WorldWideScience

Sample records for single-step multiplex pcr

  1. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  2. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  3. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  4. Comparison of culture, single and multiplex real-time PCR for detection of Sabin poliovirus shedding in recently vaccinated Indian children.

    Science.gov (United States)

    Giri, Sidhartha; Rajan, Anand K; Kumar, Nirmal; Dhanapal, Pavithra; Venkatesan, Jayalakshmi; Iturriza-Gomara, Miren; Taniuchi, Mami; John, Jacob; Abraham, Asha Mary; Kang, Gagandeep

    2017-08-01

    Although, culture is considered the gold standard for poliovirus detection from stool samples, real-time PCR has emerged as a faster and more sensitive alternative. Detection of poliovirus from the stool of recently vaccinated children by culture, single and multiplex real-time PCR was compared. Of the 80 samples tested, 55 (68.75%) were positive by culture compared to 61 (76.25%) and 60 (75%) samples by the single and one step multiplex real-time PCR assays respectively. Real-time PCR (singleplex and multiplex) is more sensitive than culture for poliovirus detection in stool, although the difference was not statistically significant. © 2017 Wiley Periodicals, Inc.

  5. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  7. Development of a One-Step Multiplex PCR Assay for Differential Detection of Major Mycobacterium Species.

    Science.gov (United States)

    Chae, Hansong; Han, Seung Jung; Kim, Su-Young; Ki, Chang-Seok; Huh, Hee Jae; Yong, Dongeun; Koh, Won-Jung; Shin, Sung Jae

    2017-09-01

    The prevalence of tuberculosis continues to be high, and nontuberculous mycobacterial (NTM) infection has also emerged worldwide. Moreover, differential and accurate identification of mycobacteria to the species or subspecies level is an unmet clinical need. Here, we developed a one-step multiplex PCR assay using whole-genome analysis and bioinformatics to identify novel molecular targets. The aims of this assay were to (i) discriminate between the Mycobacterium tuberculosis complex (MTBC) and NTM using rv0577 or RD750, (ii) differentiate M. tuberculosis ( M. tuberculosis ) from MTBC using RD9, (iii) selectively identify the widespread M. tuberculosis Beijing genotype by targeting mtbk_20680 , and (iv) simultaneously detect five clinically important NTM ( M. avium , M. intracellulare , M. abscessus , M. massiliense , and M. kansasii ) by targeting IS 1311 , DT1, mass_3210 , and mkan_rs12360 An initial evaluation of the multiplex PCR assay using reference strains demonstrated 100% specificity for the targeted Mycobacterium species. Analytical sensitivity ranged from 1 to 10 pg for extracted DNA and was 10 3 and 10 4 CFU for pure cultures and nonhomogenized artificial sputum cultures, respectively, of the targeted species. The accuracy of the multiplex PCR assay was further evaluated using 55 reference strains and 94 mycobacterial clinical isolates. Spoligotyping, multilocus sequence analysis, and a commercial real-time PCR assay were employed as standard assays to evaluate the multiplex PCR assay with clinical M. tuberculosis and NTM isolates. The PCR assay displayed 100% identification agreement with the standard assays. Our multiplex PCR assay is a simple, convenient, and reliable technique for differential identification of MTBC, M. tuberculosis , M. tuberculosis Beijing genotype, and major NTM species. Copyright © 2017 American Society for Microbiology.

  8. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  9. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Novel One-Step Multiplex PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of -Thalassemia

    Directory of Open Access Journals (Sweden)

    Raquel M. Fernández

    2013-01-01

    Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.

  11. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  12. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  13. Simultaneous detection of three pome fruit tree viruses by one-step multiplex quantitative RT-PCR.

    Science.gov (United States)

    Malandraki, Ioanna; Beris, Despoina; Isaioglou, Ioannis; Olmos, Antonio; Varveri, Christina; Vassilakos, Nikon

    2017-01-01

    A one-step multiplex real-time reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan probes was developed for the simultaneous detection of Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV) and Apple stem grooving virus (ASGV) in total RNA of pome trees extracted with a CTAB method. The sensitivity of the method was established using in vitro synthesized viral transcripts serially diluted in RNA from healthy, virus-tested (negative) pome trees. The three viruses were simultaneously detected up to a 10-4 dilution of total RNA from a naturally triple-infected apple tree prepared in total RNA of healthy apple tissue. The newly developed RT-qPCR assay was at least one hundred times more sensitive than conventional single RT-PCRs. The assay was validated with 36 field samples for which nine triple and 11 double infections were detected. All viruses were detected simultaneously in composite samples at least up to the ratio of 1:150 triple-infected to healthy pear tissue, suggesting the assay has the capacity to examine rapidly a large number of samples in pome tree certification programs and surveys for virus presence.

  14. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  15. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  16. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  17. Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

    Science.gov (United States)

    Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

    2016-03-12

    Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

  18. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience

    DEFF Research Database (Denmark)

    Nielsen, A. C. Y.; Bottiger, B.; Midgley, S. E.

    2013-01-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay....... The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel...... testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses...

  19. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  20. A novel enterovirus and parechovirus multiplex one-step real-time PCR-validation and clinical experience.

    Science.gov (United States)

    Nielsen, Alex Christian Yde; Böttiger, Blenda; Midgley, Sofie Elisabeth; Nielsen, Lars Peter

    2013-11-01

    As the number of new enteroviruses and human parechoviruses seems ever growing, the necessity for updated diagnostics is relevant. We have updated an enterovirus assay and combined it with a previously published assay for human parechovirus resulting in a multiplex one-step RT-PCR assay. The multiplex assay was validated by analysing the sensitivity and specificity of the assay compared to the respective monoplex assays, and a good concordance was found. Furthermore, the enterovirus assay was able to detect 42 reference strains from all 4 species, and an additional 9 genotypes during panel testing and routine usage. During 15 months of routine use, from October 2008 to December 2009, we received and analysed 2187 samples (stool samples, cerebrospinal fluids, blood samples, respiratory samples and autopsy samples) were tested, from 1546 patients and detected enteroviruses and parechoviruses in 171 (8%) and 66 (3%) of the samples, respectively. 180 of the positive samples could be genotyped by PCR and sequencing and the most common genotypes found were human parechovirus type 3, echovirus 9, enterovirus 71, Coxsackievirus A16, and echovirus 25. During 2009 in Denmark, both enterovirus and human parechovirus type 3 had a similar seasonal pattern with a peak during the summer and autumn. Human parechovirus type 3 was almost invariably found in children less than 4 months of age. In conclusion, a multiplex assay was developed allowing simultaneous detection of 2 viruses, which can cause similar clinical symptoms. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. One-Step Multiplex RT-qPCR Assay for the detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp.) capripneumoniae

    International Nuclear Information System (INIS)

    Settypalli, T.B.K.; Lamien, C.; Spergser, J.; Lelenta, M.; Wade, A.; Gelaye, E.; Loitsch, A.; Minoungou, G.; Thiaucourt, F.; Diallo, A.

    2016-01-01

    Full text: Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV), Peste de petits ruminants virus (PPRV), Pasteurella multocida (PM) and Mycoplasma capricolum ssp. capripneumonia (Mccp) in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%–4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI) were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s) by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  2. One-Step Multiplex RT-qPCR Assay for the Detection of Peste des petits ruminants virus, Capripoxvirus, Pasteurella multocida and Mycoplasma capricolum subspecies (ssp. capripneumoniae.

    Directory of Open Access Journals (Sweden)

    Tirumala Bharani Kumar Settypalli

    Full Text Available Respiratory infections, although showing common clinical symptoms like pneumonia, are caused by bacterial, viral or parasitic agents. These are often reported in sheep and goats populations and cause huge economic losses to the animal owners in developing countries. Detection of these diseases is routinely done using ELISA or microbiological methods which are being reinforced or replaced by molecular based detection methods including multiplex assays, where detection of different pathogens is carried out in a single reaction. In the present study, a one-step multiplex RT-qPCR assay was developed for simultaneous detection of Capripoxvirus (CaPV, Peste de petits ruminants virus (PPRV, Pasteurella multocida (PM and Mycoplasma capricolum ssp. capripneumonia (Mccp in pathological samples collected from small ruminants with respiratory disease symptoms. The test performed efficiently without any cross-amplification. The multiplex PCR efficiency was 98.31%, 95.48%, 102.77% and 91.46% whereas the singleplex efficiency was 93.43%, 98.82%, 102.55% and 92.0% for CaPV, PPRV, PM and Mccp, respectively. The correlation coefficient was greater than 0.99 for all the targets in both multiplex and singleplex. Based on cycle threshold values, intra and inter assay variability, ranged between the limits of 2%-4%, except for lower concentrations of Mccp. The detection limits at 95% confidence interval (CI were 12, 163, 13 and 23 copies/reaction for CaPV, PPRV, PM and Mccp, respectively. The multiplex assay was able to detect CaPVs from all genotypes, PPRV from the four lineages, PM and Mccp without amplifying the other subspecies of mycoplasmas. The discriminating power of the assay was proven by accurate detection of the targeted pathogen (s by screening 58 viral and bacterial isolates representing all four targeted pathogens. Furthermore, by screening 81 pathological samples collected from small ruminants showing respiratory disease symptoms, CaPV was detected in

  3. Typing of Y chromosome SNPs with multiplex PCR methods

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels

    2005-01-01

    We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....

  4. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  5. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  6. Detection of four important Eimeria species by multiplex PCR in a single assay.

    Science.gov (United States)

    You, Myung-Jo

    2014-06-01

    The oocysts of some of the recognized species of chicken coccidiosis are difficult to distinguish morphologically. Diagnostic laboratories are increasingly utilizing DNA-based technologies for the specific identification of Eimeria species. This study reports a multiplex polymerase chain reaction (PCR) assay based on internal transcribed spacer-1 (ITS-1) for the simultaneous diagnosis of the Eimeria tenella, Eimeria acervulina, Eimeria maxima, and Eimeria necatrix species, which infect domestic fowl. Primer pairs specific to each species were designed in order to generate a ladder of amplification products ranging from 20 to 25 bp, and a common optimum annealing temperature for these species was determined to be 52.5 °C. Sensitivity tests were performed for each species, showing a detection threshold of 1-5 pg. All the species were amplified homogeneously, and a homogenous band ladder was observed, indicating that the assay permitted the simultaneous detection of all the species in a single-tube reaction. In the phylogenic study, there was a clear species clustering, which was irrespective of geographical location, for all the ITS-1 sequences used. This multiplex PCR assay represents a rapid and potential cost-effective diagnostic method for the detection of some key Eimeria species that infect domestic fowl. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  8. Interlaboratory study of DNA extraction from multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for individual kernel detection system of genetically modified maize.

    Science.gov (United States)

    Akiyama, Hiroshi; Sakata, Kozue; Makiyma, Daiki; Nakamura, Kosuke; Teshima, Reiko; Nakashima, Akie; Ogawa, Asako; Yamagishi, Toru; Futo, Satoshi; Oguchi, Taichi; Mano, Junichi; Kitta, Kazumi

    2011-01-01

    In many countries, the labeling of grains, feed, and foodstuff is mandatory if the genetically modified (GM) organism content exceeds a certain level of approved GM varieties. We previously developed an individual kernel detection system consisting of grinding individual kernels, DNA extraction from the individually ground kernels, GM detection using multiplex real-time PCR, and GM event detection using multiplex qualitative PCR to analyze the precise commingling level and varieties of GM maize in real sample grains. We performed the interlaboratory study of the DNA extraction with multiple ground samples, multiplex real-time PCR detection, and multiplex qualitative PCR detection to evaluate its applicability, practicality, and ruggedness for the individual kernel detection system of GM maize. DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR were evaluated by five laboratories in Japan, and all results from these laboratories were consistent with the expected results in terms of the commingling level and event analysis. Thus, the DNA extraction with multiple ground samples, multiplex real-time PCR, and multiplex qualitative PCR for the individual kernel detection system is applicable and practicable in a laboratory to regulate the commingling level of GM maize grain for GM samples, including stacked GM maize.

  9. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  10. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  11. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  12. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  13. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  15. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Multiplex PCR identification of Taenia spp. in rodents and carnivores.

    Science.gov (United States)

    Al-Sabi, Mohammad N S; Kapel, Christian M O

    2011-11-01

    The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

  17. A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

    Science.gov (United States)

    Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

    2015-07-07

    Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

  18. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Directory of Open Access Journals (Sweden)

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  19. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  20. A novel one-step real-time multiplex PCR assay to detect Streptococcus agalactiae presence and serotypes Ia, Ib, and III.

    Science.gov (United States)

    Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S

    2017-09-01

    Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

    Science.gov (United States)

    Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

    2004-01-01

    Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

  3. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  4. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  5. Simultaneous quantitative assessment of circulating cell-free mitochondrial and nuclear DNA by multiplex real-time PCR

    Directory of Open Access Journals (Sweden)

    Peng Xia

    2009-01-01

    Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.

  6. Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Kelly Grace Magalhães

    2004-06-01

    Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.

  7. A novel multiplex PCR for the simultaneous detection of Salmonella enterica and Shigella species.

    Science.gov (United States)

    Radhika, M; Saugata, Majumder; Murali, H S; Batra, H V

    2014-01-01

    Salmonella enterica and Shigella species are commonly associated with food and water borne infections leading to gastrointestinal diseases. The present work was undertaken to develop a sensitive and reliable PCR based detection system for simultaneous detection of Salmonella enterica and Shigella at species level. For this the conserved regions of specific genes namely ipaH1, ipaH, wbgZ, wzy and invA were targeted for detection of Shigella genus, S. flexneri, S. sonnei, S. boydii and Salmonella enterica respectively along with an internal amplification control (IAC). The results showed that twenty Salmonella and eleven Shigella spp., were accurately identified by the assay without showing non-specificity against closely related other Enterobacteriaceae organisms and also against other pathogens. Further evaluation of multiplex PCR was undertaken on 50 natural samples of chicken, eggs and poultry litter and results compared with conventional culture isolation and identification procedure. The multiplex PCR identified the presence of Salmonella and Shigella strains with a short pre-enrichment step of 5 h in peptone water and the same samples were processed by conventional procedures for comparison. Therefore, this reported multiplex PCR can serve as an alternative to the tedious time-consuming procedure of culture and identification in food safety laboratories.

  8. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  9. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  10. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

  11. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  12. Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli

    OpenAIRE

    Toma, Claudia; Lu, Yan; Higa, Naomi; Nakasone, Noboru; Chinen, Isabel; Baschkier, Ariela; Rivas, Marta; Iwanaga, Masaaki

    2003-01-01

    A multiplex PCR assay for the identification of human diarrheagenic Escherichia coli was developed. The targets selected for each category were eae for enteropathogenic E. coli, stx for Shiga toxin-producing E. coli, elt and est for enterotoxigenic E. coli, ipaH for enteroinvasive E. coli, and aggR for enteroaggregative E. coli. This assay allowed the categorization of a diarrheagenic E. coli strain in a single reaction tube.

  13. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

    Science.gov (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

    2013-10-01

    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  15. Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples

    Directory of Open Access Journals (Sweden)

    Whyte Paul

    2008-09-01

    Full Text Available Abstract Background A real-time multiplex PCR assay was developed for the detection of multiple Salmonella serotypes in chicken samples. Poultry-associated serotypes detected in the assay include Enteritidis, Gallinarum, Typhimurium, Kentucky and Dublin. The traditional cultural method according to EN ISO 6579:2002 for the detection of Salmonella in food was performed in parallel. The real-time PCR based method comprised a pre-enrichment step in Buffered Peptone Water (BPW overnight, followed by a shortened selective enrichment in Rappaport Vasilliadis Soya Broth (RVS for 6 hours and subsequent DNA extraction. Results The real-time multiplex PCR assay and traditional cultural method showed 100% inclusivity and 100% exclusivity on all strains tested. The real-time multiplex PCR assay was as sensitive as the traditional cultural method in detecting Salmonella in artificially contaminated chicken samples and correctly identified the serotype. Artificially contaminated chicken samples resulted in a detection limit of between 1 and 10 CFU per 25 g sample for both methods. A total of sixty-three naturally contaminated chicken samples were investigated by both methods and relative accuracy, relative sensitivity and relative specificity of the real-time PCR method were determined to be 89, 94 and 87%, respectively. Thirty cultures blind tested were correctly identified by the real-time multiplex PCR method. Conclusion Real-time PCR methodology can contribute to meet the need for rapid identification and detection methods in food testing laboratories.

  16. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  17. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    Science.gov (United States)

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

    Science.gov (United States)

    Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-08-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

  19. Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

    Science.gov (United States)

    Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-01-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

  20. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

    Directory of Open Access Journals (Sweden)

    V Hallur

    2015-01-01

    Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  1. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  2. Authentication of Meat Species in Sucuk by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Osman İrfan İLHAK

    2015-01-01

    Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

  3. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  4. Quantitation of Marek's disease and chicken anemia viruses in organs of experimentally infected chickens and commercial chickens by multiplex real-time PCR.

    Science.gov (United States)

    Davidson, Irit; Raibshtein, I; Al-Touri, A

    2013-06-01

    The worldwide distribution of chicken anemia virus (CAV) and Marek's disease virus (MDV) is well documented. In addition to their economic significance in single- or dual-virus infections, the two viruses can often accompany various other pathogens and affect poultry health either directly, by causing tumors, anemia, and delayed growth, or indirectly, by aggravating other diseases, as a result of their immunosuppressive effects. After a decade of employing the molecular diagnosis of those viruses, which replaced conventional virus isolation, we present the development of a real-time multiplex PCR for the simultaneous detection of both viruses. The real-time PCRs for MDV and for CAV alone are more sensitive than the respective end-point PCRs. In addition, the multiplex real-time shows a similar sensitivity when compared to the single real-time PCR for each virus. The newly developed real-time multiplex PCR is of importance in terms of the diagnosis and detection of low copies of each virus, MDV and CAV in single- and in multiple-virus infections, and its applicability will be further evaluated.

  5. Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

    Science.gov (United States)

    Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

    2015-01-01

    Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

  6. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  7. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. [Application of multiplex PCR for the screening of genotyping system for the rare blood groups Fy(a-), s-,k-,Di(b-) and Js(b-)].

    Science.gov (United States)

    Jiao, Wei; Xie, Li; Li, Hailan; Lan, Jiao; Mo, Zhuning; Yang, Ziji; Liu, Fei; Xiao, Ruiping; He, Yunlei; Ye, Luyi; Zhu, Ziyan

    2014-04-01

    To screen rare blood groups Fy(a-), s-, k-, Di(b-) and Js(b-) in an ethnic Zhuang population. Sequence-specific primers were designed based on single nucleotide polymorphism (SNP) sites of blood group antigens Fy(b) and s. A specific multiplex PCR system I was established. Multiplex PCR system II was applied to detect alleles antigens Di(b), k, Js(b)1910 and Js(b) 2019 at the same time. The two systems was were used to screen for rare blood group antigens in 4490 randomly selected healthy donors of Guangxi Zhuang ethnic origin. We successfully made the multiplex PCR system I. We detected the rare blood group antigens using the two PCR system. There are five Fy(a-), three s(-), two Di(b-) in 4490 Guangxi zhuang random samples. The multiplex PCR system I has achieved good accuracy and stability. With multiplex PCR systems I and II, 4490 samples were screened. Five Fy(a-), three s(-) and two Di(b-) samples were discovered. Multiplex PCR is an effective methods, which can be used for high throughput screening of rare blood groups. The rare blood types of Guangxi Zhuang ethnic origin obtained through the screening can provide valuable information for compatible blood transfusion. Through screening we obtained precious rare blood type materials which can be used to improve the capability of compatible infusion and reduce the transfusion reactions.

  9. Study comparing human papillomavirus (HPV) real-time multiplex PCR and Hybrid Capture II INNO-LiPA v2 HPV genotyping PCR assays

    DEFF Research Database (Denmark)

    Iftner, Thomas; Germ, Liesje; Swoyer, Ryan

    2009-01-01

    methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...

  10. Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples

    Science.gov (United States)

    Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris

    2002-01-01

    A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951

  11. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  12. Multiplex real-time PCR for the detection and quantification of latent and persistent viral genomes in cellular or plasma blood fractions.

    Science.gov (United States)

    Compston, Lara Isobel; Sarkobie, Francis; Li, Chengyao; Candotti, Daniel; Opare-Sem, Ohene; Allain, Jean-Pierre

    2008-07-01

    In common with latent viruses such as herpesviruses, parvovirus B19, HBV and GBV-C are contained successfully by the immune response and persist in the host. When immune control breaks down, reactivation of both latent and persistent viruses occurs. Two multiplex assays were developed (B19, HBV, HHV-8), (EBV, CMV, VZV) for blood screening, and tested on blood donor samples from Ghana to determine baseline prevalence of viraemia in immunocompetent persons. Single-virus real-time quantitative PCR (qPCR) assays were optimised for viral load determination of positive initial screening. The qPCR method utilised was absolute quantification with external standards. Multiplex and single-virus qPCR assays had similar sensitivity, except for the B19 assay in which sensitivity was 100-fold lower. Assays were optimised for reproducibility and repeatability, with R(2) of 0.9 being obtained for most assays. With the exception of B19 and CMV, assays had 100% detection limit ranging between 10(1) and 10(2) copies, IU or arbitrary units under single-virus and multiplex assay conditions. The prevalence of viraemia was 1.6% HBV (0.8% DNA+/HBsAg-, 0.8% DNA+/HBsAg+), 0.8% parvovirus B19, and 3.3% GBV-C viraemia in the plasma fraction. The prevalence of four herpesviruses was 1.0% HHV-8, 0.85% CMV, and 8.3% EBV, and no detectable VZV viraemia.

  13. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  14. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  15. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    Science.gov (United States)

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  16. Comparison of three human papillomavirus DNA detection methods: Next generation sequencing, multiplex-PCR and nested-PCR followed by Sanger based sequencing.

    Science.gov (United States)

    da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui

    2016-05-01

    To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.

  17. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  18. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  19. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  20. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

    Science.gov (United States)

    Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

    2015-01-01

    To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

  2. Use of Multiplex PCR for Diagnosis of Bacterial Infection Respiratory Mixed

    Directory of Open Access Journals (Sweden)

    Al-ssum, R. M.

    2010-01-01

    Full Text Available Atypical bacteria grow very slowly in culture or they do not grow at all leading to delays in detection and diagnosis. PCR multiplex was performed on template DNAs extracted from seventy three collected specimens. Thirty seven showed positive indication for the presence of bacterial infection. The incidence of Mycoplasma pneumoniae, Chlamydia pneumonia and Legionella pneumophila as a single infecting agent was 31.5%, 27.5% and 20 % respectively. Dual agent infection caused by Mycoplasma + Chlamydia, Mycoplasma + Legionella and Legionella + Chlamydia was 24%, 20% and 15% respectively. Triple agent infection caused by Legionella + Mycoplasma + Chlamydia was 17.5%. The etiology of the infection was M. pneumoniae, L. pneumophila or C. pneumoniae as a single etiology or in combination of two or three organisms.

  3. Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

    Directory of Open Access Journals (Sweden)

    K. Kurta

    2017-12-01

    Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

  4. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  5. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  6. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    Science.gov (United States)

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  7. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  8. A multiplex real-time PCR assay for routine diagnosis of bacterial vaginosis

    NARCIS (Netherlands)

    Kusters, J. G.; Reuland, E. A.; Bouter, S.; Koenig, P.; Dorigo-Zetsma, J. W.

    2015-01-01

    A semi-quantitative multiplex PCR assay for the diagnosis of bacterial vaginosis (BV) was evaluated in a prospective study in a population of Dutch women with complaints of abnormal vaginal discharge. The PCR targets Gardnerella vaginalis, Atopobium vaginae, Megasphaera phylotype 1, Lactobacillus

  9. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  10. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  11. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  12. Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad

    2012-01-01

    Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

  13. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  14. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  15. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    Science.gov (United States)

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  16. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  17. A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

    Science.gov (United States)

    Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

    2010-09-01

    The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to

  18. Multiplex real-time PCR for identification of canine parvovirus antigenic types.

    Science.gov (United States)

    Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Narang, Deepti

    2016-07-01

    Canine parvovirus (CPV) is an important disease causing gastroenteritis and/or haemorrhagic gastroenteritis in dogs. There are four antigenic types of CPV reported worldwide viz. CPV 2, CPV 2a, CPV 2b and CPV 2c. The diagnosis of CPV with the identification of the antigen type responsible remains problematic. In the present study, identification as well as antigenic typing of CPV was done using a de novo multiplex real time PCR to combat the problem of antigenic type identification. From the study it could be concluded that the here developed multiplex real time PCR assay could be used for rapid detection of CPV as well as typing of its three antigenic types. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. A multiplex PCR assay for the detection and quantification of Sclerotinia sclerotiorum and Botrytis cinerea.

