; Manini, P.; Naccarati, Alessio; Maestri, L.; Vodičková, L.; Kuricová, Miroslava; Jarventaus, H.; Majvalková, Z.; Hirvonen, A.; Imbriani, M.; Mutti, A.; Norppa, H.; Hemminki, K.


    Roč. 112, č. 8 (2004), s. 867-871 ISSN 0091-6765 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 3.929, year: 2004

  17. High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases

    DEFF Research Database (Denmark)

    Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping


    Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point...... mutation, (ii) targeted genomic deletion of up to 100 kb and (iii) targeted insertion of small genetic elements concomitant with large genomic deletions....

  18. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  19. ssDNA degradation along capillary electrophoresis process using a Tris buffer. (United States)

    Ric, Audrey; Ong-Meang, Varravaddheay; Poinsot, Verena; Martins-Froment, Nathalie; Chauvet, Fabien; Boutonnet, Audrey; Ginot, Frédéric; Ecochard, Vincent; Paquereau, Laurent; Couderc, François


    Tris-Acetate buffer is currently used in the selection and the characterization of ssDNA by capillary electrophoresis (CE). By applying high voltage, the migration of ionic species into the capillary generates a current that induces water electrolysis. This phenomenon is followed by the modification of the pH and the production of Tris derivatives. By injecting ten times by capillary electrophoresis ssDNA (50 nM), the whole oligonucleotide was degraded. In this paper, we will show that the Tris buffer in the running vials is modified along the electrophoretic process by electrochemical reactions. We also observed that the composition of the metal ions changes in the running buffer vials. This phenomenon, never described in CE, is important for fluorescent ssDNA analysis using Tris buffer. The oligonucleotides are degraded by electrochemically synthesized species (present in the running Tris vials) until it disappears, even if the separation buffer in the capillary is clean. To address these issues, we propose to use a sodium phosphate buffer that we demonstrate to be electrochemically inactive. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control. (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A


    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  2. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto


    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  3. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.


    Roč. 148, č. 11 (2017), s. 2011-2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  4. Atomic force spectroscopic and SPR kinetic analysis of long circular and short ssDNA molecules interacting with single-stranded DNA-binding protein

    Czech Academy of Sciences Publication Activity Database

    Horáčková, V.; Hlaváček, Antonín; Čundlerová, V.; Pastucha, M.; Skládal, P.


    Roč. 148, č. 11 (2017), s. 2011- 2018 ISSN 0026-9247 Institutional support: RVO:68081715 Keywords : microscopy * biology * specificity * surface Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 1.282, year: 2016

  5. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha


    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA. (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong


    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  7. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family. (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro


    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  8. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  9. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB)


    van Loon, Barbara; Samson, Leona D.


    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known...

  10. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.


    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  11. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)


    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  12. Cyclic voltammetry of echinomycin and its interaction with double-stranded and single-stranded DNA adsorbed at the electrode

    Czech Academy of Sciences Publication Activity Database

    Jelen, František; Erdem, A.; Paleček, Emil


    Roč. 55, 1/2 (2002), s. 165-167 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004901; GA ČR GV204/97/K084 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemistry of DNA * interaction of DNA with echinomycin * hanging mercury drop electrode Subject RIV: BO - Biophysics Impact factor: 1.463, year: 2002

  13. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS. (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun


    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  14. Guanine quadruplex monoclonal antibody 1H6 cross-reacts with restrained thymidine-rich single stranded DNA

    NARCIS (Netherlands)

    Kazemier, Hinke G.; Paeschke, Katrin; Lansdorp, Peter M.


    Previously we reported the production and characterization of monoclonal antibody 1H6 raised against (T(4)G(4))(2) intermolecular guanine quadruplex (G4) DNA structures (Henderson A. et al. (2014) Nucleic Acids Res., 42, 860-869; Hoffmann R. F. et al. (2016) Nucleic Acids Res., 44, 152-163). It was

  15. Structural insights of the ssDNA binding site in the multifunctional endonuclease AtBFN2 from Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Tsung-Fu Yu

    Full Text Available The multi S1/P1 nuclease AtBFN2 (EC encoded by the Arabidopsis thaliana At1g68290 gene is a glycoprotein that digests RNA, ssDNA, and dsDNA. AtBFN2 depends on three zinc ions for cleaving DNA and RNA at 3'-OH to yield 5'-nucleotides. In addition, AtBFN2's enzymatic activity is strongly glycan dependent. Plant Zn(2+-dependent endonucleases present a unique fold, and belong to the Phospholipase C (PLC/P1 nuclease superfamily. In this work, we present the first complete, ligand-free, AtBFN2 crystal structure, along with sulfate, phosphate and ssDNA co-crystal structures. With these, we were able to provide better insight into the glycan structure and possible enzymatic mechanism. In comparison with other nucleases, the AtBFN2/ligand-free and AtBFN2/PO4 models suggest a similar, previously proposed, catalytic mechanism. Our data also confirm that the phosphate and vanadate can inhibit the enzyme activity by occupying the active site. More importantly, the AtBFN2/A5T structure reveals a novel and conserved secondary binding site, which seems to be important for plant Zn(2+-dependent endonucleases. Based on these findings, we propose a rational ssDNA binding model, in which the ssDNA wraps itself around the protein and the attached surface glycan, in turn, reinforces the binding complex.

  16. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong


    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  17. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  18. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA. (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S


    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  19. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes. (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M


    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  20. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy


    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  1. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray. (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  2. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino


    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  3. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.


    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  4. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast. (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A


    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  5. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries. (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan


    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  6. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region. (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter


    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  7. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian


    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  8. Novel ssDNA Viruses Detected in the Virome of Bleached, Habitat-Forming Kelp Ecklonia radiata

    Directory of Open Access Journals (Sweden)

    Douglas T. Beattie


    Full Text Available Kelp forests provide essential habitats for organisms in temperate rocky shores. Loss of kelp forests has occurred over large areas in a number of temperate regions, including in Australia, where the dominant kelp Ecklonia radiata has been lost from substantial areas of the shoreline. Loss of E. radiata has been associated with environmental stressors, including increased temperature and anthropogenic contaminants, as well as biological factors, such as herbivory. Disease may also play a role, but there is little information on the role of disease in the loss of kelp from coastal ecosystems or on the potential role of pathogenic microorganisms, such as viruses. E. radiata across much of its distribution in Australia can develop a “bleached” phenotype, which may be a disease. To investigate whether the phenotype was associated with a potential viral agent, we shotgun sequenced viral particles that were isolated from kelp with normal (healthy and bleached phenotypes. Each virome consisted of ~380,000 reads, of which ~25% were similar to known viruses. All samples were dominated by bacteriophages, but novel ssDNA virus sequences were detected that were almost exclusively in viromes from the bleached kelp phenotype. These ssDNA viruses are covered by 11 contigs that contained complete capsids and characteristic rep genes that were 30–60% similar to those of circular, Rep-encoding ssDNA viruses (CRESS-DNA viruses. CRESS-DNA viruses have not previously been described from macroalgae, and the rep genes were similar to CRESS-DNA viruses from marine water samples, snails, crabs, anemones, but also dragonflies. This raises the interesting possibility that the kelp could be a vector of the CRESS-DNA viruses to other organisms that are associated with the bleached state.

  9. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.


    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  10. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley


    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  11. mtSSB may sequester UNG1 at mitochondrial ssDNA and delay uracil processing until the dsDNA conformation is restored

    DEFF Research Database (Denmark)

    Wollen Steen, Kristian; Doseth, Berit; westbye, Marianne


    identified a putative surface motif in mtSSB that may recruit UNG1 to DNA-bound mtSSB. We suggest that the massive amount of mtSSB in mitochondria effectively prevents processing of uracil and other types of damaged bases to avoid introduction of nicks in single-stranded mtDNA formed during replication....... Local enrichment of UNG1 at DNA-bound mtSSB may furthermore facilitate rapid access to- and processing of the damage once the dsDNA conformation is restored. This could be of potential biological importance, since mitochondria have no or limited capacity for homologous recombination to process nicks...

  12. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)


    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  13. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family. (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław


    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  14. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)


    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  15. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.


    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  16. Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP.

    Directory of Open Access Journals (Sweden)

    Natalia Guerra-Pérez

    Full Text Available A poly (A-binding protein from Leishmania infantum (LiPABP has been recently cloned and characterized in our laboratory. Although this protein shows a very high homology with PABPs from other eukaryotic organisms including mammals and other parasites, exist divergences along the sequence that convert them in potential diagnostic markers and/or therapeutics targets. Aptamers are oligonucleotide ligands that are selected in vitro by their affinity and specificity for the target as a consequence of the particular tertiary structure that they are able to acquire depending on their sequence. Development of high-affinity molecules with the ability to recognize specifically Leishmania proteins is essential for the progress of this kind of study.We have selected a ssDNA aptamer population against a recombinant 6xHIS-LiPABP protein (rLiPABP that is able to recognize the target with a low Kd. Cloning, sequencing and in silico analysis of the aptamers obtained from the population yielded three aptamers (ApPABP#3, ApPABP#7 and ApPABP#11 that significantly bound to PABP with higher affinity than the naïve population. These aptamers were analyzed by ELONA and slot blot to establish affinity and specificity for rLiPABP. Results demonstrated that the three aptamers have high affinity and specificity for the target and that they are able to detect an endogenous LiPABP (eLiPABP protein amount corresponding to 2500 L. infantum promastigotes in a significant manner. The functional analysis of the aptamers also revealed that ApPABP#11 disrupts the binding of both Myc-LiPABP and eLiPABP to poly (A in vitro. On the other hand, these aptamers are able to bind and purify LiPABP from complex mixes.Results presented here demonstrate that aptamers represent new reagents for characterization of LiPABP and that they can affect LiPABP activity. At this respect, the use of these aptamers as therapeutic tool affecting the physiological role of PABP has to be analyzed.

  17. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity. (United States)

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong


    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail:

  18. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart. (United States)

    Zeng, Huawei; Saari, Jack T


    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  19. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  20. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  1. Phenolic extracts of brewers' spent grain (BSG) as functional ingredients - assessment of their DNA protective effect against oxidant-induced DNA single strand breaks in U937 cells. (United States)

    McCarthy, Aoife L; O'Callaghan, Yvonne C; Connolly, Alan; Piggott, Charles O; Fitzgerald, Richard J; O'Brien, Nora M


    Brewers' spent grain (BSG), a by-product of the brewing industry, contains high amounts of phenolic acids, which have antioxidant effects. The present study examined the ability of BSG extracts to protect against the genotoxic effects of oxidants, hydrogen peroxide (H(2)O(2)), 3-morpholinosydnonimine hydrochloride (SIN-1), 4-nitroquinoline 1-oxide (4-NQO) and tert-butylhydroperoxide (t-BOOH) in U937 cells. Four pale (P1-P4) and four black (B1-B4) BSG extracts were investigated. U937 cells were pre-incubated with BSG extracts, exposed to the oxidants and the DNA damage was measured by the Comet assay. The black BSG extracts (B1-B4) significantly protected against H(2)O(2)-induced DNA damage. Extract B2, which had the highest phenol content, provided the greatest protection. Extracts P2, B2, B3 and B4 provided significant protection against SIN-1-induced DNA damage. None of the extracts protected against DNA damage induced by t-BOOH and 4-NQO. The DNA protective effects of the BSG phenolic extracts may be related to iron chelation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Effect of temperature and ionic strength on the dissociation kinetics and lifetime of PNA-DNA triplexes

    DEFF Research Database (Denmark)

    Kosaganov, Y N; Stetsenko, D A; Lubyako, E N


    Dissociation kinetics of triplexes formed by molecules of peptide nucleic acid (PNA) and DNA have been studied. The complexes consisted of oligomeric PNA containing 10 thymine bases and the dA(10) target incorporated in single-stranded (ssDNA) or double-stranded DNA (dsDNA). Their dissociation wa...

  3. The structure and function of replication protein A in DNA replication. (United States)

    Prakash, Aishwarya; Borgstahl, Gloria E O


    In all organisms from bacteria and archaea to eukarya, single-stranded DNA binding proteins play an essential role in most, if not all, nuclear metabolism involving single-stranded DNA (ssDNA). Replication protein A (RPA), the major eukaryotic ssDNA binding protein, has two important roles in DNA metabolism: (1) in binding ssDNA to protect it and to keep it unfolded, and (2) in coordinating the assembly and disassembly of numerous proteins and protein complexes during processes such as DNA replication. Since its discovery as a vital player in the process of replication, RPAs roles in recombination and DNA repair quickly became evident. This chapter summarizes the current understanding of RPA's roles in replication by reviewing the available structural data, DNA-binding properties, interactions with various replication proteins, and interactions with DNA repair proteins when DNA replication is stalled.

  4. The Mycoplasma pneumoniae MPN229 gene encodes a protein that selectively binds single-stranded DNA and stimulates Recombinase A-mediated DNA strand exchange

    NARCIS (Netherlands)

    M. Sluijter (Marcel); T.A. Hoogenboezem (Thomas); N.G. Hartwig (Nico); C. Vink (Cornelis)


    textabstractBackground. Mycoplasma pneumoniae has previously been characterized as a micro-organism that is genetically highly stable. In spite of this genetic stability, homologous DNA recombination has been hypothesized to lie at the basis of antigenic variation of the major surface protein, P1,

  5. Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX (United States)

    Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong


    Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223

  6. VirE2: a unique ssDNA-compacting molecular machine.

    Directory of Open Access Journals (Sweden)

    Wilfried Grange


    Full Text Available The translocation of single-stranded DNA (ssDNA across membranes of two cells is a fundamental biological process occurring in both bacterial conjugation and Agrobacterium pathogenesis. Whereas bacterial conjugation spreads antibiotic resistance, Agrobacterium facilitates efficient interkingdom transfer of ssDNA from its cytoplasm to the host plant cell nucleus. These processes rely on the Type IV secretion system (T4SS, an active multiprotein channel spanning the bacterial inner and outer membranes. T4SSs export specific proteins, among them relaxases, which covalently bind to the 5' end of the translocated ssDNA and mediate ssDNA export. In Agrobacterium tumefaciens, another exported protein-VirE2-enhances ssDNA transfer efficiency 2000-fold. VirE2 binds cooperatively to the transferred ssDNA (T-DNA and forms a compact helical structure, mediating T-DNA import into the host cell nucleus. We demonstrated-using single-molecule techniques-that by cooperatively binding to ssDNA, VirE2 proteins act as a powerful molecular machine. VirE2 actively pulls ssDNA and is capable of working against 50-pN loads without the need for external energy sources. Combining biochemical and cell biology data, we suggest that, in vivo, VirE2 binding to ssDNA allows an efficient import and pulling of ssDNA into the host. These findings provide a new insight into the ssDNA translocation mechanism from the recipient cell perspective. Efficient translocation only relies on the presence of ssDNA binding proteins in the recipient cell that compacts ssDNA upon binding. This facilitated transfer could hence be a more general ssDNA import mechanism also occurring in bacterial conjugation and DNA uptake processes.

  7. DNA adsorption characteristics of hollow spherule allophane nano-particles

    International Nuclear Information System (INIS)

    Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo


    To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5′-monophosphate (5′-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5′-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al–OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. - Highlights: • The interaction between phosphate groups of ss-DNA and Al–OH groups • Higher energy barrier for the adsorption of ss-DNA • The individual ss-DNA with mono-layer coverage of the allophane clustered particle

  8. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.


    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  9. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.


    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  10. Green fluorescent protein fused to the C terminus of RAD51 specifically interferes with secondary DNA binding by the RAD51-ssDNA complex. (United States)

    Kobayashi, Wataru; Sekine, Satoshi; Machida, Shinichi; Kurumizaka, Hitoshi


    Green fluorescent protein (GFP), fused to the N or C terminus of a protein of interest, is widely used to monitor the localization and mobility of proteins in cells. RAD51 is an essential protein that functions in mitotic DNA repair and meiotic chromosome segregation by promoting the homologous recombination reaction. A previous genetic study with Arabidopsis thaliana revealed that GFP fused to the C terminus of RAD51 (RAD51-GFP) inhibits mitotic DNA repair, but meiotic homologous recombination remained unaffected. To determine how the C-terminal GFP specifically inhibits mitotic DNA repair by RAD51, we purified rice RAD51A1-GFP and RAD51A2-GFP, and performed biochemical analyses. Interestingly, purified RAD51A1-GFP and RAD51A2-GFP are proficient in DNA binding and ATP hydrolysis. However, nucleoprotein complexes containing single-stranded DNA and RAD51A1-GFP or RAD51A2-GFP are significantly defective in binding to the second DNA molecule (secondary DNA binding), and consequently fail to catalyze homologous pairing. In contrast, RAD51A1-GFP and RAD51A2-GFP efficiently stimulated homologous pairing promoted by the meiosis-specific RAD51 isoform DMC1. These biochemical characteristics are well conserved in human RAD51-GFP. Therefore, GFP fused to the C terminus of RAD51 abolishes the homologous pairing activity of RAD51 by disrupting secondary DNA binding, but does not affect its DMC1-stimulating activity.

  11. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair. (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W


    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti


    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  13. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.


    Cleary, J M; Ray, D S


    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  14. Imidazole-free purification of His3-tagged recombinant proteins using ssDNA aptamer-based affinity chromatography. (United States)

    Bartnicki, Filip; Kowalska, Ewa; Pels, Katarzyna; Strzalka, Wojciech


    Immobilized metal ion affinity chromatography (IMAC) is widely used for the purification of many different His6-tagged recombinant proteins. On the one hand, it is a powerful technique but on the other hand it has its disadvantages. In this report, we present the development of a unique ssDNA aptamer for the purification of His3-tagged recombinant proteins. Our study shows that stability of the His3-tag/H3T aptamer complex can be controlled by the sodium ion concentration. Based on this feature, we demonstrate that H3T aptamer resin was successfully employed for the purification of three out of four tested His3-tagged recombinant proteins from an E. coli total protein extract using imidazole-free buffers. Finally, we show that the purity of His3-tagged proteins is superior when purified with the help of the H3T aptamer in comparison with Ni-NTA resin. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. RpoS Regulates a Novel Type of Plasmid DNA Transfer in Escherichia coli


    Zhang, Yanmei; Shi, Chunyu; Yu, Jiafei; Ren, Jingjing; Sun, Dongchang


    Spontaneous plasmid transformation of Escherichia coli is independent of the DNA uptake machinery for single-stranded DNA (ssDNA) entry. The one-hit kinetic pattern of plasmid transformation indicates that double-stranded DNA (dsDNA) enters E. coli cells on agar plates. However, DNA uptake and transformation regulation remain unclear in this new type of plasmid transformation. In this study, we developed our previous plasmid transformation system and induced competence at early stationary pha...

  16. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi


    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  17. Previously unknown evolutionary groups dominate the ssDNA gokushoviruses in oxic and anoxic waters of a coastal marine environment

    Directory of Open Access Journals (Sweden)

    Jessica M. Labonté


    Full Text Available Metagenomic studies have revealed that ssDNA phages from the family Microviridae subfamily Gokushovirinae are widespread in aquatic ecosystems. It is hypothesized that gokushoviruses occupy specialized niches, resulting in differences among genotypes traversing water column gradients. Here, we use degenerate primers that amplify a fragment of the gene encoding the major capsid protein to examine the diversity of gokushoviruses in Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia. Amplicon sequencing of samples from the mixed oxic surface (10 m and deeper anoxic (200 m layers indicated a diverse assemblage of gokushoviruses, with greater richness at 10 m than 200 m. A comparison of amplicon sequences with sequences selected on the basis of RFLP patterns from eight surface samples collected over a one-year period revealed that gokushovirus diversity was higher in spring and summer during stratification, and lower in fall and winter after deep-water renewal, consistent with seasonal variability within gokushovirus populations. Phylogenetic analysis of clustered amplicons revealed at least five new phylogenetic clades of previously unknown sequences, with the most abundant group associated with viruses that infect SUP05, a ubiquitous and abundant member of marine oxygen minimum zones. Our results provide persuasive evidence that, while specific gokushovirus genotypes may have a narrow host range, hosts for gokushoviruses in Saanich Inlet consist of a wide range of bacterial taxa, including SUP05, a taxonomic clade of gamma proteobacterial sulfur oxidizers. Members of SUP05 are abundant in Saanich Inlet and involved in carbon, nitrogen, and sulfur cycling along the redoxline; thus, gokushoviruses are likely important mortality agents of these bacteria and have consequent influences on biogeochemical cycling in this system.

  18. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms. (United States)

    Swanson, Colby A; Sliwinski, Marek K


    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  19. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    the other hand, if there is a negative torsional stress, a pulling force as small as 0.3 pN can distort the native structure of DNA considerably [5,6]. Related to the latter, there has been recent progress in understanding the force–extension curves of single-stranded DNA. (ssDNA) and RNA [7–12]. Many distinct transitions have ...

  20. Structural dynamics and ssDNA binding activity of the three N-terminal domains of the large subunit of Replication Protein A from small angle X-ray scattering

    Energy Technology Data Exchange (ETDEWEB)

    Pretto, Dalyir I.; Tsutakawa, Susan; Brosey, Chris A.; Castillo, Amalchi; Chagot, Marie-Eve; Smith, Jarrod A.; Tainer, John A.; Chazin, Walter J.