    Science.gov (United States)

    Reich, J D; Alexander, T W; Chatterton, S

    2016-05-01

    Traditional culture methods for identifying the plant fungal pathogens Sclerotinia sclerotiorum (Lib.) de Bary and Botrytis cinerea Pers.:Fr. are slow and laborious. The goal of this study was to develop a multiplex real-time PCR (qPCR) assay to detect and quantify DNA from S. sclerotiorum and B. cinerea. A primer set (SsIGS_5) for S. sclerotiorum was designed that targeted the intergenic spacer (IGS) regions of the ribosomal DNA. Addition of a probe to the assay increased its specificity: when the primer/probe set was tested against 21 fungal species (35 strains), amplification was detected from all S. sclerotiorum strains and no other species. For qPCR, the SsIGS_5 primer and probe set exhibited a linear range from 7·0 ng to 0·07 pg target DNA (R(2)  = 0·99). SsIGS_5 was then multiplexed with a previously published primer/probe set for B. cinerea to develop a high-throughput method for the detection and quantification of DNA from both pathogens. When multiplexed, the sensitivity and specificity of both assays were not different from individual qPCR reactions. The multiplex assay is currently being used to detect and quantify S. sclerotiorum and B. cinerea DNA from aerosol samples collected in commercial seed alfalfa fields. A primer and probe set for the quantification of Sclerotinia sclerotiorum DNA in a PCR assay was developed. The probe-based nature of this assay signifies an improvement over previous assays for this species by allowing multiplex reactions while maintaining high sensitivity. The primer/probe set was used in a multiplex real-time PCR assay for the quantification of S. sclerotiorum and Botrytis cinerea DNA, enabling rapid analysis of environmental samples. In crops susceptible to both pathogens, this multiplex assay can be used to quickly quantify the presence of each pathogen. © 2016 Her Majesty the Queen in Right of Canada © 2016 The Society for Applied Microbiology. Reproduced with the permission of the Office of the

  20. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  1. Development of Multiplex Microsatellite PCR Panels for the Seagrass Thalassia hemprichii (Hydrocharitaceae

    Directory of Open Access Journals (Sweden)

    Kor-jent van Dijk

    2014-11-01

    Full Text Available Premise of the study: New microsatellites were developed for the seagrass Thalassia hemprichii (Hydrocharitaceae, a long-lived seagrass species that is found throughout the shallow waters of tropical and subtropical Indo-West Pacific. Three multiplex PCR panels were designed utilizing new and previously developed markers, resulting in a toolkit for generating a 16-locus genotype. Methods and Results: Through the use of microsatellite enrichment and next-generation sequencing, 16 new, validated, polymorphic microsatellite markers were isolated. Diversity was between two and four alleles per locus totaling 36 alleles. These markers, plus previously developed microsatellite markers for T. hemprichii and T. testudinum, were tested for suitability in multiplex PCR panels. Conclusions: The generation of an easily replicated suite of multiplex panels of codominant molecular markers will allow for high-resolution and detailed genetic structure analysis and clonality assessment with minimal genotyping costs. We suggest the establishment of a T. hemprichii primer convention for the unification of future data sets.

  2. A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

    NARCIS (Netherlands)

    Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

    2007-01-01

    Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

  3. Practical implementation of a multiplex PCR for acute respiratory tract infections in children

    NARCIS (Netherlands)

    Gruteke, Paul; Glas, Afina S.; Dierdorp, Mirjam; Vreede, Willem B.; Pilon, Jan-Willem; Bruisten, Sylvia M.

    2004-01-01

    Molecular testing for acute respiratory infections (ARIs) has documented value but limited implementation due to questions that typically slow the acceptance of new tests. This study sought to address these questions and achieve implementation. Rhinovirus was added to a nested multiplex PCR (M-PCR),

  4. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  5. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  6. Multiplex polymerase chain reaction on FTA cards vs. flow cytometry for B-lymphocyte clonality.

    Science.gov (United States)

    Dictor, Michael; Skogvall, Ingela; Warenholt, Janina; Rambech, Eva

    2007-01-01

    Two-colour flow cytometry was compared with multiplex PCR with capillary electrophoresis for clonality determination in specific categories of B-cell lymphoma. FTA cards were evaluated for preserving DNA from node imprints and expediting molecular analysis. A single-tube multiplex PCR targeted IGH and lymphoma-specific translocations in DNA extracted from 180 frozen lymphoid tissues and DNA bound to FTA cards from 192 fresh tissues and 137 aspirates. PCR results were compared with flow cytometry in the extracted and aspirated samples. Overall, single-tube multiplex PCR sensitivity was equivalent in the sample groups (intergroup range 79%-91%). False negatives were associated with tumour origin in the follicle centre. Multiplex PCR and flow cytometry were equally sensitive and together detected 98% of B-cell lymphomas. Additional two-tube targeting of IGK suggested an overall molecular sensitivity >90%. False positive (pseudoclonal) single-tube multiplex PCR was associated with necrosis and sparse lymphocytes. Multiplex PCR using template DNA bound to an FTA card effectively detects B-lymphocyte clonality, obviates DNA extraction and refrigeration, and can be used without diminished sensitivity in fine needle aspirates or node imprints as a replacement for or complement to flow cytometry at any point in the diagnostic work-up.

  7. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

    Science.gov (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

    1996-06-01

    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  8. Entamoeba spp. diagnosis in patients with inflmmatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods

    Directory of Open Access Journals (Sweden)

    Zahra Gharibi

    2017-10-01

    Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.

  9. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2018-05-01

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  10. Evaluation of a PCR multiplex for detection and differentiation of Mycoplasma synoviae, M. gallisepticum, and M. gallisepticum strain F-vaccine

    Directory of Open Access Journals (Sweden)

    Elena Mettifogo

    2015-01-01

    Full Text Available Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS are the mycoplasma infections of most concern for commercial poultry industry. MG infection is commonly designated as chronic respiratory disease (CRD of chickens and infections sinusitis of turkeys. MS causes sub clinical upper respiratory infection and tenosynovitis or bursitis in chickens and turkeys. The multiplex PCR was standardized to detect simultaneously the MS, MG field strains and MG F-vaccine strain specific. The generic PCR for detection of any species of Mollicutes Class was performed and compared to the multiplex PCR and to PCR using species-specific primers. A total of 129 avian tracheal swabs were collected from broiler-breeders, layer hens and broilers in seven different farms and were examined by multiplex PCR methods. The system (multiplex PCR demonstrated to be very rapid, sensitive, and specific. Therefore, the results showed a high prevalence of MS in the flocks examined (27.9%, and indicate that the MS is a recurrent pathogen in Brazilian commercial poultry flocks.

  11. Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

    Directory of Open Access Journals (Sweden)

    Ravi Prakash

    2014-12-01

    Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

  12. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  13. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  14. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  15. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  16. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  18. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  19. Performance of automated multiplex PCR using sonication fluid for diagnosis of periprosthetic joint infection: a prospective cohort.

    Science.gov (United States)

    Renz, Nora; Feihl, Susanne; Cabric, Sabrina; Trampuz, Andrej

    2017-12-01

    Sonication of explanted prostheses improved the microbiological diagnosis of periprosthetic joint infections (PJI). We evaluated the performance of automated multiplex polymerase chain reaction (PCR) using sonication fluid for the microbiological diagnosis of PJI. In a prospective cohort using uniform definition criteria for PJI, explanted joint prostheses were investigated by sonication and the resulting sonication fluid was analyzed by culture and multiplex PCR. McNemar's Chi-squared test was used to compare the performance of diagnostic tests. Among 111 patients, PJI was diagnosed in 78 (70%) and aseptic failure in 33 (30%). For the diagnosis of PJI, the sensitivity and specificity of periprosthetic tissue culture was 51 and 100%, of sonication fluid culture 58 and 100%, and of sonication fluid PCR 51 and 94%, respectively. Among 70 microorganisms, periprosthetic tissue culture grew 52 (74%), sonication fluid culture grew 50 (71%) and sonication fluid PCR detected 37 pathogens (53%). If only organisms are considered, for which primers are included in the test panel, PCR detected 37 of 58 pathogens (64%). The sonication fluid PCR missed 19 pathogens (predominantly oral streptococci and anaerobes), whereas 7 additional microorganisms were detected only by PCR (including Cutibacterium spp. and coagulase-negative staphylococci). The performance of multiplex PCR using sonication fluid is comparable to culture of periprosthetic tissue or sonication fluid. The advantages of PCR are short processing time (PCR, especially of low-virulent organisms.

  20. Screening for circulating RAS/RAF mutations by multiplex digital PCR

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Jakobsen, Anders

    2016-01-01

    by technical challenges primarily due to the low levels of ctDNA in patients with localized disease and in patients responding to therapy. The approach presented here is a multiplex digital PCR method of screening for 31 mutations in the KRAS, NRAS, BRAF, and PIK3CA genes in the plasma. The upper level...

  1. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  2. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  3. Development of a multiplex methylation-specific PCR as candidate triage test for women with an HPV-positive cervical scrape

    International Nuclear Information System (INIS)

    Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM

    2012-01-01

    Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions

  4. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  5. Clostridium perfringens isolate typing by multiplex PCR

    Directory of Open Access Journals (Sweden)

    MR Ahsani

    2010-01-01

    Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

  6. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  7. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  8. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    Science.gov (United States)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  10. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    Science.gov (United States)

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  11. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  12. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacteria and Viruses in Pepper and Tomato Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this study was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant seed infection pathogenic bacteria and virus, Xanthomonns campestris pv. vesicatoria (Xcv, Clavibacter michiganensis subsp. michiganensis (Cmm, Erwinia carotovora subsp. carotovora (Ecc, Pepper mild mottle virus (PMMoV and Tobacco mild green mosaic virus (TMGMV in pepper and tomato seeds. Most of pepper and tomato bacterial and virus diseases are responsible for germination and growth obstruction. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcv, Cmm, Ecc, PMMoV and TMGMV in pepper and tomato seeds, five pairs (Cmm-F/R, Ecc-F/R, Xcv-F/R, PMMoV-F/R, TMGMV-F/R of specific primer were synthesized by primer-blast program. The multiplex PCR for the five pathogens in pepper and tomato seeds could detect specially without interference among primers and/or cDNA of plant seeds and other plant pathogens. The PCR result for pathogen detection using 20 commercial pepper and 10 tomato seed samples, Ecc was detected from 4 pepper and 2 tomato seed samples, PMMoV was detected from 1 pepper seed sample, and PMMoV and TMGMV were simultaneously detected from 1 pepper seed sample.

  13. Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR.

    Science.gov (United States)

    Guion, Chase E; Ochoa, Theresa J; Walker, Christopher M; Barletta, Francesca; Cleary, Thomas G

    2008-05-01

    Diarrheagenic Escherichia coli strains are important causes of diarrhea in children from the developing world and are now being recognized as emerging enteropathogens in the developed world. Current methods of detection are too expensive and labor-intensive for routine detection of these organisms to be practical. We developed a real-time fluorescence-based multiplex PCR for the detection of all six of the currently recognized classes of diarrheagenic E. coli. The primers were designed to specifically amplify eight different virulence genes in the same reaction: aggR for enteroaggregative E. coli, stIa/stIb and lt for enterotoxigenic E. coli, eaeA for enteropathogenic E. coli and Shiga toxin-producing E. coli (STEC), stx(1) and stx(2) for STEC, ipaH for enteroinvasive E. coli, and daaD for diffusely adherent E. coli (DAEC). Eighty-nine of ninety diarrheagenic E. coli and 36/36 nonpathogenic E. coli strains were correctly identified using this approach (specificity, 1.00; sensitivity, 0.99). The single false negative was a DAEC strain. The total time between preparation of DNA from E. coli colonies on agar plates and completion of PCR and melting-curve analysis was less than 90 min. The cost of materials was low. Melting-point analysis of real-time multiplex PCR is a rapid, sensitive, specific, and inexpensive method for detection of diarrheagenic E. coli.

  14. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Science.gov (United States)

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  15. Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M Heiat

    2010-07-01

    Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

  16. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    C. Latha

    2017-08-01

    Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.

  17. Development and validation of the AmpFℓSTR® Identifiler® Direct PCR Amplification Kit: a multiplex assay for the direct amplification of single-source samples.

    Science.gov (United States)

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K

    2011-07-01

    The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.

  18. Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR.

    Science.gov (United States)

    Montazeri, Effat Abbasi; Khosravi, Azar Dokht; Jolodar, Abbas; Ghaderpanah, Mozhgan; Azarpira, Samireh

    2015-05-01

    Methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant coagulase-negative staphylococci (MRCoNS) as important human pathogens are causes of nosocomial infections worldwide. Burn patients are at a higher risk of local and systemic infections with these microorganisms. A screening method for MRSA by using a multiplex polymerase chain reaction (PCR) targeting the 16S ribosomal RNA (rRNA), mecA, and nuc genes was developed. The aim of the present study was to investigate the potential of this PCR assay for the detection of MRSA strains in samples from burn patients. During an 11-month period, 230 isolates (53.11%) of Staphylococcus spp. were collected from burn patients. The isolates were identified as S. aureus by using standard culture and biochemical tests. DNA was extracted from bacterial colonies and multiplex PCR was used to detect MRSA and MRCoNS strains. Of the staphylococci isolates, 149 (64.9%) were identified as S. aureus and 81 (35.21%) were described as CoNS. Among the latter, 51 (62.97%) were reported to be MRCoNS. From the total S. aureus isolates, 132 (88.6%) were detected as MRSA and 17 (11.4%) were methicillin-susceptible S. aureus (MSSA). The presence of the mecA gene in all isolates was confirmed by using multiplex PCR as a gold standard method. This study presented a high MRSA rate in the region under investigation. The 16S rRNA-mecA-nuc multiplex PCR is a good tool for the rapid characterization of MRSA strains. This paper emphasizes the need for preventive measures and choosing effective antimicrobials against MRSA and MRCoNS infections in the burn units. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  19. Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.

    Science.gov (United States)

    Jahan, F; Shamsuzzaman, S M; Akter, S

    2014-12-01

    Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.

  20. Technical aspects and recommendations for single-cell qPCR.

    Science.gov (United States)

    Ståhlberg, Anders; Kubista, Mikael

    2018-02-01

    Single cells are basic physiological and biological units that can function individually as well as in groups in tissues and organs. It is central to identify, characterize and profile single cells at molecular level to be able to distinguish different kinds, to understand their functions and determine how they interact with each other. During the last decade several technologies for single-cell profiling have been developed and used in various applications, revealing many novel findings. Quantitative PCR (qPCR) is one of the most developed methods for single-cell profiling that can be used to interrogate several analytes, including DNA, RNA and protein. Single-cell qPCR has the potential to become routine methodology but the technique is still challenging, as it involves several experimental steps and few molecules are handled. Here, we discuss technical aspects and provide recommendation for single-cell qPCR analysis. The workflow includes experimental design, sample preparation, single-cell collection, direct lysis, reverse transcription, preamplification, qPCR and data analysis. Detailed reporting and sharing of experimental details and data will promote further development and make validation studies possible. Efforts aiming to standardize single-cell qPCR open up means to move single-cell analysis from specialized research settings to standard research laboratories. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  2. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    Science.gov (United States)

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  3. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  4. Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.

    Science.gov (United States)

    Ullal, Adeeti V; Weissleder, Ralph

    2015-01-01

    We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.

  5. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  6. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Science.gov (United States)

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  7. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  8. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  9. Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

    Science.gov (United States)

    Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

    2014-01-01

    The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

  10. Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

    Directory of Open Access Journals (Sweden)

    Valeria Velasco

    Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

  11. Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

    Science.gov (United States)

    Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

    2013-05-01

    This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

  12. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  13. ddPCRclust - An R package and Shiny app for automated analysis of multiplexed ddPCR data.

    Science.gov (United States)

    Brink, Benedikt G; Meskas, Justin; Brinkman, Ryan R

    2018-03-09

    Droplet digital PCR (ddPCR) is an emerging technology for quantifying DNA. By partitioning the target DNA into ∼20000 droplets, each serving as its own PCR reaction compartment, a very high sensitivity of DNA quantification can be achieved. However, manual analysis of the data is time consuming and algorithms for automated analysis of non-orthogonal, multiplexed ddPCR data are unavailable, presenting a major bottleneck for the advancement of ddPCR transitioning from low-throughput to high- throughput. ddPCRclust is an R package for automated analysis of data from Bio-Rad's droplet digital PCR systems (QX100 and QX200). It can automatically analyse and visualise multiplexed ddPCR experiments with up to four targets per reaction. Results are on par with manual analysis, but only take minutes to compute instead of hours. The accompanying Shiny app ddPCRvis provides easy access to the functionalities of ddPCRclust through a web-browser based GUI. R package: https://github.com/bgbrink/ddPCRclust; Interface: https://github.com/bgbrink/ddPCRvis/; Web: https://bibiserv.cebitec.uni-bielefeld.de/ddPCRvis/. bbrink@cebitec.uni-bielefeld.de.

  14. Development of a multiplex real time PCR to detect thermophilic lactic acid bacteria in natural whey starters.

    Science.gov (United States)

    Bottari, Benedetta; Agrimonti, Caterina; Gatti, Monica; Neviani, Erasmo; Marmiroli, Nelson

    2013-01-01

    A multiplex real time PCR (mRealT-PCR) useful to rapidly screen microbial composition of thermophilic starter cultures for hard cooked cheeses and to compare samples with potentially different technological properties was developed. Novel primers directed toward pheS gene were designed and optimized for multiple detection of Lactobacillus helveticus, Lactobacillus delbrueckii, Streptococcus thermophilus and Lactobacillus fermentum. The assay was based on SYBR Green chemistry followed by melting curves analysis. The method was then evaluated for applications in the specific detection of the 4 lactic acid bacteria (LAB) in 29 different natural whey starters for Parmigiano Reggiano cheese production. The results obtained by mRealT-PCR were also compared with those obtained on the same samples by Fluorescence in Situ Hybridization (FISH) and Length-Heterogeneity PCR (LH-PCR). The mRealT-PCR developed in this study, was found to be effective for analyzing species present in the samples with an average sensitivity down to less than 600 copies of DNA and therefore sensitive enough to detect even minor LAB community members of thermophilic starter cultures. The assay was able to describe the microbial population of all the different natural whey starter samples analyzed, despite their natural variability. A higher number of whey starter samples with S. thermophilus and L. fermentum present in their microbial community were revealed, suggesting that these species could be more frequent in Parmigiano Reggiano natural whey starter samples than previously shown. The method was more effective than LH-PCR and FISH and, considering that these two techniques have to be used in combination to detect the less abundant species, the mRealT-PCR was also faster. Providing a single step sensitive detection of L. helveticus, L. delbrueckii, S. thermophilus and L. fermentum, the developed mRealT-PCR could be used for screening thermophilic starter cultures and to follow the presence of

  15. Clinical Application of a Multiplex Real-Time PCR Assay for Simultaneous Detection of Legionella Species, Legionella pneumophila, and Legionella pneumophila Serogroup 1

    OpenAIRE

    Benitez, Alvaro J.; Winchell, Jonas M.

    2014-01-01

    We developed a single-tube multiplex real-time PCR assay capable of simultaneously detecting and discriminating Legionella spp., Legionella pneumophila, and Legionella pneumophila serogroup 1 in primary specimens. Evaluation of 21 clinical specimens and 115 clinical isolates demonstrated this assay to be a rapid, high-throughput diagnostic test with 100% specificity that may aid during legionellosis outbreaks and epidemiologic investigations.

  16. Laboratory Tests of Multiplex Detection of PCR Amplicons Using the Luminex 100 Flow Analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Venkateswaran, K.S.; Nasarabadi, S.; Langlois, R.G.

    2000-05-05

    Lawrence Livermore National Laboratory (LLNL) demonstrated the power of flow cytometry in detecting the biological agents simulants at JFT III. LLNL pioneered in the development of advanced nucleic acid analyzer (ANM) for portable real time identification. Recent advances in flow cytometry provide a means for multiplexed nucleic acid detection and immunoassay of pathogenic microorganisms. We are presently developing multiplexed immunoassays for the simultaneous detection of different simulants. Our goal is to build an integrated instrument for both nucleic acid analysis and immuno detection. In this study we evaluated the Luminex LX 100 for concurrent identification of more than one PCR amplified product. ANAA has real-time Taqman fluorescent detection capability for rapid identification of field samples. However, its multiplexing ability is limited by the combination of available fluorescent labels. Hence integration of ANAA with flow cytometry can give the rapidity of ANAA amplification and the multiplex capability of flow cytometry. Multiplexed flow cytometric analysis is made possible using a set of fluorescent latex microsphere that are individually identified by their red and infrared fluorescence. A green fluorochrome is used as the assay signal. Methods were developed for the identification of specific nucleic acid sequences from Bacillus globigii (Bg), Bacillus thuringensis (Bt) and Erwinia herbicola (Eh). Detection sensitivity using different reporter fluorochromes was tested with the LX 100, and also different assay formats were evaluated for their suitability for rapid testing. A blind laboratory trial was carried out December 22-27, 1999 to evaluate bead assays for multiplex identification of Bg and Bt PCR products. This report summarizes the assay development, fluorochrome comparisons, and the results of the blind trial conducted at LLNL for the laboratory evaluation of the LX 100 flow analyzer.

  17. Multiplex PCR from Menstrual Blood: A Non-Invasive Cost-Effective Approach to Reduce Diagnostic Dilemma for Genital Tuberculosis.

    Science.gov (United States)

    Paine, Suman K; Basu, Analabha; Choudhury, Rajib Gon; Bhattacharya, Basudev; Chatterjee, Sidhartha; Bhattacharya, Chandra

    2018-03-16

    Genital tuberculosis (GTB) is a potent contributor to irreversible damage to the reproductive system and infertility in females. As no gold standard diagnostic tool is yet available, clinical suspicion and relatively insensitive approaches such as histopathology, laparoscopy and hysterosalpingogram are currently critical determinants in the diagnosis of GTB. Although a polymerase chain reaction (PCR)-based assay using endometrial tissue seems promising, sampling does require an invasive procedure. We hypothesized that menstrual blood may provide an alternate non-invasive source of samples for PCR-based GTB diagnosis. We enrolled 195 women with primary infertility in whom GTB was suspected. We obtained ethics committee approval from our institution and written informed consent from subjects. Endometrial tissue and menstrual blood was collected from the subjects and culture, histopathology, and multiplex PCR with both sample type was performed for each subject. The sensitivity and specificity of multiplex PCR was, respectively, 90.2 and 86.1% for menstrual blood, 95.8 and 84.3% for endometrial tissue, and 64.8 and 93.2% for histopathology staining. A strong clinical suspicion aided with multiplex PCR using menstrual blood may significantly reduce the diagnostic dilemma for GTB diagnosis in a non-invasive, sensitive, rapid, and cost-effective manner.

  18. Molecular diagnostics of the honey bee parasites Lotmaria passim and Crithidia spp. (Trypanosomatidae) using multiplex PCR

    Science.gov (United States)

    Lotmaria passim Schwarz is a recently described trypanosome parasite of honey bees in continental United States, Europe, and Japan. We developed a multiplex PCR technique using a PCR primer specific for L. passim to distinguish this species from C. mellificae. We report the presence of L. passim in ...

  19. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

    Science.gov (United States)

    Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz; Gray, Darren J.; Verweij, Jaco J.; Clements, Archie C. A.; Gomes, Santina J.; Traub, Rebecca; McCarthy, James S.

    2016-01-01

    Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two multiplex real-time PCR reactions the first targeting: Necator americanus, Ancylostoma spp., Ascaris spp., and Trichuris trichiura; and the second Entamoeba histolytica, Cryptosporidium spp., Giardia. duodenalis, and Strongyloides stercoralis. Samples were also subject to sodium nitrate flotation for identification and quantification of STH eggs, and zinc sulphate centrifugal flotation for detection of protozoan parasites. Higher parasite prevalence was detected by multiplex PCR (hookworms 2.9 times higher, Ascaris 1.2, Giardia 1.6, along with superior polyparasitism detection with this effect magnified as the number of parasites present increased (one: 40.2% vs. 38.1%, two: 30.9% vs. 12.9%, three: 7.6% vs. 0.4%, four: 0.4% vs. 0%). Although, all STH positive samples were low intensity infections by microscopy as defined by WHO guidelines the DNA-load detected by multiplex PCR suggested higher intensity infections. Conclusions/Significance Multiplex PCR, in addition to superior sensitivity, enabled more accurate determination of infection intensity for Ascaris, hookworms and

  20. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  1. Multiplex PCR for Differential Identification of Broad Tapeworms (Cestoda: Diphyllobothrium) Infecting Humans

    Czech Academy of Sciences Publication Activity Database

    Wicht, B.; Yanagida, T.; Scholz, Tomáš; Ito, A.; Jiménez, J. A.; Brabec, Jan

    2010-01-01

    Roč. 48, č. 9 (2010), s. 3111-3116 ISSN 0095-1137 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : MOLECULAR EVIDENCE * PACIFIC SALMON * NIHONKAIENSE * Diphyllobothrium * multiplex PCR * the cytochrome c oxidase subunit 1 * mitochondrial DNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 4.220, year: 2010

  2. A tissue biopsy-based epigenetic multiplex PCR assay for prostate cancer detection

    Directory of Open Access Journals (Sweden)

    Van Neste Leander

    2012-06-01

    Full Text Available Abstract Background PSA-directed prostate cancer screening leads to a high rate of false positive identifications and an unnecessary biopsy burden. Epigenetic biomarkers have proven useful, exhibiting frequent and abundant inactivation of tumor suppressor genes through such mechanisms. An epigenetic, multiplex PCR test for prostate cancer diagnosis could provide physicians with better tools to help their patients. Biomarkers like GSTP1, APC and RASSF1 have demonstrated involvement with prostate cancer, with the latter two genes playing prominent roles in the field effect. The epigenetic states of these genes can be used to assess the likelihood of cancer presence or absence. Results An initial test cohort of 30 prostate cancer-positive samples and 12 cancer-negative samples was used as basis for the development and optimization of an epigenetic multiplex assay based on the GSTP1, APC and RASSF1 genes, using methylation specific PCR (MSP. The effect of prostate needle core biopsy sample volume and age of formalin-fixed paraffin-embedded (FFPE samples was evaluated on an independent follow-up cohort of 51 cancer-positive patients. Multiplexing affects copy number calculations in a consistent way per assay. Methylation ratios are therefore altered compared to the respective singleplex assays, but the correlation with patient outcome remains equivalent. In addition, tissue-biopsy samples as small as 20 μm can be used to detect methylation in a reliable manner. The age of FFPE-samples does have a negative impact on DNA quality and quantity. Conclusions The developed multiplex assay appears functionally similar to individual singleplex assays, with the benefit of lower tissue requirements, lower cost and decreased signal variation. This assay can be applied to small biopsy specimens, down to 20 microns, widening clinical applicability. Increasing the sample volume can compensate the loss of DNA quality and quantity in older samples.

  3. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus

    NARCIS (Netherlands)

    E. Ghaznavi Rad (Ehsanollah); N.S. Mariana (Nor Shamsudin); Z. Sekawi (Zamberi); A.F. van Belkum (Alex); V. Neela (Vasanthakumari)

    2010-01-01

    textabstractA multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus

  4. A method for the analysis of 32 X chromosome insertion deletion polymorphisms in a single PCR

    DEFF Research Database (Denmark)

    Pereira, Rui; Pereira, Vania; Gomes, Iva

    2012-01-01

    population samples and revealed high forensic efficiency, as measured by the accumulated power of discrimination (0.9999990 was the lowest value in males and 0.999999999998 was the highest in females) and mean exclusion chance varied between 0.998 and 0.9996 in duos and between 0.99997 and 0.999998 in trios......-Indel multiplex system amplifying 32 biallelic markers in one single PCR. The multiplex includes X-Indels shown to be polymorphic in the major human population groups and follows a short amplicon strategy. The set was applied in the genetic characterization of sub-Saharan African, European and East Asian...

  5. Real time quantitative amplification detection on a microarray: towards high multiplex quantitative PCR.

    NARCIS (Netherlands)

    Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  6. Real time quantitative amplification detection on a microarray : towards high multiplex quantitative PCR

    NARCIS (Netherlands)

    Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.

    2012-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that

  7. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  8. Two-step multiplex polymerase chain reaction improves the speed and accuracy of genotyping using DNA from noninvasive and museum samples.

    Science.gov (United States)

    Arandjelovic, M; Guschanski, K; Schubert, G; Harris, T R; Thalmann, O; Siedel, H; Vigilant, L

    2009-01-01

    Many studies in molecular ecology rely upon the genotyping of large numbers of low-quantity DNA extracts derived from noninvasive or museum specimens. To overcome low amplification success rates and avoid genotyping errors such as allelic dropout and false alleles, multiple polymerase chain reaction (PCR) replicates for each sample are typically used. Recently, two-step multiplex procedures have been introduced which drastically increase the success rate and efficiency of genotyping. However, controversy still exists concerning the amount of replication needed for suitable control of error. Here we describe the use of a two-step multiplex PCR procedure that allows rapid genotyping using at least 19 different microsatellite loci. We applied this approach to quantified amounts of noninvasive DNAs from western chimpanzee, western gorilla, mountain gorilla and black and white colobus faecal samples, as well as to DNA from ~100-year-old gorilla teeth from museums. Analysis of over 45 000 PCRs revealed average success rates of > 90% using faecal DNAs and 74% using museum specimen DNAs. Average allelic dropout rates were substantially reduced compared to those obtained using conventional singleplex PCR protocols, and reliable genotyping using low (< 25 pg) amounts of template DNA was possible. However, four to five replicates of apparently homozygous results are needed to avoid allelic dropout when using the lowest concentration DNAs (< 50 pg/reaction), suggesting that use of protocols allowing routine acceptance of homozygous genotypes after as few as three replicates may lead to unanticipated errors when applied to low-concentration DNAs. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

  9. The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-a-chip Agilent DNA 1000 platform.

    Science.gov (United States)

    Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš

    2016-01-01

    Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.

  10. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  11. Multiplexed homogeneous proximity ligation assays for high throughput protein biomarker research in serological material

    DEFF Research Database (Denmark)

    Lundberg, Martin; Thorsen, Stine Buch; Assarsson, Erika

    2011-01-01

    A high throughput protein biomarker discovery tool has been developed based on multiplexed proximity ligation assays (PLA) in a homogeneous format in the sense of no washing steps. The platform consists of four 24-plex panels profiling 74 putative biomarkers with sub pM sensitivity each consuming...... sequences are united by DNA ligation upon simultaneous target binding forming a PCR amplicon. Multiplex PLA thereby converts multiple target analytes into real-time PCR amplicons that are individually quantificatied using microfluidic high capacity qPCR in nano liter volumes. The assay shows excellent...

  12. Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

    Science.gov (United States)

    Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

    2017-10-01

    Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparison of Real-Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO-LiPA HPV Genotyping Extra Assay▿

    OpenAIRE

    Else, Elizabeth A.; Swoyer, Ryan; Zhang, Yuhua; Taddeo, Frank J.; Bryan, Janine T.; Lawson, John; Van Hyfte, Inez; Roberts, Christine C.

    2011-01-01

    Real-time type-specific multiplex human papillomavirus (HPV) PCR assays were developed to detect HPV DNA in samples collected for the efficacy determination of the quadrivalent HPV (type 6, 11, 16, and 18) L1 virus-like particle (VLP) vaccine (Gardasil). Additional multiplex (L1, E6, and E7 open reading frame [ORF]) or duplex (E6 and E7 ORF) HPV PCR assays were developed to detect high-risk HPV types, including HPV type 31 (HPV31), HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, and H...

  14. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  15. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Science.gov (United States)

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  16. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Science.gov (United States)

    Ikten, Cengiz; Ustun, Rustem; Catal, Mursel; Yol, Engin; Uzun, Bulent

    2016-01-01

    Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.). Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  17. Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea

    DEFF Research Database (Denmark)

    Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni

    2017-01-01

    and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. Methods: A real-time multiplex PCR method with internal inhibition control...... microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Conclusions: Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof...

  18. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  19. Reliability and short-term intra-individual variability of telomere length measurement using monochrome multiplexing quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Sangmi Kim

    Full Text Available Studies examining the association between telomere length and cancer risk have often relied on measurement of telomere length from a single blood draw using a real-time PCR technique. We examined the reliability of telomere length measurement using sequential samples collected over a 9-month period.Relative telomere length in peripheral blood was estimated using a single tube monochrome multiplex quantitative PCR assay in blood DNA samples from 27 non-pregnant adult women (aged 35 to 74 years collected in 7 visits over a 9-month period. A linear mixed model was used to estimate the components of variance for telomere length measurements attributed to variation among women and variation between time points within women. Mean telomere length measurement at any single visit was not significantly different from the average of 7 visits. Plates had a significant systematic influence on telomere length measurements, although measurements between different plates were highly correlated. After controlling for plate effects, 64% of the remaining variance was estimated to be accounted for by variance due to subject. Variance explained by time of visit within a subject was minor, contributing 5% of the remaining variance.Our data demonstrate good short-term reliability of telomere length measurement using blood from a single draw. However, the existence of technical variability, particularly plate effects, reinforces the need for technical replicates and balancing of case and control samples across plates.

  20. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Directory of Open Access Journals (Sweden)

    Ghalia Boubaker

    Full Text Available Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10 and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3, E. equinus (G4, E. ortleppi (G5, and E. canadensis (G6-G10. The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR allowing three levels of discrimination: (i Echinococcus genus, (ii E. granulosus complex in common, and (iii the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20 and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13. The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (<40%. Thus, except for copro analysis, the mPCR described here has a high potential for a worldwide application in large-scale molecular epidemiological studies on the Echinococcus genus.

  1. A Multiplex PCR for the Simultaneous Detection and Genotyping of the Echinococcus granulosus Complex

    Science.gov (United States)

    Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A.; Rosenzvit, Mara C.; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2013-01-01

    Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1–G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1–G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6–G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus. PMID:23350011

  2. A multiplex PCR for the simultaneous detection and genotyping of the Echinococcus granulosus complex.

    Science.gov (United States)

    Boubaker, Ghalia; Macchiaroli, Natalia; Prada, Laura; Cucher, Marcela A; Rosenzvit, Mara C; Ziadinov, Iskender; Deplazes, Peter; Saarma, Urmas; Babba, Hamouda; Gottstein, Bruno; Spiliotis, Markus

    2013-01-01

    Echinococcus granulosus is characterized by high intra-specific variability (genotypes G1-G10) and according to the new molecular phylogeny of the genus Echinococcus, the E. granulosus complex has been divided into E. granulosus sensu stricto (G1-G3), E. equinus (G4), E. ortleppi (G5), and E. canadensis (G6-G10). The molecular characterization of E. granulosus isolates is fundamental to understand the spatio-temporal epidemiology of this complex in many endemic areas with the simultaneous occurrence of different Echinococcus species and genotypes. To simplify the genotyping of the E. granulosus complex we developed a single-tube multiplex PCR (mPCR) allowing three levels of discrimination: (i) Echinococcus genus, (ii) E. granulosus complex in common, and (iii) the specific genotype within the E. granulosus complex. The methodology was established with known DNA samples of the different strains/genotypes, confirmed on 42 already genotyped samples (Spain: 22 and Bulgaria: 20) and then successfully applied on 153 unknown samples (Tunisia: 114, Algeria: 26 and Argentina: 13). The sensitivity threshold of the mPCR was found to be 5 ng Echinoccoccus DNA in a mixture of up to 1 µg of foreign DNA and the specificity was 100% when template DNA from closely related members of the genus Taenia was used. Additionally to DNA samples, the mPCR can be carried out directly on boiled hydatid fluid or on alkaline-lysed frozen or fixed protoscoleces, thus avoiding classical DNA extractions. However, when using Echinococcus eggs obtained from fecal samples of infected dogs, the sensitivity of the mPCR was low (Echinococcus genus.

  3. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

    2002-01-01

    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  4. Capsular typing of Streptococcus agalactiae (Lancefield group B streptococci) from fish using multiplex PCR and serotyping

    Science.gov (United States)

    Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...

  5. A Multiplex PCR for Detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in Clinical Specimens

    National Research Council Canada - National Science Library

    McDonough, E. A; Barrozo, C. P; Russell, K. L; Metzgar, D

    2005-01-01

    A multiplex PCR was developed that is capable of detecting four of the most important bacterial agents of atypical pneumophia, Mycaplasma pneumoniae, Chlamydophia pneumoniae, Legionella pneumophila...

  6. On-chip single photon filtering and multiplexing in hybrid quantum photonic circuits.

    Science.gov (United States)

    Elshaari, Ali W; Zadeh, Iman Esmaeil; Fognini, Andreas; Reimer, Michael E; Dalacu, Dan; Poole, Philip J; Zwiller, Val; Jöns, Klaus D

    2017-08-30

    Quantum light plays a pivotal role in modern science and future photonic applications. Since the advent of integrated quantum nanophotonics different material platforms based on III-V nanostructures-, colour centers-, and nonlinear waveguides as on-chip light sources have been investigated. Each platform has unique advantages and limitations; however, all implementations face major challenges with filtering of individual quantum states, scalable integration, deterministic multiplexing of selected quantum emitters, and on-chip excitation suppression. Here we overcome all of these challenges with a hybrid and scalable approach, where single III-V quantum emitters are positioned and deterministically integrated in a complementary metal-oxide-semiconductor-compatible photonic circuit. We demonstrate reconfigurable on-chip single-photon filtering and wavelength division multiplexing with a foot print one million times smaller than similar table-top approaches, while offering excitation suppression of more than 95 dB and efficient routing of single photons over a bandwidth of 40 nm. Our work marks an important step to harvest quantum optical technologies' full potential.Combining different integration platforms on the same chip is currently one of the main challenges for quantum technologies. Here, Elshaari et al. show III-V Quantum Dots embedded in nanowires operating in a CMOS compatible circuit, with controlled on-chip filtering and tunable routing.

  7. A Multiplex PCR for Simultaneous Detection of Three Zoonotic Parasites Ancylostoma ceylanicum, A. caninum, and Giardia lamblia Assemblage A

    Directory of Open Access Journals (Sweden)

    Wei Hu

    2015-01-01

    Full Text Available Ancylostoma ceylanicum, A. caninum, and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats; they can also infect humans, causing parasitic zoonoses. In this study, a multiplex PCR method was developed for simultaneous identification and detection of those three zoonotic parasites. Three pairs of specific primers were designed based on ITS sequence of A. ceylanicum and A. caninum and TPI gene of G. lamblia available in the GenBank. The multiplex PCR reaction system was established by optimizing the reaction condition, and a series of tests on the sensitivity, specificity, and clinical application were also conducted. Results showed that three target fragments were amplified specifically; the detection limit was 10 eggs for both A. ceylanicum and A. caninum, 72 pg DNA for G. lamblia. Of 112 clinical fecal samples, 34.8% and 17.8% samples were positive for A. caninum and A. ceylanicum, respectively, while only 2.7% samples were positive for G. lamblia assemblage A. It is concluded that the established multiplex PCR assay is a convenient, rapid, cost-effective, and high-efficiency method for molecular detection and epidemiological investigation of three zoonotic parasites.

  8. Multiplex Real-Time qPCR Assay for Simultaneous and Sensitive Detection of Phytoplasmas in Sesame Plants and Insect Vectors.

    Directory of Open Access Journals (Sweden)

    Cengiz Ikten

    Full Text Available Phyllody, a destructive and economically important disease worldwide caused by phytoplasma infections, is characterized by the abnormal development of floral structures into stunted leafy parts and contributes to serious losses in crop plants, including sesame (Sesamum indicum L.. Accurate identification, differentiation, and quantification of phyllody-causing phytoplasmas are essential for effective management of this plant disease and for selection of resistant sesame varieties. In this study, a diagnostic multiplex qPCR assay was developed using TaqMan® chemistry based on detection of the 16S ribosomal RNA gene of phytoplasmas and the 18S ribosomal gene of sesame. Phytoplasma and sesame specific primers and probes labeled with different fluorescent dyes were used for simultaneous amplification of 16SrII and 16SrIX phytoplasmas in a single tube. The multiplex real-time qPCR assay allowed accurate detection, differentiation, and quantification of 16SrII and 16SrIX groups in 109 sesame plant and 92 insect vector samples tested. The assay was found to have a detection sensitivity of 1.8 x 102 and 1.6 x 102 DNA copies for absolute quantification of 16SrII and 16SrIX group phytoplasmas, respectively. Relative quantification was effective and reliable for determination of phyllody phytoplasma DNA amounts normalized to sesame DNA in infected plant tissues. The development of this qPCR assay provides a method for the rapid measurement of infection loads to identify resistance levels of sesame genotypes against phyllody phytoplasma disease.

  9. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  10. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  11. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  12. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  13. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Disentangling mite predator-prey relationships by multiplex PCR.

    Science.gov (United States)

    Pérez-Sayas, Consuelo; Pina, Tatiana; Gómez-Martínez, María A; Camañes, Gemma; Ibáñez-Gual, María V; Jaques, Josep A; Hurtado, Mónica A

    2015-11-01

    Gut content analysis using molecular techniques can help elucidate predator-prey relationships in situations in which other methodologies are not feasible, such as in the case of trophic interactions between minute species such as mites. We designed species-specific primers for a mite community occurring in Spanish citrus orchards comprising two herbivores, the Tetranychidae Tetranychus urticae and Panonychus citri, and six predatory mites belonging to the Phytoseiidae family; these predatory mites are considered to be these herbivores' main biological control agents. These primers were successfully multiplexed in a single PCR to test the range of predators feeding on each of the two prey species. We estimated prey DNA detectability success over time (DS50), which depended on the predator-prey combination and ranged from 0.2 to 18 h. These values were further used to weight prey detection in field samples to disentangle the predatory role played by the most abundant predators (i.e. Euseius stipulatus and Phytoseiulus persimilis). The corrected predation value for E. stipulatus was significantly higher than for P. persimilis. However, because this 1.5-fold difference was less than that observed regarding their sevenfold difference in abundance, we conclude that P. persimilis is the most effective predator in the system; it preyed on tetranychids almost five times more frequently than E. stipulatus did. The present results demonstrate that molecular tools are appropriate to unravel predator-prey interactions in tiny species such as mites, which include important agricultural pests and their predators. © 2015 John Wiley & Sons Ltd.

  15. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  16. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA...

  17. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  18. Multiplex real-time PCR for detection, identification and quantification of 'Candidatus Liberibacter solanacearum' in potato plants with zebra chip.

    Science.gov (United States)

    Li, Wenbin; Abad, Jorge A; French-Monar, Ronald D; Rascoe, John; Wen, Aimin; Gudmestad, Neil C; Secor, Gary A; Lee, Ing-Ming; Duan, Yongping; Levy, Laurene

    2009-07-01

    The new Liberibacter species, 'Candidatus Liberibacter solanacearum' (Lso) recently associated with potato/tomato psyllid-transmitted diseases in tomato and capsicum in New Zealand, was found to be consistently associated with a newly emerging potato zebra chip (ZC) disease in Texas and other southwestern states in the USA. A species-specific primer LsoF was developed for both quantitative real-time PCR (qPCR) and conventional PCR (cPCR) to detect and quantify Lso in infected samples. In multiplex qPCR, a plant cytochrome oxidase (COX)-based probe-primer set was used as a positive internal control for host plants, which could be used to reliably access the DNA extraction quality and to normalize qPCR data for accurate quantification of the bacterial populations in environment samples. Neither the qPCR nor the cPCR using the primer and/or probe sets with LsoF reacted with other Liberibacter species infecting citrus or other potato pathogens. The low detection limit of the multiplex qPCR was about 20 copies of the target 16S rDNA templates per reaction for field samples. Lso was readily detected and quantified in various tissues of ZC-affected potato plants collected from fields in Texas. A thorough but uneven colonization of Lso was revealed in various tissues of potato plants. The highest Lso populations were about 3x10(8) genomes/g tissue in the root, which were 3-order higher than those in the above-ground tissues of potato plants. The Lso bacterial populations were normally distributed across the ZC-affected potato plants collected from fields in Texas, with 60% of ZC-affected potato plants harboring an average Lso population from 10(5) to 10(6) genomes/g tissue, 4% of plants hosting above 10(7) Lso genomes/g tissue, and 8% of plants holding below 10(3) Lso genomes/g tissue. The rapid, sensitive, specific and reliable multiplex qPCR showed its potential to become a powerful tool for early detection and quantification of the new Liberibacter species associated

  19. A novel RT-multiplex PCR for enteroviruses, hepatitis A and E viruses and influenza A virus among infants and children with diarrhea in Vietnam.

    Science.gov (United States)

    Phan, T G; Nguyen, T A; Yan, H; Okitsu, S; Ushijima, H

    2005-06-01

    A novel reverse transcription-multiplex polymerase chain reaction (RT-multiplex PCR) assay that can detect enteroviruses, hepatitis A and E viruses and influenza A virus from various hosts (avian species, human, swine and horse) was developed. The identification of that group of viruses was performed with the mixture of four pairs of published specific primers (F1 and R1, P3 and P4, 2s and 2as, MMU42 and MMU43) for amplifying viral genomes and specifically generated four different amplicon sizes of 440, 267, 146 and 219 bp for enteroviruses, hepatitis A and E viruses and influenza A virus, respectively. A total of 276 fecal specimens (previously screened for rotavirus, adenovirus, norovirus, sapovirus and astrovirus-negative) from infants and children admitted into hospital with acute gastroenteritis in Ho Chi Minh city, Vietnam during October 2002 and September 2003 were collected and further tested for the presence of those viruses by RT-multiplex PCR. Enteroviruses were identified in 27 specimens and this represented 9.8%. No hepatitis A and E viruses and influenza A virus was found among these subjects. The sensitivity and specificity of RT-multiplex PCR were also assessed and demonstrated the strong validation against RT-monoplex PCR. Taken together, the findings clearly indicated that this novel RT-multiplex PCR is a simple and potential assay for rapid, sensitive, specific and cost-effective laboratory diagnosis to investigate molecular epidemiology of acute gastroenteritis caused by enteroviruses, hepatitis A and E viruses and influenza A virus. This report is the first, to our knowledge, detecting these kinds of viruses in diarrheal feces from infants and children in Vietnam.

  20. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

    2010-12-03

    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

  1. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina

    2010-12-01

    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

  2. Validation of the multiplex PCR for identification of Brucella spp.

    Directory of Open Access Journals (Sweden)

    Lívia de Lima Orzil

    2016-05-01

    Full Text Available ABSTRACT: A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008 and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9 of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.

  3. Differentiation of five strains of infectious bursal disease virus: Development of a strain-specific multiplex PCR

    DEFF Research Database (Denmark)

    Kusk, M.; Kabell, Susanne; Jørgensen, Poul Henrik

    2005-01-01

    and histopathology. Since these methods are laborious and have low specificity alternatives are needed. In the present study, we report the development of a strain-specific multiplex RT-PCR technique, which can detect and differentiate between field strains of IBDV and vaccine virus strains including a so-called hot...

  4. A simplified multiplex PCR assay for fast and easy discrimination of globally distributed staphylococcal cassette chromosome mec types in meticillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Ghaznavi-Rad, Ehsanollah; Nor Shamsudin, Mariana; Sekawi, Zamberi; van Belkum, Alex; Neela, Vasanthakumari

    2010-10-01

    A multiplex PCR assay was developed for the identification of major types and subtypes of staphylococcal cassette chromosome mec (SCCmec) in meticillin-resistant Staphylococcus aureus (MRSA) strains. The method uses a novel 9 valent multiplex PCR plus two primer pairs for S. aureus identification and detection of meticillin resistance. All 389 clinical MRSA isolates from Malaysia and 18 European isolates from the Harmony collection harbouring different SCCmec types that we tested were correctly characterized by our PCR assay. SCCmec type III and V were by far the most common types among both hospital- and community-acquired Malaysian MRSA isolates, with an apparent emergence of MRSA harbouring the IVh type.

  5. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  6. Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.

    Science.gov (United States)

    Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing

    2015-06-15

    Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Dispersed single-phase-step Michelson interferometer for Doppler imaging using sunlight.

    Science.gov (United States)

    Wan, Xiaoke; Ge, Jian

    2012-09-15

    A Michelson interferometer is dispersed with a fiber array-fed spectrograph, providing 59 Doppler sensing channels using sunlight in the 510-570 nm wavelength region. The interferometer operates at a single-phase-step mode, which is particularly advantageous in multiplexing and data processing compared to the phase-stepping mode of other interferometer spectrometer instruments. Spectral templates are prepared using a standard solar spectrum and simulated interferometer modulations, such that the correlation function with a measured 1D spectrum determines the Doppler shift. Doppler imaging of a rotating cylinder is demonstrated. The average Doppler sensitivity is ~12 m/s, with some channels reaching ~5 m/s.

  8. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  9. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia

    2012-01-01

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  10. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  11. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  12. Group-specific multiplex PCR detection systems for the identification of flying insect prey.

    Directory of Open Access Journals (Sweden)

    Daniela Sint

    Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.

  13. A multiplex PCR-based method for the detection and early identification of wood rotting fungi in standing trees.

    Science.gov (United States)

    Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M

    2007-11-01

    The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.

  14. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  15. Development and assessment of multiplex high resolution melting assay as a tool for rapid single-tube identification of five Brucella species.

    Science.gov (United States)

    Gopaul, Krishna K; Sells, Jessica; Lee, Robin; Beckstrom-Sternberg, Stephen M; Foster, Jeffrey T; Whatmore, Adrian M

    2014-12-11

    The zoonosis brucellosis causes economically significant reproductive problems in livestock and potentially debilitating disease of humans. Although the causative agent, organisms from the genus Brucella, can be differentiated into a number of species based on phenotypic characteristics, there are also significant differences in genotype that are concordant with individual species. This paper describes the development of a five target multiplex assay to identify five terrestrial Brucella species using real-time polymerase chain reaction (PCR) and subsequent high resolution melt curve analysis. This technology offers a robust and cost effective alternative to previously described hydrolysis-probe Single Nucleotide Polymorphism (SNP)-based species defining assays. Through the use of Brucella whole genome sequencing five species defining SNPs were identified. Individual HRM assays were developed to these target these changes and, following optimisation of primer concentrations, it was possible to multiplex all five assays in a single tube. In a validation exercise using a panel of 135 Brucella strains of terrestrial and marine origin, it was possible to distinguish the five target species from the other species within this panel. The HRM multiplex offers a number of diagnostic advantages over previously described SNP-based typing approaches. Further, and uniquely for HRM, the successful multiplexing of five assays in a single tube allowing differentiation of five Brucella species in the diagnostic laboratory in a cost-effective and timely manner is described. However there are possible limitations to using this platform on DNA extractions direct from clinical material.