    Replication Protein A (RPA) is the primary eukaryotic ssDNA binding protein utilized in diverse DNA transactions in the cell. RPA is a heterotrimeric protein with seven globular domains connected by flexible linkers, which enable substantial inter-domain motion that is essential to its function. Small angle X-ray scattering (SAXS) experiments on two multi-domain constructs from the N-terminus of the large subunit (RPA70) were used to examine the structural dynamics of these domains and their response to the binding of ssDNA. The SAXS data combined with molecular dynamics simulations reveal substantial interdomain flexibility for both RPA70AB (the tandem high affinity ssDNA binding domains A and B connected by a 10-residue linker) and RPA70NAB (RPA70AB extended by a 70-residue linker to the RPA70N protein interaction domain). Binding of ssDNA to RPA70NAB reduces the interdomain flexibility between the A and B domains, but has no effect on RPA70N. These studies provide the first direct measurements of changes in orientation of these three RPA domains upon binding ssDNA. The results support a model in which RPA70N remains structurally independent of RPA70AB in the DNA bound state and therefore freely available to serve as a protein recruitment module.

  1. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction. (United States)

    Zhou, X R; Christie, P J


    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  2. A new structural framework for integrating replication protein A into DNA processing machinery

    Energy Technology Data Exchange (ETDEWEB)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan; Heller, William; Rambo, Robert; Tainer, John; Ivanov, Ivaylo; Chazin, Walter


    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.

  3. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.


    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  4. False positives and false negatives measure less than 0.001% in labeling ssDNA with osmium tetroxide 2,2’-bipyridine

    Directory of Open Access Journals (Sweden)

    Anastassia Kanavarioti


    Full Text Available Osmium tetroxide 2,2’-bipyridine (OsBp is known to react with pyrimidines in ssDNA and preferentially label deoxythymine (T over deoxycytosine (C. The product, osmylated DNA, was proposed as a surrogate for nanopore-based DNA sequencing due to OsBp’s “perfect” label attributes. Osmylated deoxyoligos translocate unassisted and measurably slow via sub-2 nm SiN solid-state nanopores, as well as via the alpha-hemolysin (α-HL pore. Both nanopores discriminate clearly between osmylated and intact nucleobase; α-HL was also shown to discriminate between osmylated T and osmylated C. Experiments presented here confirm that the kinetics of osmylation are comparable for short oligos and long ssDNA and show that pyrimidine osmylation is practically complete in two hours at room temperature with less than 15 mM OsBp. Under the proposed labeling conditions: deoxyoligo backbone degradation measures less than 1/1,000,000; false positives such as osmylated deoxyadenine (A and osmylated deoxyguanine (G measure less than 1/100,000; false negatives, i.e., unosmylated C measure less than 1/10,000; and unosmylated T must measure substantially lower than 1/10,000 due to the 27-fold higher reactivity of T compared to C. However, osmylated C undergoes degradation that amounts to about 1–2% for the duration of the labeling protocol. This degradation may be further characterized, possibly suppressed, and the properties of the degradation products via nanopore translocation can be evaluated to assure base calling quality in a DNA sequencing effort.

  5. Human RAD52 Captures and Holds DNA Strands, Increases DNA Flexibility, and Prevents Melting of Duplex DNA: Implications for DNA Recombination

    Directory of Open Access Journals (Sweden)

    Ineke Brouwer


    Full Text Available Human RAD52 promotes annealing of complementary single-stranded DNA (ssDNA. In-depth knowledge of RAD52-DNA interaction is required to understand how its activity is integrated in DNA repair processes. Here, we visualize individual fluorescent RAD52 complexes interacting with single DNA molecules. The interaction with ssDNA is rapid, static, and tight, where ssDNA appears to wrap around RAD52 complexes that promote intra-molecular bridging. With double-stranded DNA (dsDNA, interaction is slower, weaker, and often diffusive. Interestingly, force spectroscopy experiments show that RAD52 alters the mechanics dsDNA by enhancing DNA flexibility and increasing DNA contour length, suggesting intercalation. RAD52 binding changes the nature of the overstretching transition of dsDNA and prevents DNA melting, which is advantageous for strand clamping during or after annealing. DNA-bound RAD52 is efficient at capturing ssDNA in trans. Together, these effects may help key steps in DNA repair, such as second-end capture during homologous recombination or strand annealing during RAD51-independent recombination reactions.

  6. An approach to sequence DNA without tagging (United States)

    Niu, Sanjun; Saraf, Ravi F.


    Microarray technology is playing an increasingly important role in biology and medicine and its application to genomics for gene expression analysis has already reached the market with a variety of commercially available instruments. In these combinatorial analysis methods, known probe single-strand DNA (ssDNA) 'primers' are attached in clusters of typically 100 µm × 100 µm pixels. Each pixel of the array has a slightly different sequence. On exposure to 'unknown' target ssDNA, the pixels with the right complementary probe ssDNA sequence convert to double-stranded DNA (dsDNA) by a hybridization reaction. To transduct the conversion of the pixel to dsDNA, the target ssDNA is labelled with a photoluminescent tag during the polymerase chain reaction (PCR) amplification process. Due to the statistical distribution of the tags in the target ssDNA, it becomes significantly difficult to implement these methods as a diagnostic tool in a pathology laboratory. A method to sequence DNA without tagging the molecule is developed. The fabrication process is compatible with current microelectronics and (emerging) soft-material fabrication technologies, allowing the method to be integrable with micro-electromechanical systems (MEMS) and lab-on-a-chip devices. An estimated sensitivity of 10-12 g on a 1 cm2 device area is obtained.

  7. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair. (United States)

    de Laat, W L; Appeldoorn, E; Sugasawa, K; Weterings, E; Jaspers, N G; Hoeijmakers, J H


    The human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a defined polarity; a strong ssDNA interaction domain of hRPA is positioned at the 5' side of its binding region, a weak ssDNA-binding domain resides at the 3' side. Polarity appears crucial for positioning of the excision repair nucleases XPG and ERCC1-XPF on the DNA. With the 3'-oriented side of hRPA facing a duplex ssDNA junction, hRPA interacts with and stimulates ERCC1-XPF, whereas the 5'-oriented side of hRPA at a DNA junction allows stable binding of XPG to hRPA. Our data pinpoint hRPA to the undamaged strand during nucleotide excision repair. Polarity of hRPA on ssDNA is likely to contribute to the directionality of other hRPA-dependent processes as well.

  8. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D


    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  9. Electrochemical impedance-based DNA sensor using a modified single walled carbon nanotube electrode

    Energy Technology Data Exchange (ETDEWEB)

    Weber, Jessica E. [Department of Mechanical Engineering, University of South Florida, Tampa, FL (United States); Nanomaterials and Nanomanufacturing Research Center, University of South Florida, Tampa, FL (United States); Pillai, Shreekumar [Center for NanoBiotechnology Research, Alabama State University, Montgomery, AL (United States); Ram, Manoj Kumar, E-mail: [Department of Mechanical Engineering, University of South Florida, Tampa, FL (United States); Nanomaterials and Nanomanufacturing Research Center, University of South Florida, Tampa, FL (United States); Kumar, Ashok [Department of Mechanical Engineering, University of South Florida, Tampa, FL (United States); Nanomaterials and Nanomanufacturing Research Center, University of South Florida, Tampa, FL (United States); Singh, Shree R. [Center for NanoBiotechnology Research, Alabama State University, Montgomery, AL (United States)


    Carbon nanotubes have become promising functional materials for the development of advanced electrochemical biosensors with novel features which could promote electron-transfer with various redox active biomolecules. This paper presents the detection of Salmonella enterica serovar Typhimurium using chemically modified single walled carbon nanotubes (SWNTs) with single stranded DNA (ssDNA) on a polished glassy carbon electrode. Hybridization with the corresponding complementary ssDNA has shown a shift in the impedance studies due to a higher charge transfer in ssDNA. The developed biosensor has revealed an excellent specificity for the appropriate targeted DNA strand. The methodologies to prepare and functionalize the electrode could be adopted in the development of DNA hybridization biosensor.

  10. Gene expression of benthic amphipods (genus: Diporeia in relation to a circular ssDNA virus across two Laurentian Great Lakes

    Directory of Open Access Journals (Sweden)

    Kalia S.I. Bistolas


    Full Text Available Circular rep-encoding ssDNA (CRESS-DNA viruses are common constituents of invertebrate viral consortia. Despite their ubiquity and sequence diversity, the effects of CRESS-DNA viruses on invertebrate biology and ecology remain largely unknown. This study assessed the relationship between the transcriptional profile of benthic amphipods of genus Diporeia and the presence of the CRESS-DNA virus, LM29173, in the Laurentian Great Lakes to provide potential insight into the influence of these viruses on invertebrate gene expression. Twelve transcriptomes derived from Diporeia were compared, representing organisms from two amphipod haplotype clades (Great Lakes Michigan and Superior, defined by COI barcode sequencing with varying viral loads (up to 3 × 106 genome copies organism−1. Read recruitment to de novo assembled transcripts revealed 2,208 significantly over or underexpressed contigs in transcriptomes with above average LM29173 load. Of these contigs, 31.5% were assigned a putative function. The greatest proportion of annotated, differentially expressed transcripts were associated with functions including: (1 replication, recombination, and repair, (2 cell structure/biogenesis, and (3 post-translational modification, protein turnover, and chaperones. Contigs putatively associated with innate immunity displayed no consistent pattern of expression, though several transcripts were significantly overexpressed in amphipods with high viral load. Quantitation (RT-qPCR of target transcripts, non-muscular myosin heavy chain, β-actin, and ubiquitin-conjugating enzyme E2, corroborated transcriptome analysis and indicated that Lake Michigan and Lake Superior amphipods with high LM29173 load exhibit lake-specific trends in gene expression. While this investigation provides the first comparative survey of the transcriptional profile of invertebrates of variable CRESS-DNA viral load, additional inquiry is required to define the scope of host

  11. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.


    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  12. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)


    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  13. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.


    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  14. AtTRB1–3 Mediates Structural Changes in AtPOT1b to Hold ssDNA


    Jaiswal, Amit


    POT from Arabidopsis thaliana is a member of shelterin complex and belongs to Telo_bind protein family. Three homologs are reported, namely, AtPOT1a, AtPOT1b, and AtPOT1c, where AtPOT1b is involved in genomic stability and chromosome end protection by providing necessary grip to G-rich region of telomeric DNA for telomerase assembly. Telomeric binding factors (TRB1–3) physically interact with POT with no known functionality. In this work attempt has been made to elucidate the reason behind th...

  15. Gene Specific Impedimetric Bacterial DNA Sensor for Rheumatic Heart Disease. (United States)

    Singh, Swati; Kaushal, Ankur; Gupta, Sunil; Kumar, Ashok


    An impedimetric mga gene specific DNA sensor was developed by immobilization of single stranded DNA probe onto the screen printed modified gold-dendrimer nanohybrid composite electrode for early and rapid detection of S. pyogenes in human throat swab samples causing rheumatic heart disease. Electrochemical impedance response was measured after hybridization with bacterial single stranded genomic DNA (ssG-DNA) with probe. The sensor was found highly specific to S. pyogenes and can detect as low as 0.01 ng ssDNA in 6 µL sample only in 30 min. The nanohybrid sensor was also tested with non-specific pathogens and characterized by FTIR. An early detection of the pathogen S. pyogenes in human can save damage of mitral and aortic heart valves (rheumatic heart disease) by proper medical care.

  16. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.


    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  17. RecO protein initiates DNA recombination and strand annealing through two alternative DNA binding mechanisms. (United States)

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey


    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode. (United States)

    Ahour, F; Shamsi, A


    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Thermodynamics of the DNA structural selectivity of the Pol I DNA polymerases from Escherichia coli and Thermus aquaticus. (United States)

    Wowor, Andy J; Datta, Kausiki; Brown, Hiromi S; Thompson, Gregory S; Ray, Sreerupa; Grove, Anne; LiCata, Vince J


    Understanding the thermodynamics of substrate selection by DNA polymerase I is important for characterizing the balance between replication and repair for this enzyme in vivo. Due to their sequence and structural similarities, Klenow and Klentaq, the large fragments of the Pol I DNA polymerases from Escherichia coli and Thermus aquaticus, are considered functional homologs. Klentaq, however, does not have a functional proofreading site. Examination of the DNA binding thermodynamics of Klenow and Klentaq to different DNA structures: single-stranded DNA (ss-DNA), primer-template DNA (pt-DNA), and blunt-end double-stranded DNA (ds-DNA) show that the binding selectivity pattern is similar when examined across a wide range of salt concentration, but can significantly differ at any individual salt concentration. For both proteins, binding of single-stranded DNA shifts from weakest to tightest binding of the three structures as the salt concentration increases. Both Klenow and Klentaq release two to three more ions when binding to pt-DNA and ds-DNA than when binding to ss-DNA. Klenow exhibits significant differences in the Delta C(p) of binding to pt-DNA versus ds-DNA, and a difference in pI for these two complexes, whereas Klentaq does not, suggesting that Klenow and Klentaq discriminate between these two structures differently. Taken together, the data suggest that the two polymerases bind ds-DNA very differently, but that both bind pt-DNA and ss-DNA similarly, despite the absence of a proofreading site in Klentaq. (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)


    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  1. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth


    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  2. Structural changes of linear DNA molecules induced by cisplatin

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhiguo, E-mail: [State Engineering Laboratory of Bio-Resource Eco-Utilization, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie [State Engineering Laboratory of Bio-Resource Eco-Utilization, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China)


    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  3. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes


    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar


    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  4. Magnetic porous carbon nanocomposites derived from metal-organic frameworks as a sensing platform for DNA fluorescent detection

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Hongliang, E-mail:; Tang, Gonge; Wang, Zhixiong; Li, Qian; Gao, Jie; Wu, Shimeng


    Metal-organic frameworks (MOFs) have emerged as very fascinating functional materials due to their tunable nature and diverse applications. In this work, we prepared a magnetic porous carbon (MPC) nanocomposite by employing iron-containing MOFs (MIL-88A) as precursors through a one-pot thermolysis method. It was found that the MPC can absorb selectively single-stranded DNA (ssDNA) probe to form MPC/ssDNA complex and subsequently quench the labelled fluorescent dye of the ssDNA probe, which is resulted from the synergetic effect of magnetic nanoparticles and carbon matrix. Upon the addition of complementary target DNA, however, the absorbed ssDNA probe could be released from MPC surface by forming double-stranded DNA with target DNA, and accompanied by the recovery of the fluorescence of ssDNA probe. Based on these findings, a sensing platform with low background signal for DNA fluorescent detection was developed. The proposed sensing platform exhibits high sensitivity with detection limit of 1 nM and excellent selectivity to specific target DNA, even single-base mismatched nucleotide can be distinguished. We envision that the presented study would provide a new perspective on the potential applications of MOF-derived nanocomposites in biomedical fields. - Highlights: • A MOF-derived magnetic porous carbon-based DNA fluorescent sensor was developed. • The MPC can absorb selectively single-stranded DNA probe and subsequently quench its labelled fluorescent dye. • The DNA fluorescent sensor showed excellent selectivity and high sensitivity.

  5. Discovery of a novel circular DNA virus in the Forbes sea star, Asterias forbesi. (United States)

    Fahsbender, Elizabeth; Hewson, Ian; Rosario, Karyna; Tuttle, Allison D; Varsani, Arvind; Breitbart, Mya


    A single-stranded DNA (ssDNA) virus, Asterias forbesi-associated circular virus (AfaCV), was discovered in a Forbes sea star displaying symptoms of sea star wasting disease (SSWD). The AfaCV genome organization is typical of circular Rep-encoding ssDNA (CRESS-DNA) viruses and is similar to that of members of the family Circoviridae. PCR-based surveys indicate that AfaCV is not clearly associated with SSWD, whereas the sea star-associated densovirus (SSaDV), recently implicated in SSWD in the Pacific, was prevalent in symptomatic specimens. AfaCV represents the first CRESS-DNA virus detected in echinoderms, adding to the growing diversity of these viruses recently recovered from invertebrates.

  6. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion. (United States)

    Nowarski, Roni; Kotler, Moshe


    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.

  7. Solid-state nanopores: A new platform for DNA biomarker discovery (United States)

    Marshall, Michael M.

    Solid-state (SS) nanopores emerged as a molecular detection platform in 2001, offering many advantages over their biological counterparts, α-hemolysin nanopores (α-HL). These advantages include better chemical, electrical, mechanical, and thermal stability, as well as size tunability and device integration. In addition, the size of α-HL restricts its application to translocations of single-stranded polynucleotides (ssDNA and ssRNA). This research project focused on developing a SS-nanopore platform for biomarker detection, based on differentiating ssDNA and double-stranded DNA (dsDNA) at the single-molecule scale. Reported dsDNA translocation measurements result in an average residence time of ~ 30 ns/bp, so the temporal resolution required for detection of small DNA duplexes can exceed available bandwidth limitations. To address this issue, several system parameters were explored in order to slow down translocation speed, thereby increasing temporal resolution and signal-to-noise ratio. These parameters included: applied voltage, pH, pore geometry, DNA binding agents, salt composition and concentration, and temperature. Experimental findings showed that SS-nanopores can be precisely fabricated using a controlled helium ion milling technique, acidic conditions cause DNA depurination that results in slower translocation durations, and single-stranded binding proteins (SSBs) bind preferentially to ssDNA, forming complexes with distinct translocation characteristics that permit large (> 7 kb) ds- and ssDNA to be effectively distinguished. Together, these data show that SS-nanopores can serve as a tool to electronically detect the presence and relative concentration of target DNA molecules with ultrahigh sensitivity, thus demonstrating their potential utility as a biomarker discovery platform in both biomedical and environmental applications.

  8. Evaluation of impairment of DNA in marine gastropod, Morula granulata as a biomarker of marine pollution.

    Digital Repository Service at National Institute of Oceanography (India)

    Sarkar, A.; Bhagat, J.; Sarker, S.

    parameters measured in this assay were the amount of double-stranded (dsDNA), single stranded (ss-DNA) and the fraction of double-stranded remaining after alkaline unwinding (au-DNA) for a specified time under defined condition of pH and temperature. After... on ice to minimize endogenous damage occurring during slide preparation. The trypan blue exclusion test was used for viability assessment. 2.7. Comet assay The comet assay was performed according to the method described by Singh et al. (1988) with minor...

  9. Role of pH controlled DNA secondary structures in the reversible dispersion/precipitation and separation of metallic and semiconducting single-walled carbon nanotubes. (United States)

    Maji, Basudeb; Samanta, Suman K; Bhattacharya, Santanu


    Single-stranded DNA (ss-DNA) oligomers (dA20, d[(C3TA2)3C3] or dT20) are able to disperse single-walled carbon nanotubes (SWNTs) in water at pH 7 through non-covalent wrapping on the nanotube surface. At lower pH, an alteration of the DNA secondary structure leads to precipitation of the SWNTs from the dispersion. The structural change of dA20 takes place from the single-stranded to the A-motif form at pH 3.5 while in case of d[(C3TA2)3C3] the change occurs from the single-stranded to the i-motif form at pH 5. Due to this structural change, the DNA is no longer able to bind the nanotube and hence the SWNT precipitates from its well-dispersed state. However, this could be reversed on restoring the pH to 7, where the DNA again relaxes in the single-stranded form. In this way the dispersion and precipitation process could be repeated over and over again. Variable temperature UV-Vis-NIR and CD spectroscopy studies showed that the DNA-SWNT complexes were thermally stable even at ∼90 °C at pH 7. Broadband NIR laser (1064 nm) irradiation also demonstrated the stability of the DNA-SWNT complex against local heating introduced through excitation of the carbon nanotubes. Electrophoretic mobility shift assay confirmed the formation of a stable DNA-SWNT complex at pH 7 and also the generation of DNA secondary structures (A/i-motif) upon acidification. The interactions of ss-DNA with SWNTs cause debundling of the nanotubes from its assembly. Selective affinity of the semiconducting SWNTs towards DNA than the metallic ones enables separation of the two as evident from spectroscopic as well as electrical conductivity studies.

  10. NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers

    International Nuclear Information System (INIS)

    Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.


    Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers

  11. DNA-carbon nano onion aggregate: triangle, hexagon, six-petal flower to dead-end network (United States)

    Babar, Dipak Gorakh; Pakhira, Bholanath; Sarkar, Sabyasachi


    The interaction between calf-thymus (CT) dsDNA and water soluble carbon nano onion (wsCNO) in water follows denaturation of dsDNA (double stranded) to ssDNA (single stranded) as monitored by optical spectroscopy. The ssDNA concomitantly wraps the spiky surface of wsCNO to create triangular aggregate as the building block as observed by time-dependent SEM images. These triangles further aggregate leading to six-petal flower arrangement via hexagon and finally reach a dead end network as imaged by SEM and optical fluorescence microscopy. The dead-end network aggregate lost the intrinsic optical property of DNA suggesting complete loss of its activity.

  12. Extraction of ultrashort DNA molecules from herbarium specimens. (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A


    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  13. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain. (United States)

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L


    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Reaction of single-standard DNA with hydroxyl radical generated by iron(II)-ethylenediaminetetraacetic acid

    International Nuclear Information System (INIS)

    Prigodich, R.V.; Martin, C.T.