  16. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    Science.gov (United States)

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  17. A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

    Science.gov (United States)

    Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

    2011-02-01

    In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    Science.gov (United States)

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  19. High-throughput multiplex real-time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants.

    Science.gov (United States)

    Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N

    2016-05-01

    To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.

  20. Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

    Science.gov (United States)

    del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

    2007-02-01

    Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

  1. Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats.

    Science.gov (United States)

    Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang

    2003-09-01

    A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.

  2. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  3. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  4. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  5. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  6. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    Science.gov (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  7. Identification of genomic differences between Campylobacter jejuni subsp. jejuni and C. jejuni subsp. doylei at the nap locus leads to the development of a C. jejuni subspeciation multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Heath Sekou

    2007-02-01

    Full Text Available Abstract Background The human bacterial pathogen Campylobacter jejuni contains two subspecies: C. jejuni subsp. jejuni (Cjj and C. jejuni subsp. doylei (Cjd. Although Cjd strains are isolated infrequently in many parts of the world, they are obtained primarily from human clinical samples and result in an unusual clinical symptomatology in that, in addition to gastroenteritis, they are associated often with bacteremia. In this study, we describe a novel multiplex PCR method, based on the nitrate reductase (nap locus, that can be used to unambiguously subspeciate C. jejuni isolates. Results Internal and flanking napA and napB primer sets were designed, based on existing C. jejuni and Campylobacter coli genome sequences to create two multiplex PCR primer sets, nap mpx1 and nap mpx2. Genomic DNA from 161 C. jejuni subsp. jejuni (Cjj and 27 C. jejuni subsp. doylei (Cjd strains were amplified with these multiplex primer sets. The Cjd strains could be distinguished clearly from the Cjj strains using either nap mpx1 or mpx2. In addition, combination of either nap multiplex method with an existing lpxA speciation multiplex method resulted in the unambiguous and simultaneous speciation and subspeciation of the thermophilic Campylobacters. The Cjd nap amplicons were also sequenced: all Cjd strains tested contained identical 2761 bp deletions in napA and several Cjd strains contained deletions in napB. Conclusion The nap multiplex PCR primer sets are robust and give a 100% discrimination of C. jejuni subspecies. The ability to rapidly subspeciate C. jejuni as well as speciate thermophilic Campylobacter species, most of which are pathogenic in humans, in a single amplification will be of value to clinical laboratories in strain identification and the determination of the environmental source of campylobacterioses caused by Cjd. Finally, the sequences of the Cjd napA and napB loci suggest that Cjd strains arose from a common ancestor, providing clues as to

  8. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    Directory of Open Access Journals (Sweden)

    Hirohito Ogawa

    Full Text Available Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  9. Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise.

    Science.gov (United States)

    Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N

    2008-06-01

    We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.

  10. Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel

    Science.gov (United States)

    Hindiyeh, Musa; Levy, Virginia; Azar, Roberto; Varsano, Noemi; Regev, Liora; Shalev, Yael; Grossman, Zehava; Mendelson, Ella

    2005-01-01

    The ability to rapidly diagnose influenza virus infections is of the utmost importance in the evaluation of patients with upper respiratory tract infections. It is also important for the influenza surveillance activities performed by national influenza centers. In the present study we modified a multiplex real-time reverse transcriptase PCR (RT-PCR) assay (which uses TaqMan chemistry) and evaluated it for its ability to detect and concomitantly differentiate influenza viruses A and B in 370 patient samples collected during the 2001-2002 influenza season in Israel. The performance of the TaqMan assay was compared to those of a multiplex one-step RT-PCR with gel detection, a shell vial immunofluorescence assay, and virus isolation in tissue culture. The TaqMan assay had an excellent sensitivity for the detection of influenza viruses compared to that of tissue culture. The overall sensitivity and specificity of the TaqMan assay compared to the results of culture were 98.4 and 85.5%, respectively. The sensitivity and specificity of the TaqMan assay for the detection of influenza virus A alone were 100 and 91.1%, respectively. On the other hand, the sensitivity and specificity for the detection of influenza virus B alone were 95.7 and 98.7%, respectively. The rapid turnaround time for the performance of the TaqMan assay (4.5 h) and the relatively low direct cost encourage the routine use of this assay in place of tissue culture. We conclude that the multiplex TaqMan assay is highly suitable for the rapid diagnosis of influenza virus infections both in well-established molecular biology laboratories and in reference clinical laboratories. PMID:15695650

  11. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients

    Directory of Open Access Journals (Sweden)

    Ngo Tat Trung

    2018-02-01

    Conclusion: The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients.

  12. Microfluidic platform for multiplexed detection in single cells and methods thereof

    Science.gov (United States)

    Wu, Meiye; Singh, Anup K.

    2018-05-01

    The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications.

  13. Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays

    Science.gov (United States)

    Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.

    2013-01-01

    Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707

  14. Detection of Mycobacterium chelonae, Mycobacterium abscessus Group, and Mycobacterium fortuitum Complex by a Multiplex Real-Time PCR Directly from Clinical Samples Using the BD MAX System.

    Science.gov (United States)

    Rocchetti, Talita T; Silbert, Suzane; Gostnell, Alicia; Kubasek, Carly; Campos Pignatari, Antonio C; Widen, Raymond

    2017-03-01

    A new multiplex PCR test was designed to detect Mycobacterium chelonae, Mycobacterium abscessus group, and Mycobacterium fortuitum complex on the BD MAX System. A total of 197 clinical samples previously submitted for mycobacterial culture were tested using the new protocol. Samples were first treated with proteinase K, and then each sample was inoculated into the BD MAX Sample Buffer Tube. Extraction and multiplex PCR were performed by the BD MAX System, using the BD MAX ExK TNA-3 extraction kit and BD TNA Master Mix, along with specific in-house designed primers and probes for each target. The limit of detection of each target, as well as specificity, was evaluated. Of 197 clinical samples included in this study, 133 were positive and 60 were negative for mycobacteria by culture, and another 4 negative samples were spiked with M. chelonae ATCC 35752. The new multiplex PCR on the BD MAX had 97% concordant results with culture for M. abscessus group detection, 99% for M. chelonae, and 100% for M. fortuitum complex. The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect M. chelonae, M. abscessus group, and M. fortuitum complex by real-time PCR on an automated sample-in results-out platform. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  15. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  16. Two-temperature LATE-PCR endpoint genotyping

    Directory of Open Access Journals (Sweden)

    Reis Arthur H

    2006-12-01

    Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of

  17. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Evaluation of multiplex ligation-dependent probe amplification analysis versus multiplex polymerase chain reaction assays in the detection of dystrophin gene rearrangements in an Iranian population subset

    Directory of Open Access Journals (Sweden)

    Nayereh Nouri

    2014-01-01

    Full Text Available Background: The Duchenne muscular dystrophy (DMD gene is located in the short arm of the X chromosome (Xp21. It spans 2.4 Mb of the human genomic DNA and is composed of 79 exons. Mutations in the Dystrophin gene result in DMD and Becker muscular dystrophy. In this study, the efficiency of multiplex ligation-dependent probe amplification (MLPA over multiplex polymerase chain reaction (PCR assays in an Iranian population was investigated. Materials and Methods: Multiplex PCR assays and MLPA analysis were carried out in 74 patients affected with DMD. Results: Multiplex PCR detected deletions in 51% of the patients with DMD. MLPA analysis could determine all the deletions detected by the multiplex PCR. Additionally, MLPA was able to identify one more deletion and duplication in patients without detectable mutations by multiplex PCR. Moreover, MLPA precisely determined the exact size of the deletions. Conclusion: Although MLPA analysis is more sensitive for detection of deletions and duplications in the dystrophin gene, multiplex PCR might be used for the initial analysis of the boys affected with DMD in the Iranian population as it was able to detect 95% of the rearrangements in patients with DMD.

  19. Multiplex PCR with minisequencing as an effective high-throughput SNP typing method for formalin-fixed tissue

    DEFF Research Database (Denmark)

    Gilbert, Marcus T P; Sanchez, Juan J; Haselkorn, Tamara

    2007-01-01

    , multiplex PCR with minisequencing (MPMS), on 92 DNA extractions performed on six archival FFPE samples of variable DNA quality, which date between 9 and 25 years old. On the three extracts with highest quality, we found the assay efficiency to be near 100%. However, the efficiency of the lowest quality...... extracts varied significantly. In this study, we demonstrate that although direct measures of DNA concentration in the extracts provide no useful information with regard to subsequent MPMS success, the success of the assay can be determined to some degree a priori, through initial screening of the DNA...... quality using a simple quantitative real-time PCR (qPCR) assay for nuclear DNA, and/or an assay of the maximum PCR amplifiable size of nuclear DNA. MPMS promises to be of significant use in future genetic studies on FFPE material. It provides a streamlined approach for retrieving a large amount of genetic...

  20. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox

  2. Genomic Characterization of Flavobacterium psychrophilum Serotypes and Development of a Multiplex PCR-Based Serotyping Scheme

    Directory of Open Access Journals (Sweden)

    Tatiana Rochat

    2017-09-01

    Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.

  3. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  4. High throughput multiplex real time PCR assay for the simultaneous quantification of DNA and RNA viruses infecting cassava plants

    OpenAIRE

    Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.

    2016-01-01

    Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...

  5. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  6. Multiplexed Molecular Assays for Rapid Rule-Out of Foot-and-Mouth Disease

    Energy Technology Data Exchange (ETDEWEB)

    Lenhoff, R; Naraghi-Arani, P; Thissen, J; Olivas, J; Carillo, C; Chinn, C; Rasmussen, M; Messenger, S; Suer, L; Smith, S M; Tammero, L; Vitalis, E; Slezak, T R; Hullinger, P J; Hindson, B J; Hietala, S; Crossley, B; Mcbride, M

    2007-06-26

    A nucleic acid-based multiplexed assay was developed that combines detection of foot-and-mouth disease virus (FMDV) with rule-out assays for two other foreign animal diseases and four domestic animal diseases that cause vesicular or ulcerative lesions indistinguishable from FMDV infection in cattle, sheep and swine. The FMDV 'look-alike' diagnostic assay panel contains five PCR and twelve reverse transcriptase PCR (RT-PCR) signatures for a total of seventeen simultaneous PCR amplifications for seven diseases plus incorporating four internal assay controls. It was developed and optimized to amplify both DNA and RNA viruses simultaneously in a single tube and employs Luminex{trademark} liquid array technology. Assay development including selection of appropriate controls, a comparison of signature performance in single and multiplex testing against target nucleic acids, as well of limits of detection for each of the individual signatures is presented. While this assay is a prototype and by no means a comprehensive test for FMDV 'look-alike' viruses, an assay of this type is envisioned to have benefit to a laboratory network in routine surveillance and possibly for post-outbreak proof of freedom from foot-and-mouth disease.

  7. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  8. Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

    International Nuclear Information System (INIS)

    Trejos, Sorayda; Barrera, John Fredy; Torroba, Roberto

    2015-01-01

    We present for the first time an optical encrypting–decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome. (paper)

  9. Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

    Science.gov (United States)

    Trejos, Sorayda; Fredy Barrera, John; Torroba, Roberto

    2015-08-01

    We present for the first time an optical encrypting-decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome.

  10. Quantitative Single-letter Sequencing: a method for simultaneously monitoring numerous known allelic variants in single DNA samples

    Directory of Open Access Journals (Sweden)

    Duborjal Hervé

    2008-02-01

    Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized

  11. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V

    DEFF Research Database (Denmark)

    Boye, Kit; Bartels, Mette Damkjær; Andersen, Ina S

    2007-01-01

    A multiplex PCR with four primer-pairs was designed to identify the five main known SCCmec types. A clear and easily discriminated band pattern was obtained for all five types. The SCCmec type was identified for 98% of 312 clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA......). SCCmec type IV was by far the most common SCCmec type among both hospital- and community-acquired MRSA isolates in Denmark....

  12. Application of multiplex PCR for the simultaneous detection of Taenia spp. from domestic dogs in the north of Iran

    Directory of Open Access Journals (Sweden)

    Rahimi M.T.

    2016-09-01

    Full Text Available The family Taeniidae is of great importance in the medical and veterinary fields, particularly in the tropics and subtropics. Identification of eggs of different Taenia spp. in the final host by morphological examination is difficult owing to their similarity. Therefore, a multiplex polymerase chain reaction (PCR targeting a mitochondrial gene was applied to identify morphologically indistinguishable eggs. Fecal samples from 100 domestic dogs, from the Mazandaran province in Iran, were examined using the flotation/sieving method followed by multiplex PCR. Taeniid eggs were observed in 24 % samples, of which 12 %, 10 %, and 2 % were infected with Echinococcus granulosus, Taenia spp., and both E. granulosus and Taenia spp., respectively. E. multilocularis was absent in these samples. The prevalence of E. granulosus in the examined domestic dogs as definitive hosts in north of Iran was high (14 %. Therefore, people living in this region of Iran are in danger of acquiring hydatid cyst, which is a serious public health problem.

  13. Laser Capture Microdissection and Multiplex-Tandem PCR Analysis of Proximal Tubular Epithelial Cell Signaling in Human Kidney Disease

    Science.gov (United States)

    Wilkinson, Ray; Wang, Xiangju; Kassianos, Andrew J.; Zuryn, Steven; Roper, Kathrein E.; Osborne, Andrew; Sampangi, Sandeep; Francis, Leo; Raghunath, Vishwas; Healy, Helen

    2014-01-01

    Interstitial fibrosis, a histological process common to many kidney diseases, is the precursor state to end stage kidney disease, a devastating and costly outcome for the patient and the health system. Fibrosis is historically associated with chronic kidney disease (CKD) but emerging evidence is now linking many forms of acute kidney disease (AKD) with the development of CKD. Indeed, we and others have observed at least some degree of fibrosis in up to 50% of clinically defined cases of AKD. Epithelial cells of the proximal tubule (PTEC) are central in the development of kidney interstitial fibrosis. We combine the novel techniques of laser capture microdissection and multiplex-tandem PCR to identify and quantitate “real time” gene transcription profiles of purified PTEC isolated from human kidney biopsies that describe signaling pathways associated with this pathological fibrotic process. Our results: (i) confirm previous in-vitro and animal model studies; kidney injury molecule-1 is up-regulated in patients with acute tubular injury, inflammation, neutrophil infiltration and a range of chronic disease diagnoses, (ii) provide data to inform treatment; complement component 3 expression correlates with inflammation and acute tubular injury, (iii) identify potential new biomarkers; proline 4-hydroxylase transcription is down-regulated and vimentin is up-regulated across kidney diseases, (iv) describe previously unrecognized feedback mechanisms within PTEC; Smad-3 is down-regulated in many kidney diseases suggesting a possible negative feedback loop for TGF-β in the disease state, whilst tight junction protein-1 is up-regulated in many kidney diseases, suggesting feedback interactions with vimentin expression. These data demonstrate that the combined techniques of laser capture microdissection and multiplex-tandem PCR have the power to study molecular signaling within single cell populations derived from clinically sourced tissue. PMID:24475278

  14. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Multiplexed single-molecule force spectroscopy using a centrifuge.

    Science.gov (United States)

    Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P

    2016-03-17

    We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.

  16. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  17. Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

    Directory of Open Access Journals (Sweden)

    Chang Chieh-Ting

    2008-06-01

    Full Text Available Abstract Background Hemophilia A represents the most common and severe inherited hemorrhagic disorder. It is caused by mutations in the F8 gene, which leads to a deficiency or dysfunctional factor VIII protein, an essential cofactor in the factor X activation complex. Methods We used long-distance polymerase chain reaction and denaturing high performance liquid chromatography for mutation scanning of the F8 gene. We designed the competitive multiplex PCR to identify the carrier with exonal deletions. In order to facilitate throughput and minimize the cost of mutation scanning, we also evaluated a new mutation scanning technique, high resolution melting analysis (HRM, as an alternative screening method. Results We presented the results of detailed screening of 122 Taiwanese families with hemophilia A and reported twenty-nine novel mutations. There was one family identified with whole exons deletion, and the carriers were successfully recognized by multiplex PCR. By HRM, the different melting curve patterns were easily identified in 25 out of 28 cases (89% and 15 out of 15 (100% carriers. The sensitivity was 93 % (40/43. The overall mutation detection rate of hemophilia A was 100% in this study. Conclusion We proposed a diagnostic strategy for hemophilia A genetic diagnosis. We consider HRM as a powerful screening tool that would provide us with a more cost-effective protocol for hemophilia A mutation identification.

  18. Toward photostable multiplex analyte detection on a single mode planar optical waveguide

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini [Los Alamos National Laboratory; Xei, Hongshi [Los Alamos National Laboratory; Anderson, Aaron S [Los Alamos National Laboratory; Grace, Wynne K [Los Alamos National Laboratory; Martinez, Jennifer S [NON LANL; Swanson, Basil [Los Alamos National Laboratory

    2009-01-01

    We have developed a waveguide-based optical biosensor for the sensitive and specific detection of biomarkers associated with disease. Our technology combines the superior optical properties of single-mode planar waveguides, the robust nature of functionalized self-assembled monolayer sensing films and the specificity of fluorescence sandwich immunoassays to detect biomarkers in complex biological samples such as serum, urine and sputum. We have previously reported the adaptation of our technology to the detection of biomarkers associated with breast cancer and anthrax. However, these approaches primarily used phospholipid bilayers as the functional film and organic dyes (ex: AlexaFluors) as the fluorescence reporter. Organic dyes are easily photodegraded and are not amenable to multiplexing because of their narrow Stokes' shift. Here we have developed strategies for conjugation of the detector antibodies with quantum dots for use in a multiplex detection platform. We have previously evaluated dihydroxylipoic acid quantum dots for the detection of a breast cancer biomarker. In this manuscript, we investigate the detection of the Bacillus anthracis protective antigen using antibodies conjugated with polymer-coated quantum dots. Kinetics of binding on the waveguide-based biosensor is reported. We compare the sensitivity of quantum dot labeled antibodies to those labeled with AlexaFluor and demonstrate the photostability of the former in our assay platform. In addition, we compare sulfydryl labeling of the antibody in the hinge region to that of nonspecific amine labeling. This is but the first step in developing a multiplex assay for such biomarkers on our waveguide platform.

  19. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    Science.gov (United States)

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  20. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  1. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    Science.gov (United States)

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  2. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  3. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  4. Determination of foodborne pathogenic bacteria by multiplex PCR-microchip capillary electrophoresis with genetic algorithm-support vector regression optimization.

    Science.gov (United States)

    Li, Yongxin; Li, Yuanqian; Zheng, Bo; Qu, Lingli; Li, Can

    2009-06-08

    A rapid and sensitive method based on microchip capillary electrophoresis with condition optimization of genetic algorithm-support vector regression (GA-SVR) was developed and applied to simultaneous analysis of multiplex PCR products of four foodborne pathogenic bacteria. Four pairs of oligonucleotide primers were designed to exclusively amplify the targeted gene of Vibrio parahemolyticus, Salmonella, Escherichia coli (E. coli) O157:H7, Shigella and the quadruplex PCR parameters were optimized. At the same time, GA-SVR was employed to optimize the separation conditions of DNA fragments in microchip capillary electrophoresis. The proposed method was applied to simultaneously detect the multiplex PCR products of four foodborne pathogenic bacteria under the optimal conditions within 8 min. The levels of detection were as low as 1.2 x 10(2) CFU mL(-1) of Vibrio parahemolyticus, 2.9 x 10(2) CFU mL(-1) of Salmonella, 8.7 x 10(1) CFU mL(-1) of E. coli O157:H7 and 5.2 x 10(1) CFU mL(-1) of Shigella, respectively. The relative standard deviation of migration time was in the range of 0.74-2.09%. The results demonstrated that the good resolution and less analytical time were achieved due to the application of the multivariate strategy. This study offers an efficient alternative to routine foodborne pathogenic bacteria detection in a fast, reliable, and sensitive way.

  5. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

    Science.gov (United States)

    Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

    2014-07-01

    A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

  6. Epidemiological survey on Mycoplasma gallisepticum and M. synoviae by multiplex PCR in commercial poultry Investigação epidemiológica de Mycoplasma gallisepticum e M. synoviae por PCR Multiplex em estabelecimentos comerciais de aves

    Directory of Open Access Journals (Sweden)

    Marcos Roberto Buim

    2009-07-01

    Full Text Available Mycoplasmas are important avian pathogens, which cause respiratory and joint diseases that result in large economic losses in Brazilian and world-wide poultry industry. This investigation regarding the main species of mycoplasmas, Mycoplasma gallisepticum (MG and M. synoviae (MS, responsible for the above mentioned conditions, was carried out through PCR Multiplex analysis. One thousand and forty-six (1,046 samples of tracheal swabs and piped embryos were collected from 33 farms with laying hens, breeders, broilers or hatchery, located in the Brazilian states of São Paulo, Paraná and Pernambuco, where respiratory problems or drops in egg production had occurred. The MG and MS prevalence on the farms was 72.7%. These results indicated (1 high dissemination of mycoplasmas in the evaluated farms, with predominance of MS, either as single infectious agent or associated with other mycoplasmas in 20 farms (60.6%, and (2 an increase of MS and decrease of MG infection in Brazilian commercial poultry.Os Micoplasmas são importantes patógenos aviários que causam doenças respiratórias e de articulações que resultam em grandes perdas econômicas para a indústria avícola brasileira e mundial. O estudo das principais espécies de Mycoplasma, Mycoplasma gallisepticum (MG e M. synoviae (MS, responsáveis pelas doenças mencionadas acima, foram analisadas pela técnica de PCR Multiplex. Foram colhidas 1046 amostras de suabe traqueal e embriões bicados de 33 estabelecimentos de aves de postura, matrizes, frangos de corte e um incubatório, localizados nos Estados brasileiros de São Paulo, Paraná e Pernambuco, as quais apresentavam problemas respiratórios ou queda na produção de ovos. A prevalência de MS e MG nas granjas foi de 72,7%. Os resultados indicaram uma alta disseminação de Mycoplasma nas granjas avaliadas, com predominância de MS, como um único agente infeccioso ou associado com outros micoplasmas em 20 granjas (60,6%. Assim, este

  7. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    Science.gov (United States)

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  9. Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Alireza Talebi

    2011-09-01

    Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.

  10. Multiplex PCR for specific and robust detection of Xanthomonas campestris pv. musacearum in pure culture and infected plant material

    DEFF Research Database (Denmark)

    Adriko, John; Aritua, V.; Mortensen, Carmen Nieves

    2012-01-01

    The present study developed a pathovar-specific PCR for the detection of Xanthomonas campestris pv. musacearum (Xcm), the cause of banana xanthomonas wilt, by amplification of a 265-bp region of the gene encoding the general secretion pathway protein D (GspD). A distinct DNA fragment......-specific PCR was successfully multiplexed with internal control primers targeting 16S rDNA for application on DNA from bacterial cultures and with primers targeting plant mitochondrial 26S rDNA for application on DNA extracted from plant material. Diagnostic discrimination of healthy and infected plants...

  11. Detection of gene copy number aberrations in mantle cell lymphoma by a single quantitative multiplex PCR assay: clinicopathological relevance and prognosis value.

    Science.gov (United States)

    Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé

    2009-09-01

    The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.

  12. Multiplexed Engineering in Biology.

    Science.gov (United States)

    Rogers, Jameson K; Church, George M

    2016-03-01

    Biotechnology is the manufacturing technology of the future. However, engineering biology is complex, and many possible genetic designs must be evaluated to find cells that produce high levels of a desired drug or chemical. Recent advances have enabled the design and construction of billions of genetic variants per day, but evaluation capacity remains limited to thousands of variants per day. Here we evaluate biological engineering through the lens of the design–build–test cycle framework and highlight the role that multiplexing has had in transforming the design and build steps. We describe a multiplexed solution to the ‘test’ step that is enabled by new research. Achieving a multiplexed test step will permit a fully multiplexed engineering cycle and boost the throughput of biobased product development by up to a millionfold.

  13. Novel multiplex PCR reveals multiple trypanosomatid species infecting North American bumble bees (Hymenoptera: Apidae: Bombus).