    This study demonstrates that the reaction of Fe(II)-EDTA and hydrogen peroxide with the single-stranded nucleic acids d(pT) 70 and a 29-base sequence containing a mixture of bases results in substantial damage which is not directly detected by gel electrophoresis. Cleavage of the DNA sugar backbone is enhanced significantly after the samples are incubated at 90 degree C in the presence of piperidine. The latter reaction is used in traditional Maxam-Gilbert DNA sequencing to detect base damage, and the current results are consistent with reaction of the hydroxyl radical with the bases in single-stranded DNA (although reaction with sugar may also produce adducts that are uncleaved but labile to cleavage by piperidine). We the authors propose that hydroxyl radicals may react preferentially with the nucleic acid bases in ssDNA and that reaction of the sugars in dsDNA is dominant because the bases are sequestered within the double helix. These results have implications both for the study of single-stranded DNA binding protein binding sites and for the interpretation of experiments using the hydroxyl radical to probe DNA structure or to footprint double-stranded DNA binding protein binding sites

  15. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry. (United States)

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza


    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Logic Gate Operation by DNA Translocation through Biological Nanopores.

    Directory of Open Access Journals (Sweden)

    Hiroki Yasuga

    Full Text Available Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

  17. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)


    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  18. A flexible fluorescence correlation spectroscopy based method for quantification of the DNA double labeling efficiency with precision control

    International Nuclear Information System (INIS)

    Hou, Sen; Tabaka, Marcin; Sun, Lili; Trochimczyk, Piotr; Kaminski, Tomasz S; Kalwarczyk, Tomasz; Zhang, Xuzhu; Holyst, Robert


    We developed a laser-based method to quantify the double labeling efficiency of double-stranded DNA (dsDNA) in a fluorescent dsDNA pool with fluorescence correlation spectroscopy (FCS). Though, for quantitative biochemistry, accurate measurement of this parameter is of critical importance, before our work it was almost impossible to quantify what percentage of DNA is doubly labeled with the same dye. The dsDNA is produced by annealing complementary single-stranded DNA (ssDNA) labeled with the same dye at 5′ end. Due to imperfect ssDNA labeling, the resulting dsDNA is a mixture of doubly labeled dsDNA, singly labeled dsDNA and unlabeled dsDNA. Our method allows the percentage of doubly labeled dsDNA in the total fluorescent dsDNA pool to be measured. In this method, we excite the imperfectly labeled dsDNA sample in a focal volume of <1 fL with a laser beam and correlate the fluctuations of the fluorescence signal to get the FCS autocorrelation curves; we express the amplitudes of the autocorrelation function as a function of the DNA labeling efficiency; we perform a comparative analysis of a dsDNA sample and a reference dsDNA sample, which is prepared by increasing the total dsDNA concentration c (c > 1) times by adding unlabeled ssDNA during the annealing process. The method is flexible in that it allows for the selection of the reference sample and the c value can be adjusted as needed for a specific study. We express the precision of the method as a function of the ssDNA labeling efficiency or the dsDNA double labeling efficiency. The measurement precision can be controlled by changing the c value. (letter)

  19. Elastic properties of alternative versus single-stranded leveling archwires. (United States)

    Rucker, Brian K; Kusy, Robert P


    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  20. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.


    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  1. DNA methylation detection by a novel fluorimetric nanobiosensor for early cancer diagnosis. (United States)

    Dadmehr, M; Hosseini, M; Hosseinkhani, S; Ganjali, M R; Khoobi, M; Behzadi, H; Hamedani, M; Sheikhnejad, R


    A very sensitive and convenient fluorescence nanobiosensor for rapid detection of DNA methylation based on Fe3O4/Au core/shell nanoparticles has been developed. Specific site of CpG islands of adenomatous polyposis coli (APC), a well studied tumor suppressor gene, was used as the detection target DNA sequence. The characteristics of nanoparticles were determined by scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), UV-visible spectroscopy and X-ray diffraction (XRD) spectroscopy. Fe@Au nanoparticles functionalized by bounding of single stranded DNA (ssDNA) probe through sulfhydryl group at the 5' phosphate end. Then unmethylated and methylated complementary target ssDNA were hybridized with the immobilized ssDNA probe. Dipyridamole, a pharmaceutical agent used for the first time as a fluorescence probe which significantly interacted with hybridized unmethylated and methylated DNA. Upon the addition of the target unmethylated and methylated ssDNA, the fluorescence intensity increased in linear range by concentration of unmethylated ssDNA from 1.6 × 10(-15) to 6.6 × 10(-13)M with detection limit of 1.2 × 10(-16)M and on the other hand, fluorescence intensity declined linearly with concentration of 3.2 × 10(-15)-8.0 × 10(-13)M methylated DNA and detection limit was 3.1 × 10(-16)M. We have also shown that nanobiosensor could distinguish ratio of methylation in series of partially methylated DNA targets with identical sequences. A density functional theory (DFT) calculation was also performed to investigate the interaction between Dipyridamole with unmethylated and methylated cytosine. Finally real sample analysis suggested that nanobiosensor could have practical application for methylation detection in human plasma sample. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Swi5-Sfr1 protein stimulates Rad51-mediated DNA strand exchange reaction through organization of DNA bases in the presynaptic filament.

    KAUST Repository

    Fornander, Louise H


    The Swi5-Sfr1 heterodimer protein stimulates the Rad51-promoted DNA strand exchange reaction, a crucial step in homologous recombination. To clarify how this accessory protein acts on the strand exchange reaction, we have analyzed how the structure of the primary reaction intermediate, the Rad51/single-stranded DNA (ssDNA) complex filament formed in the presence of ATP, is affected by Swi5-Sfr1. Using flow linear dichroism spectroscopy, we observe that the nucleobases of the ssDNA are more perpendicularly aligned to the filament axis in the presence of Swi5-Sfr1, whereas the bases are more randomly oriented in the absence of Swi5-Sfr1. When using a modified version of the natural protein where the N-terminal part of Sfr1 is deleted, which has no affinity for DNA but maintained ability to stimulate the strand exchange reaction, we still observe the improved perpendicular DNA base orientation. This indicates that Swi5-Sfr1 exerts its activating effect through interaction with the Rad51 filament mainly and not with the DNA. We propose that the role of a coplanar alignment of nucleobases induced by Swi5-Sfr1 in the presynaptic Rad51/ssDNA complex is to facilitate the critical matching with an invading double-stranded DNA, hence stimulating the strand exchange reaction.

  3. Two-color spectroscopy of UV excited ssDNA complex with a single-wall nanotube probe: Fast nucleobase autoionization mechanism


    Ignatova, Tetyana; Balaeff, Alexander; Zheng, Ming; Blades, Michael; Stoeckl, Peter; Rotkin, Slava V.


    DNA autoionization is a fundamental process wherein UV-photoexcited nucleobases dissipate energy by charge transfer to the environment without undergoing chemical damage. Here, single-wall carbon nanotubes (SWNT) are explored as a photoluminescent reporter for studying the mechanism and rates of DNA autoionization. Two-color photoluminescence spectroscopy allows separate photoexcitation of the DNA and the SWNTs in the UV and visible range, respectively. A strong SWNT photoluminescence quenchi...

  4. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan


    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  5. Mechanisms of DNA binding and regulation of Bacillus anthracis DNA primase. (United States)

    Biswas, Subhasis B; Wydra, Eric; Biswas, Esther E


    DNA primases are pivotal enzymes in chromosomal DNA replication in all organisms. In this article, we report unique mechanistic characteristics of recombinant DNA primase from Bacillus anthracis. The mechanism of action of B. anthracis DNA primase (DnaG(BA)) may be described in several distinct steps as follows. Its mechanism of action is initiated when it binds to single-stranded DNA (ssDNA) in the form of a trimer. Although DnaG(BA) binds to different DNA sequences with moderate affinity (as expected of a mobile DNA binding protein), we found that DnaG(BA) bound to the origin of bacteriophage G4 (G4ori) with approximately 8-fold higher affinity. DnaG(BA) was strongly stimulated (>or=75-fold) by its cognate helicase, DnaB(BA), during RNA primer synthesis. With the G4ori ssDNA template, DnaG(BA) formed short (primers in the absence of DnaB(BA). The presence of DnaB(BA) increased the rate of primer synthesis. The observed stimulation of primer synthesis by cognate DnaB(BA) is thus indicative of a positive effector role for DnaB(BA). By contrast, Escherichia coli DnaB helicase (DnaB(EC)) did not stimulate DnaG(BA) and inhibited primer synthesis to near completion. This observed effect of E. coli DnaB(EC) is indicative of a strong negative effector role for heterologous DnaB(EC). We conclude that DnaG(BA) is capable of interacting with DnaB proteins from both B. anthracis and E. coli; however, between DnaB proteins derived from these two organisms, only the homologous DNA helicase (DnaB(BA)) acted as a positive effector of primer synthesis.

  6. Molecular threading and tunable molecular recognition on DNA origami nanostructures. (United States)

    Wu, Na; Czajkowsky, Daniel M; Zhang, Jinjin; Qu, Jianxun; Ye, Ming; Zeng, Dongdong; Zhou, Xingfei; Hu, Jun; Shao, Zhifeng; Li, Bin; Fan, Chunhai


    The DNA origami technology holds great promise for the assembly of nanoscopic technological devices and studies of biochemical reactions at the single-molecule level. For these, it is essential to establish well controlled attachment of functional materials to predefined sites on the DNA origami nanostructures for reliable measurements and versatile applications. However, the two-sided nature of the origami scaffold has shown limitations in this regard. We hypothesized that holes of the commonly used two-dimensional DNA origami designs are large enough for the passage of single-stranded (ss)-DNA. Sufficiently long ssDNA initially located on one side of the origami should thus be able to "thread" to the other side through the holes in the origami sheet. By using an origami sheet attached with patterned biotinylated ssDNA spacers and monitoring streptavidin binding with atomic force microscopic (AFM) imaging, we provide unambiguous evidence that the biotin ligands positioned on one side have indeed threaded through to the other side. Our finding reveals a previously overlooked critical design feature that should provide new interpretations to previous experiments and new opportunities for the construction of origami structures with new functional capabilities.

  7. Label-free detection of C-reactive protein using an electrochemical DNA immunoassay

    Directory of Open Access Journals (Sweden)

    Temsiri Songjaroen


    Full Text Available A label-free electrochemical immunoassay that combines DNA-directed immobilization (DDI with electrochemical impedance spectroscopy (EIS on microwire sensors is reported for the detection of C-reactive protein (CRP. CRP is an acute-phase protein that is strongly correlated with systemic inflammation. Since inflammation plays a role in pathogenesis of cardiovascular diseases, CRP can be used to predict the likelihood of coronary events. To demonstrate the new chemistry, 25-μm Au electrodes were modified with single strand DNA (ssDNA and exposed to a solution containing complementary ssDNA conjugated to monoclonal anti-CRP. The charge-transfer resistance of the [Fe(CN6]3−/4− redox couple was used to determine the CRP concentration after binding. A stepwise increase in the charge transfer resistance was observed using EIS for each modification step, ssDNA, ssDNA-anti-CRP hybridization and the final CRP capture. Cyclic voltammetry (CV was used to verify the EIS results, and showed an increase in peak potential splitting in a similar stepwise manner for each modification step. Finally, fluorescence microscopy was used to confirm the DNA hybridization and CRP binding. Standard addition of CRP revealed that EIS could be used to detect CRP at clinically relevant levels in serum samples. This new form of electrochemical DNA immunoassay (eDI has significant potential as a simple, label-free sensor for proteins in microfluidic devices.

  8. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara


    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  9. The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, A.M.; Simon, M.; Sen, A.; Yu, X.; Griffith, J. D.; Egelman, E. H.


    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

  10. Adsorption behavior of DNA-wrapped carbon nanotubes on self-assembled monolayer surfaces. (United States)

    Zangmeister, Rebecca A; Maslar, James E; Opdahl, Aric; Tarlov, Michael J


    We have examined the adsorption of DNA-wrapped single-walled carbon nanotubes (DNA-SWNTs) on hydrophobic, hydrophilic, and charged surfaces of alkylthiol self-assembled monolayers (SAMs) on gold. Our goal is to understand how DNA-SWNTs interact with surfaces of varying chemical functionality. These samples were characterized using reflection absorption FTIR (RAIRS), X-ray photoelectron spectroscopy (XPS), and Raman spectroscopy. We have found that DNA-SWNTs preferentially adsorb to positively charged amine-terminated SAMs and to bare gold surfaces versus hydrophobic methyl-terminated or negatively charged carboxylic acid-terminated SAMs. Examination of the adsorption on gold of single-strand DNA (ssDNA) of the same sequence used to wrap the SWNTs suggests that the DNA wrapping plays a role in the adsorption behavior of DNA-SWNTs.

  11. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID. (United States)

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani


    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Faecal virome of healthy chickens reveals a large diversity of the eukaryote viral community, including novel circular ssDNA viruses. (United States)

    Lima, Diane A; Cibulski, Samuel P; Finkler, Fabrine; Teixeira, Thais F; Varela, Ana Paula M; Cerva, Cristine; Loiko, Márcia R; Scheffer, Camila M; Dos Santos, Helton F; Mayer, Fabiana Q; Roehe, Paulo M


    This study is focused on the identification of the faecal virome of healthy chickens raised in high-density, export-driven poultry farms in Brazil. Following high-throughput sequencing, a total of 7743 de novo-assembled contigs were constructed and compared with known nucleotide/amino acid sequences from the GenBank database. Analyses with blastx revealed that 279 contigs (4 %) were related to sequences of eukaryotic viruses. Viral genome sequences (total or partial) indicative of members of recognized viral families, including Adenoviridae, Caliciviridae, Circoviridae, Parvoviridae, Picobirnaviridae, Picornaviridae and Reoviridae, were identified, some of those representing novel genotypes. In addition, a range of circular replication-associated protein encoding DNA viruses were also identified. The characterization of the faecal virome of healthy chickens described here not only provides a description of the viruses encountered in such niche but should also represent a baseline for future studies comparing viral populations in healthy and diseased chicken flocks. Moreover, it may also be relevant for human health, since chickens represent a significant proportion of the animal protein consumed worldwide.

  13. Application of DNA Hybridization Biosensor as a Screening Method for the Detection of Genetically Modified Food Components

    Directory of Open Access Journals (Sweden)

    Marian Filipiak


    Full Text Available An electrochemical biosensor for the detection of genetically modified food components is presented. The biosensor was based on 21-mer single-stranded oligonucleotide (ssDNA probe specific to either 35S promoter or nos terminator, which are frequently present in transgenic DNA cassettes. ssDNA probe was covalently attached by 5’-phosphate end to amino group of cysteamine self-assembled monolayer (SAM on gold electrode surface with the use of activating reagents – water soluble 1-ethyl-3(3’- dimethylaminopropyl-carbodiimide (EDC and N-hydroxy-sulfosuccinimide (NHS. The hybridization reaction on the electrode surface was detected via methylene blue (MB presenting higher affinity to ssDNA probe than to DNA duplex. The electrode modification procedure was optimized using 19-mer oligoG and oligoC nucleotides. The biosensor enabled distinction between DNA samples isolated from soybean RoundupReady® (RR soybean and non-genetically modified soybean. The frequent introduction of investigated DNA sequences in other genetically modified organisms (GMOs give a broad perspectives for analytical application of the biosensor.

  14. The role of the Zn(II binding domain in the mechanism of E. coli DNA topoisomerase I

    Directory of Open Access Journals (Sweden)

    Tse-Dinh Yuk-Ching


    Full Text Available Abstract Background Escherichia coli DNA topoisomerase I binds three Zn(II with three tetracysteine motifs which, together with the 14 kDa C-terminal region, form a 30 kDa DNA binding domain (ZD domain. The 67 kDa N-terminal domain (Top67 has the active site tyrosine for DNA cleavage but cannot relax negatively supercoiled DNA. We analyzed the role of the ZD domain in the enzyme mechanism. Results Addition of purified ZD domain to Top67 partially restored the relaxation activity, demonstrating that covalent linkage between the two domains is not necessary for removal of negative supercoils from DNA. The two domains had similar affinities to ssDNA. However, only Top67 could bind dsDNA with high affinity. DNA cleavage assays showed that the Top67 had the same sequence and structure selectivity for DNA cleavage as the intact enzyme. DNA rejoining also did not require the presence of the ZD domain. Conclusions We propose that during relaxation of negatively supercoiled DNA, Top67 by itself can position the active site tyrosine near the junction of double-stranded and single-stranded DNA for cleavage. However, the interaction of the ZD domain with the passing single-strand of DNA, coupled with enzyme conformational change, is needed for removal of negative supercoils.

  15. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.


    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  16. Fiber optofluidic biosensor for the label-free detection of DNA hybridization and methylation based on an in-line tunable mode coupler. (United States)

    Gao, Ran; Lu, Dan-Feng; Cheng, Jin; Jiang, Yi; Jiang, Lan; Xu, Jian-Dong; Qi, Zhi-Mei


    An optical fiber optofluidic biosensor for the detection of DNA hybridization and methylation has been proposed and experimentally demonstrated. An in-line fiber Michelson interferometer was formed in the photonic crystal fiber. A micrhole in the collapsed region, which combined the tunable mode coupler and optofluidic channel, was fabricated by using femtosecond laser micromachining. The mode field diameter of the guided light is changed with the refractive index in the optofluidic channel, which results in the tunable coupling ratio. Label-free detections of the DNA hybridization and methylation have been experimentally demonstrated. The probe single stranded DNA (ssDNA) was bound with the surface of the optofluidic channel through the Poly-l-lysine layer, and the hybridization between a short 22-mer probe ssDNA and a complementary target ssDNA was carried out and detected by interrogating the fringe visibility of the reflection spectrum. Then, the DNA methylation was also detected through the binding between the methylated DNA and the 5-methylcytosine (5-mC) monoclonal antibody. The experiments results demonstrate that the limit of detection of 5nM is achieved, establishing the tunable mode coupler as a sensitive and versatile biosensor. The sensitive optical fiber optofluidic biosensor possesses high specificity and low temperature cross-sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  18. Ionic effects on the temperature-force phase diagram of DNA. (United States)

    Amnuanpol, Sitichoke


    Double-stranded DNA (dsDNA) undergoes a structural transition to single-stranded DNA (ssDNA) in many biologically important processes such as replication and transcription. This strand separation arises in response either to thermal fluctuations or to external forces. The roles of ions are twofold, shortening the range of the interstrand potential and renormalizing the DNA elastic modulus. The dsDNA-to-ssDNA transition is studied on the basis that dsDNA is regarded as a bound state while ssDNA is regarded as an unbound state. The ground state energy of DNA is obtained by mapping the statistical mechanics problem to the imaginary time quantum mechanics problem. In the temperature-force phase diagram the critical force F c (T) increases logarithmically with the Na + concentration in the range from 32 to 110 mM. Discussing this logarithmic dependence of F c (T) within the framework of polyelectrolyte theory, it inevitably suggests a constraint on the difference between the interstrand separation and the length per unit charge during the dsDNA-to-ssDNA transition.

  19. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P


    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska


    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  1. DNA-templated antibody conjugation for targeted drug delivery to cancer cells

    DEFF Research Database (Denmark)

    Liu, Tianqiang


    conjugation strategy. Recently, a site-selective antibody conjugation method called “DNA-templated protein conjugation (DTPC)” was developed by our group. The site-selective covalently attachment of single-stranded DNA (ssDNA) to proteins was achieved by using a metal-affinity DNA probe and DNA-templated...... state to get a good pharmacological performance. Recombinant antibody engineering with non-natural amino acids, or enzyme-mediated conjugation approaches (transglutaminase, Sortase A or endoglycosidase) have been reported for producing homogeneous antibody conjugates. However, these methods require...... organic synthesis due to the wide existence of the 3-histidine cluster in most wild-type proteins. In this thesis, three projects that relate to targeted drug delivery to cancer cells based on the DTPC method is described. The first project was a delivery system which uses transferrin as the targeting...

  2. Detection of DNA hybridization by various spectroscopic methods using the copper tetraphenylporphyrin complex as a probe

    International Nuclear Information System (INIS)

    Gong, H.; Cai, C.; Ma, Y.; Chen, X.


    We are presenting new and highly sensitive hybridization assays. They are based on various spectroscopic methods including resonance light scattering, circular dichroism, ultraviolet spectra and fluorescence spectra, as well as atomic force microscopy, and relies on the interaction of the Cu(II), Ni(II), Mg(II), Co(II), Cd(II), and Zn(II) complexes, respectively, of tetraphenylporphyrin (TPP) with double-strand DNA (dsDNA) and single strand DNA (ssDNA). The interaction results in amplified resonance light scattering (RLS) signals and enables the detection of hybridization without the need for labeling DNA. The RLS signals are strongest in case of the Cu (II)-TPP complex which therefore was selected as the probe. The technique is simple, robust, accurate, and can be completed in less than one hour. (author)

  3. A Novel Open Tubular Capillary Electrochromatographic Method for Differentiating the DNA Interaction Affinity of Environmental Contaminants.

    Directory of Open Access Journals (Sweden)

    Lucia D'Ulivo

    Full Text Available The interaction of chemicals with DNA may lead to genotoxicity, mutation or carcinogenicity. A simple open tubular capillary electrochromatographic method is proposed to rapidly assess the interaction affinity of three environmental contaminants (1,4-phenylenediamine, pyridine and 2,4-diaminotoluene to DNA by measuring their retention in the capillaries coated with DNA probes. DNA oligonucleotide probes were immobilized on the inner wall of a fused silica capillary that was first derivatized with 3-(aminopropyl-triethoxysilane (APTES. The difference in retention times and factors was considered as the difference in interaction affinity of the contaminants to the DNA probes. The interaction of the contaminants with both double-stranded (dsDNA and single-stranded DNA (ssDNA coatings was compared. Retention factors of 1,4-phenylenediamine, pyridine and 2,4-diaminotoluene in the capillary coated with ssDNA probe were 0.29, 0.42, and 0.44, respectively. A similar trend was observed in the capillary coated with dsDNA, indicating that 2,4-diaminotoluene has the highest affinity among the three contaminants. The relative standard deviation (RSD for the retention factors was in the range of 0.05-0.69% (n = 3. The results demonstrated that the developed technique could be applied for preliminary screening purpose to provide DNA interaction affinity information of various environmental contaminants.

  4. Evaluation of Fluorescent Analogs of Deoxycytidine for Monitoring DNA Transitions from Duplex to Functional Structures

    Directory of Open Access Journals (Sweden)

    Yogini P. Bhavsar


    Full Text Available Topological variants of single-strand DNA (ssDNA structures, referred to as “functional DNA,” have been detected in regulatory regions of many genes and are thought to affect gene expression. Two fluorescent analogs of deoxycytidine, Pyrrolo-dC (PdC and 1,3-diaza-2-oxophenoxazine (tC∘, can be incorporated into DNA. Here, we describe spectroscopic studies of both analogs to determine fluorescent properties that report on structural transitions from double-strand DNA (dsDNA to ssDNA, a common pathway in the transition to functional DNA structures. We obtained fluorescence-detected circular dichroism (FDCD spectra, steady-state fluorescence spectra, and fluorescence lifetimes of the fluorophores in DNA. Our results show that PdC is advantageous in fluorescence lifetime studies because of a distinct ~2 ns change between paired and unpaired bases. However, tC∘ is a better probe for FDCD experiments that report on the helical structure of DNA surrounding the fluorophore. Both fluorophores provide complementary data to measure DNA structural transitions.

  5. Mesoscopic models for DNA stretching under force: New results and comparison with experiments. (United States)

    Manghi, Manoel; Destainville, Nicolas; Palmeri, John


    Single-molecule experiments on double-stranded B-DNA stretching have revealed one or two structural transitions, when increasing the external force. They are characterized by a sudden increase of DNA contour length and a decrease of the bending rigidity. The nature and the critical forces of these transitions depend on DNA base sequence, loading rate, salt conditions and temperature. It has been proposed that the first transition, at forces of 60-80 pN, is a transition from B to S-DNA, viewed as a stretched duplex DNA, while the second one, at stronger forces, is a strand peeling resulting in single-stranded DNAs (ssDNA), similar to thermal denaturation. But due to experimental conditions these two transitions can overlap, for instance for poly(dA-dT). In an attempt to propose a coherent picture compatible with this variety of experimental observations, we derive an analytical formula using a coupled discrete worm-like chain-Ising model. Our model takes into account bending rigidity, discreteness of the chain, linear and non-linear (for ssDNA) bond stretching. In the limit of zero force, this model simplifies into a coupled model already developed by us for studying thermal DNA melting, establishing a connection with previous fitting parameter values for denaturation profiles. Our results are summarized as follows: i) ssDNA is fitted, using an analytical formula, over a nano-Newton range with only three free parameters, the contour length, the bending modulus and the monomer size; ii) a surprisingly good fit on this force range is possible only by choosing a monomer size of 0.2 nm, almost 4 times smaller than the ssDNA nucleobase length; iii) mesoscopic models are not able to fit B to ssDNA (or S to ss) transitions; iv) an analytical formula for fitting B to S transitions is derived in the strong force approximation and for long DNAs, which is in excellent agreement with exact transfer matrix calculations; v) this formula fits perfectly well poly(dG-dC) and λ-DNA

  6. Programmed Switching of Single Polymer Conformation on DNA Origami

    DEFF Research Database (Denmark)

    Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach


    ) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold......-mediated strand displacement. The switching is observed by atomic force microscopy and by Förster resonance energy transfer between the polymer and two different organic dyes positioned in close proximity to the respective patterns. Using this method, the polymer conformation can be switched six times...... successively. This controlled nanomechanical switching of conjugated organic polymer conformation demonstrates unique control of the shape of a single polymer molecule, and it may constitute a new component for the development of reconfigurable nanophotonic and nanoelectronic devices....

  7. Threading DNA Through a Nanometer-Scale Pore: Biophysical and Biotechnological Applications (United States)

    Kasianowicz, John; Henrickson, Sarah; Misakian, Martin; Wang, Qian; Weetall, Howard; Roberston, Baldwin


    With the goal of developing technologies for biomedical applications (e.g. antiviral treatments, targeted genetic therapies, analyte sensing, and ultra-rapid DNA sequencing), we are studying the mechanism by which DNA is transported through a nanometer-scale pore. Individual molecules of single-stranded DNA (ssDNA) can be detected and characterized as they are driven electrophoretically through a single Staphylococcus aureus alpha-hemolysin (alpha-HL) ion channel. We recently demonstrated that the ability of ssDNA to partition into the pore depends on the side to which the polymer is added and on the magnitude of the applied potential. These results are consistent with the alpha-HL channel’s crystal structure and are providing insight into the physics of DNA transport through a nanopore. We are also researching methods for using ion channels as components of analyte sensors. Using the alpha-HL channel and ssDNA as a model system, we demonstrated an analyte sensing technology based on a single nanopore and pore-permeant polymers. Instead of affixing an analyte binding site to the channel, it is covalently attached to a polymer that is initially free in solution. The binding of analyte to the polymer alters the ability of the polymer to thread into or through the pore. This system can simultaneously quantitate multiple analytes in real-time. Finally, we demonstrate that the signal produced by the transport of individual ssDNA molecules through the alpha-HL channel depends on which end of the channel the polymer enters.

  8. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism. (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong


    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  9. Determining the RAD51-DNA Nucleoprotein Filament Structure and Function by Cryo-Electron Microscopy. (United States)

    Zhao, Lingyun; Xu, Jingfei; Zhao, Weixing; Sung, Patrick; Wang, Hong-Wei


    Homologous recombination is a universal tool for DNA double-strand break and replication fork repair, and it is catalyzed by a highly conserved family of recombinases. In eukaryotes, Rad51 is the recombinase that catalyzes the pairing of homologous DNA molecules and the exchange of strands between the paired molecules. Rad51 assembles on single-stranded DNA (ssDNA) stemming from lesion processing to form a right-handed helical polymer that engages then samples double-stranded DNA (dsDNA) for homology. Upon matching with a homologous sequence, the Rad51-bound ssDNA invades the dsDNA, leading to the formation of a DNA joint with concomitant displacement of the strand of like polarity. The Rad51-DNA filaments are amenable to structural studies using cryo-electron microscopy (cryo-EM). In particular, recent technical breakthroughs in cryo-EM have made it possible to define the structure and function of human RAD51 at near-atomic resolution. In this chapter, we describe our cryo-EM approach to capture the human RAD51 filament structures in various stages of catalysis. The approach may also be useful for related recombinases and other helical assemblies. © 2018 Elsevier Inc. All rights reserved.

  10. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry

    Energy Technology Data Exchange (ETDEWEB)

    Jafari, Safiye [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush, E-mail: [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Norouzi, Parviz [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ajloo, Davood [School of Chemistry, Damghan University, Damghan (Iran, Islamic Republic of); Mohammadipanah, Fatemeh [Department of Microbial Biotechnology, School of Biology and Center of Excellence in Phylogeny of Living Organisms, College of Science, University of Tehran, 14155-6455 Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)


    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO{sub 2}NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy){sub 3}]{sup 2+/3+} redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy){sub 3}]{sup 2+/3+} FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10{sup −15} to 1 × 10{sup −8} mol L{sup −1}. The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL{sup −1} with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy){sub 3}]{sup 2+/3+} interaction with ssDNA before and after hybridization. - Highlights: • New DNA biosensor is designed for sub-femtomolar detection of Aeromonas hydrophila DNA sequence. • Reduced graphene oxide decorated Ceria nanoparticles was used as a new immobilization platform. • Biosensor was successfully used to detect A. hydrophila DNA sequence in fish pond water.

  11. A high throughput system for the preparation of single stranded templates grown in microculture. (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M


    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  12. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)


    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  13. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhenbao [Central South University, School of Pharmaceutical Sciences (China); Zhou, Bo, E-mail: [The Affiliated Zhongda Hospital of Southeast University, Department of Gerontology (China); Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang, E-mail: [Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College (China)


    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 {mu}m in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL{sup -1} to 10 ng mL{sup -1}. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

  14. A novel protein that recognizes DNA strand break

    Energy Technology Data Exchange (ETDEWEB)

    Narumi, Issay; Satoh, Katsuya; Kikuchi, Masahiro [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment


    By analyzing a DNA damage-sensitive mutant of the radioresistant bacterium Deinococcus radiodurans, we discovered that a novel protein participates in the extreme radiation resistance of this bacterium. The protein (designated PprA for promoting prominent repair) can recognize DNA strand breaks. PprA could bind to double-stranded DNA (dsDNA) in the open circular form and to linear dsDNA, but could not bind to either dsDNA in the closed circular form or single-stranded DNA (ssDNA). Further, under conditions where a substantial amount of degradation of naked DNA fragments would normally result from the activity of E. coli exonuclease III, no DNA degradation was observed when the DNA fragments were preincubated with PprA. These suggest that PprA would protect irradiation-damaged DNA from exonuclease-mediated degradation and consequent DNA repair processes could function. Beside DNA-binding ability, PprA could promote the activities of DNA repair enzymes such as DNA ligase and RecA, suggesting that PprA functions as a DNA repair-promoting protein to potentiate the effectiveness of DNA repair. These properties enable PprA to use the widespread application in vivo and in vitro. (author)

  15. Bacterial transformation: ComFA is a DNA-dependent ATPase that forms complexes with ComFC and DprA. (United States)

    Diallo, Amy; Foster, Hannah R; Gromek, Katarzyna A; Perry, Thomas N; Dujeancourt, Annick; Krasteva, Petya V; Gubellini, Francesca; Falbel, Tanya G; Burton, Briana M; Fronzes, Rémi


    Pneumococcal natural transformation contributes to genomic plasticity, antibiotic resistance development and vaccine escape. Streptococcus pneumoniae, like many other naturally transformable species, has evolved sophisticated protein machinery for the binding and uptake of DNA. Two proteins encoded by the comF operon, ComFA and ComFC, are involved in transformation but their exact molecular roles remain unknown. In this study, we provide experimental evidence that ComFA binds to single stranded DNA (ssDNA) and has ssDNA-dependent ATPase activity. We show that both ComFA and ComFC are essential for the transformation process in pneumococci. Moreover, we show that these proteins interact with each other and with other proteins involved in homologous recombination, such as DprA, thus placing the ComFA-ComFC duo at the interface between DNA uptake and DNA recombination during transformation. © 2017 John Wiley & Sons Ltd.

  16. Development of a Fluorescence Resonance Energy Transfer (FRET-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    Directory of Open Access Journals (Sweden)

    Noremylia Mohd Bakhori


    Full Text Available An optical DNA biosensor based on fluorescence resonance energy transfer (FRET utilizing synthesized quantum dot (QD has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  17. Remodeling and Control of Homologous Recombination by DNA Helicases and Translocases that Target Recombinases and Synapsis (United States)

    Northall, Sarah J.; Ivančić-Baće, Ivana; Soultanas, Panos; Bolt, Edward L.


    Recombinase enzymes catalyse invasion of single-stranded DNA (ssDNA) into homologous duplex DNA forming “Displacement loops” (D-loops), a process called synapsis. This triggers homologous recombination (HR), which can follow several possible paths to underpin DNA repair and restart of blocked and collapsed DNA replication forks. Therefore, synapsis can be a checkpoint for controlling whether or not, how far, and by which pathway, HR proceeds to overcome an obstacle or break in a replication fork. Synapsis can be antagonized by limiting access of a recombinase to ssDNA and by dissociation of D-loops or heteroduplex formed by synapsis. Antagonists include DNA helicases and translocases that are identifiable in eukaryotes, bacteria and archaea, and which target synaptic and pre-synaptic DNA structures thereby controlling HR at early stages. Here we survey these events with emphasis on enabling DNA replication to be resumed from sites of blockage or collapse. We also note how knowledge of anti-recombination activities could be useful to improve efficiency of CRISPR-based genome editing. PMID:27548227

  18. Assay for human Rad51-mediated DNA displacement loop formation. (United States)

    Raynard, Steven; Sung, Patrick


    Homologous recombination is an important mechanism for the repair of damaged chromosomes, for preventing the demise of damaged replication forks, and for several other aspects of chromosome metabolism and maintenance. The homologous recombination reaction is mediated by the Rad51 recombinase. In the presence of ATP, Rad51 polymerizes on single-stranded DNA (ssDNA) to form a nucleoprotein filament that is commonly referred to as the "presynaptic filament." The presynaptic filament is capable of locating a homologous duplex DNA molecule and catalyzing invasion of the duplex to form a DNA displacement loop called the "D-loop." This protocol describes an in vitro D-loop assay that uses a radiolabeled ssDNA oligonucleotide and a nonlabeled homologous supercoiled duplex DNA as substrates, and agarose gel electrophoresis together with PhosphorImaging for product analysis. To enhance the efficiency of the D-loop reaction, an ancillary factor (the Hop2-Mnd1 complex or Rad54) is included in the reaction. This reconstituted system provides researchers a biochemical means to dissect the mechanisms of the homologous recombination machinery.

  19. Transforming DNA uptake gene orthologs do not mediate spontaneous plasmid transformation in Escherichia coli. (United States)

    Sun, Dongchang; Zhang, Xuewu; Wang, Lingyu; Prudhomme, Marc; Xie, Zhixiong; Martin, Bernard; Claverys, Jean-Pierre


    Spontaneous plasmid transformation of Escherichia coli occurs on nutrient-containing agar plates. E. coli has also been reported to use double-stranded DNA (dsDNA) as a carbon source. The mechanism(s) of entry of exogenous dsDNA that allows plasmid establishment or the use of DNA as a nutrient remain(s) unknown. To further characterize plasmid transformation, we first documented the stimulation of transformation by agar and agarose. We provide evidence that stimulation is not due to agar contributing a supplement of Ca(2+), Fe(2+), Mg(2+), Mn(2+), or Zn(2+). Second, we undertook to inactivate the E. coli orthologues of Haemophilus influenzae components of the transformation machine that allows the uptake of single-stranded DNA (ssDNA) from exogenous dsDNA. The putative outer membrane channel protein (HofQ), transformation pseudopilus component (PpdD), and transmembrane pore (YcaI) are not required for plasmid transformation. We conclude that plasmid DNA does not enter E. coli cells as ssDNA. The finding that purified plasmid monomers transform E. coli with single-hit kinetics supports this conclusion; it establishes that a unique monomer molecule is sufficient to give rise to a transformant, which is not consistent with the reconstitution of an intact replicon through annealing of partially overlapping complementary ssDNA, taken up from two independent monomers. We therefore propose that plasmid transformation involves internalization of intact dsDNA molecules. Our data together, with previous reports that HofQ is required for the use of dsDNA as a carbon source, suggest the existence of two routes for DNA entry, at least across the outer membrane of E. coli.

  20. Binding Affinities among DNA Helicase-Primase, DNA Polymerase, and Replication Intermediates in the Replisome of Bacteriophage T7* (United States)

    Zhang, Huidong; Tang, Yong; Lee, Seung-Joo; Wei, Zeliang; Cao, Jia; Richardson, Charles C.


    The formation of a replication loop on the lagging strand facilitates coordinated synthesis of the leading- and lagging-DNA strands and provides a mechanism for recycling of the lagging-strand DNA polymerase. As an Okazaki fragment is completed, the loop is released, and a new loop is formed as the synthesis of a new Okazaki fragment is initiated. Loop release requires the dissociation of the complex formed by the interactions among helicase, DNA polymerase, and DNA. The completion of the Okazaki fragment may result in either a nick or a single-stranded DNA region. In the replication system of bacteriophage T7, the dissociation of the polymerase from either DNA region is faster than that observed for the dissociation of the helicase from DNA polymerase, implying that the replication loop is released more likely through the dissociation of the lagging-strand DNA from polymerase, retaining the polymerase at replication fork. Both dissociation of DNA polymerase from DNA and that of helicase from a DNA polymerase·DNA complex are much faster at a nick DNA region than the release from a ssDNA region. These results suggest that the replication loop is released as a result of the nick formed when the lagging-strand DNA polymerase encounters the previously synthesized Okazaki fragment, releasing lagging-strand DNA and retaining DNA polymerase at the replication fork for the synthesis of next Okazaki fragment. PMID:26620561

  1. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators.

    Directory of Open Access Journals (Sweden)

    Yumiko Kurokawa


    Full Text Available In the fission yeast Schizosaccharomyces pombe, genetic evidence suggests that two mediators, Rad22 (the S. pombe Rad52 homolog and the Swi5-Sfr1 complex, participate in a common pathway of Rhp51 (the S. pombe Rad51 homolog-mediated homologous recombination (HR and HR repair. Here, we have demonstrated an in vitro reconstitution of the central step of DNA strand exchange during HR. Our system consists entirely of homogeneously purified proteins, including Rhp51, the two mediators, and replication protein A (RPA, which reflects genetic requirements in vivo. Using this system, we present the first robust biochemical evidence that concerted action of the two mediators directs the loading of Rhp51 onto single-stranded DNA (ssDNA precoated with RPA. Dissection of the reaction reveals that Rad22 overcomes the inhibitory effect of RPA on Rhp51-Swi5-Sfr1-mediated strand exchange. In addition, Rad22 negates the requirement for a strict order of protein addition to the in vitro system. However, despite the presence of Rad22, Swi5-Sfr1 is still essential for strand exchange. Importantly, Rhp51, but neither Rad22 nor the Swi5-Sfr1 mediator, is the factor that displaces RPA from ssDNA. Swi5-Sfr1 stabilizes Rhp51-ssDNA filaments in an ATP-dependent manner, and this stabilization is correlated with activation of Rhp51 for the strand exchange reaction. Rad22 alone cannot activate the Rhp51 presynaptic filament. AMP-PNP, a nonhydrolyzable ATP analog, induces a similar stabilization of Rhp51, but this stabilization is independent of Swi5-Sfr1. However, hydrolysis of ATP is required for processive strand transfer, which results in the formation of a long heteroduplex. Our in vitro reconstitution system has revealed that the two mediators have indispensable, but distinct, roles for mediating Rhp51 loading onto RPA-precoated ssDNA.

  2. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.


    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  3. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus. (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao


    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  4. A New FRET-Based Sensitive DNA Sensor for Medical Diagnostics using PNA Probe and Water-Soluble Blue Light Emitting Polymer

    Directory of Open Access Journals (Sweden)

    Nidhi Mathur


    Full Text Available A reliable, fast, and low-cost biosensor for medical diagnostics using DNA sequence detection has been developed and tested for the detection of the bacterium “Bacillus anthracis.” In this sensor, Poly [9,9-di (6,6′- N, N′ trimethylammonium hexylfluorenyl-2, 7-diyl-alt-co- (1,4-phenylene] dibromide salt (PFP has been taken as cationic conjugated polymer (CCP and PNA attached with fluorescein dye (PNAC∗ as a probe. The basic principle of this sensor is that when a PNAC∗ probe is hybridized with a single strand DNA (ssDNA having complementary sequence, Forster resonance energy transfer (FRET may take place from PFP to the PNAC∗/DNA complex. If the FRET is efficient, the photoluminescence from the PFP will be highly quenched and that from PNAC∗ will be enhanced. On the other hand, if the DNA sequence is noncomplementary to PNA, FRET will not occur.

  5. DNA recognition by an RNA-guided bacterial Argonaute (United States)

    Doudna, Jennifer A.