    Science.gov (United States)

    Tripodi, Amber D; Szalanski, Allen L; Strange, James P

    2018-03-01

    Crithidia bombi and Crithidia expoeki (Trypanosomatidae) are common parasites of bumble bees (Bombus spp.). Crithidia bombi was described in the 1980s, and C. expoeki was recently discovered using molecular tools. Both species have cosmopolitan distributions among their bumble bee hosts, but there have been few bumble bee studies that have identified infections to species since the original description of C. expoeki in 2010. Morphological identification of species is difficult due to variability within each stage of their complex lifecycles, although they can be easily differentiated through DNA sequencing. However, DNA sequencing can be expensive, particularly with many samples to diagnose. In order to reliably and inexpensively distinguish Crithidia species for a large-scale survey, we developed a multiplex PCR protocol using species-specific primers with a universal trypanosomatid primer set to detect unexpected relatives. We applied this method to 356 trypanosomatid-positive bumble bees from North America as a first-look at the distribution and host range of each parasite in the region. Crithidia bombi was more common (90.2%) than C. expoeki (21.3%), with most C. expoeki-positive samples existing as co-infections with C. bombi (13.8%). This two-step detection method also revealed that 2.2% samples were positive for trypanosmatids that were neither C. bombi nor C. expoeki. Sequencing revealed that two individuals were positive for C. mellificae, one for Lotmaria passim, and three for two unclassified trypanosomatids. This two-step method is effective in diagnosing known bumble bee infecting Crithidia species, and allowing for the discovery of unknown potential symbionts. Published by Elsevier Inc.

  14. A Dual Filtration-Based Multiplex PCR Method for Simultaneous Detection of Viable Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus on Fresh-Cut Cantaloupe.

    Directory of Open Access Journals (Sweden)

    Ke Feng

    Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.

  15. The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M. R. Keyhkhaee

    2006-07-01

    Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.

  16. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Trisadee Khamlor

    2014-10-01

    Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  17. A Set of Plastid Loci for Use in Multiplex Fragment Length Genotyping for Intraspecific Variation in Pinus (Pinaceae

    Directory of Open Access Journals (Sweden)

    Austin M. Wofford

    2014-04-01

    Full Text Available Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences ofycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group.

  18. Evaluation of the Roche LightMix Gastro parasites multiplex PCR assay detecting Giardia duodenalis, Entamoeba histolytica, cryptosporidia, Dientamoeba fragilis, and Blastocystis hominis.

    Science.gov (United States)

    Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R

    2018-03-23

    Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Simultaneous detection of four garlic viruses by multiplex reverse transcription PCR and their distribution in Indian garlic accessions.

    Science.gov (United States)

    Majumder, S; Baranwal, V K

    2014-06-01

    Indian garlic is infected with Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), Garlic common latent virus (GarCLV) and allexiviruses. Identity and distribution of garlic viruses in various garlic accessions from different geographical regions of India were investigated. OYDV and allexiviruses were observed in all the garlic accessions, while SLV and GarCLV were observed only in a few accessions. A multiplex reverse transcription (RT)-PCR method was developed for the simultaneous detection and identification of OYDV, SLV, GarCLV and Allexivirus infecting garlic accessions in India. This multiplex protocol standardized in this study will be useful in indexing of garlic viruses and production of virus free seed material. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  1. Interlaboratory comparison of real-time pcr protocols for quantification of general fecal indicator bacteria

    Science.gov (United States)

    Shanks, O.C.; Sivaganesan, M.; Peed, L.; Kelty, C.A.; Blackwood, A.D.; Greene, M.R.; Noble, R.T.; Bushon, R.N.; Stelzer, E.A.; Kinzelman, J.; Anan'Eva, T.; Sinigalliano, C.; Wanless, D.; Griffith, J.; Cao, Y.; Weisberg, S.; Harwood, V.J.; Staley, C.; Oshima, K.H.; Varma, M.; Haugland, R.A.

    2012-01-01

    The application of quantitative real-time PCR (qPCR) technologies for the rapid identification of fecal bacteria in environmental waters is being considered for use as a national water quality metric in the United States. The transition from research tool to a standardized protocol requires information on the reproducibility and sources of variation associated with qPCR methodology across laboratories. This study examines interlaboratory variability in the measurement of enterococci and Bacteroidales concentrations from standardized, spiked, and environmental sources of DNA using the Entero1a and GenBac3 qPCR methods, respectively. Comparisons are based on data generated from eight different research facilities. Special attention was placed on the influence of the DNA isolation step and effect of simplex and multiplex amplification approaches on interlaboratory variability. Results suggest that a crude lysate is sufficient for DNA isolation unless environmental samples contain substances that can inhibit qPCR amplification. No appreciable difference was observed between simplex and multiplex amplification approaches. Overall, interlaboratory variability levels remained low (<10% coefficient of variation) regardless of qPCR protocol. ?? 2011 American Chemical Society.

  2. One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR).

    Science.gov (United States)

    Breunig, Christopher T; Durovic, Tamara; Neuner, Andrea M; Baumann, Valentin; Wiesbeck, Maximilian F; Köferle, Anna; Götz, Magdalena; Ninkovic, Jovica; Stricker, Stefan H

    2018-01-01

    Novel applications based on the bacterial CRISPR system make genetic, genomic, transcriptional and epigenomic engineering widely accessible for the first time. A significant advantage of CRISPR over previous methods is its tremendous adaptability due to its bipartite nature. Cas9 or its engineered variants define the molecular effect, while short gRNAs determine the targeting sites. A majority of CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into single cells, either as an essential precondition, to increase responsive cell populations or to enhance phenotypic outcomes. Despite these requirements, methods allowing the efficient generation and delivery of multiple gRNA expression units into single cells are still sparse. Here we present STAgR (String assembly gRNA cloning), a single step gRNA multiplexing system, that obtains its advantages by employing the N20 targeting sequences as necessary homologies for Gibson assembly. We show that STAgR allows reliable and cost-effective generation of vectors with high numbers of gRNAs enabling multiplexed CRISPR approaches. Moreover, STAgR is easily customizable, as vector backbones as well as gRNA structures, numbers and promoters can be freely chosen and combined. Finally, we demonstrate STAgR's widespread functionality, its efficiency in multi-targeting approaches, using it for both, genome and transcriptome editing, as well as applying it in vitro and in vivo.

  3. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  4. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  5. A simple method for encapsulating single cells in alginate microspheres allows for direct PCR and whole genome amplification.

    Directory of Open Access Journals (Sweden)

    Saharnaz Bigdeli

    Full Text Available Microdroplets are an effective platform for segregating individual cells and amplifying DNA. However, a key challenge is to recover the contents of individual droplets for downstream analysis. This paper offers a method for embedding cells in alginate microspheres and performing multiple serial operations on the isolated cells. Rhodobacter sphaeroides cells were diluted in alginate polymer and sprayed into microdroplets using a fingertip aerosol sprayer. The encapsulated cells were lysed and subjected either to conventional PCR, or whole genome amplification using either multiple displacement amplification (MDA or a two-step PCR protocol. Microscopic examination after PCR showed that the lumen of the occupied microspheres contained fluorescently stained DNA product, but multiple displacement amplification with phi29 produced only a small number of polymerase colonies. The 2-step WGA protocol was successful in generating fluorescent material, and quantitative PCR from DNA extracted from aliquots of microspheres suggested that the copy number inside the microspheres was amplified up to 3 orders of magnitude. Microspheres containing fluorescent material were sorted by a dilution series and screened with a fluorescent plate reader to identify single microspheres. The DNA was extracted from individual isolates, re-amplified with full-length sequencing adapters, and then a single isolate was sequenced using the Illumina MiSeq platform. After filtering the reads, the only sequences that collectively matched a genome in the NCBI nucleotide database belonged to R. sphaeroides. This demonstrated that sequencing-ready DNA could be generated from the contents of a single microsphere without culturing. However, the 2-step WGA strategy showed limitations in terms of low genome coverage and an uneven frequency distribution of reads across the genome. This paper offers a simple method for embedding cells in alginate microspheres and performing PCR on isolated

  6. Wavelength-stepped, actively mode-locked fiber laser based on wavelength-division-multiplexed optical delay lines

    Science.gov (United States)

    Lee, Eunjoo; Kim, Byoung Yoon

    2017-12-01

    We propose a new scheme for an actively mode-locked wavelength-swept fiber laser that produces a train of discretely wavelength-stepped pulses from a short fiber cavity. Pulses with different wavelengths are split and combined by standard wavelength division multiplexers with fiber delay lines. As a proof of concept, we demonstrate a laser using an erbium doped fiber amplifier and commercially available wavelength-division multiplexers with wavelength spacing of 0.8 nm. The results show simultaneous mode-locking at three different wavelengths. Laser output parameters in time domain, optical and radio frequency spectral domain, and the noise characteristics are presented. Suggestions for the improved design are discussed.

  7. A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

    Science.gov (United States)

    Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

    2014-01-01

    • Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

  8. Isolation and identification of Enterococcus faecalis from necrotic root canals using multiplex PCR.

    Science.gov (United States)

    Mahmoudpour, Ali; Rahimi, Saeed; Sina, Mahmood; Soroush, Mohammad H; Shahi, Shahriar; Shahisa, Shahriar; Asl-Aminabadi, Naser

    2007-09-01

    This study was designed to survey the incidence of Enterococcus faecalis infection in symptomatic and asymptomatic root canals of necrotic teeth using PCR and to isolate the bacterium for further screening. Sixty patients categorized according to their clinical symptoms were used for sampling by insertion of paper points into the root canals and absorbing all the fluids present within them. The samples were incubated in 1.0 ml 2xYT (containing 16 g bacto tryptone, 10 g yeast extract and 5.0 g NaCl per liter) for 24 h at 37 degrees C without aeration prior to multiplex PCR analysis. To assist the isolation of E. faecalis, sub-samples were further grown in the same medium supplemented with 6.5% NaCl and back-inoculated into bile esculin. Using multiple cultivation-dependent and PCR analyses, 6 cases (10%) of E. faecalis were identified. Four isolates were obtained from asymptomatic cases of chronic apical periodontitis, and the other two were associated with phoenix abscess and acute apical abscess, respectively. No E. faecalis infection was found in 5 patients with acute apical periodontitis or in 9 with chronic suppurative periodontitis. Our results indicate that there is no significant difference in the incidence of E. faecalis between symptomatic and asymptomatic necrotic dental root canals (P > 0.05).

  9. Multiplex Real-Time PCR Assay Using TaqMan Probes for the Identification of Trypanosoma cruzi DTUs in Biological and Clinical Samples

    Science.gov (United States)

    Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.

    2015-01-01

    Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316

  10. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  11. Novel exon-exon breakpoint in CIC-DUX4 fusion sarcoma identified by anchored multiplex PCR (Archer FusionPlex Sarcoma Panel).

    Science.gov (United States)

    Loke, Benjamin Nathanael; Lee, Victor Kwan Min; Sudhanshi, Jain; Wong, Meng Kang; Kuick, Chik Hong; Puhaindran, Mark; Chang, Kenneth Tou En

    2017-08-01

    We describe the clinical and pathological features and novel genetic findings of a case of CIC-DUX4 sarcoma occurring in the thigh of a 35-year-old man. Fusion gene detection using a next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) was used to identify the novel fusion breakpoints of this CIC-DUX4 sarcoma using formalin-fixed and paraffin-embedded tumour material. This CIC-DUX4 sarcoma has a novel fusion breakpoint between exon 20 of the CIC gene and exon 1 of the DUX4 gene. This case report describes an additional case of CIC-DUX4 sarcoma with a novel fusion breakpoint, and demonstrates the value of this next-generation sequencing-based anchored multiplex PCR technique (Archer FusionPlex Sarcoma Panel) in both diagnosis for patient care and in identification of a novel fusion breakpoint in this tumour type. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  12. Development of a multiplex qPCR in real time for quantification and differential diagnosis of Salmonella Gallinarum and Salmonella Pullorum.

    Science.gov (United States)

    Rubio, Marcela da Silva; Penha Filho, Rafael Antonio Casarin; Almeida, Adriana Maria de; Berchieri, Angelo

    2017-12-01

    Currently there are 2659 Salmonella serovars. The host-specific biovars Salmonella Pullorum and Salmonella Gallinarum cause systemic infections in food-producing and wild birds. Fast diagnosis is crucial to control the dissemination in avian environments. The present work describes the development of a multiplex qPCR in real time using a low-cost DNA dye (SYBr Green) to identify and quantify these biovars. Primers were chosen based on genomic regions of difference (RoD) and optimized to control dimers. Primers pSGP detect both host-specific biovars but not other serovars and pSG and pSP differentiate biovars. Three amplicons showed different melting temperatures (Tm), allowing differentiation. The pSGP amplicon (97 bp) showed Tm of 78°C for both biovars. The pSG amplicon (273 bp) showed a Tm of 86.2°C for S. Gallinarum and pSP amplicon (260 bp) dissociated at 84.8°C for S. Pullorum identification. The multiplex qPCR in real time showed high sensitivity and was capable of quantifying 10 8 -10 1 CFU of these biovars.

  13. Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

    Science.gov (United States)

    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

    2013-08-01

    Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

  14. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  15. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  16. A 50 SNP-multiplex mass spectrometry assay for human identification

    DEFF Research Database (Denmark)

    Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus

    2008-01-01

    We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...

  17. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. A new multiplex real-time TaqMan® PCR for quantification of Mycoplasma hyopneumoniae, M. hyorhinis and M. flocculare: Exploratory epidemiological investigations to research mycoplasmal association in enzootic pneumonia-like lesions in slaughtered pigs.

    Science.gov (United States)

    Fourour, Sarah; Fablet, Christelle; Tocqueville, Véronique; Dorenlor, Virginie; Eono, Florent; Eveno, Eric; Kempf, Isabelle; Marois-Créhan, Corinne

    2018-03-30

    A new multiplex qPCR targeting Mycoplasma (M.) hyopneumoniae, M. hyorhinis and M. flocculare was developed and the relationship between the detection of those mycoplasma species and the extent of gross pneumonia like lesions in slaughtered pigs lungs were investigated. The multiplex qPCR method targets the p102, p37 and fruA genes and has detection limits of 14, 146, and 16 genome equivalents μl -1 for M. hyopneumoniae, M. hyorhinis and M. flocculare, respectively. In all, 671 lungs were collected and analysed, among them 666 were scored for macroscopic pneumonia and categorized according to the extent of the lesions (no or minor lesions, moderate lesions, and extensive lesions). According to results of multiplex qPCR, 59.5% were positive for M. hyopneumoniae, 3.4% for M. hyorhinis and 34.7% for M. flocculare, with on average, 3.1x10 7 , 9.7x10 6 and 5.7x10 6 genome equivalents of mycoplasma ml -1 , respectively. More results showed that no or minor lesions were associated with multiplex qPCR-negative results or qPCR-positive results for M. flocculare. Moderate to extensive lesions were positively correlated with qPCR-positive results for M. hyopneumoniae. Extensive lesions were associated with qPCR-positive results for at least two mycoplasma species (M. hyopneumoniae and M. hyorhinis). The findings also indicated that M. hyopneumoniae and M. hyorhinis significantly increased the odds for a lung to have macroscopic pneumonia. No relationship was found between the extent of lesions and the mycoplasma genome load. This new multiplex qPCR appears to be specific, sufficiently sensitive and repeatable. The validation of this method with field samples guarantees its use for field epidemiological investigations, particularly to gain more insight into the etiology of the porcine respiratory disease complex. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  19. Combination of microbiological culture and multiplex PCR increases the range of vaginal microorganisms identified in cervical cancer patients at high risk for bacterial vaginosis and vaginitis.

    Science.gov (United States)

    Schmidt, Katarzyna; Cybulski, Zefiryn; Roszak, Andrzej; Grabiec, Alicja; Talaga, Zofia; Urbański, Bartosz; Odważna, Joanna; Wojciechowicz, Jacek

    2015-05-01

    Bacterial vaginosis (BV) and vaginitis in cervical cancer patients might becaused by mixed aerobic, anaerobic, and atypical bacteria. Since genital tract infections can be complicated, early and accurate identification of causal pathogens is vital. The purpose of this study was i) to determinate if currently used aerobic culture methods are sufficiently sensitive to identify pathogens that can appear in the cervix of women after cancer treatment; ii) to investigate if molecular methods can improve the diagnostic process of BV and vaginitis, as well as broaden the range of detectable pathogens that would otherwise be difficult to cultivate. A one-year hospital-based study was conducted in 2011/2012. Cervical swabs from 130 patients were examined by microbiological culture and multiplex PCR. Swab samples were positive for 107 and 93 women by microbiological culture and multiplex PCR, respectively The most common bacteria isolated from culture were: Escherichia coli, Enterococcus faecalis, Streptococcus agalactiae, and Staphylococcus aureus, and using the molecular technique were: Gardnerella vaginalis, Bacteroides fragilis, Ureoplasma ureoliticum/parvum, Mobiluncus curtisii and Atopobium vaginae. Multiplex PCR might contribute to the diagnosis of genital tract infections and it broadens the number of detectable microorganisms responsible for BV. Combination of these two methods may become the basis for standardized diagnosis of BV and vaginitis.

  20. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

  1. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  2. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  3. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    Science.gov (United States)

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  4. Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

    Science.gov (United States)

    Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

    2012-11-14

    DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

  5. A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

    Science.gov (United States)

    Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

    2018-04-01

    Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional

  6. Multiplex Nucleic Acid Sequence-Based Amplification for Simultaneous Detection of Several Enteric Viruses in Model Ready-To-Eat Foods†

    Science.gov (United States)

    Jean, Julie; D'Souza, Doris H.; Jaykus, Lee-Ann

    2004-01-01

    Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10−1 reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 100 to 102 reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods. PMID:15528524

  7. Multiplex nucleic acid sequence-based amplification for simultaneous detection of several enteric viruses in model ready-to-eat foods.

    Science.gov (United States)

    Jean, Julie; D'Souza, Doris H; Jaykus, Lee-Ann

    2004-11-01

    Human enteric viruses are currently recognized as one of the most important causes of food-borne disease. Implication of enteric viruses in food-borne outbreaks can be difficult to confirm due to the inadequacy of the detection methods available. In this study, a nucleic acid sequence-based amplification (NASBA) method was developed in a multiplex format for the specific, simultaneous, and rapid detection of epidemiologically relevant human enteric viruses. Three previously reported primer sets were used in a single reaction for the amplification of RNA target fragments of 474, 371, and 165 nucleotides for the detection of hepatitis A virus and genogroup I and genogroup II noroviruses, respectively. Amplicons were detected by agarose gel electrophoresis and confirmed by electrochemiluminescence and Northern hybridization. Endpoint detection sensitivity for the multiplex NASBA assay was approximately 10(-1) reverse transcription-PCR-detectable units (or PFU, as appropriate) per reaction. When representative ready-to-eat foods (deli sliced turkey and lettuce) were inoculated with various concentrations of each virus and processed for virus detection with the multiplex NASBA method, all three human enteric viruses were simultaneously detected at initial inoculum levels of 10(0) to 10(2) reverse transcription-PCR-detectable units (or PFU)/9 cm2 in both food commodities. The multiplex NASBA system provides rapid and simultaneous detection of clinically relevant food-borne viruses in a single reaction tube and may be a promising alternative to reverse transcription-PCR for the detection of viral contamination of foods.

  8. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  9. Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites.

    Science.gov (United States)

    Hamoy, I G; Santos, E J M; Santos, S E B

    2008-01-22

    The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.

  10. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  11. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Science.gov (United States)

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  12. Prevalence of Eimeria spp. in Broilers by Multiplex PCR in the Southern Region of Brazil on Two Hundred and Fifty Farms.

    Science.gov (United States)

    Moraes, Julio Cesar; França, Marciél; Sartor, Amélia Aparecida; Bellato, Valdomiro; de Moura, Anderson Barbosa; de Lourdes Borba Magalhães, Maria; de Souza, Antonio Pereira; Miletti, Luiz Claudio

    2015-06-01

    Parasitic infections caused by Eimeria species are responsible for most economic losses in poultry production. Prevalence studies can adequately assist the design of prophylaxis strategies for disease control. Therefore, stool samples from 251 flocks of broilers from 28 to 48 days old were collected in 21 municipalities in the state of Santa Catarina, Brazil, to detect and examine the prevalence of Eimeria acervulina, Eimeria maxima, Eimeria tenella, Eimeria mitis, Eimeria praecox, Eimeria necatrix, and Eimeria brunetti. The oocysts were recovered and quantified, and the species were identified by a multiplex PCR technique. Amplicons of seven Eimeria species originating from the PCR-positive samples were cloned. Microscopy studies demonstrated that 96% of the farms were positive for the Eimeria. Seven species were identified, as follows: E. maxima (63.7%) and E. acervulina (63.3%) were the most prevalent species, followed by E. tenella (54.6%), E. mitis (38.6%), E. praecox (25.1%), E. necatrix (24.3%), and E. brunetti (13.1%). The average number of species detected per farm was 2.96, and the most common were E. acervulina, E. maxima, and E. tenella (9.16%). The sequencing of the clones confirmed the specificity and effectiveness of multiplex PCR for the identification of seven species of Eimeria, so this tool can be useful in studying circulating species in poultry farms, thereby assisting prophylactic measures against coccidiosis.

  13. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

    DEFF Research Database (Denmark)

    Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S.

    2018-01-01

    Background and aim: Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriace...

  14. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection

    OpenAIRE

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce

    2013-01-01

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...

  15. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  16. Application of multiplex PCR approaches for shark molecular identification: feasibility and applications for fisheries management and conservation in the Eastern Tropical Pacific.

    Science.gov (United States)

    Caballero, S; Cardeñosa, D; Soler, G; Hyde, J

    2012-03-01

    Here we describe the application of new and existing multiplex PCR methodologies for shark species molecular identification. Four multiplex systems (group ID, thresher sharks, hammerhead sharks and miscellaneous shark) were employed with primers previously described and some designed in this study, which allow for species identification after running PCR products through an agarose gel. This system was implemented for samples (bodies and fins) collected from unidentified sharks landed in the port of Buenaventura and from confiscated tissues obtained from illegal fishing around the Malpelo Island Marine Protected Area, Pacific Coast of Colombia. This method has allowed reliable identification, to date, of 407 samples to the genus and/or species levels, most of them (380) identified as the pelagic thresher shark (Alopias pelagicus). Another seven samples were identified as scalloped hammerhead sharks (Sphyrna lewini). This is an easy-to-implement and reliable identification method that could even be used locally to monitor shark captures in the main fishing ports of developed and developing countries. © 2011 Blackwell Publishing Ltd.

  17. Detection of Human Bocavirus DNA by Multiplex PCR Analysis: Postmortem Case Report

    Directory of Open Access Journals (Sweden)

    Nihan Ziyade

    2015-06-01

    Full Text Available Background: Human bocavirus (HBoV is a virus belonging to the Parvoviridae family, which has been newly discovered to be associated with respiratory tract infections in children. There are many reports worldwide on the endemicity of this virus. Since it is relatively new, it is not routinely detected in clinical laboratory investigations. Case Report: We demonstrated that HBoV infection caused the death of a 5-month-old girl with a history of high fever and wheezing. Human bocavirus (HBoV 1/2/3/4 was found in a nasopharyngeal swab, paraffin-embedded lung tissue and stool samples by multiplex PCR methods using postmortem microbiological analysis. Conclusion: This case suggests that lower respiratory tract infections due to HBoV may cause severe and life-threatening diseases. Postmortem microbiology is useful in both clinical and forensic autopsies, and allows a suspected infection to be confirmed. To our knowledge, this report is the first document of a HBoV postmortem case in Turkey.

  18. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    Directory of Open Access Journals (Sweden)

    Neng Chen

    2014-07-01

    Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.

  19. Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

    Science.gov (United States)

    Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

    2017-08-01

    A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Multiplex PCR detection of Cryptosporidium sp, Giardia lamblia and Entamoeba histolytica directly from dried stool samples from Guinea-Bissauan children with diarrhoea.

    Science.gov (United States)

    Mero, Sointu; Kirveskari, Juha; Antikainen, Jenni; Ursing, Johan; Rombo, Lars; Kofoed, Poul-Erik; Kantele, Anu

    2017-09-01

    In developing countries, diarrhoea is the most common cause of death for children under five years of age, with Giardia lamblia, Cryptosporidium and Entamoeba histolytica as the most frequent pathogenic parasites. Traditional microscopy for stool parasites has poor sensitivity and specificity, while new molecular methods may provide more accurate diagnostics. In poor regions with sample storage hampered by uncertain electricity supply, research would benefit from a method capable of analysing dried stools. A real-time multiplex PCR method with internal inhibition control was developed for detecting Giardia lamblia, Cryptosporidium hominis/parvum and Entamoeba histolytica directly from stool specimens. Applicability to dried samples was checked by comparing with fresh ones in a small test material. Finally, the assay was applied to dried specimens collected from Guinea-Bissauan children with diarrhoea. The PCR's analytical sensitivity limit was 0.1 ng/ml for G. lamblia DNA, 0.01 ng/ml for E. histolytica DNA and 0.1 ng/ml for Cryptosporidium sp. In the test material, the assay performed similarly with fresh and dried stools. Of the 52 Guinea-Bissauan samples, local microscopy revealed a parasite in 15%, while PCR detected 62% positive for at least one parasite: 44% of the dried samples had Giardia, 23% Cryptosporidium and 0% E. histolytica. Our new multiplex real-time PCR for protozoa presents a sensitive method applicable to dried samples. As proof of concept, it worked well on stools collected from Guinea-Bissauan children with diarrhoea. It provides an epidemiological tool for analysing dried specimens from regions poor in resources.