    Argonaute (Ago) proteins are widespread in prokaryotes and eukaryotes and share a four-domain architecture capable of RNA- or DNA-guided nucleic acid recognition. Previous studies identified a prokaryotic Argonaute protein from the eubacterium Marinitoga piezophila (MpAgo), which binds preferentially to 5′-hydroxylated guide RNAs and cleaves single-stranded RNA (ssRNA) and DNA (ssDNA) targets. Here we present a 3.2 Å resolution crystal structure of MpAgo bound to a 21-nucleotide RNA guide and a complementary 21-nucleotide ssDNA substrate. Comparison of this ternary complex to other target-bound Argonaute structures reveals a unique orientation of the N-terminal domain, resulting in a straight helical axis of the entire RNA-DNA heteroduplex through the central cleft of the protein. Additionally, mismatches introduced into the heteroduplex reduce MpAgo cleavage efficiency with a symmetric profile centered around the middle of the helix. This pattern differs from the canonical mismatch tolerance of other Argonautes, which display decreased cleavage efficiency for substrates bearing sequence mismatches to the 5′ region of the guide strand. This structural analysis of MpAgo bound to a hybrid helix advances our understanding of the diversity of target recognition mechanisms by Argonaute proteins. PMID:28520746

  6. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  7. Metagenomic Characterization of Airborne Viral DNA Diversity in the Near-Surface Atmosphere (United States)

    Whon, Tae Woong; Kim, Min-Soo; Roh, Seong Woon; Shin, Na-Ri; Lee, Hae-Won


    Airborne viruses are expected to be ubiquitous in the atmosphere but they still remain poorly understood. This study investigated the temporal and spatial dynamics of airborne viruses and their genotypic characteristics in air samples collected from three distinct land use types (a residential district [RD], a forest [FR], and an industrial complex [IC]) and from rainwater samples freshly precipitated at the RD site (RD-rain). Viral abundance exhibited a seasonal fluctuation in the range between 1.7 × 106 and 4.0 × 107 viruses m−3, which increased from autumn to winter and decreased toward spring, but no significant spatial differences were observed. Temporal variations in viral abundance were inversely correlated with seasonal changes in temperature and absolute humidity. Metagenomic analysis of air viromes amplified by rolling-circle phi29 polymerase-based random hexamer priming indicated the dominance of plant-associated single-stranded DNA (ssDNA) geminivirus-related viruses, followed by animal-infecting circovirus-related sequences, with low numbers of nanoviruses and microphages-related genomes. Particularly, the majority of the geminivirus-related viruses were closely related to ssDNA mycoviruses that infect plant-pathogenic fungi. Phylogenetic analysis based on the replication initiator protein sequence indicated that the airborne ssDNA viruses were distantly related to known ssDNA viruses, suggesting that a high diversity of viruses were newly discovered. This research is the first to report the seasonality of airborne viruses and their genetic diversity, which enhances our understanding of viral ecology in temperate regions. PMID:22623790

  8. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis. (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B


    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  9. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder


    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  10. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP


    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  11. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.


    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  12. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology. (United States)

    Shariati, Mohsen


    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Spontaneous unscheduled DNA synthesis in human lymphocytes

    International Nuclear Information System (INIS)

    Forell, B.; Myers, L.S. Jr.; Norman, A.


    The rate of spontaneous unscheduled DNA synthesis in human lymphocytes was estimated from measurements of tritiated thymidine incorporation into double-stranded DNA (ds-DNA) during incubation of cells in vitro. The contribution of scheduled DNA synthesis to the observed incorporation was reduced by inhibiting replication with hydroxyurea and by separating freshly replicated single-stranded DNA (ss-DNA) from repaired ds-DNA by column chromatography. The residual contribution of scheduled DNA synthesis was estimated by observing effects on thymidine incorporation of: (a) increasing the rate of production of apurinic sites, and alternatively, (b) increasing the number of cells in S-phase. Corrections based on estimates of endogenous pool size were also made. The rate of spontaneous unscheduled DNA synthesis is estimated to be 490 +- 120 thymidine molecules incorporated per cell per hour. These results compare favorably with estimates made from rates of depurination and depyrimidination of DNA, measured in molecular systems if we assume thymidine is incorporated by a short patch mechanism which incorporates an average of four bases per lesion

  14. Differential interaction kinetics of a bipolar structure-specific endonuclease with DNA flaps revealed by single-molecule imaging.

    Directory of Open Access Journals (Sweden)

    Rachid Rezgui

    Full Text Available As DNA repair enzymes are essential for preserving genome integrity, understanding their substrate interaction dynamics and the regulation of their catalytic mechanisms is crucial. Using single-molecule imaging, we investigated the association and dissociation kinetics of the bipolar endonuclease NucS from Pyrococcus abyssi (Pab on 5' and 3'-flap structures under various experimental conditions. We show that association of the PabNucS with ssDNA flaps is largely controlled by diffusion in the NucS-DNA energy landscape and does not require a free 5' or 3' extremity. On the other hand, NucS dissociation is independent of the flap length and thus independent of sliding on the single-stranded portion of the flapped DNA substrates. Our kinetic measurements have revealed previously unnoticed asymmetry in dissociation kinetics from these substrates that is markedly modulated by the replication clamp PCNA. We propose that the replication clamp PCNA enhances the cleavage specificity of NucS proteins by accelerating NucS loading at the ssDNA/dsDNA junctions and by minimizing the nuclease interaction time with its DNA substrate. Our data are also consistent with marked reorganization of ssDNA and nuclease domains occurring during NucS catalysis, and indicate that NucS binds its substrate directly at the ssDNA-dsDNA junction and then threads the ssDNA extremity into the catalytic site. The powerful techniques used here for probing the dynamics of DNA-enzyme binding at the single-molecule have provided new insight regarding substrate specificity of NucS nucleases.

  15. A novel role of the Dna2 translocase function in DNA break resection. (United States)

    Miller, Adam S; Daley, James M; Pham, Nhung Tuyet; Niu, Hengyao; Xue, Xiaoyu; Ira, Grzegorz; Sung, Patrick


    DNA double-strand break repair by homologous recombination entails nucleolytic resection of the 5' strand at break ends. Dna2, a flap endonuclease with 5'-3' helicase activity, is involved in the resection process. The Dna2 helicase activity has been implicated in Okazaki fragment processing during DNA replication but is thought to be dispensable for DNA end resection. Unexpectedly, we found a requirement for the helicase function of Dna2 in end resection in budding yeast cells lacking exonuclease 1. Biochemical analysis reveals that ATP hydrolysis-fueled translocation of Dna2 on ssDNA facilitates 5' flap cleavage near a single-strand-double strand junction while attenuating 3' flap incision. Accordingly, the ATP hydrolysis-defective dna2-K1080E mutant is less able to generate long products in a reconstituted resection system. Our study thus reveals a previously unrecognized role of the Dna2 translocase activity in DNA break end resection and in the imposition of the 5' strand specificity of end resection. © 2017 Miller et al.; Published by Cold Spring Harbor Laboratory Press.

  16. Structure and Function of the PriC DNA Replication Restart Protein. (United States)

    Wessel, Sarah R; Cornilescu, Claudia C; Cornilescu, Gabriel; Metz, Alice; Leroux, Maxime; Hu, Kaifeng; Sandler, Steven J; Markley, John L; Keck, James L


    Collisions between DNA replication complexes (replisomes) and barriers such as damaged DNA or tightly bound protein complexes can dissociate replisomes from chromosomes prematurely. Replisomes must be reloaded under these circumstances to avoid incomplete replication and cell death. Bacteria have evolved multiple pathways that initiate DNA replication restart by recognizing and remodeling abandoned replication forks and reloading the replicative helicase. In vitro, the simplest of these pathways is mediated by the single-domain PriC protein, which, along with the DnaC helicase loader, can load the DnaB replicative helicase onto DNA bound by the single-stranded DNA (ssDNA)-binding protein (SSB). Previous biochemical studies have identified PriC residues that mediate interactions with ssDNA and SSB. However, the mechanisms by which PriC drives DNA replication restart have remained poorly defined due to the limited structural information available for PriC. Here, we report the NMR structure of full-length PriC from Cronobacter sakazakii PriC forms a compact bundle of α-helices that brings together residues involved in ssDNA and SSB binding at adjacent sites on the protein surface. Disruption of these interaction sites and of other conserved residues leads to decreased DnaB helicase loading onto SSB-bound DNA. We also demonstrate that PriC can directly interact with DnaB and the DnaB·DnaC complex. These data lead to a model in which PriC acts as a scaffold for recruiting DnaB·DnaC to SSB/ssDNA sites present at stalled replication forks. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events. (United States)

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza


    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  18. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair. (United States)

    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe


    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy.

  19. Normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  20. A biochemical and biophysical model of G-quadruplex DNA recognition by positive coactivator of transcription 4. (United States)

    Griffin, Wezley C; Gao, Jun; Byrd, Alicia K; Chib, Shubeena; Raney, Kevin D


    DNA sequences that are guanine-rich have received considerable attention because of their potential to fold into a secondary, four-stranded DNA structure termed G-quadruplex (G4), which has been implicated in genomic instability and some human diseases. We have previously identified positive coactivator of transcription (PC4), a single-stranded DNA (ssDNA)-binding protein, as a novel G4 interactor. Here, to expand on these previous observations, we biochemically and biophysically characterized the interaction between PC4 and G4DNA. PC4 can bind alternative G4DNA topologies with a low nanomolar K d value of ∼2 nm, similar to that observed for ssDNA. In consideration of the different structural features between G4DNA and ssDNA, these binding data indicated that PC4 can interact with G4DNA in a manner distinct from ssDNA. The stoichiometry of the PC4-G4 complex was 1:1 for PC4 dimer:G4 substrate. PC4 did not enhance the rate of folding of G4DNA, and formation of the PC4-G4DNA complex did not result in unfolding of the G4DNA structure. We assembled a G4DNA structure flanked by duplex DNA. We find that PC4 can interact with this G4DNA, as well as the complementary C-rich strand. Molecular docking simulations and DNA footprinting experiments suggest a model where a PC4 dimer accommodates the DNA with one monomer on the G4 strand and the second monomer bound to the C-rich strand. Collectively, these data provide a novel mode of PC4 binding to a DNA secondary structure that remains within the framework of the model for binding to ssDNA. Additionally, consideration of the PC4-G4DNA interaction could provide insight into the biological functions of PC4, which remain incompletely understood. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Differential repair of etheno-DNA adducts by bacterial and human AlkB proteins. (United States)

    Zdżalik, Daria; Domańska, Anna; Prorok, Paulina; Kosicki, Konrad; van den Born, Erwin; Falnes, Pål Ø; Rizzo, Carmelo J; Guengerich, F Peter; Tudek, Barbara


    AlkB proteins are evolutionary conserved Fe(II)/2-oxoglutarate-dependent dioxygenases, which remove alkyl and highly promutagenic etheno(ɛ)-DNA adducts, but their substrate specificity has not been fully determined. We developed a novel assay for the repair of ɛ-adducts by AlkB enzymes using oligodeoxynucleotides with a single lesion and specific DNA glycosylases and AP-endonuclease for identification of the repair products. We compared the repair of three ɛ-adducts, 1,N(6)-ethenoadenine (ɛA), 3,N(4)-ethenocytosine (ɛC) and 1,N(2)-ethenoguanine (1,N(2)-ɛG) by nine bacterial and two human AlkBs, representing four different structural groups defined on the basis of conserved amino acids in the nucleotide recognition lid, engaged in the enzyme binding to the substrate. Two bacterial AlkB proteins, MT-2B (from Mycobacterium tuberculosis) and SC-2B (Streptomyces coelicolor) did not repair these lesions in either double-stranded (ds) or single-stranded (ss) DNA. Three proteins, RE-2A (Rhizobium etli), SA-2B (Streptomyces avermitilis), and XC-2B (Xanthomonas campestris) efficiently removed all three lesions from the DNA substrates. Interestingly, XC-2B and RE-2A are the first AlkB proteins shown to be specialized for ɛ-adducts, since they do not repair methylated bases. Three other proteins, EcAlkB (Escherichia coli), SA-1A, and XC-1B removed ɛA and ɛC from ds and ssDNA but were inactive toward 1,N(2)-ɛG. SC-1A repaired only ɛA with the preference for dsDNA. The human enzyme ALKBH2 repaired all three ɛ-adducts in dsDNA, while only ɛA and ɛC in ssDNA and repair was less efficient in ssDNA. ALKBH3 repaired only ɛC in ssDNA. Altogether, we have shown for the first time that some AlkB proteins, namely ALKBH2, RE-2A, SA-2B and XC-2B can repair 1,N(2)-ɛG and that ALKBH3 removes only ɛC from ssDNA. Our results also suggest that the nucleotide recognition lid is not the sole determinant of the substrate specificity of AlkB proteins. Copyright © 2015 Elsevier B

  2. LC-MS-MS quantitative analysis reveals the association between FTO and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Yuting Zhu

    Full Text Available Fat mass and obesity-associated protein (FTO is α-ketoglutarate-dependent dioxygenase and responsible for demethylating N6-methyladenosine (m6A in mRNA, 3-methylthymine (m3T in single-stranded DNA (ssDNA and 3-methyluracil (m3U in single-stranded RNA (ssRNA. Its other function remains unknown but thousands of mammalian DNA show 5-methyl-2'-deoxycytidine (5mdC modification and 5mdC demethylases are required for mammalian energy homeostasis and fertility. Here, we aimed to confirm whether FTO proteins can demethylate 5mdC in DNA. However, we found that FTO exhibits no potent demethylation activity against 5mdC in vitro and in vivo by using liquid chromatography-tandem mass spectrometry (LC-MS-MS. The result showed FTO demethylase has the characteristics of high substrates specificity and selectivity. In addition, we also used immunofluorescence technique to demonstrate overexpression of wild type TET2, but not FTO and mutant TET2 in Hela cells results in higher levels of 5-hydroxymethyl-2'-deoxycytidine (5hmdC generated from 5mdC. In conclusion, our results not only reveal the enzymatic activity of FTO, but also may facilitate the future discovery of proteins involved in epigenetic modification function.

  3. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification


    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  4. Some Physics and Applications for DNA Transport Through Single Nanopores (United States)

    Kasianowicz, J. J.


    In an effort to understand macromolecular transport in living systems, we are studying the ability of a single-stranded DNA (ssDNA) to thread through single nanometer-scale pores. Some six years ago it was shown that an applied electrostatic potential can drive individual negatively charged molecules of ssDNA through a single Staphylococcus aureus a-hemolysin (aHL) protein ionic channel(Kasianowicz, J.J., et al. 1996. Proc. Natl. Acad. Sci. (USA) 93, 13770). We also demonstrated that the mean rate at which polynucleotides enter this pore depends on the magnitude of the applied potential and the side through which the polymer enters. Although the flux of polynucleotides into the pore can be described by a simple Van't-Hoff rate law(Henrickson, S.E., et al. 2000. Phys. Rev. Lett. 85, 3057), detailed models provide more physical insight into both this process and polymer translocation(Konkoli, Z., et al. submitted)/footnoteAmbjörnsson, T., et al. submitted. We show that modified polynucleotides can be used to probe the structure of channels formed by native aHL and modified aHL mutants(Henrickson, et al., submitted). These experimental results suggest that both the location of energy barriers to polymer transport and the channel's geometric properties can be determined. We discuss several potential biotechnological applications based on these findings(Kasianowicz, J.J. et al., Anal. Chem. 73, 2268)(Stanford, V. and J.J. Kasianowicz, submitted.)

  5. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study. (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero


    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  6. Nanoprobe-Initiated Enzymatic Polymerization for Highly Sensitive Electrochemical DNA Detection. (United States)

    Wan, Ying; Wang, Pengjuan; Su, Yan; Wang, Lihua; Pan, Dun; Aldalbahi, Ali; Yang, Shulin; Zuo, Xiaolei


    Electrochemical DNA (E-DNA) sensors have been greatly developed and play an important role in early diagnosis of different diseases. To determine the extremely low abundance of DNA biomarkers in clinical samples, scientists are making unremitting efforts toward achieving highly sensitive and selective E-DNA sensors. Here, a novel E-DNA sensor was developed taking advantage of the signal amplification efficiency of nanoprobe-initiated enzymatic polymerization (NIEP). In the NIEP based E-DNA sensor, the capture probe DNA was thiolated at its 3'-terminal to be immobilized onto gold electrode, and the nanoprobe was fabricated by 5'-thiol-terminated signal probe DNA conjugated gold nanoparticles (AuNPs). Both of the probes could simultaneously hybridize with the target DNA to form a "sandwich" structure followed by the terminal deoxynucleotidyl transferase (TdT)-catalyzed elongation of the free 3'-terminal of DNA on the nanoprobe. During the DNA elongation, biotin labels were incorporated into the NIEP-generated long single-stranded DNA (ssDNA) tentacles, leading to specific binding of avidin modified horseradish peroxidase (Av-HRP). Since there are hundreds of DNA probes on the nanoprobe, one hybridization event would generate hundreds of long ssDNA tentacles, resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. By employing nanoprobe and TdT, it is demonstrated that the NIEP amplified E-DNA sensor has a detection limit of 10 fM and excellent differentiation ability for even single-base mismatch.

  7. Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

    Energy Technology Data Exchange (ETDEWEB)

    Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan; Lynn, Annie [Department of Molecular Biosciences, University of Kansas, Lawrence, KS 66045 (United States); Cotmore, Susan F. [Departments of Laboratory Medicine, Yale University Medical School, New Haven, CT 06510 (United States); Tattersall, Peter [Departments of Laboratory Medicine, Yale University Medical School, New Haven, CT 06510 (United States); Departments of Genetics, Yale University Medical School, New Haven, CT 06510 (United States); Zhao, Haiyan, E-mail: [Department of Molecular Biosciences, University of Kansas, Lawrence, KS 66045 (United States); Tang, Liang, E-mail: [Department of Molecular Biosciences, University of Kansas, Lawrence, KS 66045 (United States)


    Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase active site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.

  8. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.

    Directory of Open Access Journals (Sweden)

    Yuki Nakayama

    Full Text Available The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA. Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR, which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1 DNA extracted from fresh frozen liver tissues (Frozen-DNA; 2 DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA; and 3 DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA. These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method

  9. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions. (United States)

    Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko


    The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

  10. Procedure for normalization of cDNA libraries (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento


    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  11. Carbon nanostructures as immobilization platform for DNA: A review on current progress in electrochemical DNA sensors. (United States)

    Rasheed, P Abdul; Sandhyarani, N


    Development of a sensitive, specific and cost-effective DNA detection method is motivated by increasing demand for the early stage diagnosis of genetic diseases. Recent developments in the design and fabrication of efficient sensor platforms based on nanostructures make the highly sensitive sensors which could indicate very low detection limit to the level of few molecules, a realistic possibility. Electrochemical detection methods are widely used in DNA diagnostics as it provide simple, accurate and inexpensive platform for DNA detection. In addition, the electrochemical DNA sensors provide direct electronic signal without the use of expensive signal transduction equipment and facilitates the immobilization of single stranded DNA (ssDNA) probe sequences on a wide variety of electrode substrates. It has been found that a range of nanomaterials such as metal nanoparticles (MNPs), carbon based nanomaterials, quantum dots (QDs), magnetic nanoparticles and polymeric NPs have been introduced in the sensor design to enhance the sensing performance of electrochemical DNA sensor. In this review, we discuss recent progress in the design and fabrication of efficient electrochemical genosensors based on carbon nanostructures such as carbon nanotubes, graphene, graphene oxide and nanodiamonds. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. DNA-polymer micelles as nanoparticles with recognition ability. (United States)

    Talom, Renée Mayap; Fuks, Gad; Kaps, Leonard; Oberdisse, Julian; Cerclier, Christel; Gaillard, Cédric; Mingotaud, Christophe; Gauffre, Fabienne


    The Watson-Crick binding of DNA single strands is a powerful tool for the assembly of nanostructures. Our objective is to develop polymer nanoparticles equipped with DNA strands for surface-patterning applications, taking advantage of the DNA technology, in particular, recognition and reversibility. A hybrid DNA copolymer is synthesized through the conjugation of a ssDNA (22-mer) with a poly(ethylene oxide)-poly(caprolactone) diblock copolymer (PEO-b-PCl). It is shown that, in water, the PEO-b-PCl-ssDNA(22) polymer forms micelles with a PCl hydrophobic core and a hydrophilic corona made of PEO and DNA. The micelles are thoroughly characterized using electron microscopy (TEM and cryoTEM) and small-angle neutron scattering. The binding of these DNA micelles to a surface through DNA recognition is monitored using a quartz crystal microbalance and imaged by atomic force microscopy. The micelles can be released from the surface by a competitive displacement event. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Influence of intra-molecular flexibility on the elastic property of double-stranded DNA film on a substrate (United States)

    Wu, Jun-Zheng; Meng, Wei-Lie; Tang, Heng-Song; Zhang, Neng-Hui


    DNA film self-assembled or nanografted on a substrate, as a kind of soft matter, consists of fixed DNA chains endowed with negative charges and an aqueous solution full of cations, anions and water molecules. Their thermal/electrical/mechanical properties are closely related to the complex biodetection signals in nano-/micro-scale biosensors and other new genome technologies. This makes it important to properly characterize these properties. In this paper, the effect of flexible micro-scale configurations on the elastic moduli of DNA films is investigated. First, illuminated by Qiu’s sphere model, an alternative bead-chain model in terms of the Yukawa potential is presented for flexible intra-DNA configurations to describe interactions between DNA fragments. The effective charges of coarse-grained DNA beads could be derived, in which the empirical parameters are identified by curve fitting with Qiu’s experimental data. Second, the updated mesoscopic bead-chain model and the thought experiment of a continuum compression bar are used to compare the elastic moduli of double-stranded DNA (dsDNA) films prepared by self-assembling and nanografting techniques. Configurational sampling is achieved via Monte Carlo simulation. Our predictions quantitatively or qualitatively agree well with the relevant experiments on the effective charge of dsDNA from low to moderate monovalent counterion concentration, immobilization deflection of single-stranded DNA (ssDNA) or dsDNA microcantilever with the variation of salt concentration, and elastic modulus of ssDNA film in the air. The results reveal that different solution environment stimulates the diverse mechanical properties of dsDNA film on a substrate, and the end effect (i.e. terminal group effect) makes self-assembling dsDNA film stiffer in the sense of the same average packing density.