  1. madSTORM: a superresolution technique for large-scale multiplexing at single-molecule accuracy

    Science.gov (United States)

    Yi, Jason; Manna, Asit; Barr, Valarie A.; Hong, Jennifer; Neuman, Keir C.; Samelson, Lawrence E.

    2016-01-01

    Investigation of heterogeneous cellular structures using single-molecule localization microscopy has been limited by poorly defined localization accuracy and inadequate multiplexing capacity. Using fluorescent nanodiamonds as fiducial markers, we define and achieve localization precision required for single-molecule accuracy in dSTORM images. Coupled with this advance, our new multiplexing strategy, madSTORM, allows accurate targeting of multiple molecules using sequential binding and elution of fluorescent antibodies. madSTORM is used on an activated T-cell to localize 25 epitopes, 14 of which are on components of the same multimolecular T-cell receptor complex. We obtain an average localization precision of 2.6 nm, alignment error of 2.0 nm, and molecules within structures. Probing the molecular topology of complex signaling cascades and other heterogeneous networks is feasible with madSTORM. PMID:27708141

  2. Development of a novel single tube nested PCR for enhanced detection of cytomegalovirus DNA from dried blood spots.

    Science.gov (United States)

    Atkinson, C; Emery, V C; Griffiths, P D

    2014-02-01

    Newborn screening for congenital cytomegalovirus (CCMV) using dried blood spots (DBS) has been proposed because many developed countries have DBS screening programmes in place for other diseases. The aim of this study was to develop a rapid, single tube nested polymerase chain reaction (PCR) method for enhanced detection of CMV from DBS compared to existing (single target) real time PCRs. The new method was compared with existing real time PCRs for sensitivity and specificity. Overall sensitivity of the single target PCR assays in both asymptomatic and symptomatic infants with laboratory confirmed congenital CMV was 69% (CMV PCR or culture positive before day 21 of life). In contrast, the single tube nested assay had an increased sensitivity of 81% with100% specificity. Overall the assay detected CMV from a DBS equivalent to an original blood sample which contained 500IU/ml. In conclusion this single tube nested methodology allows simultaneous amplification and detection of CMV DNA in 1.5h removing the associated contamination risk of a two step nested PCR. Owing to its increased sensitivity, it has the potential to be used as a screening assay and ultimately allow early identification and intervention for children with congenital CMV. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. A multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at point-of-care

    Energy Technology Data Exchange (ETDEWEB)

    Letant, S E; .Ortiz, J I; Tammero, L; Birch, J M; Derlet, R W; Cohen, S; Manning, D; McBride, M T

    2007-04-11

    We have developed a nucleic acid-based assay that is rapid, sensitive, specific, and can be used for the simultaneous detection of 5 common human respiratory pathogens including influenza A, influenza B, parainfluenza type 1 and 3, respiratory syncytial virus, and adenovirus group B, C, and E. Typically, diagnosis on an un-extracted clinical sample can be provided in less than 3 hours, including sample collection, preparation, and processing, as well as data analysis. Such a multiplexed panel would enable rapid broad-spectrum pathogen testing on nasal swabs, and therefore allow implementation of infection control measures, and timely administration of antiviral therapies. This article presents a summary of the assay performance in terms of sensitivity and specificity. Limits of detection are provided for each targeted respiratory pathogen, and result comparisons are performed on clinical samples, our goal being to compare the sensitivity and specificity of the multiplexed assay to the combination of immunofluorescence and shell vial culture currently implemented at the UCDMC hospital. Overall, the use of the multiplexed RT-PCR assay reduced the rate of false negatives by 4% and reduced the rate of false positives by up to 10%. The assay correctly identified 99.3% of the clinical negatives, 97% of adenovirus, 95% of RSV, 92% of influenza B, and 77% of influenza A without any extraction performed on the clinical samples. The data also showed that extraction will be needed for parainfluenza virus, which was only identified correctly 24% of the time on un-extracted samples.

  4. Development of a multiplex real-time PCR for the simultaneous detection of herpes simplex and varicella zoster viruses in cerebrospinal fluid and lesion swab specimens.

    Science.gov (United States)

    Wong, Anita A; Pabbaraju, Kanti; Wong, Sallene; Tellier, Raymond

    2016-03-01

    Herpes simplex viruses (HSV) and varicella zoster virus (VZV) can have very similar and wide-ranging clinical presentations. Rapid identification is necessary for timely antiviral therapy, especially with infections involving the central nervous system, neonates, and immunocompromised individuals. Detection of HSV-1, HSV-2 and VZV was combined into one real-time PCR reaction utilizing hydrolysis probes. The assay was validated on the LightCycler(®) (Roche) and Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific Inc.) to detect alphaherpesviruses in cerebral spinal fluid (CSF) and lesion swab specimens, respectively. Validation data on blood and tissue samples are also presented. The multiplex assay showed excellent sensitivity, specificity and reproducibility when compared to two singleplex real-time PCR assays for CSF samples and direct fluorescent antigen/culture for lesion swab samples. Implementation of the multiplex assay has facilitated improved sensitivity and accuracy as well as reduced turn-around-times and costs. The results from a large data set of 16,622 prospective samples tested between August 16, 2012 to February 1, 2014 at the Provincial Laboratory for Public Health (Alberta, Canada) are presented here. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A novel lab-on-chip platform with integrated solid phase PCR and Supercritical Angle Fluorescence (SAF) microlens array for highly sensitive and multiplexed pathogen detection

    DEFF Research Database (Denmark)

    Hung, Tran Quang; Chin, Wai Hoe; Sun, Yi

    2016-01-01

    technology. In this paper, we addressed this challenge by combining the SP-PCR with super critical angle fluorescence (SAF) microlens array embedded in a microchip. We fabricated miniaturized SAF microlens array as part of a microfluidic chamber in thermoplastic material and performed multiplexed SP...

  6. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  7. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Directory of Open Access Journals (Sweden)

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  8. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  9. Development of a qualitative, multiplex real-time PCR kit for screening of genetically modified organisms (GMOs).

    Science.gov (United States)

    Dörries, Hans-Henno; Remus, Ivonne; Grönewald, Astrid; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2010-03-01

    The number of commercially available genetically modified organisms (GMOs) and therefore the diversity of possible target sequences for molecular detection techniques are constantly increasing. As a result, GMO laboratories and the food production industry currently are forced to apply many different methods to reliably test raw material and complex processed food products. Screening methods have become more and more relevant to minimize the analytical effort and to make a preselection for further analysis (e.g., specific identification or quantification of the GMO). A multiplex real-time PCR kit was developed to detect the 35S promoter of the cauliflower mosaic virus, the terminator of the nopaline synthase gene of Agrobacterium tumefaciens, the 35S promoter from the figwort mosaic virus, and the bar gene of the soil bacterium Streptomyces hygroscopicus as the most widely used sequences in GMOs. The kit contains a second assay for the detection of plant-derived DNA to control the quality of the often processed and refined sample material. Additionally, the plant-specific assay comprises a homologous internal amplification control for inhibition control. The determined limits of detection for the five assays were 10 target copies/reaction. No amplification products were observed with DNAs of 26 bacterial species, 25 yeasts, 13 molds, and 41 not genetically modified plants. The specificity of the assays was further demonstrated to be 100% by the specific amplification of DNA derived from reference material from 22 genetically modified crops. The applicability of the kit in routine laboratory use was verified by testing of 50 spiked and unspiked food products. The herein described kit represents a simple and sensitive GMO screening method for the reliable detection of multiple GMO-specific target sequences in a multiplex real-time PCR reaction.

  10. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR.

    Science.gov (United States)

    Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M

    2014-04-01

    Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution

  11. Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

    Science.gov (United States)

    Williams, D Ross; Chanos, Panagiotis

    2012-12-01

    Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

  12. Euratom experience with video surveillance - Single camera and other non-multiplexed

    International Nuclear Information System (INIS)

    Otto, P.; Cozier, T.; Jargeac, B.; Castets, J.P.; Wagner, H.G.; Chare, P.; Roewer, V.

    1991-01-01

    The Euratom Safeguards Directorate (ESD) has been using a number of single camera video systems (Ministar, MIVS, DCS) and non-multiplexed multi-camera systems (Digiquad) for routine safeguards surveillance applications during the last four years. This paper describes aspects of system design and considerations relevant for installation. It reports on system reliability and performance and presents suggestions on future improvements

  13. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  14. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. A two-step real-time PCR assay for quantitation and genotyping of human parvovirus 4.

    Science.gov (United States)

    Väisänen, E; Lahtinen, A; Eis-Hübinger, A M; Lappalainen, M; Hedman, K; Söderlund-Venermo, M

    2014-01-01

    Human parvovirus 4 (PARV4) of the family Parvoviridae was discovered in a plasma sample of a patient with an undiagnosed acute infection in 2005. Currently, three PARV4 genotypes have been identified, however, with an unknown clinical significance. Interestingly, these genotypes seem to differ in epidemiology. In Northern Europe, USA and Asia, genotypes 1 and 2 have been found to occur mainly in persons with a history of injecting drug use or other parenteral exposure. In contrast, genotype 3 appears to be endemic in sub-Saharan Africa, where it infects children and adults without such risk behaviour. In this study, a novel straightforward and cost-efficient molecular assay for both quantitation and genotyping of PARV4 DNA was developed. The two-step method first applies a single-probe pan-PARV4 qPCR for screening and quantitation of this relatively rare virus, and subsequently, only the positive samples undergo a real-time PCR-based multi-probe genotyping. The new qPCR-GT method is highly sensitive and specific regardless of the genotype, and thus being suitable for studying the clinical impact and occurrence of the different PARV4 genotypes. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Development of a multiplex PCR assay for fine-scale population genetic analysis of the Komodo monitor Varanus komodoensis based on 18 polymorphic microsatellite loci.

    Science.gov (United States)

    Ciofi, Claudio; Tzika, Athanasia C; Natali, Chiara; Watts, Phillip C; Sulandari, Sri; Zein, Moch S A; Milinkovitch, Michel C

    2011-05-01

    Multiplex PCR assays for the coamplification of microsatellite loci allow rapid and cost-effective genetic analyses and the production of efficient screening protocols for international breeding programs. We constructed a partial genomic library enriched for di-nucleotide repeats and characterized 14 new microsatellite loci for the Komodo monitor (or Komodo dragon, Varanus komodoensis). Using these novel microsatellites and four previously described loci, we developed multiplex PCR assays that may be loaded on a genetic analyser in three separate panels. We tested the novel set of microsatellites for polymorphism using 69 individuals from three island populations and evaluated the resolving power of the entire panel of 18 loci by conducting (i) a preliminary assignment test to determine population(s) of origin and (ii) a parentage analysis for 43 captive Komodo monitors. This panel of polymorphic loci proved useful for both purposes and thus can be exploited for fine-scale population genetic analyses and as part of international captive breeding programs directed at maintaining genetically viable ex situ populations and reintroductions. © 2011 Blackwell Publishing Ltd.

  17. A multiplex, internally controlled real-time PCR assay for detection of toxigenic Clostridium difficile and identification of hypervirulent strain 027/ST-1

    DEFF Research Database (Denmark)

    Hoegh, A M; Nielsen, J B; Lester, A

    2012-01-01

    The purpose of this study was to validate a multiplex real-time PCR assay capable of detecting toxigenic Clostridium difficile and simultaneously identifying C. difficile ribotype 027/ST-1 by targeting the toxin genes tcdA, tcdB and cdtA in one reaction and in a separate reaction identifying the Δ...... to confirm the correct identification of the Δ117 deletion in tcdC and C. difficile ribotype 027/ST-1, respectively. The PCR assay displayed a sensitivity, specificity, PPV and NPV of 99.0%, 97.4%, 87.4% and 99.8%, respectively, compared to toxigenic culture on 665 samples evaluable both by PCR and culture....... Sequencing of tcdC, ribotyping and MLST of cultured isolates validated the genotyping assay and confirmed the ability of the assay to correctly identify C. difficile ribotype 027/ST-1 in our current epidemiological setting. We describe the use of a combination of two separate PCR assays for sensitive...

  18. Considering dominance in reduced single-step genomic evaluations.

    Science.gov (United States)

    Ertl, J; Edel, C; Pimentel, E C G; Emmerling, R; Götz, K-U

    2018-06-01

    Single-step models including dominance can be an enormous computational task and can even be prohibitive for practical application. In this study, we try to answer the question whether a reduced single-step model is able to estimate breeding values of bulls and breeding values, dominance deviations and total genetic values of cows with acceptable quality. Genetic values and phenotypes were simulated (500 repetitions) for a small Fleckvieh pedigree consisting of 371 bulls (180 thereof genotyped) and 553 cows (40 thereof genotyped). This pedigree was virtually extended for 2,407 non-genotyped daughters. Genetic values were estimated with the single-step model and with different reduced single-step models. Including more relatives of genotyped cows in the reduced single-step model resulted in a better agreement of results with the single-step model. Accuracies of genetic values were largest with single-step and smallest with reduced single-step when only the cows genotyped were modelled. The results indicate that a reduced single-step model is suitable to estimate breeding values of bulls and breeding values, dominance deviations and total genetic values of cows with acceptable quality. © 2018 Blackwell Verlag GmbH.

  19. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  20. Polarization-multiplexing ghost imaging

    Science.gov (United States)

    Dongfeng, Shi; Jiamin, Zhang; Jian, Huang; Yingjian, Wang; Kee, Yuan; Kaifa, Cao; Chenbo, Xie; Dong, Liu; Wenyue, Zhu

    2018-03-01

    A novel technique for polarization-multiplexing ghost imaging is proposed to simultaneously obtain multiple polarimetric information by a single detector. Here, polarization-division multiplexing speckles are employed for object illumination. The light reflected from the objects is detected by a single-pixel detector. An iterative reconstruction method is used to restore the fused image containing the different polarimetric information by using the weighted sum of the multiplexed speckles based on the correlation coefficients obtained from the detected intensities. Next, clear images of the different polarimetric information are recovered by demultiplexing the fused image. The results clearly demonstrate that the proposed method is effective.

  1. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  2. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers

    OpenAIRE

    Girardot, Charles; Scholtalbers, Jelle; Sauer, Sajoscha; Su, Shu-Yi; Furlong, Eileen E.M.

    2016-01-01

    Background The yield obtained from next generation sequencers has increased almost exponentially in recent years, making sample multiplexing common practice. While barcodes (known sequences of fixed length) primarily encode the sample identity of sequenced DNA fragments, barcodes made of random sequences (Unique Molecular Identifier or UMIs) are often used to distinguish between PCR duplicates and transcript abundance in, for example, single-cell RNA sequencing (scRNA-seq). In paired-end sequ...

  3. Estimating trematode prevalence in snail hosts using a single-step duplex PCR: how badly does cercarial shedding underestimate infection rates?

    Czech Academy of Sciences Publication Activity Database

    Born-Torrijos, A.; Poulin, R.; Raga, J. A.; Holzer, Astrid S.

    2014-01-01

    Roč. 7, MAY 2014 (2014), s. 243 ISSN 1756-3305 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : prevalence * detection * snail host * double infection * single-steo duplex PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.430, year: 2014

  4. Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome.

    Science.gov (United States)

    Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette

    2009-06-01

    Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.

  5. Multiplex PCR in determination of Opiinae parasitoids of fruit flies, Bactrocera sp., infesting star fruit and guava.

    Science.gov (United States)

    Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S

    2014-01-23

    Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an

  6. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  7. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  8. A novel, multiplexed, probe-based quantitative PCR assay for the soybean root- and stem-rot pathogen, Phytophthora sojae, utilizes its transposable element.

    Science.gov (United States)

    Haudenshield, James S; Song, Jeong Y; Hartman, Glen L

    2017-01-01

    Phytophthora root rot of soybean [Glycine max (L.) Merr.] is caused by the oomycete Phytophthora sojae (Kaufm. & Gerd.). P. sojae has a narrow host range, consisting primarily of soybean, and it is a serious pathogen worldwide. It exists in root and stem tissues as mycelium, wherein it can form oospores which subsequently germinate to release motile, infectious zoospores. Molecular assays detecting DNA of P. sojae are useful in disease diagnostics, and for determining the presence of the organism in host tissues, soils, and runoff or ponded water from potentially infested fields. Such assays as published have utilized ITS sequences from the nuclear ribosomal RNA genes in conventional PCR or dye-binding quantitative PCR (Q-PCR) but are not amenable to multiplexing, and some of these assays did not utilize control strategies for type I or type II errors. In this study, we describe primers and a bifunctional probe with specificity to a gypsy-like retroelement in the P. sojae genome to create a fluorogenic 5'-exonuclease linear hydrolysis assay, with a multiplexed internal control reaction detecting an exogenous target to validate negative calls, and with uracil-deglycosylase-mediated protection against carryover contamination. The assay specifically detected 13 different P. sojae isolates, and excluded 17 other Phytophthora species along with 20 non-Phytophthora fungal and oomycete species pathogenic on soybean. A diagnostic limit of detection of 34 fg total P. sojae DNA was observed in serial dilutions, equivalent to 0.3 genome, and a practical detection sensitivity of four zoospores per sample was achieved, despite losses during DNA extraction.

  9. Microarray multiplex assay for the simultaneous detection and discrimination of hepatitis B, hepatitis C, and human immunodeficiency type-1 viruses in human blood samples

    International Nuclear Information System (INIS)

    Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.; Selvapandiyan, Angamuthu; Hewlett, Indira; Duncan, Robert; Puri, Raj K.; Nakhasi, Hira L.; Kaplan, Gerardo G.

    2007-01-01

    Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminated the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients

  10. High-Throughput, Multiplex Genotyping Directly from Blood or Dried Blood Spot without DNA Extraction for the Screening of Multiple G6PD Gene Variants at Risk for Drug-Induced Hemolysis.

    Science.gov (United States)

    Tian, Xiaoyi; Zhou, Jun; Zhao, Ye; Cheng, Zhibin; Song, Wenqi; Sun, Yu; Sun, Xiaodong; Zheng, Zhi

    2017-09-01

    Clinical or epidemiologic screening of single-nucleotide polymorphism markers requires large-scale multiplexed genotyping. Available genotyping tools require DNA extraction and multiplex PCR, which may limit throughput and suffer amplification bias. Herein, a novel genotyping approach has been developed, multiplex extension and ligation-based probe amplification (MELPA), which eliminates DNA extraction and achieves uniform PCR amplification. MELPA lyses blood or dried blood spot and directly captures specific target DNA to 96-well plates using tailed probes. Subsequent enzymatic extension and ligation form target single-nucleotide polymorphism-spanning single-stranded templates, which are PCR-amplified using universal primers. Multiplexed genotyping by single-base primer extension is analyzed by mass spectrometry, with a call rate >97%. MELPA was compared with a commercial assay (iPLEX) for detecting 24 G6PD variants known to be at risk for primaquine-induced hemolysis. MELPA provided results that were more reliable than iPLEX, with higher throughput and lower cost. Genotyping archival blood from 106 malaria patients taking primaquine found 10 G6PD-deficient variants, including 1 patient with a hemizygous Mahidol mutation who had hemolysis. Preemptive G6PD genotyping of 438 dried blood spots from a malaria-endemic area identified three variants. MELPA also enabled pooled genotyping without diluting rare alleles, in which undesired common-allele background increased by sample pooling can be repressed by adding specific common allele blockers. Thus, MELPA represents a high-throughput, cost-effective approach to targeted genotyping at the population level. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  11. Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay

    Directory of Open Access Journals (Sweden)

    Dabisch-Ruthe Mareike

    2012-07-01

    Full Text Available Abstract Background A broad spectrum of pathogens is causative for respiratory tract infections, but symptoms are mostly similar. Therefore, the identification of the causative viruses and bacteria is only feasible using multiplex PCR or several monoplex PCR tests in parallel. Methods The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP, were compared to monoplex real-time PCR with quantified standardized control material. All assays include the most common respiratory pathogens. Results To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 101 to 105 copies/ml. Concordant results were received for rhinovirus, whereas the RVP detected influenzavirus, RSV and hMPV more frequently in low concentrations. The RespiFinder-19 and the RespiFinder-SMART-22 showed a higher analytical sensitivity for adenoviruses and coronaviruses, whereas the RVP was incapable to detect adenovirus and coronavirus in concentrations of 104 copies/ml. The RespiFinder-19 and RespiFinder-SMART-22A did not detect influenzaviruses (104 copies/ml and RSV (103 copies/ml. The detection of all 13 viruses in one sample was only achieved using monoplex PCR. To analyze possible competitive amplification reactions between the different viruses, samples were further inoculated with only 4 different viruses in one sample. Compared to the detection of 13 viruses in parallel, only a few differences were found. The incidence of respiratory viruses was compared in tracheal secretion (TS samples (n = 100 of mechanically ventilated patients in winter (n = 50 and summer (n = 50. In winter, respiratory viruses were detected in 32 TS samples (64% by RespiFinder-19, whereas the detection rate with RVP was only 22%. The most frequent viruses were adenovirus (32% and PIV-2 (20%. Multiple infections were detected

  12. Synthetic internal control sequences to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

    Science.gov (United States)

    Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...

  13. A novel multiplex PCR-RFLP method for simultaneous detection of the MTHFR 677 C > T, eNOS +894 G > T and - eNOS -786 T > C variants among Malaysian Malays

    Directory of Open Access Journals (Sweden)

    Loo Keat

    2012-05-01

    Full Text Available Abstract Background Hyperhomocysteinemia as a consequence of the MTHFR 677 C > T variant is associated with cardiovascular disease and stroke. Another factor that can potentially contribute to these disorders is a depleted nitric oxide level, which can be due to the presence of eNOS +894 G > T and eNOS −786 T > C variants that make an individual more susceptible to endothelial dysfunction. A number of genotyping methods have been developed to investigate these variants. However, simultaneous detection methods using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis are still lacking. In this study, a novel multiplex PCR-RFLP method for the simultaneous detection of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants was developed. A total of 114 healthy Malay subjects were recruited. The MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants were genotyped using the novel multiplex PCR-RFLP and confirmed by DNA sequencing as well as snpBLAST. Allele frequencies of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C were calculated using the Hardy Weinberg equation. Methods The 114 healthy volunteers were recruited for this study, and their DNA was extracted. Primer pair was designed using Primer 3 Software version 0.4.0 and validated against the BLAST database. The primer specificity, functionality and annealing temperature were tested using uniplex PCR methods that were later combined into a single multiplex PCR. Restriction Fragment Length Polymorphism (RFLP was performed in three separate tubes followed by agarose gel electrophoresis. PCR product residual was purified and sent for DNA sequencing. Results The allele frequencies for MTHFR 677 C > T were 0.89 (C allele and 0.11 (T allele; for eNOS +894 G > T, the allele frequencies were 0.58 (G allele and 0.43 (T allele; and for eNOS −786 T > C, the allele

  14. Evaluation of a single-tube fluorogenic RT-PCR assay for detection of bovine respiratory syncytial virus in clinical samples

    DEFF Research Database (Denmark)

    Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik

    2005-01-01

    understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...

  15. Comparison study on mechanical properties single step and three step artificial aging on duralium

    Science.gov (United States)

    Tsamroh, Dewi Izzatus; Puspitasari, Poppy; Andoko, Sasongko, M. Ilman N.; Yazirin, Cepi

    2017-09-01

    Duralium is kind of non-ferro alloy that used widely in industrial. That caused its properties such as mild, high ductility, and resistance from corrosion. This study aimed to know mechanical properties of duralium on single step and three step articial aging process. Mechanical properties that discussed in this study focused on toughness value, tensile strength, and microstructure of duralium. Toughness value of single step artificial aging was 0.082 joule/mm2, and toughness value of three step artificial aging was 0,0721 joule/mm2. Duralium tensile strength of single step artificial aging was 32.36 kgf/mm^2, and duralium tensile strength of three step artificial aging was 32,70 kgf/mm^2. Based on microstructure photo of duralium of single step artificial aging showed that precipitate (θ) was not spreading evenly indicated by black spot which increasing the toughness of material. While microstructure photo of duralium that treated by three step artificial aging showed that it had more precipitate (θ) spread evenly compared with duralium that treated by single step artificial aging.

  16. Virology: The Next Generation from Digital PCR to Single Virion Genomics

    Energy Technology Data Exchange (ETDEWEB)

    White, Richard A.; Brazelton De Cardenas, Jessica N.; Hayden, Randall T.

    2015-10-01

    In the past 25 years, virology has had major technology breakthroughs stemming first from the introduction of nucleic acid amplification testing, but more recently from the use of next-generation sequencing, digital PCR, and the possibility of single virion genomics. These technologies have and will improve diagnosis and disease state monitoring in clinical settings, aid in environmental monitoring, and reveal the vast genetic potential of viruses. Using the principle of limiting dilution, digital PCR amplifies single molecules of DNA in highly partitioned endpoint reactions and reads each of those reactions as either positive or negative based on the presence or absence of target fluorophore. In this review, digital PCR will be highlighted along with current studies, advantages/disadvantages, and future perspectives with regard to digital PCR, viral load testing, and the possibility of single virion genomics.