  14. Spectroscopic studies of DNA interactions with food colorant indigo carmine with the use of ethidium bromide as a fluorescence probe. (United States)

    Ma, Yadi; Zhang, Guowen; Pan, Junhui


    The interaction of indigo carmine (IC) with calf thymus DNA in physiological buffer (pH 7.4), using ethidium bromide (EB) dye as a fluorescence probe, was investigated by ultraviolet-visible absorption, fluorescence, and circular dichroism (CD) spectroscopy, coupled with viscosity measurements and DNA-melting studies. Hypochromicity of the absorption spectra of IC and enhancement in fluorescence polarization of IC were observed with the addition of DNA. Moreover, the binding of IC to DNA was able to decrease iodide and single-stranded DNA (ssDNA) quenching effects, increase the melting temperature and relative viscosity of DNA, and induce the changes in CD spectra of DNA. All of the evidence indicated that IC interacted with DNA in the mode of intercalative binding. Furthermore, the three-way synchronous fluorescence spectra data obtained from the interaction between IC and DNA-EB were resolved by parallel factor analysis (PARAFAC), and the results provided simultaneously the concentration information and the pure spectra for the three reaction components (IC, EB, and DNA-EB) of the system at equilibrium. This PARAFAC demonstrated that the intercalation of IC molecules into DNA proceeded by substituting for EB in the DNA-EB complex. The calculated thermodynamic parameters, ΔH° and ΔS°, suggested that both hydrophobic interactions and hydrogen bonds played a predominant role in the binding of IC to DNA.

  15. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification. (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei


    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  16. A Hybrid Semi-Digital Transimpedance Amplifier With Noise Cancellation Technique for Nanopore-Based DNA Sequencing. (United States)

    Hsu, Chung-Lun; Jiang, Haowei; Venkatesh, A G; Hall, Drew A


    Over the past two decades, nanopores have been a promising technology for next generation deoxyribonucleic acid (DNA) sequencing. Here, we present a hybrid semi-digital transimpedance amplifier (HSD-TIA) to sense the minute current signatures introduced by single-stranded DNA (ssDNA) translocating through a nanopore, while discharging the baseline current using a semi-digital feedback loop. The amplifier achieves fast settling by adaptively tuning a DC compensation current when a step input is detected. A noise cancellation technique reduces the total input-referred current noise caused by the parasitic input capacitance. Measurement results show the performance of the amplifier with 31.6 M Ω mid-band gain, 950 kHz bandwidth, and 8.5 fA/ √Hz input-referred current noise, a 2× noise reduction due to the noise cancellation technique. The settling response is demonstrated by observing the insertion of a protein nanopore in a lipid bilayer. Using the nanopore, the HSD-TIA was able to measure ssDNA translocation events.

  17. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.


    to that for the adenine molecule and the dAMP mononucleotide. Desolvation has little effect on the bandwidth, which implies that inhomogenous broadening of the absorption bands in aqueous solution is of minor importance compared to, e.g., conformational disorder. Finally, at high photon energies, internal conversion...

  18. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  19. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes. (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar


    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Coarse-grained molecular dynamics simulation of DNA translocation in chemically modified nanopores. (United States)

    Ramachandran, Abhijit; Guo, Qingjiang; Iqbal, Samir M; Liu, Yaling


    Solid-state nanopores provide a direct means to detect and analyze DNA and proteins. In a typical setup, the DNA molecules travel through a nanopore under electrophoretic voltage bias. The nanopore is sandwiched between two chambers that are filled with ionic solution. A major challenge in using solid-state nanopores for DNA sequencing and gene detection is to improve their selectivity and detection sensitivity. To achieve these goals, one solution is to functionalize the nanopores by chemically modifying the pore walls with silanes or nucleic acids. However, little is known about molecular interactions in functionalized nanopores. This paper presents DNA translocation dynamics and the mechanism of DNA sequencing in a functionalized nanopore through a coarse-grained molecular dynamics model. The DNA nucleotide is coarse-grained into two interaction sites: one site corresponds to the base group and the other encompasses the phosphate and sugar groups. The water molecules are included in the model implicitly through Langevin dynamics. The coarse-grained model immensely improves the computational efficiency while still capturing the essential translocation dynamics. The model characterizes important physical properties of functionalized nanopores such as the effective pore diameter and effect of biasing voltage on the DNA translocation dynamics. The model reveals a nonlinear relationship between translocation speed of DNA and applied voltage. Moreover, DNA translocation in nanopores functionalized with hairpin-loop (HPL) DNA and single-stranded DNA (ss-DNA) shows significant differences: a target DNA is found to translocate through a ss-DNA coated nanopore 9 times faster than through an HPL coated one at a bias of 100 mV, putatively from lower stiffness of ss-DNA than that for HPL. The DNA translocation speed is also largely influenced by interaction potential between the DNA and surface-tethered molecules. The results reveal that such selective translocation

  1. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns. (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John


    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  2. Community Sewage Sensors towards Evaluation of Drug Use Trends: Detection of Cocaine in Wastewater with DNA-Directed Immobilization Aptamer Sensors. (United States)

    Yang, Zhugen; Castrignanò, Erika; Estrela, Pedro; Frost, Christopher G; Kasprzyk-Hordern, Barbara


    Illicit drug use has a global concern and effective monitoring and interventions are highly required to combat drug abuse. Wastewater-based epidemiology (WBE) is an innovative and cost-effective approach to evaluate community-wide drug use trends, compared to traditional population surveys. Here we report for the first time, a novel quantitative community sewage sensor (namely DNA-directed immobilization of aptamer sensors, DDIAS) for rapid and cost-effective estimation of cocaine use trends via WBE. Thiolated single-stranded DNA (ssDNA) probe was hybridized with aptamer ssDNA in solution, followed by co-immobilization with 6-mercapto-hexane onto the gold electrodes to control the surface density to effectively bind with cocaine. DDIAS was optimized to detect cocaine at as low as 10 nM with a dynamic range from 10 nM to 5 μM, which were further employed for the quantification of cocaine in wastewater samples collected from a wastewater treatment plant in seven consecutive days. The concentration pattern of the sampling week is comparable with that from mass spectrometry. Our results demonstrate that the developed DDIAS can be used as community sewage sensors for rapid and cost-effective evaluation of drug use trends, and potentially implemented as a powerful tool for on-site and real-time monitoring of wastewater by un-skilled personnel.

  3. Community Sewage Sensors towards Evaluation of Drug Use Trends: Detection of Cocaine in Wastewater with DNA-Directed Immobilization Aptamer Sensors (United States)

    Yang, Zhugen; Castrignanò, Erika; Estrela, Pedro; Frost, Christopher G.; Kasprzyk-Hordern, Barbara


    Illicit drug use has a global concern and effective monitoring and interventions are highly required to combat drug abuse. Wastewater-based epidemiology (WBE) is an innovative and cost-effective approach to evaluate community-wide drug use trends, compared to traditional population surveys. Here we report for the first time, a novel quantitative community sewage sensor (namely DNA-directed immobilization of aptamer sensors, DDIAS) for rapid and cost-effective estimation of cocaine use trends via WBE. Thiolated single-stranded DNA (ssDNA) probe was hybridized with aptamer ssDNA in solution, followed by co-immobilization with 6-mercapto-hexane onto the gold electrodes to control the surface density to effectively bind with cocaine. DDIAS was optimized to detect cocaine at as low as 10 nM with a dynamic range from 10 nM to 5 μM, which were further employed for the quantification of cocaine in wastewater samples collected from a wastewater treatment plant in seven consecutive days. The concentration pattern of the sampling week is comparable with that from mass spectrometry. Our results demonstrate that the developed DDIAS can be used as community sewage sensors for rapid and cost-effective evaluation of drug use trends, and potentially implemented as a powerful tool for on-site and real-time monitoring of wastewater by un-skilled personnel.

  4. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan


    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  5. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    National Research Council Canada - National Science Library

    Kuo, Shue-Ru


    .... Both DNA-PK and the unknown factor are functioned as trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication, repair and recombination...

  6. Characterization of the χψ subcomplex of Pseudomonas aeruginosa DNA polymerase III

    Directory of Open Access Journals (Sweden)

    Witte Gregor


    Full Text Available Abstract Background DNA polymerase III, the main enzyme responsible for bacterial DNA replication, is composed of three sub-assemblies: the polymerase core, the β-sliding clamp, and the clamp loader. During replication, single-stranded DNA-binding protein (SSB coats and protects single-stranded DNA (ssDNA and also interacts with the χψ heterodimer, a sub-complex of the clamp loader. Whereas the χ subunits of Escherichia coli and Pseudomonas aeruginosa are about 40% homologous, P. aeruginosa ψ is twice as large as its E. coli counterpart, and contains additional sequences. It was shown that P. aeruginosa χψ together with SSB increases the activity of its cognate clamp loader 25-fold at low salt. The E. coli clamp loader, however, is insensitive to the addition of its cognate χψ under similar conditions. In order to find out distinguishing properties within P. aeruginosa χψ which account for this higher stimulatory effect, we characterized P. aeruginosa χψ by a detailed structural and functional comparison with its E. coli counterpart. Results Using small-angle X-ray scattering, analytical ultracentrifugation, and homology-based modeling, we found the N-terminus of P. aeruginosa ψ to be unstructured. Under high salt conditions, the affinity of the χψ complexes from both organisms to their cognate SSB was similar. Under low salt conditions, P. aeruginosa χψ, contrary to E. coli χψ, binds to ssDNA via the N-terminus of ψ. Whereas it is also able to bind to double-stranded DNA, the affinity is somewhat reduced. Conclusions The binding to DNA, otherwise never reported for any other ψ protein, enhances the affinity of P. aeruginosa χψ towards the SSB/ssDNA complex and very likely contributes to the higher stimulatory effect of P. aeruginosa χψ on the clamp loader. We also observed DNA-binding activity for P. putida χψ, making this activity most probably a characteristic of the ψ proteins from the Pseudomonadaceae.

  7. Novel rolling circle amplification and DNA origami-based DNA belt-involved signal amplification assay for highly sensitive detection of prostate-specific antigen (PSA). (United States)

    Yan, Juan; Hu, Chongya; Wang, Ping; Liu, Rui; Zuo, Xiaolei; Liu, Xunwei; Song, Shiping; Fan, Chunhai; He, Dannong; Sun, Gang


    Prostate-specific antigen (PSA) is one of the most important biomarkers for the early diagnosis and prognosis of prostate cancer. Although many efforts have been made to achieve significant progress for the detection of PSA, challenges including relative low sensitivity, complicated operation, sophisticated instruments, and high cost remain unsolved. Here, we have developed a strategy combining rolling circle amplification (RCA)-based DNA belts and magnetic bead-based enzyme-linked immunosorbent assay (ELISA) for the highly sensitive and specific detection of PSA. At first, a 96-base circular DNA template was designed and prepared for the following RCA. Single stranded DNA (ssDNA) products from RCA were used as scaffold strand for DNA origami, which was hybridized with three staple strands of DNA. The resulting DNA belts were conjugated with multiple enzymes for signal amplification and then employed to magnetic bead based ELISA for PSA detection. Through our strategy, as low as 50 aM of PSA can be detected with excellent specificity.

  8. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol


    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  9. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong


    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  10. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks. (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P


    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  11. Electrochemical DNA Biosensor Based on a Tetrahedral Nanostructure Probe for the Detection of Avian Influenza A (H7N9) Virus. (United States)

    Dong, Shibiao; Zhao, Rongtao; Zhu, Jiangong; Lu, Xiao; Li, Yang; Qiu, Shaofu; Jia, Leili; Jiao, Xiong; Song, Shiping; Fan, Chunhai; Hao, RongZhang; Song, HongBin


    A DNA tetrahedral nanostructure-based electrochemical biosensor was developed to detect avian influenza A (H7N9) virus through recognizing a fragment of the hemagglutinin gene sequence. The DNA tetrahedral probe was immobilized onto a gold electrode surface based on self-assembly between three thiolated nucleotide sequences and a longer nucleotide sequence containing complementary DNA to hybridize with the target single-stranded (ss)DNA. The captured target sequence was hybridized with a biotinylated-ssDNA oligonucleotide as a detection probe, and then avidin-horseradish peroxidase was introduced to produce an amperometric signal through the interaction with 3,3',5,5'-tetramethylbenzidine substrate. The target ssDNA was obtained by asymmetric polymerase chain reaction (PCR) of the cDNA template, reversely transcribed from the viral lysate of influenza A (H7N9) virus in throat swabs. The results showed that this electrochemical biosensor could specifically recognize the target DNA fragment of influenza A (H7N9) virus from other types of influenza viruses, such as influenza A (H1N1) and (H3N2) viruses, and even from single-base mismatches of oligonucleotides. Its detection limit could reach a magnitude of 100 fM for target nucleotide sequences. Moreover, the cycle number of the asymmetric PCR could be reduced below three with the electrochemical biosensor still distinguishing the target sequence from the negative control. To the best of our knowledge, this is the first report of the detection of target DNA from clinical samples using a tetrahedral DNA probe functionalized electrochemical biosensor. It displays that the DNA tetrahedra has a great potential application as a probe of the electrochemical biosensor to detect avian influenza A (H7N9) virus and other pathogens at the gene level, which will potentially aid the prevention and control of the disease caused by such pathogens.

  12. Binding characteristics and interactive region of 2-phenylpyrazolo[1,5-c]quinazoline with DNA. (United States)

    Song, Yonghai; Zhong, Dandan; Luo, Jinhui; Tan, Hongliang; Chen, Shouhui; Li, Ping; Wang, Li; Wang, Tao


    The interaction between 2-phenylpyrazolo[1,5-c]quinazoline (PQ) and DNA under physiological conditions was investigated using multi-spectroscopic techniques, atomic force microscopy and gel electrophoresis. The thermodynamic parameters were estimated and were discussed in detail. The results of fluorescence-quenching experiments indicated that the main interactive force between PQ and DNA was a hydrophobic interaction and that it was a static quenching process. Potassium iodide and single-strand (ss)DNA quenching studies, together with circular dichroism spectra implied groove binding of PQ with DNA. Atomic force microscopy and gel electrophoresis experiments suggested that there were no major conformational changes in DNA upon interaction with PQ. In addition, UV/vis absorption titration of DNA bases confirmed that PQ bound with DNA mainly through a minor groove interaction and preferentially interacted with adenine and thymine. We anticipate that this work will provide useful information for the application of quinazoline derivatives in the fields of medicinal and pharmaceutical chemistry. Copyright © 2014 John Wiley & Sons, Ltd.

  13. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses. (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn


    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  14. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    Directory of Open Access Journals (Sweden)

    Tina Y Liu

    Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  15. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System. (United States)

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A


    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  16. Rolling cycle amplification based single-color quantum dots–ruthenium complex assembling dyads for homogeneous and highly selective detection of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Su, Chen; Liu, Yufei; Ye, Tai; Xiang, Xia; Ji, Xinghu; He, Zhike, E-mail:


    , this strategy applies QDs–Ru assembling dyads to the detection of single-strand DNA (ssDNA) without any functionalization and separation techniques.

  17. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide


    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  18. Systematic Analysis of the DNA Damage Response Network in Telomere Defective Budding Yeast

    Directory of Open Access Journals (Sweden)

    Eva-Maria Holstein


    Full Text Available Functional telomeres are critically important to eukaryotic genetic stability. Scores of proteins and pathways are known to affect telomere function. Here, we report a series of related genome-wide genetic interaction screens performed on budding yeast cells with acute or chronic telomere defects. Genetic interactions were examined in cells defective in Cdc13 and Stn1, affecting two components of CST, a single stranded DNA (ssDNA binding complex that binds telomeric DNA. For comparison, genetic interactions were also examined in cells with defects in Rfa3, affecting the major ssDNA binding protein, RPA, which has overlapping functions with CST at telomeres. In more complex experiments, genetic interactions were measured in cells lacking EXO1 or RAD9, affecting different aspects of the DNA damage response, and containing a cdc13-1 induced telomere defect. Comparing fitness profiles across these data sets helps build a picture of the specific responses to different types of dysfunctional telomeres. The experiments show that each context reveals different genetic interactions, consistent with the idea that each genetic defect causes distinct molecular defects. To help others engage with the large volumes of data, the data are made available via two interactive web-based tools: Profilyzer and DIXY. One particularly striking genetic interaction observed was that the chk1∆ mutation improved fitness of cdc13-1 exo1∆ cells more than other checkpoint mutations (ddc1∆, rad9∆, rad17∆, and rad24∆, whereas, in cdc13-1 cells, the effects of all checkpoint mutations were similar. We show that this can be explained by Chk1 stimulating resection—a new function for Chk1 in the eukaryotic DNA damage response network.

  19. Polynucleotide 3′-terminal Phosphate Modifications by RNA and DNA Ligases (United States)

    Zhelkovsky, Alexander M.; McReynolds, Larry A.


    RNA and DNA ligases catalyze the formation of a phosphodiester bond between the 5′-phosphate and 3′-hydroxyl ends of nucleic acids. In this work, we describe the ability of the thermophilic RNA ligase MthRnl from Methanobacterium thermoautotrophicum to recognize and modify the 3′-terminal phosphate of RNA and single-stranded DNA (ssDNA). This ligase can use an RNA 3′p substrate to generate an RNA 2′,3′-cyclic phosphate or convert DNA3′p to ssDNA3′pp5′A. An RNA ligase from the Thermus scotoductus bacteriophage TS2126 and a predicted T4 Rnl1-like protein from Thermovibrio ammonificans, TVa, were also able to adenylate ssDNA 3′p. These modifications of RNA and DNA 3′-phosphates are similar to the activities of RtcA, an RNA 3′-phosphate cyclase. The initial step involves adenylation of the enzyme by ATP, which is then transferred to either RNA 3′p or DNA 3′p to generate the adenylated intermediate. For RNA 3′pp5′A, the third step involves attack of the adjacent 2′ hydroxyl to generate the RNA 2′,3′-cyclic phosphate. These steps are analogous to those in classical 5′ phosphate ligation. MthRnl and TS2126 RNA ligases were not able to modify a 3′p in nicked double-stranded DNA. However, T4 DNA ligase and RtcA can use 3′-phosphorylated nicks in double-stranded DNA to produce a 3′-adenylated product. These 3′-terminal phosphate-adenylated intermediates are substrates for deadenylation by yeast 5′Deadenylase. Our findings that classic ligases can duplicate the adenylation and phosphate cyclization activity of RtcA suggests that they have an essential role in metabolism of nucleic acids with 3′-terminal phosphates. PMID:25324547

  20. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals (United States)


    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  1. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes. (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian


    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  2. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs (United States)

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima


    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  3. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Directory of Open Access Journals (Sweden)

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  4. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  5. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    Czech Academy of Sciences Publication Activity Database

    Charnavets, Tatsiana; Nunvář, Jaroslav; Nečasová, Iva; Voelker, J.; Breslauer, K.J.; Schneider, Bohdan


    Roč. 103, č. 10 (2015), s. 585-596 ISSN 0006-3525 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA ČR GAP305/12/1801; GA MŠk(CZ) EE2.3.30.0020 Institutional support: RVO:86652036 Keywords : bacterial repetitive extragenic palindromes (REP) * circular dichroism spectroscopy * REP associated tyrosine transposases (RAYTs) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.248, year: 2015

  6. Spectroscopic study on the interaction of eugenol with salmon sperm DNA in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bi Shuyun, E-mail: [College of Chemistry, Changchun Normal University, Changchun 130032 (China); Yan Lili; Wang Yu; Pang Bong; Wang Tianjiao [College of Chemistry, Changchun Normal University, Changchun 130032 (China)


    Fluorescence spectra, absorption spectra, melting temperature, ionic strength effect, and viscosity experiments were described that characterize the interaction of eugenol with salmon sperm DNA in vitro. Eugenol was found to bind but weakly to DNA, with binding constants of 4.23 Multiplication-Sign 10{sup 3}, 3.62 Multiplication-Sign 10{sup 3} and 2.47 Multiplication-Sign 10{sup 3} L mol{sup -1} at 18, 28 and 38 Degree-Sign C respectively. The Stern-Volmer plots at different temperatures suggested that the quenching type of fluorescence of eugenol by DNA was a static quenching. Both the relative viscosity and the melting temperature of DNA were increased by the addition of eugenol. The changes of ionic strength had no affect on the binding. In addition, the binding constant of eugenol with single stranded DNA (ssDNA) was larger than that of eugenol with double stranded DNA (dsDNA). These results revealed that the binding mode of eugenol to DNA was intercalative binding. The thermodynamic parameters {Delta}H, {Delta}G and {Delta}S were also obtained according to the Van't Hoff equations, which suggested that hydrogen bond or van der Waals force might play an important role in a binding of eugenol to DNA. Based on the theory of the Foerster energy transference, the binding distance between DNA and eugenol was determined as 4.40 nm, indicating that the static fluorescence quenching of eugenol by DNA was also a non-radiation energy transfer process. - Highlights: Black-Right-Pointing-Pointer DNA quenched the fluorescence of eugenol. Black-Right-Pointing-Pointer Binding constant, binding site and binding force were determined. Black-Right-Pointing-Pointer Binding mode of eugenol to DNA was intercalative. Black-Right-Pointing-Pointer Energy transfer occurred between eugenol and DNA.