  17. Evidence of presence of Mycobacterium tuberculosis in bovine tissue samples by multiplex PCR: possible relevance to reverse zoonosis.

    Science.gov (United States)

    Mittal, M; Chakravarti, S; Sharma, V; Sanjeeth, B S; Churamani, C P; Kanwar, N S

    2014-04-01

    Bovine tuberculosis, caused by Mycobacterium bovis, remains one of the most important zoonotic health concerns worldwide. The transmission of Mycobacterium tuberculosis from humans to animals also occurs especially in countries where there is close interaction of humans with the animals. In the present study, thirty bovine lung tissue autopsy samples from an organized dairy farm located in North India were screened for the presence of Mycobacterium tuberculosis complex by smear microscopy, histopathological findings and PCR. Differential diagnosis of M. tuberculosis and M. bovis was made based on the deletion of mce-3 operon in M. bovis. The present study found eight of these samples positive for M. tuberculosis by multiplex PCR. Sequencing was performed on two PCR-positive representative samples and on annotation, and BLAST analysis confirmed the presence of gene fragment specific to Mycobacterium tuberculosis. The presence of M. tuberculosis in all the positive samples raises the possibility of human-to-cattle transmission and possible adaptation of this organism in bovine tissues. This study accentuates the importance of screening and differential diagnosis of Mycobacterium tuberculosis complex in humans and livestock for adopting effective TB control and eradication programmes. © 2014 Blackwell Verlag GmbH.

  18. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM) analysis.

    Science.gov (United States)

    Hanson, Erin K; Ballantyne, Jack

    2013-01-01

    Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA) profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE) or quantitative RT-PCR (qRT-PCR) platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM) assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions), IL1F7 (skin), ALAS2 (blood), MMP10 (menstrual blood), HTN3 (saliva) and TGM4 (semen).  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green). Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively inexpensive

  19. A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

    Science.gov (United States)

    Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

    2016-01-01

    To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

  20. Aplicación de las pruebas de PCR convencional simple y múltiple para la identificación de aislamientos de Leptospira spp. en Colombia Application of conventional and multiplex PCR assays for identification of isolates of Leptospira spp. in Colombia

    Directory of Open Access Journals (Sweden)

    Natali Moreno

    2010-12-01

    and multiplex PCR methods (using primers directed against lipl32 and secY/flaB genes, respectively. To assess the capacity of PCR methods to identify pathogenic and saprophytic species of Leptospira ssp. Material and methods. 22 international reference strains and 12 colombian isolates were used. DNA was extracted with a commercial kit (Wizard. Specificity and sensitivity of both PCR methods were evaluated. Results. The maximum dilution of DNA samples allowing the detection of Leptospira ssp was determined to be 1:10000 for the PCR lipL32 and 1:100/1:1000 for the multiplex PCR secY/flaB. Both PCR didn’t detect DNA from microorganisms unrelated to Leptospira ssp. The lipL32 PCR specifically amplified a 423bp fragment from all pathogenic Leptospira reference strains, while the secY/flaB PCR amplified both 285bp (secY and 793bp (flaB fragments from 18 reference strains. The lipL32 PCR detected 7/12 colombian isolates, while secY/flaB PCR detected both secY and flaB genes from 6/12 isolates. Conclusions. Best results were obtained with the lipL32 PCR, which displayed a better sensitivity and a better capacity to detect different strains than the multiplex PCR. The secY primers showed a poor specificity to pathogenic species and a poor sensitivity. Thus, lipL32 primers show high potential for molecular diagnosis of Leptospira spp in clinical and environmental samples.

  1. Multiplexing Superconducting Qubit Circuit for Single Microwave Photon Generation

    Science.gov (United States)

    George, R. E.; Senior, J.; Saira, O.-P.; Pekola, J. P.; de Graaf, S. E.; Lindström, T.; Pashkin, Yu A.

    2017-10-01

    We report on a device that integrates eight superconducting transmon qubits in λ /4 superconducting coplanar waveguide resonators fed from a common feedline. Using this multiplexing architecture, each resonator and qubit can be addressed individually, thus reducing the required hardware resources and allowing their individual characterisation by spectroscopic methods. The measured device parameters agree with the designed values, and the resonators and qubits exhibit excellent coherence properties and strong coupling, with the qubit relaxation rate dominated by the Purcell effect when brought in resonance with the resonator. Our analysis shows that the circuit is suitable for generation of single microwave photons on demand with an efficiency exceeding 80%.

  2. Pulse patterning effect in optical pulse division multiplexing for flexible single wavelength multiple access optical network

    Science.gov (United States)

    Jung, Sun-Young; Kim, Chang-Hun; Han, Sang-Kook

    2018-05-01

    A demand for high spectral efficiency requires multiple access within a single wavelength, but the uplink signals are significantly degraded because of optical beat interference (OBI) in intensity modulation/direct detection system. An optical pulse division multiplexing (OPDM) technique was proposed that could effectively reduce the OBI via a simple method as long as near-orthogonality is satisfied, but the condition was strict, and thus, the number of multiplexing units was very limited. We propose pulse pattern enhanced OPDM (e-OPDM) to reduce the OBI and improve the flexibility in multiple access within a single wavelength. The performance of the e-OPDM and patterning effect are experimentally verified after 23-km single mode fiber transmission. By employing pulse patterning in OPDM, the tight requirement was relaxed by extending the optical delay dynamic range. This could support more number of access with reduced OBI, which could eventually enhance a multiple access function.

  3. MeltMan: Optimization, Evaluation, and Universal Application of a qPCR System Integrating the TaqMan qPCR and Melting Analysis into a Single Assay

    Science.gov (United States)

    Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina

    2016-01-01

    In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831

  4. Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

    Science.gov (United States)

    Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

    2017-06-01

    Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    Science.gov (United States)

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  6. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  7. Development of the Multiple Gene Knockout System with One-Step PCR in Thermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    Directory of Open Access Journals (Sweden)

    Shoji Suzuki

    2017-01-01

    Full Text Available Multiple gene knockout systems developed in the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius are powerful genetic tools. However, plasmid construction typically requires several steps. Alternatively, PCR tailing for high-throughput gene disruption was also developed in S. acidocaldarius, but repeated gene knockout based on PCR tailing has been limited due to lack of a genetic marker system. In this study, we demonstrated efficient homologous recombination frequency (2.8 × 104 ± 6.9 × 103 colonies/μg DNA by optimizing the transformation conditions. This optimized protocol allowed to develop reliable gene knockout via double crossover using short homologous arms and to establish the multiple gene knockout system with one-step PCR (MONSTER. In the MONSTER, a multiple gene knockout cassette was simply and rapidly constructed by one-step PCR without plasmid construction, and the PCR product can be immediately used for target gene deletion. As an example of the applications of this strategy, we successfully made a DNA photolyase- (phr- and arginine decarboxylase- (argD- deficient strain of S. acidocaldarius. In addition, an agmatine selection system consisting of an agmatine-auxotrophic strain and argD marker was also established. The MONSTER provides an alternative strategy that enables the very simple construction of multiple gene knockout cassettes for genetic studies in S. acidocaldarius.

  8. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells

    Directory of Open Access Journals (Sweden)

    Spyros Darmanis

    2016-01-01

    Full Text Available Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell’s phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment.

  9. Simultaneous Multiplexed Measurement of RNA and Proteins in Single Cells.

    Science.gov (United States)

    Darmanis, Spyros; Gallant, Caroline Julie; Marinescu, Voichita Dana; Niklasson, Mia; Segerman, Anna; Flamourakis, Georgios; Fredriksson, Simon; Assarsson, Erika; Lundberg, Martin; Nelander, Sven; Westermark, Bengt; Landegren, Ulf

    2016-01-12

    Significant advances have been made in methods to analyze genomes and transcriptomes of single cells, but to fully define cell states, proteins must also be accessed as central actors defining a cell's phenotype. Methods currently used to analyze endogenous protein expression in single cells are limited in specificity, throughput, or multiplex capability. Here, we present an approach to simultaneously and specifically interrogate large sets of protein and RNA targets in lysates from individual cells, enabling investigations of cell functions and responses. We applied our method to investigate the effects of BMP4, an experimental therapeutic agent, on early-passage glioblastoma cell cultures. We uncovered significant heterogeneity in responses to treatment at levels of RNA and protein, with a subset of cells reacting in a distinct manner to BMP4. Moreover, we found overall poor correlation between protein and RNA at the level of single cells, with proteins more accurately defining responses to treatment. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Multiplex PCR Study of Plasmid-Mediated AmpC Beta-Lactamases Genes in Clinical Isolates of Escherichia coli

    Directory of Open Access Journals (Sweden)

    Maryam Dehghani

    2017-02-01

    Full Text Available Background:   AmpC β-lactamases are important cephalosporinases chromosomally encoded in many of Enterobacteriaceae and a few other organisms where they mediate resistance to cephalothin, cefazolin, cefoxitin and penicillins. The six different families of plasmid-mediated AmpC β-lactamases have been described, but no phenotypic test can discriminate among them. AmpC multiplex PCR has been successfully used to discriminate plasmid-mediated ampC specific families in organisms such as Klebsiella pneumonia and Escherichia coli. The aim of this study was to indicate the prevalence of AmpC β-lactamase genes by specifically designed primers through PCR test.Methods:   243 total clinical urine samples were collected, and 227 isolates were identified as Escherichia coli based on standard biochemical tests. Subsequently, the isolates were screened by disc diffusion and combined disc test for β-lactamase production. Resistant isolates were evaluated by PCR for ampC family determination. Results:  Antibiotic resistance pattern were observed as follows: cefepime (%25, ceftazidime (%31, ceftriaxone (%37, cefotaxime (%38. The ratio of isolates was detected as ESBLs and AmpC producers were 34% and 5.2%, respectively. PCR performed on 12 selected isolates via phenotypic tests and the results revealed that among 12 isolates, 11 contained blaCMY-42. Conclusion:  Unfortunately, antibiotic resistance has become an increasingly critical problem in many countries like Iran and occurrence of isolates co-expressing AmpC-β-lactamases and ESBLs can create serious problems in the future. As antibiotic options in the treatment of AmpC β-lactamases and ESBLs producing organisms are extremely limited, molecular screening by laboratories is suggested to reduce the risk of therapeutic defeat.

  11. Multiplex PCR assay discriminates rabbit, rat and squirrel meat in food chain.

    Science.gov (United States)

    Ahamad, Mohammad Nasir Uddin; Ali, Md Eaqub; Hossain, M A Motalib; Asing, Asing; Sultana, Sharmin; Jahurul, M H A

    2017-12-01

    Rabbit meat is receiving increasing attention because it contains a high level of proteins with relatively little fat. On the other hand, squirrel meat is served in upper-class meals in certain countries, so is sold at higher prices. The other side of the coin is rat meat, which has family ties with rabbit and squirrel but poses substantial threats to public health because it is a potential carrier of several zoonotic organisms. Recently, rat meat was mislabelled and sold as lamb after chemical modification. Thus, the chances of rabbit and squirrel meat substitution by rat meat cannot be ruled out. For the first time, a multiplex PCR assay was developed in Malaysia for the discriminatory identification of rat, rabbit and squirrel in the food chain. Rabbit (123 bp), rat (108 bp) and squirrel (243 bp) targets were amplified from ATP6 and cytb genes, along with a eukaryotic internal control (141bp). The products were sequenced and cross-tested against 22 species. A total of 81 reference samples and 72 meatball specimens were screened to validate the assay. Analyte stability was evaluated through boiling, autoclaving and micro-oven cooking. The tested lower limits of detection were 0.01 ng DNA for pure meat and 0.1% for meatballs.

  12. Simulation Performance of Multiple-Input Multiple-Output Systems Employing Single-Carrier Modulation and Orthogonal Frequency Division Multiplexing

    National Research Council Canada - National Science Library

    Saglam, Halil D

    2004-01-01

    ...) systems utilizing Alamouti-based space-time block coding (STBC) technique. The MIMO communication systems using STBC technique employing both single-carrier modulation and orthogonal frequency division multiplexing (OFDM...

  13. Evaluation of Palm PCRTM G1-12 System: a portable battery-operated PCR thermal cycler

    Directory of Open Access Journals (Sweden)

    Siti Aminah Ahmed

    2016-08-01

    Full Text Available Polymerase chain reaction (PCR is the basis of recombinant and other molecular biological techniques. Availability of cheap and robust PCR platforms enables the tests to be performed easily, even in resource constrained settings. Herein we compared the efficacy of a portable thermal cycler ( Palm PCRTM G1-12 System for rapid DNA amplification against the standard Peltier-based thermal cycler using plasmid DNA and genomic DNA in single and multiplex PCR experiments. Our study revealed that the Palm PCRTM G1-12 System could be a portable DNA amplification system to conduct various molecular techniques, especially in places where resources are limited.

  14. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  15. Frequency-multiplexed bias and readout of a 16-pixel superconducting nanowire single-photon detector array

    Science.gov (United States)

    Doerner, S.; Kuzmin, A.; Wuensch, S.; Charaev, I.; Boes, F.; Zwick, T.; Siegel, M.

    2017-07-01

    We demonstrate a 16-pixel array of microwave-current driven superconducting nanowire single-photon detectors with an integrated and scalable frequency-division multiplexing architecture, which reduces the required number of bias and readout lines to a single microwave feed line. The electrical behavior of the photon-sensitive nanowires, embedded in a resonant circuit, as well as the optical performance and timing jitter of the single detectors is discussed. Besides the single pixel measurements, we also demonstrate the operation of a 16-pixel array with a temporal, spatial, and photon-number resolution.

  16. Multiplex Real-Time PCR Assay Targeting Eight Parasites Customized to the Korean Population: Potential Use for Detection in Diarrheal Stool Samples from Gastroenteritis Patients.

    Directory of Open Access Journals (Sweden)

    Eun Jeong Won

    Full Text Available Intestinal parasitic diseases occur worldwide and can cause diarrhea or gastroenteritis; however, their diagnosis is quite difficult, especially in low-endemism countries. We developed a multiplex real-time PCR assay for detection of eight intestinal parasites and prospectively evaluated it for patients with gastroenteritis. The assay targeted Cryptosporidium parvum, Giardia lamblia, Entamoeba histolytica, Blastocystis hominis, Dientamoeba fragilis, Clonorchis sinensis, Metagonimus yokogawai, and Gymnophalloides seoi. Performance characteristics were evaluated based on recovery after DNA extraction, analytical sensitivity, specificity, reproducibility, cross-reactivity, and interference characteristics. Clinical performance was validated against microscopy on 123 diarrheal samples. The assay demonstrated strong correlations between DNA concentrations and Ct values (R2, 0.9924-0.9998, and had a high PCR efficiency (83.3%-109.5%. Polymerase chain reactions detected as few as 10-30 copies of genomic DNA, and coefficient of variance was 0-7%. There was no cross-reactivity to the other 54 microorganisms tested. Interference occurred only in presence of high concentrations of erythrocytes or leukocytes. This assay had a higher correct identification rate (100.0% vs. 90.2% and lower incorrect ID rate (0.0% vs. 9.8% when compared to microscopy. Overall, this assay showed a higher sensitivity (100.0%; 95% confidence interval [CI] of 80.5-100.0 than microscopy (29.4%; 95% CI 10.31-55.96, and the specificity levels were comparable for both methods (100.0%; 95% CI 96.58-100.0. This newly developed multiplex real-time PCR assay offers a potential use for detecting intestinal parasitic pathogens customized to the Korean population.

  17. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  18. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    Science.gov (United States)

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  19. Factors affecting GEBV accuracy with single-step Bayesian models.

    Science.gov (United States)

    Zhou, Lei; Mrode, Raphael; Zhang, Shengli; Zhang, Qin; Li, Bugao; Liu, Jian-Feng

    2018-01-01

    A single-step approach to obtain genomic prediction was first proposed in 2009. Many studies have investigated the components of GEBV accuracy in genomic selection. However, it is still unclear how the population structure and the relationships between training and validation populations influence GEBV accuracy in terms of single-step analysis. Here, we explored the components of GEBV accuracy in single-step Bayesian analysis with a simulation study. Three scenarios with various numbers of QTL (5, 50, and 500) were simulated. Three models were implemented to analyze the simulated data: single-step genomic best linear unbiased prediction (GBLUP; SSGBLUP), single-step BayesA (SS-BayesA), and single-step BayesB (SS-BayesB). According to our results, GEBV accuracy was influenced by the relationships between the training and validation populations more significantly for ungenotyped animals than for genotyped animals. SS-BayesA/BayesB showed an obvious advantage over SSGBLUP with the scenarios of 5 and 50 QTL. SS-BayesB model obtained the lowest accuracy with the 500 QTL in the simulation. SS-BayesA model was the most efficient and robust considering all QTL scenarios. Generally, both the relationships between training and validation populations and LD between markers and QTL contributed to GEBV accuracy in the single-step analysis, and the advantages of single-step Bayesian models were more apparent when the trait is controlled by fewer QTL.

  20. One-step cross-genogroup multiplex RT-qPCR with an internal control system for the detection of infectious pancreatic necrosis virus (IPNV).

    Science.gov (United States)

    Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard

    2017-09-01

    Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

    Directory of Open Access Journals (Sweden)

    Bramastha Rosadi

    2015-01-01

    Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

  2. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP Assay for the Detection of Bacterial Meningitis Pathogens

    Directory of Open Access Journals (Sweden)

    Owen Higgins

    2018-02-01

    Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.

  3. Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (TEC-LAMP) Assay for the Detection of Bacterial Meningitis Pathogens

    Science.gov (United States)

    Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert

    2018-01-01

    Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124

  4. A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.

    Science.gov (United States)

    Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S

    2011-12-01

    Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  6. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  7. Development of a Multiplexed Microsphere PCR for Culture-Free Detection and Gram-Typing of Bacteria in Human Blood Samples.

    Science.gov (United States)

    Liang, Fang; Browne, Daniel J; Gray, Megan J; Gartlan, Kate H; Smith, David D; Barnard, Ross T; Hill, Geoffrey R; Corrie, Simon R; Markey, Kate A

    2018-05-11

    Bloodstream infection is a significant clinical problem, particularly in vulnerable patient groups such as those undergoing chemotherapy and bone marrow transplantation. Clinical diagnostics for suspected bloodstream infection remain centered around blood culture (highly variable timing, in the order of hours to days to become positive), and empiric use of broad-spectrum antibiotics is therefore employed for patients presenting with febrile neutropenia. Gram-typing provides the first opportunity to target therapy (e.g., combinations containing vancomycin or teicoplanin for Gram-positives; piperacillin-tazobactam or a carbapenem for Gram-negatives); however, current approaches require blood culture. In this study, we describe a multiplexed microsphere-PCR assay with flow cytometry readout, which can distinguish Gram-positive from Gram-negative bacterial DNA in a 3.5 h time period. The combination of a simple assay design (amplicon-dependent release of Gram-type specific Cy3-labeled oligonucleotides) and the Luminex-based readout (for quantifying each specific Cy3-labeled sequence) opens opportunities for further multiplexing. We demonstrate the feasibility of detecting common Gram-positive and Gram-negative organisms after spiking whole bacteria into healthy human blood prior to DNA extraction. Further development of DNA extraction methods is required to reach detection limits comparable to blood culture.

  8. A rapid two-step algorithm detects and identifies clinical macrolide and beta-lactam antibiotic resistance in clinical bacterial isolates.

    Science.gov (United States)

    Lu, Xuedong; Nie, Shuping; Xia, Chengjing; Huang, Lie; He, Ying; Wu, Runxiang; Zhang, Li

    2014-07-01

    Aiming to identify macrolide and beta-lactam resistance in clinical bacterial isolates rapidly and accurately, a two-step algorithm was developed based on detection of eight antibiotic resistance genes. Targeting at genes linked to bacterial macrolide (msrA, ermA, ermB, and ermC) and beta-lactam (blaTEM, blaSHV, blaCTX-M-1, blaCTX-M-9) antibiotic resistances, this method includes a multiplex real-time PCR, a melting temperature profile analysis as well as a liquid bead microarray assay. Liquid bead microarray assay is applied only when indistinguishable Tm profile is observed. The clinical validity of this method was assessed on clinical bacterial isolates. Among the total 580 isolates that were determined by our diagnostic method, 75% of them were identified by the multiplex real-time PCR with melting temperature analysis alone, while the remaining 25% required both multiplex real-time PCR with melting temperature analysis and liquid bead microarray assay for identification. Compared with the traditional phenotypic antibiotic susceptibility test, an overall agreement of 81.2% (kappa=0.614, 95% CI=0.550-0.679) was observed, with a sensitivity and specificity of 87.7% and 73% respectively. Besides, the average test turnaround time is 3.9h, which is much shorter in comparison with more than 24h for the traditional phenotypic tests. Having the advantages of the shorter operating time and comparable high sensitivity and specificity with the traditional phenotypic test, our two-step algorithm provides an efficient tool for rapid determination of macrolide and beta-lactam antibiotic resistances in clinical bacterial isolates. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  10. Single-cell duplex RT-LATE-PCR reveals Oct4 and Xist RNA gradients in 8-cell embryos

    Directory of Open Access Journals (Sweden)

    Hartung Odelya

    2007-12-01

    Full Text Available Abstract Background The formation of two distinctive cell lineages in preimplantation mouse embryos is characterized by differential gene expression. The cells of the inner cell mass are pluripotent and express high levels of Oct4 mRNA, which is down-regulated in the surrounding trophectoderm. In contrast, the trophectoderm of female embryos contains Xist mRNA, which is absent from cells of the inner mass. Prior to blastocyst formation, all blastomeres of female embryos still express both of these RNAs. We, thus, postulated that simultaneous quantification of Oct4 and Xist transcripts in individual blastomeres at the 8-cell stage could be informative as to their subsequent fate. Testing this hypothesis, however, presented numerous technical challenges. We overcame these difficulties by combining PurAmp, a single-tube method for RNA preparation and quantification, with LATE-PCR, an advanced form of asymmetric PCR. Results We constructed a duplex RT-LATE-PCR assay for real-time measurement of Oct4 and Xist templates and confirmed its specificity and quantitative accuracy with different methods. We then undertook analysis of sets of blastomeres isolated from embryos at the 8-cell stage. At this stage, all cells in the embryo are still pluripotent and morphologically equivalent. Our results demonstrate, however, that both Oct4 and Xist RNA levels vary in individual blastomeres comprising the same embryo, with some cells having particularly elevated levels of either transcript. Analysis of multiple embryos also shows that Xist and Oct4 expression levels are not correlated at the 8-cell stage, although transcription of both genes is up-regulated at this time in development. In addition, comparison of data from males and females allowed us to determine that the efficiency of the Oct4/Xist assay is unaffected by sex-related differences in gene expression. Conclusion This paper describes the first example of multiplex RT-LATE-PCR and its utility, when

  11. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Multiplex PCR for the detection of BCL-1/IGH and BCL-2/IGH gene rearrangements--clinical validation in a prospective study of blood and bone marrow in 258 patients with or suspected of non-Hodgkin's lymphoma

    DEFF Research Database (Denmark)

    Nyvold, Charlotte G; Bendix, Knud; Brandsborg, Margrethe

    2007-01-01

    prospectively been evaluated. Eleven patients (4%) were found t(11;14)+ and 37 patients (14%) t(14;18)+. Comparing these results to standard diagnostic methods of PB and/or BM identified PCR+ samples that were normal by morphology (BCL-1/IGH: 1/11; BCL-2/IGH: 17/37). Equally important, patients who were......We have designed a multiplex PCR, which allows for fast and high throughput demonstration of the BCL-1/IGH and BCL-2/IGH fusion DNA observed primarily in mantle cell- and follicular non-Hodgkin's lymphoma (NHL). Blood (PB) and/or bone marrow (BM) from 258 patients suspected of NHL have...... not clonal in PB and/or BM by flow cytometry were identified as PCR+ (BCL-1/IGH: 3/11; BCL-2/IGH: 23/37). We conclude that this multiplex approach allows for easy and sensitive molecular determination of molecular lesions in NHL, which have diagnostic and prognostic importance. Udgivelsesdato: 2007-null...

  15. Design and optimization of reverse-transcription quantitative PCR experiments.

    Science.gov (United States)

    Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

    2009-10-01

    Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

  16. PCR specific for Actinobacillus pleuropneumoniae serotype 3

    DEFF Research Database (Denmark)

    Zhou, L.; Jones, S.C.P.; Angen, Øystein

    2008-01-01

    , but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...

  17. Accuracy of Single-Step versus 2-Step Double-Mix Impression Technique

    DEFF Research Database (Denmark)

    Franco, Eduardo Batista; da Cunha, Leonardo Fernandes; Herrera, Francyle Simões

    2011-01-01

    Objective. To investigate the accuracy of dies obtained from single-step and 2-step double-mix impressions. Material and Methods. Impressions (n = 10) of a stainless steel die simulating a complete crown preparation were performed using a polyether (Impregum Soft Heavy and Light body) and a vinyl...