  7. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis. (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R


    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  8. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.


    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  9. Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry. (United States)

    Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong


    G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

  10. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids. (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi


    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Phase Transition of DNA-Linked Gold Nanoparticle


    Kiang, Ching-Hwa


    Melting and hybridization of DNA-capped gold nanoparticle networks are investigated with optical absorption spectroscopy. Single-stranded, 12-base DNA-capped gold nanoparticles are linked with complementary, single-stranded, 24-base linker DNA to form particle networks. Compared to free DNA, a sharp melting transition is seen in these networked DNA-nanoparticle systems. The sharpness is explained by percolation transition phenomena.

  12. The UL8 subunit of the helicase-primase complex of herpes simplex virus promotes DNA annealing and has a high affinity for replication forks. (United States)

    Bermek, Oya; Weller, Sandra K; Griffith, Jack D


    During lytic infection, herpes simplex virus (HSV) DNA is replicated by a mechanism involving DNA recombination. For instance, replication of the HSV-1 genome produces X- and Y-branched structures, reminiscent of recombination intermediates. HSV-1's replication machinery includes a trimeric helicase-primase composed of helicase (UL5) and primase (UL52) subunits and a third subunit, UL8. UL8 has been reported to stimulate the helicase and primase activities of the complex in the presence of ICP8, an HSV-1 protein that functions as an annealase, a protein that binds complementary single-stranded DNA (ssDNA) and facilitates its annealing to duplex DNA. UL8 also influences the intracellular localization of the UL5/UL52 subunits, but UL8's catalytic activities are not known. In this study we used a combination of biochemical techniques and transmission electron microscopy. First, we report that UL8 alone forms protein filaments in solution. Moreover, we also found that UL8 binds to ssDNAs >50-nucletides long and promotes the annealing of complementary ssDNA to generate highly branched duplex DNA structures. Finally, UL8 has a very high affinity for replication fork structures containing a gap in the lagging strand as short as 15 nucleotides, suggesting that UL8 may aid in directing or loading the trimeric complex onto a replication fork. The properties of UL8 uncovered here suggest that UL8 may be involved in the generation of the X- and Y-branched structures that are the hallmarks of HSV replication. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda


    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  14. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.


    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present

  15. Multispectroscopic studies of paeoniflorin binding to calf thymus DNA in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Guowen, E-mail: [State Key Laboratory of Food Science and Technology, Nanchang University, No. 235, Nanjing East Road, Nanchang, Jiangxi 330047 (China); Fu, Peng; Pan, Junhui [State Key Laboratory of Food Science and Technology, Nanchang University, No. 235, Nanjing East Road, Nanchang, Jiangxi 330047 (China)


    The mechanism of paeoniflorin binding to calf thymus DNA in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy, coupled with viscosity measurements and DNA melting techniques. The results suggested that paeoniflorin molecules could bind to DNA via groove binding mode as evidenced by no significant change in iodide quenching effect, increase in single-stranded DNA (ssDNA) quenching effect, and almost unchanged relative viscosity and melting temperature of DNA. The observed changes in CD signals revealed that DNA remains in the B-conformation. Further, the displacement experiments with Hoechst 33258 probe and the results of FT-IR spectra indicated that paeoniflorin mainly binds in the region of rich A-T base pairs of DNA. The thermodynamic parameters, enthalpy change ({Delta}H Degree-Sign ) and entropy change ({Delta}S Degree-Sign ) were calculated to be -30.09{+-}0.18 kJ mol{sup -1} and -14.07{+-}0.61 J mol{sup -1} K{sup -1} by the van't Hoff equation, suggesting that hydrogen bond and van der Waals forces play a predominant role in the binding of paeoniflorin to DNA. - Highlights: Black-Right-Pointing-Pointer The binding mode of paeoniflorin to calf thymus DNA is the minor groove binding. Black-Right-Pointing-Pointer Paeoniflorin mainly binds in the region of rich A-T base pairs of DNA. Black-Right-Pointing-Pointer The binding does not alter the native B-conformation of DNA. Black-Right-Pointing-Pointer The binding is driven mainly by hydrogen bonds and van der Waals forces.

  16. Cellular Dynamics of Rad51 and Rad54 in Response to Postreplicative Stress and DNA Damage in HeLa Cells. (United States)

    Choi, Eui-Hwan; Yoon, Seobin; Hahn, Yoonsoo; Kim, Keun P


    Homologous recombination (HR) is necessary for maintenance of genomic integrity and prevention of various mutations in tumor suppressor genes and proto-oncogenes. Rad51 and Rad54 are key HR factors that cope with replication stress and DNA breaks in eukaryotes. Rad51 binds to single-stranded DNA (ssDNA) to form the presynaptic filament that promotes a homology search and DNA strand exchange, and Rad54 stimulates the strand-pairing function of Rad51. Here, we studied the molecular dynamics of Rad51 and Rad54 during the cell cycle of HeLa cells. These cells constitutively express Rad51 and Rad54 throughout the entire cell cycle, and the formation of foci immediately increased in response to various types of DNA damage and replication stress, except for caffeine, which suppressed the Rad51-dependent HR pathway. Depletion of Rad51 caused severe defects in response to postreplicative stress. Accordingly, HeLa cells were arrested at the G2-M transition although a small amount of Rad51 was steadily maintained in HeLa cells. Our results suggest that cell cycle progression and proliferation of HeLa cells can be tightly controlled by the abundance of HR proteins, which are essential for the rapid response to postreplicative stress and DNA damage stress.

  17. Plant organellar DNA primase-helicase synthesizes RNA primers for organellar DNA polymerases using a unique recognition sequence. (United States)

    Peralta-Castro, Antolín; Baruch-Torres, Noe; Brieba, Luis G


    DNA primases recognize single-stranded DNA (ssDNA) sequences to synthesize RNA primers during lagging-strand replication. Arabidopsis thaliana encodes an ortholog of the DNA primase-helicase from bacteriophage T7, dubbed AtTwinkle, that localizes in chloroplasts and mitochondria. Herein, we report that AtTwinkle synthesizes RNA primers from a 5'-(G/C)GGA-3' template sequence. Within this sequence, the underlined nucleotides are cryptic, meaning that they are essential for template recognition but are not instructional during RNA synthesis. Thus, in contrast to all primases characterized to date, the sequence recognized by AtTwinkle requires two nucleotides (5'-GA-3') as a cryptic element. The divergent zinc finger binding domain (ZBD) of the primase module of AtTwinkle may be responsible for template sequence recognition. During oligoribonucleotide synthesis, AtTwinkle shows a strong preference for rCTP as its initial ribonucleotide and a moderate preference for rGMP or rCMP incorporation during elongation. RNA products synthetized by AtTwinkle are efficiently used as primers for plant organellar DNA polymerases. In sum, our data strongly suggest that AtTwinkle primes organellar DNA polymerases during lagging strand synthesis in plant mitochondria and chloroplast following a primase-mediated mechanism. This mechanism contrasts to lagging-strand DNA replication in metazoan mitochondria, in which transcripts synthesized by mitochondrial RNA polymerase prime mitochondrial DNA polymerase γ. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis. (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G


    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  19. Conjugative DNA transfer induces the bacterial SOS response and promotes antibiotic resistance development through integron activation.

    Directory of Open Access Journals (Sweden)

    Zeynep Baharoglu


    Full Text Available Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response controls a series of genes responsible for DNA damage repair, which can lead to recombination and mutagenesis. In this manuscript, we show that conjugative transfer of ssDNA induces the bacterial SOS stress response, unless an anti-SOS factor is present to alleviate this response. We also show that integron integrases are up-regulated during this process, resulting in increased cassette rearrangements. Moreover, the data we obtained using broad and narrow host range plasmids strongly suggests that plasmid transfer, even abortive, can trigger chromosomal gene rearrangements and transcriptional switches in the recipient cell. Our results highlight the importance of environments concentrating disparate bacterial communities as reactors for extensive genetic adaptation of bacteria.

  20. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    National Research Council Canada - National Science Library

    Kuo, Shu-Ru


    .... We found that RPA purified from cells treated with adozelesin has the same single-stranded DNA binding activity and support nucleotide excision repair as normal RPA, but is not able to support SV40...

  1. Pyrrolo-dC modified duplex DNA as a novel probe for the sensitive assay of base excision repair enzyme activity. (United States)

    Lee, Chang Yeol; Park, Ki Soo; Park, Hyun Gyu


    We develop a novel approach to determine formamidopyrimidine DNA glycosylase (Fpg) activity by taking advantage of the unique fluorescence property of pyrrolo-dC (PdC) positioned opposite to 8-oxoguanine (8-oxoG) in duplex DNA. In its initial state, PdC in duplex DNA undergoes the efficient stacking and collisional quenching interactions, showing the low fluorescence signal. In contrast, the presence of Fpg, which specifically removes 8-oxoG and incises resulting apurinic (AP) site, transforms duplex DNA into single-stranded (ss) DNAs. As a result, the intrinsic fluorescence signal of PdC in ssDNA is recovered to exhibit the significantly enhanced fluorescence signal. Based on this Fpg-dependent fluorescence response of PdC, we could reliably determine Fpg activity down to 1.25U/ml with a linear response from 0 to 50U/ml. In addition, the diagnostic capability of this strategy was successfully demonstrated by reliably assaying Fpg activity in human blood serum, showing its great potential in the practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. DNA Structure Specificity Conferred on a Replicative Helicase by Its Loader*


    Gupta, Milind K.; Atkinson, John; McGlynn, Peter


    Prokaryotic and eukaryotic replicative helicases can translocate along single-stranded and double-stranded DNA, with the central cavity of these multimeric ring helicases being able to accommodate both forms of DNA. Translocation by such helicases along single-stranded DNA results in the unwinding of forked DNA by steric exclusion and appears critical in unwinding of parental strands at the replication fork, whereas translocation over double-stranded DNA has no well-defined role. We have foun...

  3. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  4. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.


    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  5. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism. (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol


    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  6. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes

    Czech Academy of Sciences Publication Activity Database

    Pietilä, M.K.; Roine, E.; Sencilo, Ana; Bamford, D.H.; Oksanen, H.M.


    Roč. 161, č. 1 (2016), s. 249-256 ISSN 0304-8608 R&D Projects: GA ČR(CZ) GAP302/11/ 1940 Institutional support: RVO:61388971 Keywords : VIRION ARCHITECTURE * HALOVIRUSES * SPINDLE Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  7. Two different routes for double-stranded DNA transfer in natural and artificial transformation of Escherichia coli. (United States)

    Sun, Dongchang


    Escherichia coli is naturally transformable, independent on the conserved DNA uptake machinery for single-stranded DNA (ssDNA) integration. The transfer of double-stranded DNA (dsDNA) during natural transformation of E. coli is regulated by the alternative sigma factor σ(S). However, it remains mysterious how dsDNA transfers across the membranes and how σ(S) regulates natural transformation of E. coli. Here, I screened for σ(S)-regulated genes for dsDNA transfer in E. coli. The screening identified the σ(S)-regulated genes ydcS and ydcV, both locate on the putative ABC transporter ydcSTUV operon. Considering that ydcS and ydcV are predicted to encode a periplasmic protein and an inner membrane protein for substrate binding and translocation respectively, I propose that they may mediate dsDNA translocation across the inner membrane during natural transformation. In chemical transformation of E. coli, ydcS was but ydcV was not required. Thus, YdcV should not be the channel for dsDNA translocation in artificial transformation. Together with the previous observation that the outer membrane porin OmpA mediates dsDNA transfer across the outer membrane in chemical transformation but not in natural transformation, I conclude that dsDNA transfers across the two membranes through different routes in natural and artificial transformation of E. coli. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A


    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. DNA & Protein detection based on microbead agglutination

    KAUST Repository

    Kodzius, Rimantas


    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  10. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles. (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique


    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  11. A DNA nanocapsule with aptamer-controlled open-closure function for targeted delivery

    DEFF Research Database (Denmark)

    Bentin, Thomas


    A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces.......A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces....

  12. Secreted single‐stranded DNA is involved in the initial phase of biofilm formation by Neisseria gonorrhoeae

    DEFF Research Database (Denmark)

    Zweig, Maria; Schork, Sabine; Koerdt, Andrea


    plays an important role in biofilm formation. Many clinical isolates contain a gonococcal genetic island that encodes a type IV secretion system (T4SS). The T4SS of N. gonorrhoeae strain MS11 secretes ssDNA directly into the medium. Biofilm formation, studied in continuous flow‐chamber systems...... was developed in which thermostable fluorescently labelled ssDNA‐ and ss/dsDNA‐binding proteins were used to visualize ssDNA and total DNA in biofilms and planktonic cultures. Remarkably, mainly dsDNA was detected in biofilms of the ssDNA secreting strain. We conclude that the secreted ssDNA facilitates initial...

  13. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis. (United States)

    Wang, M; Park, J S; Ishiai, M; Hurwitz, J; Lee, S H


    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) alpha and delta. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol alpha-primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis.

  14. Method for construction of normalized cDNA libraries (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  15. 3′-Terminated Overhangs Regulate DNA Double-Strand Break Processing in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Edyta Đermić


    Full Text Available Double-strand breaks (DSBs are lethal DNA lesions, which are repaired by homologous recombination in Escherichia coli. To study DSB processing in vivo, we induced DSBs into the E. coli chromosome by γ-irradiation and measured chromosomal degradation. We show that the DNA degradation is regulated by RecA protein concentration and its rate of association with single-stranded DNA (ssDNA. RecA decreased DNA degradation in wild-type, recB, and recD strains, indicating that it is a general phenomenon in E. coli. On the other hand, DNA degradation was greatly reduced and unaffected by RecA in the recB1080 mutant (which produces long overhangs and in a strain devoid of four exonucleases that degrade a 3′ tail (ssExos. 3′–5′ ssExos deficiency is epistatic to RecA deficiency concerning DNA degradation, suggesting that bound RecA is shielding the 3′ tail from degradation by 3′–5′ ssExos. Since 3′ tail preservation is common to all these situations, we infer that RecA polymerization constitutes a subset of mechanisms for preserving the integrity of 3′ tails emanating from DSBs, along with 3′ tail’s massive length, or prevention of their degradation by inactivation of 3′–5′ ssExos. Thus, we conclude that 3′ overhangs are crucial in controlling the extent of DSB processing in E. coli. This study suggests a regulatory mechanism for DSB processing in E. coli, wherein 3′ tails impose a negative feedback loop on DSB processing reactions, specifically on helicase reloading onto dsDNA ends.

  16. The Modular Construction of DNA Double Helix

    Indian Academy of Sciences (India)

    DNA or the left-handed double helix,. Z- DNA. Construction of the Module .... 12. DNA, namely, replication and transcription. In the former case, Figure 3. 8 would represent a DNA single strand-generated by splitting of the mother duplex ...

  17. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana


    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  18. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities. (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C


    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  19. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))


    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  20. Label-free detection of DNA using novel organic-based electrolyte-insulator-semiconductor. (United States)

    Lin, Tsung-Wu; Kekuda, Dhananjay; Chu, Chih-Wei


    In this study, we have constructed the first organic field effect sensor based on an electrolyte-insulator-semiconductor structure (OEIS) and applied this novel device to pH and DNA sensing. Variations in the insulator-electrolyte surface potential, which originate from either the change of the ionization states of the insulator surface groups or the binding of charged molecules to the insulator surface, modify the flat band voltage (V(FB)) of the OEIS sensor. The pH sensing experiments of OEIS sensor showed that the output signal linearly depended on pH solution in the range from pH 2 to pH 12, and an average sensitivity of 44.1 mV/pH was obtained. In the biosensing experiments, the absorption of positively charged poly-L-lysine on the insulator surface resulted in the reduction of the V(FB) value, whereas the subsequent binding of negatively charged single-stranded DNA probe (ssDNA) via electrostatic interaction increased the V(FB) value. Furthermore, the ssDNA-immobilized OEIS device was successfully used for the detection of DNA hybridization. The detection limit of complementary DNA was as low as 1 microM, and the output signal of OEIS biosensor linearly increased with the logarithm of complementary DNA concentration in the range from 5x10(-5) to 10(-7) M. The easy and inexpensive fabrication of the OEIS device allows to be served as a potentially disposable and sensitive biosensor. Copyright 2010 Elsevier B.V. All rights reserved.

  1. Structural and Functional Insights into the DNA Replication Factor Cdc45 Reveal an Evolutionary Relationship to the DHH Family of Phosphoesterases* (United States)

    Krastanova, Ivet; Sannino, Vincenzo; Amenitsch, Heinz; Gileadi, Opher; Pisani, Francesca M.; Onesti, Silvia


    Cdc45 is an essential protein conserved in all eukaryotes and is involved both in the initiation of DNA replication and the progression of the replication fork. With GINS, Cdc45 is an essential cofactor of the Mcm2–7 replicative helicase complex. Despite its importance, no detailed information is available on either the structure or the biochemistry of the protein. Intriguingly, whereas homologues of both GINS and Mcm proteins have been described in Archaea, no counterpart for Cdc45 is known. Herein we report a bioinformatic analysis that shows a weak but significant relationship among eukaryotic Cdc45 proteins and a large family of phosphoesterases that has been described as the DHH family, including inorganic pyrophosphatases and RecJ ssDNA exonucleases. These enzymes catalyze the hydrolysis of phosphodiester bonds via a mechanism involving two Mn2+ ions. Only a subset of the amino acids that coordinates Mn2+ is conserved in Cdc45. We report biochemical and structural data on the recombinant human Cdc45 protein, consistent with the proposed DHH family affiliation. Like the RecJ exonucleases, the human Cdc45 protein is able to bind single-stranded, but not double-stranded DNA. Small angle x-ray scattering data are consistent with a model compatible with the crystallographic structure of the RecJ/DHH family members. PMID:22147708

  2. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.


    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  3. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis (United States)

    Wang, Mu; Park, Jang-Su; Ishiai, Masamichi; Hurwitz, Jerard; Lee, Suk-Hee


    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) α and δ. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol α–primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis. PMID:11095685

  4. A tool for rapid screening of direct DNA agents using reaction rates and relative interaction potency: towards screening environmental contaminants for hazard. (United States)

    Gavina, Jennilee M A; Rubab, Mamoona; Zhang, Huijuan; Zhu, Jiping; Nong, Andy; Feng, Yong-Lai


    DNA damage represents a potential biomarker for determining the exposure risk to chemicals and may provide early warning data for identifying chemical hazards to human health. Here, we have demonstrated a simple chromatography-based method that can be used to rapidly screen for the presence of chemical hazards as well as to determine parameters relevant to hazard assessment. In this proof-of-principle study, a simple in vitro system was used to determine the interaction of pollutants and probable carcinogens, phenyl glycidyl ether (PGE), tetrachlorohydroquinone (Cl(4)HQ), methylmethane sulfonate (MMS), styrene-7,8-oxide (SO), and benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), a metabolite of benzo[a]pyrene (B[a]P), with single- and double-stranded DNA probes. Differences in potency and reaction kinetics were studied for chemical and DNA type. A relative interaction potency equivalency (PEQ) of a chemical was determined by ratio of interaction potency of a chemical to BPDE as the reference chemical in the reaction with single- and double-stranded oligodeoxynucleotides. PEQs were found to be BPDE > PGE > SO > MMS > Cl(4)HQ for single-stranded oligodeoxynucleotides while they were found to be BPDE > PGE > Cl(4)HQ > MMS > SO for double-stranded oligodeoxynucleotides. Kinetics evaluation revealed that BPDE reacted with both DNA probes at a significantly faster rate, as compared to the remaining test chemicals. Equilibrium was reached within an hour for BPDE, but required a minimum of 48 h for the remaining chemicals. First-order rate constants were (1.61 ± 0.2) × 10(-3) s(-1) and (3.18 ± 0.4) × 10(-4) s(-1) for reaction of BPDE with double- and single-stranded DNA, respectively. The remaining chemicals possessed rate constants from 2 to 13 × 10(-6) s(-1) with a relative kinetic order for reaction with DNA of BPDE ≫ MMS > SO > PGE > Cl(4)HQ for ds-DNA and BPDE ≫ SO ≈ Cl(4)HQ ≈ MMS > PGE for ss-DNA. We further found that the reaction potency, defined by

  5. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    DNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Raman spectroscopy. Keywords. Graphene oxide; DNA; hydrogels; liquid crystals; self-assembly. 1. Introduction.

  6. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager


    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  7. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  8. PCNA ubiquitination is important, but not essential for translesion DNA synthesis in mammalian cells.

    Directory of Open Access Journals (Sweden)

    Ayal Hendel


    Full Text Available Translesion DNA synthesis (TLS is a DNA damage tolerance mechanism in which specialized low-fidelity DNA polymerases bypass replication-blocking lesions, and it is usually associated with mutagenesis. In Saccharomyces cerevisiae a key event in TLS is the monoubiquitination of PCNA, which enables recruitment of the specialized polymerases to the damaged site through their ubiquitin-binding domain. In mammals, however, there is a debate on the requirement for ubiquitinated PCNA (PCNA-Ub in TLS. We show that UV-induced Rpa foci, indicative of single-stranded DNA (ssDNA regions caused by UV, accumulate faster and disappear more slowly in Pcna(K164R/K164R cells, which are resistant to PCNA ubiquitination, compared to Pcna(+/+ cells, consistent with a TLS defect. Direct analysis of TLS in these cells, using gapped plasmids with site-specific lesions, showed that TLS is strongly reduced across UV lesions and the cisplatin-induced intrastrand GG crosslink. A similar effect was obtained in cells lacking Rad18, the E3 ubiquitin ligase which monoubiquitinates PCNA. Consistently, cells lacking Usp1, the enzyme that de-ubiquitinates PCNA exhibited increased TLS across a UV lesion and the cisplatin adduct. In contrast, cells lacking the Rad5-homologs Shprh and Hltf, which polyubiquitinate PCNA, exhibited normal TLS. Knocking down the expression of the TLS genes Rev3L, PolH, or Rev1 in Pcna(K164R/K164R mouse embryo fibroblasts caused each an increased sensitivity to UV radiation, indicating the existence of TLS pathways that are independent of PCNA-Ub. Taken together these results indicate that PCNA-Ub is required for maximal TLS. However, TLS polymerases can be recruited to damaged DNA also in the absence of PCNA-Ub, and perform TLS, albeit at a significantly lower efficiency and altered mutagenic specificity.

  9. Signal-on electrochemical assay for label-free detection of TdT and BamHI activity based on grown DNA nanowire-templated copper nanoclusters. (United States)

    Hu, Yufang; Zhang, Qingqing; Xu, Lihua; Wang, Jiao; Rao, Jiajia; Guo, Zhiyong; Wang, Sui


    Electrochemical methods allow fast and inexpensive analysis of enzymatic activity. Here, a simple and yet efficient "signal-on" electrochemical assay for sensitive, label-free detection of DNA-related enzyme activity was established on the basis of terminal deoxynucleotidyl transferase (TdT)-mediated extension strategy. TdT, which is a template-independent DNA polymerase, can catalyze the sequential addition of deoxythymidine triphosphate (dTTP) at the 3'-OH terminus of single-stranded DNA (ssDNA); then, the TdT-yield T-rich DNA nanowires can be employed as the synthetic template of copper nanoclusters (CuNCs). Grown DNA nanowires-templated CuNCs (noted as DNA-CuNCs) were attached onto graphene oxide (GO) surface and exhibited unique electrocatalytic activity to H 2 O 2 reduction. Under optimal conditions, the proposed biosensor was utilized for quantitatively monitoring TdT activity, with the observed LOD of 0.1 U/mL. It also displayed high selectivity to TdT with excellent stability, and offered a facile, convenient electrochemical method for TdT-relevant inhibitors screening. Moreover, the proposed sensor was successfully used for BamHI activity detection, in which a new 3'-OH terminal was exposed by the digestion of a phosphate group. Ultimately, it has good prospects in DNA-related enzyme-based biochemical studies, disease diagnosis, and drug discovery. Graphical Abstract Extraordinary TdT-generated DNA-CuNCs are synthesized and act as a novel electrochemical sensing platform for sensitive detection of TdT and BamHI activity in biological environments.

  10. The beta subunit modulates bypass and termination at UV lesions during in vitro replication with DNA polymerase III holoenzyme of Escherichia coli

    International Nuclear Information System (INIS)

    Shavitt, O.; Livneh, Z.


    The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM

  11. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis. (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J


    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Correlation of Free Radical Yields with Strand Break Yields Produced in Plasmid DNA by the Direct Effect of Ionizing Radiation


    Purkayastha, Shubhadeep; Milligan, Jamie R.; Bernhard, William A.


    The purpose of this study was to determine how free radical formation (fr) correlates with single strand break (ssb) and double strand break (dsb) formation in DNA exposed to the direct effects of ionizing radiation. Chemical yields have been determined of (i) total radicals trapped on DNA at 4 K, G(∑fr), (ii) radicals trapped on the DNA sugar, Gsugar(fr), (iii) prompt single strand breaks, Gprompt(ssb), (iv) total single strand breaks, Gtotal(ssb), and (v) double strand breaks, G(dsb). These...

  13. 3-Nitrobenzanthrone and 3-aminobenzanthrone induce DNA damage and cell signalling in Hepa1c1c7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Landvik, N.E. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway); Arlt, V.M.; Nagy, E. [Section of Molecular Carcinogenesis, Institute of Cancer Research, Brookes Lawley Building, Sutton, Surrey SM2 5NG (United Kingdom); Solhaug, A. [Section for Toxicology, Department of Feed and Food Safety, National Veterinary Institute Pb 750 Sentrum, N-0106 Oslo (Norway); Tekpli, X. [EA SeRAIC, Equipe labellisee Ligue contre le Cancer, IFR 140, Universite de Rennes 1, Rennes (France); Schmeiser, H.H. [Research Group Genetic Alteration in Carcinogenesis, German Cancer Research Center, Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Refsnes, M. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway); Phillips, D.H. [Section of Molecular Carcinogenesis, Institute of Cancer Research, Brookes Lawley Building, Sutton, Surrey SM2 5NG (United Kingdom); Lagadic-Gossmann, D. [EA SeRAIC, Equipe labellisee Ligue contre le Cancer, IFR 140, Universite de Rennes 1, Rennes (France); Holme, J.A., E-mail: [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway)


    3-Nitrobenzanthrone (3-NBA) is a mutagenic and carcinogenic environmental pollutant found in diesel exhaust and urban air pollution. In the present work we have characterised the effects of 3-NBA and its metabolite 3-aminobenzanthrone (3-ABA) on cell death and cytokine release in mouse hepatoma Hepa1c1c7 cells. These effects were related to induced DNA damage and changes in cell signalling pathways. 3-NBA resulted in cell death and caused most DNA damage as judged by the amount of DNA adducts ({sup 32}P-postlabelling assay), single strand (ss)DNA breaks and oxidative DNA lesions (comet assay) detected. An increased phosphorylation of H2AX, chk1, chk2 and partly ATM was observed using flow cytometry and/or Western blotting. Both compounds increased phosphorylation of p53 and MAPKs (ERK, p38 and JNK). However, only 3-NBA caused an accumulation of p53 in the nucleus and a translocation of Bax to the mitochondria. The p53 inhibitor pifithrin-alpha inhibited 3-NBA-induced apoptosis, indicating that cell death was a result of the triggering of DNA signalling pathways. The highest phosphorylation of Akt and degradation of I{kappa}B-{alpha} (suggesting activation of NF-{kappa}B) were also seen after treatment with 3-NBA. In contrast 3-ABA increased IL-6 release, but caused little or no toxicity. Cytokine release was inhibited by PD98059 and curcumin, suggesting that ERK and NF-{kappa}B play a role in this process. In conclusion, 3-NBA seems to have a higher potency to induce DNA damage compatible with its cytotoxic effects, while 3-ABA seems to have a greater effect on the immune system.

  14. 3-Nitrobenzanthrone and 3-aminobenzanthrone induce DNA damage and cell signalling in Hepa1c1c7 cells. (United States)

    Landvik, N E; Arlt, V M; Nagy, E; Solhaug, A; Tekpli, X; Schmeiser, H H; Refsnes, M; Phillips, D H; Lagadic-Gossmann, D; Holme, J A


    3-Nitrobenzanthrone (3-NBA) is a mutagenic and carcinogenic environmental pollutant found in diesel exhaust and urban air pollution. In the present work we have characterised the effects of 3-NBA and its metabolite 3-aminobenzanthrone (3-ABA) on cell death and cytokine release in mouse hepatoma Hepa1c1c7 cells. These effects were related to induced DNA damage and changes in cell signalling pathways. 3-NBA resulted in cell death and caused most DNA damage as judged by the amount of DNA adducts ((32)P-postlabelling assay), single strand (ss)DNA breaks and oxidative DNA lesions (comet assay) detected. An increased phosphorylation of H2AX, chk1, chk2 and partly ATM was observed using flow cytometry and/or Western blotting. Both compounds increased phosphorylation of p53 and MAPKs (ERK, p38 and JNK). However, only 3-NBA caused an accumulation of p53 in the nucleus and a translocation of Bax to the mitochondria. The p53 inhibitor pifithrin-alpha inhibited 3-NBA-induced apoptosis, indicating that cell death was a result of the triggering of DNA signalling pathways. The highest phosphorylation of Akt and degradation of IkappaB-alpha (suggesting activation of NF-kappaB) were also seen after treatment with 3-NBA. In contrast 3-ABA increased IL-6 release, but caused little or no toxicity. Cytokine release was inhibited by PD98059 and curcumin, suggesting that ERK and NF-kappaB play a role in this process. In conclusion, 3-NBA seems to have a higher potency to induce DNA damage compatible with its cytotoxic effects, while 3-ABA seems to have a greater effect on the immune system. Copyright 2009 Elsevier B.V. All rights reserved.

  15. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça


    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  16. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.


    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M


    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  17. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. (United States)

    Castro-Chavez, Fernando


    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  18. Effect of oxygen and misonidazole on radiation damage in biologically active DNA dissolved in a bacterial extract. Influence of cytochrome c

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Pluijmackers-Westmijze, E.J.; Loman, H.


    The effect of radiation on biologically active DNA, dissolved in a bacterial extract was studied. The results show that oxygen affects DNA inactivation for both double-stranded (RF) and single-stranded phiX174 DNA. Misonidazole induces an increased radiosensitivity in this system as found for single-stranded DNA. These effects disappear with ageing of the extract, but can be recovered by the addition of 10 -6 M cytochrome c. (author)

  19. APE2 Zf-GRF facilitates 3'-5' resection of DNA damage following oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, Bret D.; Berman, Zachary; Mueller, Geoffrey A.; Lin, Yunfeng; Chang, Timothy; Andres, Sara N.; Wojtaszek, Jessica L.; DeRose, Eugene F.; Appel, C. Denise; London, Robert E.; Yan, Shan; Williams, R. Scott


    The Xenopus laevis APE2 (apurinic/apyrimidinic endonuclease 2) nuclease participates in 3'-5' nucleolytic resection of oxidative DNA damage and activation of the ATR-Chk1 DNA damage response (DDR) pathway via ill-defined mechanisms. Here we report that APE2 resection activity is regulated by DNA interactions in its Zf-GRF domain, a region sharing high homology with DDR proteins Topoisomerase 3α (TOP3α) and NEIL3 (Nei-like DNA glycosylase 3), as well as transcription and RNA regulatory proteins, such as TTF2 (transcription termination factor 2), TFIIS, and RPB9. Biochemical and NMR results establish the nucleic acid-binding activity of the Zf-GRF domain. Moreover, an APE2 Zf-GRF X-ray structure and small-angle X-ray scattering analyses show that the Zf-GRF fold is typified by a crescent-shaped ssDNA binding claw that is flexibly appended to an APE2 endonuclease/exonuclease/phosphatase (EEP) catalytic core. Structure-guided Zf-GRF mutations impact APE2 DNA binding and 3'-5' exonuclease processing, and also prevent efficient APE2-dependent RPA recruitment to damaged chromatin and activation of the ATR-Chk1 DDR pathway in response to oxidative stress in Xenopus egg extracts. Collectively, our data unveil the APE2 Zf-GRF domain as a nucleic acid interaction module in the regulation of a key single-strand break resection function of APE2, and also reveal topologic similarity of the Zf-GRF to the zinc ribbon domains of TFIIS and RPB9.

  20. Identification of a premature termination of DNA polymerization in ...

    Indian Academy of Sciences (India)


    Apr 25, 2013 ... DNA polymerases have been widely used as sophisticated powerful tools in molecular biology for DNA cloning and genetic diagnosis (Raymond et al. 2010). Using parental single-stranded DNA as template and oligonucleo- tide as primer, these DNA polymerases can extend daughter strands to the 5′ ...

  1. Triplet repeat DNA structures and human genetic disease: dynamic ...

    Indian Academy of Sciences (India)


    alternative to double-stranded DNA (table 2). These include single-stranded hairpins, triplex and quadruplex. DNA, and slipped-strand DNA. Studies have also con- firmed that the formation of alternative structures occurs in trinucleotide repeat sequences. Linear DNA molecules containing triplet repeats have unusual ...

  2. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have ...

  3. Development of an electrochemical DNA biosensor for detection of ...

    Indian Academy of Sciences (India)

    long oligonucleotides related to DNA sequence of Mycobacterium tuberculosis in optimal condition. Keywords. Poly(L-glutamic acid); DNA .... (TBS) (pH 7.0) containing 20 mM MDB.12,13 Then, the biosensors were immersed in washing ... signal when interacting with single strand DNA since this kind of DNA does not have ...

  4. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie


    sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections...

  5. The development of a silica nanoparticle-based label-free DNA biosensor (United States)

    Kell, Arnold J.; Pagé, Lilianne; Tan, Sophie; Charlebois, Isabelle; Boissinot, Maurice; Leclerc, Mario; Simard, Benoit


    A silica nanoparticle-based DNA biosensor capable of detecting Bacillus anthracis bacteria through the use of unlabelled ss-oligonucleotides has been developed. The biosensor makes use of the optical changes that accompany a nanoparticle-immobilized cationic conjugated polymer (polythiophene) interacting with single-stranded vs. hybridized oligonucleotides, where a fluorescence signal appears only when hybridized DNA is present (i.e. only when the ss-oligonucleotide interacting with the polymer has hybridized with its complement). In order to enhance the sensitivity of the biosensor, two different nanoparticle architectures were developed and used to elucidate how the presence of neighboring fluorophores on the nanoparticle surface affects Förster-resonant energy transfer (FRET) between the polythiophene/oligonucleotide complex (FRET donor) and the fluorophores (FRET acceptors). We demonstrate that the silica nanoparticle-based FRET platform lowers the limit of detection at least 10-fold in comparison to the polythiophene itself, and allows the detection of ~2 × 10-12 moles of ss-oligonucleotide in a 100 μL sample with a standard fluorimeter (i.e. has a limit of detection of ~2 nM ssDNA). Such nanoparticle-based biosensor platforms are beneficial because of the robustness and stability inherent to their covalent assembly and they provide a valuable new tool that may allow for the sensitive, label-free detection (the target DNA that produces the fluorescence signal is unlabelled) without the use of polymerase chain reaction.A silica nanoparticle-based DNA biosensor capable of detecting Bacillus anthracis bacteria through the use of unlabelled ss-oligonucleotides has been developed. The biosensor makes use of the optical changes that accompany a nanoparticle-immobilized cationic conjugated polymer (polythiophene) interacting with single-stranded vs. hybridized oligonucleotides, where a fluorescence signal appears only when hybridized DNA is present (i.e. only when

  6. How effective is graphene nanopore geometry on DNA sequencing?


    Satarifard, Vahid; Foroutan, Masumeh; Ejtehadi, Mohammad Reza


    In this paper we investigate the effects of graphene nanopore geometry on homopolymer ssDNA pulling process through nanopore using steered molecular dynamic (SMD) simulations. Different graphene nanopores are examined including axially symmetric and asymmetric monolayer graphene nanopores as well as five layer graphene polyhedral crystals (GPC). The pulling force profile, moving fashion of ssDNA, work done in irreversible DNA pulling and orientations of DNA bases near the nanopore are assesse...

  7. The C-terminal domain of the bacterial SSB protein acts as a DNA maintenance hub at active chromosome replication forks.

    Directory of Open Access Journals (Sweden)

    Audrey Costes


    Full Text Available We have investigated in vivo the role of the carboxy-terminal domain of the Bacillus subtilis Single-Stranded DNA Binding protein (SSB(Cter as a recruitment platform at active chromosomal forks for many proteins of the genome maintenance machineries. We probed this SSB(Cter interactome using GFP fusions and by Tap-tag and biochemical analysis. It includes at least 12 proteins. The interactome was previously shown to include PriA, RecG, and RecQ and extended in this study by addition of DnaE, SbcC, RarA, RecJ, RecO, XseA, Ung, YpbB, and YrrC. Targeting of YpbB to active forks appears to depend on RecS, a RecQ paralogue, with which it forms a stable complex. Most of these SSB partners are conserved in bacteria, while others, such as the essential DNA polymerase DnaE, YrrC, and the YpbB/RecS complex, appear to be specific to B. subtilis. SSB(Cter deletion has a moderate impact on B. subtilis cell growth. However, it markedly affects the efficiency of repair of damaged genomic DNA and arrested replication forks. ssbΔCter mutant cells appear deficient in RecA loading on ssDNA, explaining their inefficiency in triggering the SOS response upon exposure to genotoxic agents. Together, our findings show that the bacterial SSB(Cter acts as a DNA maintenance hub at active chromosomal forks that secures their propagation along the genome.

  8. Biotechnological mass production of DNA origami (United States)

    Praetorius, Florian; Kick, Benjamin; Behler, Karl L.; Honemann, Maximilian N.; Weuster-Botz, Dirk; Dietz, Hendrik


    DNA nanotechnology, in particular DNA origami, enables the bottom-up self-assembly of micrometre-scale, three-dimensional structures with nanometre-precise features. These structures are customizable in that they can be site-specifically functionalized or constructed to exhibit machine-like or logic-gating behaviour. Their use has been limited to applications that require only small amounts of material (of the order of micrograms), owing to the limitations of current production methods. But many proposed applications, for example as therapeutic agents or in complex materials, could be realized if more material could be used. In DNA origami, a nanostructure is assembled from a very long single-stranded scaffold molecule held in place by many short single-stranded staple oligonucleotides. Only the bacteriophage-derived scaffold molecules are amenable to scalable and efficient mass production; the shorter staple strands are obtained through costly solid-phase synthesis or enzymatic processes. Here we show that single strands of DNA of virtually arbitrary length and with virtually arbitrary sequences can be produced in a scalable and cost-efficient manner by using bacteriophages to generate single-stranded precursor DNA that contains target strand sequences interleaved with self-excising ‘cassettes’, with each cassette comprising two Zn2+-dependent DNA-cleaving DNA enzymes. We produce all of the necessary single strands of DNA for several DNA origami using shaker-flask cultures, and demonstrate end-to-end production of macroscopic amounts of a DNA origami nanorod in a litre-scale stirred-tank bioreactor. Our method is compatible with existing DNA origami design frameworks and retains the modularity and addressability of DNA origami objects that are necessary for implementing custom modifications using functional groups. With all of the production and purification steps amenable to scaling, we expect that our method will expand the scope of DNA nanotechnology in

  9. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni


    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  10. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.


    Furfine, E S; White, T C; Wang, A L; Wang, C C


    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  11. Toward larger DNA origami. (United States)

    Marchi, Alexandria N; Saaem, Ishtiaq; Vogen, Briana N; Brown, Stanley; LaBean, Thomas H


    Structural DNA nanotechnology, and specifically scaffolded DNA origami, is rapidly developing as a versatile method for bottom-up fabrication of novel nanometer-scale materials and devices. However, lengths of conventional single-stranded scaffolds, for example, 7,249-nucleotide circular genomic DNA from the M13mp18 phage, limit the scales of these uniquely addressable structures. Additionally, increasing DNA origami size generates the cost burden of increased staple-strand synthesis. We addressed this 2-fold problem by developing the following methods: (1) production of the largest to-date biologically derived single-stranded scaffold using a λ/M13 hybrid virus to produce a 51 466-nucleotide DNA in a circular, single-stranded form and (2) inexpensive DNA synthesis via an inkjet-printing process on a chip embossed with functionalized micropillars made from cyclic olefin copolymer. We have experimentally demonstrated very efficient assembly of a 51-kilobasepair origami from the λ/M13 hybrid scaffold folded by chip-derived staple strands. In addition, we have demonstrated two-dimensional, asymmetric origami sheets with controlled global curvature such that they land on a substrate in predictable orientations that have been verified by atomic force microscopy.

  12. Hydration induced stress on DNA monolayers grafted on microcantilevers. (United States)

    Domínguez, Carmen M; Kosaka, Priscila M; Mokry, Guillermo; Pini, Valerio; Malvar, Oscar; del Rey, Mercedes; Ramos, Daniel; San Paulo, Alvaro; Tamayo, Javier; Calleja, Montserrat


    Surface tethered single-stranded DNA films are relevant biorecognition layers for oligonucleotide sequence identification. Also, hydration induced effects on these films have proven useful for the nanomechanical detection of DNA hybridization. Here, we apply nanomechanical sensors and atomic force microscopy to characterize in air and upon varying relative humidity conditions the swelling and deswelling of grafted single stranded and double stranded DNA films. The combination of these techniques validates a two-step hybridization process, where complementary strands first bind to the surface tethered single stranded DNA probes and then slowly proceed to a fully zipped configuration. Our results also demonstrate that, despite the slow hybridization kinetics observed for grafted DNA onto microcantilever surfaces, ex situ sequence identification does not require hybridization times typically longer than 1 h, while quantification is a major challenge.

  13. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a