  18. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  19. Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

    2016-05-01

    Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Multiplex PageRank.

    Directory of Open Access Journals (Sweden)

    Arda Halu

    Full Text Available Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

  1. Multiplex PageRank.

    Science.gov (United States)

    Halu, Arda; Mondragón, Raúl J; Panzarasa, Pietro; Bianconi, Ginestra

    2013-01-01

    Many complex systems can be described as multiplex networks in which the same nodes can interact with one another in different layers, thus forming a set of interacting and co-evolving networks. Examples of such multiplex systems are social networks where people are involved in different types of relationships and interact through various forms of communication media. The ranking of nodes in multiplex networks is one of the most pressing and challenging tasks that research on complex networks is currently facing. When pairs of nodes can be connected through multiple links and in multiple layers, the ranking of nodes should necessarily reflect the importance of nodes in one layer as well as their importance in other interdependent layers. In this paper, we draw on the idea of biased random walks to define the Multiplex PageRank centrality measure in which the effects of the interplay between networks on the centrality of nodes are directly taken into account. In particular, depending on the intensity of the interaction between layers, we define the Additive, Multiplicative, Combined, and Neutral versions of Multiplex PageRank, and show how each version reflects the extent to which the importance of a node in one layer affects the importance the node can gain in another layer. We discuss these measures and apply them to an online multiplex social network. Findings indicate that taking the multiplex nature of the network into account helps uncover the emergence of rankings of nodes that differ from the rankings obtained from one single layer. Results provide support in favor of the salience of multiplex centrality measures, like Multiplex PageRank, for assessing the prominence of nodes embedded in multiple interacting networks, and for shedding a new light on structural properties that would otherwise remain undetected if each of the interacting networks were analyzed in isolation.

  2. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  3. A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

    Directory of Open Access Journals (Sweden)

    Brisabois Anne

    2011-06-01

    Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

  4. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    Science.gov (United States)

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  5. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae.

    Directory of Open Access Journals (Sweden)

    Nicole Roschanski

    Full Text Available Beta-lactamase resistant bacteria and especially ESBL producing Enterobacteriaceae are an increasing problem worldwide. For this reason a major interest in efficient and reliable methods for rapid screening of high sample numbers is recognizable. Therefore, a multiplex real-time PCR was developed to detect the predominant class A beta-lactamase genes blaCTX-M, blaSHV, blaTEM and CIT-type AmpCs in a one-step reaction. A set of 114 Enterobacteriaceae containing previously identified resistance gene subtypes and in addition 20 undefined animal and environmental isolates were used for the validation of this assay. To confirm the accessibility in variable settings, the real-time runs were performed analogous in two different laboratories using different real-time cyclers. The obtained results showed complete accordance between the real-time data and the predetermined genotypes. Even if sequence analyses are further necessary for a comprehensive characterization, this method was proofed to be reliable for rapid screening of high sample numbers and therefore could be an important tool for e. g. epidemiological purposes or support infection control measures.

  6. Percutaneous Cystgastrostomy as a Single-Step Procedure

    International Nuclear Information System (INIS)

    Curry, L.; Sookur, P.; Low, D.; Bhattacharya, S.; Fotheringham, T.

    2009-01-01

    The purpose of this study was to evaluate the success of percutaneous transgastric cystgastrostomy as a single-step procedure. We performed a retrospective analysis of single-step percutaneous transgastric cystgastrostomy carried out in 12 patients (8 male, 4 female; mean age 44 years; range 21-70 years), between 2002 and 2007, with large symptomatic pancreatic pseudocysts for whom up to 1-year follow-up data (mean 10 months) were available. All pseudocysts were drained by single-step percutaneous cystgastrostomy with the placement of either one or two stents. The procedure was completed successfully in all 12 patients. The pseudocysts showed complete resolution on further imaging in 7 of 12 patients with either enteric passage of the stent or stent removal by endoscopy. In 2 of 12 patients, the pseudocysts showed complete resolution on imaging, with the stents still noted in situ. In 2 of 12 patients, the pseudocysts became infected after 1 month and required surgical intervention. In 1 of 12 patients, the pseudocyst showed partial resolution on imaging, but subsequently reaccumulated and later required external drainage. In our experience, percutaneous cystgastrostomy as a single-step procedure has a high success rate and good short-term outcomes over 1-year follow-up and should be considered in the treatment of large symptomatic cysts.

  7. Multiplexed Western Blotting Using Microchip Electrophoresis.

    Science.gov (United States)

    Jin, Shi; Furtaw, Michael D; Chen, Huaxian; Lamb, Don T; Ferguson, Stephen A; Arvin, Natalie E; Dawod, Mohamed; Kennedy, Robert T

    2016-07-05

    Western blotting is a commonly used protein assay that combines the selectivity of electrophoretic separation and immunoassay. The technique is limited by long time, manual operation with mediocre reproducibility, and large sample consumption, typically 10-20 μg per assay. Western blots are also usually used to measure only one protein per assay with an additional housekeeping protein for normalization. Measurement of multiple proteins is possible; however, it requires stripping membranes of antibody and then reprobing with a second antibody. Miniaturized alternatives to Western blot based on microfluidic or capillary electrophoresis have been developed that enable higher-throughput, automation, and greater mass sensitivity. In one approach, proteins are separated by electrophoresis on a microchip that is dragged along a polyvinylidene fluoride membrane so that as proteins exit the chip they are captured on the membrane for immunoassay. In this work, we improve this method to allow multiplexed protein detection. Multiple injections made from the same sample can be deposited in separate tracks so that each is probed with a different antibody. To further enhance multiplexing capability, the electrophoresis channel dimensions were optimized for resolution while keeping separation and blotting times to less than 8 min. Using a 15 μm deep × 50 μm wide × 8.6 cm long channel, it is possible to achieve baseline resolution of proteins that differ by 5% in molecular weight, e.g., ERK1 (44 kDa) from ERK2 (42 kDa). This resolution allows similar proteins detected by cross-reactive antibodies in a single track. We demonstrate detection of 11 proteins from 9 injections from a single Jurkat cell lysate sample consisting of 400 ng of total protein using this procedure. Thus, multiplexed Western blots are possible without cumbersome stripping and reprobing steps.

  8. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection.

    Science.gov (United States)

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce

    2013-10-07

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.

  9. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  10. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    Science.gov (United States)

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Single Cell HLA Matching Feasibility by Whole Genomic Amplification and Nested PCR

    Institute of Scientific and Technical Information of China (English)

    Xiao-hong Li; Fang-yin Meng

    2004-01-01

    @@ PCR based single-cell DNA analysis has been widely used in forensic science, preimplantation genetic diagnosis and so on. However, the original sample cannot be efficiently retrieved following single cell PCR, consequently the amount of information gained is limited. HLA system is too sophisticated that it is very hard to complete HLA typing by single cell. A Taq polymerase-based method using random primers to amplify whole genome termed as whole genome amplification (WGA) has demonstrated to be a useful method in increasing the copies of minimum sample. We establish a technique in this study to amplify HLA-A and HLA-B loci at same time in a single cell using WGA.

  12. Single-Cell Quantitative PCR: Advances and Potential in Cancer Diagnostics.

    Science.gov (United States)

    Ok, Chi Young; Singh, Rajesh R; Salim, Alaa A

    2016-01-01

    Tissues are heterogeneous in their components. If cells of interest are a minor population of collected tissue, it would be difficult to obtain genetic or genomic information of the interested cell population with conventional genomic DNA extraction from the collected tissue. Single-cell DNA analysis is important in the analysis of genetics of cell clonality, genetic anticipation, and single-cell DNA polymorphisms. Single-cell PCR using Single Cell Ampligrid/GeXP platform is described in this chapter.

  13. A multiplex microplatform for the detection of multiple DNA methylation events using gold-DNA affinity.

    Science.gov (United States)

    Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt

    2017-10-07

    We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.

  14. Design of a Modular DNA Triangular-Prism Sensor Enabling Ratiometric and Multiplexed Biomolecule Detection on a Single Microbead.

    Science.gov (United States)

    Liu, Yu; Chen, Qiaoshu; Liu, Jianbo; Yang, Xiaohai; Guo, Qiuping; Li, Li; Liu, Wei; Wang, Kemin

    2017-03-21

    DNA nanostructures have emerged as powerful and versatile building blocks for the construction of programmable nanoscale structures and functional sensors for biomarker detection, disease diagnostics, and therapy. Here we integrated multiple sensing modules into a single DNA three-dimensional (3D) nanoarchitecture with a triangular-prism (TP) structure for ratiometric and multiplexed biomolecule detection on a single microbead. In our design, the complementary hybridization of three clip sequences formed TP nanoassemblies in which the six single-strand regions in the top and bottom faces act as binding sites for different sensing modules, including an anchor module, reference sequence module, and capture sequence module. The multifunctional modular TP nanostructures were thus exploited for ratiometric and multiplexed biomolecule detection on microbeads. Microbead imaging demonstrated that, after ratiometric self-calibration analysis, the imaging deviations resulting from uneven fluorescence intensity distribution and differing probe concentrations were greatly reduced. The rigid nanostructure also conferred the TP as a framework for geometric positioning of different capture sequences. The inclusion of multiple targets led to the formation of sandwich hybridization structures that gave a readily detectable optical response at different fluorescence channels and distinct fingerprint-like pattern arrays. This approach allowed us to discriminate multiplexed biomolecule targets in a simple and efficient fashion. In this module-designed strategy, the diversity of the controlled DNA assembly coupled with the geometrically well-defined rigid nanostructures of the TP assembly provides a flexible and reliable biosensing approach that shows great promise for biomedical applications.

  15. A strain-specific multiplex RT-PCR for Australian rabbit haemorrhagic disease viruses uncovers a new recombinant virus variant in rabbits and hares.

    Science.gov (United States)

    Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T

    2018-04-01

    Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.

  16. Seven novel probe systems for real-time PCR provide absolute single-base discrimination, higher signaling, and generic components.

    Science.gov (United States)

    Murray, James L; Hu, Peixu; Shafer, David A

    2014-11-01

    We have developed novel probe systems for real-time PCR that provide higher specificity, greater sensitivity, and lower cost relative to dual-labeled probes. The seven DNA Detection Switch (DDS)-probe systems reported here employ two interacting polynucleotide components: a fluorescently labeled probe and a quencher antiprobe. High-fidelity detection is achieved with three DDS designs: two internal probes (internal DDS and Flip probes) and a primer probe (ZIPR probe), wherein each probe is combined with a carefully engineered, slightly mismatched, error-checking antiprobe. The antiprobe blocks off-target detection over a wide range of temperatures and facilitates multiplexing. Other designs (Universal probe, Half-Universal probe, and MacMan probe) use generic components that enable low-cost detection. Finally, single-molecule G-Force probes employ guanine-mediated fluorescent quenching by forming a hairpin between adjacent C-rich and G-rich sequences. Examples provided show how these probe technologies discriminate drug-resistant Mycobacterium tuberculosis mutants, Escherichia coli O157:H7, oncogenic EGFR deletion mutations, hepatitis B virus, influenza A/B strains, and single-nucleotide polymorphisms in the human VKORC1 gene. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Development of a multiplex polymerase chain reaction assay for simultaneous identification of human enterovirus 71 and coxsackievirus A16

    Science.gov (United States)

    Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara

    2010-01-01

    Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857

  18. Comparison of the EntericBio multiplex PCR system with routine culture for detection of bacterial enteric pathogens.

    LENUS (Irish Health Repository)

    O'Leary, James

    2009-11-01

    The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.

  19. Multiplex Detection and Genotyping of Point Mutations Involved in Charcot-Marie-Tooth Disease Using a Hairpin Microarray-Based Assay

    Directory of Open Access Journals (Sweden)

    Yasser Baaj

    2009-01-01

    Full Text Available We previously developed a highly specific method for detecting SNPs with a microarray-based system using stem-loop probes. In this paper we demonstrate that coupling a multiplexing procedure with our microarray method is possible for the simultaneous detection and genotyping of four point mutations, in three different genes, involved in Charcot-Marie-Tooth disease. DNA from healthy individuals and patients was amplified, labeled with Cy3 by multiplex PCR; and hybridized to microarrays. Spot signal intensities were 18 to 74 times greater for perfect matches than for mismatched target sequences differing by a single nucleotide (discrimination ratio for “homozygous” DNA from healthy individuals. “Heterozygous” mutant DNA samples gave signal intensity ratios close to 1 at the positions of the mutations as expected. Genotyping by this method was therefore reliable. This system now combines the principle of highly specific genotyping based on stem-loop structure probes with the advantages of multiplex analysis.

  20. Evaluation of multiplex polymerase chain reaction as an alternative to conventional antibiotic sensitivity test

    Directory of Open Access Journals (Sweden)

    K. Rathore

    2018-04-01

    Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.

  1. Evaluation of the new AmpliSens multiplex real-time PCR assay for simultaneous detection of Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, and Trichomonas vaginalis.

    Science.gov (United States)

    Rumyantseva, Tatiana; Golparian, Daniel; Nilsson, Christian S; Johansson, Emma; Falk, My; Fredlund, Hans; Van Dam, Alje; Guschin, Alexander; Unemo, Magnus

    2015-10-01

    In this study, we performed an evaluation of the new CE-marked multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay compared to APTIMA tests, i.e., APTIMA COMBO 2 assay, APTIMA Trichomonas vaginalis assay (FDA-approved), and two different APTIMA Mycoplasma genitalium assays (research use only; one of them only used for discrepancy analysis). Vaginal swabs (n = 209) and first-void urine (FVU) specimens from females (n = 498) and males (n = 554), consecutive attendees (n = 1261) at a dermatovenerological clinic in Sweden, were examined. The sensitivity of the AmpliSens PCR assay for detection of C. trachomatis (6.3% prevalence), M. genitalium (5.7% prevalence), N. gonorrhoeae (0.3% prevalence), and T. vaginalis (0.08% prevalence) was 97.5% (95% confidence interval (CI): 91.2-99.6%), 81.9% (95% CI: 70.7-89.7%), 100% (95% CI: 40.2-100%) and 100% (95% CI: 16.5-100%), respectively. The specificity of the AmpliSens PCR assay was 100% (95% CI: 99.6-100%) for all agents. The analytical sensitivity and specificity for N. gonorrhoeae detection was excellent, i.e., 55 international gonococcal strains detected and 135 isolates of 13 non-gonococcal Neisseria species were negative. In conclusion, the multiplex real-time AmpliSens N.gonorrhoeae/C.trachomatis/M.genitalium/T.vaginalis-MULTIPRIME-FRT PCR assay demonstrated high sensitivity and excellent specificity for the detection of C. trachomatis, N. gonorrhoeae, and T. vaginalis, and excellent specificity but suboptimal sensitivity for M. genitalium detection. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  2. Simple Multiplexing Hand-Held Control Unit

    Science.gov (United States)

    Hannaford, Blake

    1989-01-01

    Multiplexer consists of series of resistors, each shunted by single-pole, single-throw switch. User operates switches by pressing buttons or squeezing triggers. Prototype includes three switches operated successfully in over 200 hours of system operations. Number of switches accommodated determined by signal-to-noise ratio of current source, noise induced in control unit and cable, and number of bits in output of analog-to-digital converter. Because many computer-contolled robots have extra analog-to-digital channels, such multiplexer added at little extra cost.

  3. Prospective evaluation of the SeptiFAST multiplex real-time PCR assay for surveillance and diagnosis of infections in haematological patients after allogeneic stem cell transplantation compared to routine microbiological assays and an in-house real-time PCR method.

    Science.gov (United States)

    Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus

    2017-12-01

    We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.

  4. Comparative analysis of single-step and two-step biodiesel production using supercritical methanol on laboratory-scale

    International Nuclear Information System (INIS)

    Micic, Radoslav D.; Tomić, Milan D.; Kiss, Ferenc E.; Martinovic, Ferenc L.; Simikić, Mirko Ð.; Molnar, Tibor T.

    2016-01-01

    Highlights: • Single-step supercritical transesterification compared to the two-step process. • Two-step process: oil hydrolysis and subsequent supercritical methyl esterification. • Experiments were conducted in a laboratory-scale batch reactor. • Higher biodiesel yields in two-step process at milder reaction conditions. • Two-step process has potential to be cost-competitive with the single-step process. - Abstract: Single-step supercritical transesterification and two-step biodiesel production process consisting of oil hydrolysis and subsequent supercritical methyl esterification were studied and compared. For this purpose, comparative experiments were conducted in a laboratory-scale batch reactor and optimal reaction conditions (temperature, pressure, molar ratio and time) were determined. Results indicate that in comparison to a single-step transesterification, methyl esterification (second step of the two-step process) produces higher biodiesel yields (95 wt% vs. 91 wt%) at lower temperatures (270 °C vs. 350 °C), pressures (8 MPa vs. 12 MPa) and methanol to oil molar ratios (1:20 vs. 1:42). This can be explained by the fact that the reaction system consisting of free fatty acid (FFA) and methanol achieves supercritical condition at milder reaction conditions. Furthermore, the dissolved FFA increases the acidity of supercritical methanol and acts as an acid catalyst that increases the reaction rate. There is a direct correlation between FFA content of the product obtained in hydrolysis and biodiesel yields in methyl esterification. Therefore, the reaction parameters of hydrolysis were optimized to yield the highest FFA content at 12 MPa, 250 °C and 1:20 oil to water molar ratio. Results of direct material and energy costs comparison suggest that the process based on the two-step reaction has the potential to be cost-competitive with the process based on single-step supercritical transesterification. Higher biodiesel yields, similar or lower energy

  5. Pure chromosome-specific PCR libraries from single sorted chromosomes

    NARCIS (Netherlands)

    VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

  6. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Directory of Open Access Journals (Sweden)

    Ahmad N. A. A

    2017-01-01

    Full Text Available This paper analyzes the performance of subcarrier multiplexing (SCM of spectral amplitude coding optical code multiple access (SAC-OCDMA by applying Recursive Combinatorial (RC code based on single photodiode detection (SPD. SPD is used in the receiver part to reduce the effect of multiple access interference (MAI which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  7. Analysis of hybrid subcarrier multiplexing of OCDMA based on single photodiode detection

    Science.gov (United States)

    Ahmad, N. A. A.; Junita, M. N.; Aljunid, S. A.; Rashidi, C. B. M.; Endut, R.

    2017-11-01

    This paper analyzes the performance of subcarrier multiplexing (SCM) of spectral amplitude coding optical code multiple access (SAC-OCDMA) by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. Results indicate that the SCM OCDMA network performance could be improved by using lower data rates and higher number of weight. Total number of users can also be enhanced by adding lower data rates and higher number of subcarriers.

  8. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

    Directory of Open Access Journals (Sweden)

    Mehmet Sarıer

    2017-03-01

    Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

  10. Application of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial

    DEFF Research Database (Denmark)

    Llewellyn, Stacey; Inpankaew, Tawin; Nery, Susana Vaz

    2016-01-01

    Background Accurate quantitative assessment of infection with soil transmitted helminths and protozoa is key to the interpretation of epidemiologic studies of these parasites, as well as for monitoring large scale treatment efficacy and effectiveness studies. As morbidity and transmission...... of helminth infections are directly related to both the prevalence and intensity of infection, there is particular need for improved techniques for assessment of infection intensity for both purposes. The current study aimed to evaluate two multiplex PCR assays to determine prevalence and intensity...... of intestinal parasite infections, and compare them to standard microscopy. Methodology/Principal Findings Faecal samples were collected from a total of 680 people, originating from rural communities in Timor-Leste (467 samples) and Cambodia (213 samples). DNA was extracted from stool samples and subject to two...

  11. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  12. RT-qPCR work-flow for single-cell data analysis

    Czech Academy of Sciences Publication Activity Database

    Stahlberg, A.; Rusňáková, Vendula; Forootan, A.; Anděrová, Miroslava; Kubista, Mikael

    2013-01-01

    Roč. 59, č. 1 (2013), s. 80-88 ISSN 1046-2023 R&D Projects: GA MŠk(CZ) ME10052; GA ČR GAP303/10/1338 Institutional research plan: CEZ:AV0Z50520701 Institutional support: RVO:68378041 Keywords : RT-qPCR * Single-cell biology * Single-cell data analysis Subject RIV: EB - Genetics ; Molecular Biology; FH - Neurology (UEM-P) Impact factor: 3.221, year: 2013

  13. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique.

    Science.gov (United States)

    Ertas, Nurhan; Gonulalan, Zafer; Yildirim, Yeliz; Kum, Erhan

    2010-08-15

    The aim of this study was to investigate the presence of Staphylococcus aureus (S. aureus) and staphylococcal enterotoxins (SEs) genes in sheep cheese and dairy dessert samples by multiplex PCR (mPCR) technique. A total of 150 samples were analyzed consisting of 50 dairy dessert samples and 100 sheep cheese. Coagulase positive staphylococci (CPS) were found in 86 (57.3%) out of 150 analyzed samples. S. aureus were isolated from 60 (60%), 26 (52%) of sheep cheese and from of dairy desserts, respectively. Five suspected colonies were tested from each sheep cheese and dairy dessert samples for phenotypic and genotypic characterizations. A total of 430 isolates from the 86 positive samples were investigated in this study. Eighty (18.6%) isolates were characterized as S. aureus. The enterotoxin genes (sea, seb, sec, sed) were found in 13 (3.02%) out of 80 isolates. From cheese isolates, sea, seb and sed were detected in 5 (1.6%), 2 (0.6%), 1 (0.3%), respectively. From dairy dessert isolates, sea, sec and sed were detected in 3 (2.3%), 1 (0.76%), 1 (0.76%), respectively. The presence of SEs was identified in 12 (2.8%) out of 80 isolates by using ELISA technique. It was determined that these SEs had a distribution of 7 (1.6%) SEA, 2 (0.46%) SEB, 1 (0.23%) SEC, and 2 (0.46%) SED. SEs were found in 7 (2.3%) cheese and 5 (3.8%) dairy dessert isolates. In conclusion, S.aureus and their SEs were found to be present in sheep cheese and dairy desserts in this study. It is emphasized that the presence of S. aureus and their SEs genes in sheep cheese and dairy desserts may be regarded as a potential risk for human health. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Comparison of single-step and two-step purified coagulants from Moringa oleifera seed for turbidity and DOC removal.

    Science.gov (United States)

    Sánchez-Martín, J; Ghebremichael, K; Beltrán-Heredia, J

    2010-08-01

    The coagulant proteins from Moringa oleifera purified with single-step and two-step ion-exchange processes were used for the coagulation of surface water from Meuse river in The Netherlands. The performances of the two purified coagulants and the crude extract were assessed in terms of turbidity and DOC removal. The results indicated that the optimum dosage of the single-step purified coagulant was more than two times higher compared to the two-step purified coagulant in terms of turbidity removal. And the residual DOC in the two-step purified coagulant was lower than in single-step purified coagulant or crude extract. (c) 2010 Elsevier Ltd. All rights reserved.

  15. Thermodynamic approach and comparison of two-step and single step DME (dimethyl ether) syntheses with carbon dioxide utilization

    International Nuclear Information System (INIS)

    Chen, Wei-Hsin; Hsu, Chih-Liang; Wang, Xiao-Dong

    2016-01-01

    DME (Dimethyl ether) synthesis from syngas with CO_2 utilization through two-step and single step processes is analyzed thermodynamically. The influences of reaction temperature, H_2/CO molar ratio, and CO_2/CO molar ratio on CO and CO_2 conversions, DME selectivity and yield, and thermal behavior are evaluated. Particular attention is paid to the comparison of the performance of DME synthesis between the two different methods. In the two-step method, the addition of CO_2 suppresses the CO conversion during methanol synthesis. An increase in CO_2/CO ratio decreases the CO_2 conversion (negative effect), but increases the total consumption amount of CO_2 (positive effect). At a given reaction temperature with H_2/CO = 4, the maximum DME yield develops at CO_2/CO = 1. In the single step method, over 98% of CO can be converted and the DME yield can be as high as 0.52 mol (mol CO)"−"1 at CO_2/CO = 2. The comparison of the single step and two-step processes indicates that the maximum CO conversion, DME selectivity, and DME yield in the former are higher than those in the latter, whereas an opposite result in the maximum CO_2 conversion is observed. These results reveal that the single step process has lower thermodynamic limitation and is a better option for DME synthesis. From CO_2 utilization point of view, the operation with low temperature, high H_2/CO ratio, and low CO_2/CO ratio results in higher CO_2 conversion, irrespective of two-step or single step DME synthesis. - Highlights: • DME (Dimethyl ether) synthesis with CO_2 utilization is analyzed thermodynamically. • Single step and two-step DME syntheses are studied and compared with each other. • CO_2 addition suppresses CO conversion in MeOH synthesis but increases MeOH yield. • The performance of the single step DME synthesis is better than that of the two-step one. • Increase CO_2/CO ratio decreases CO_2 conversion but increases CO_2 consumption amount.

  16. Multiplex real-time PCR assays for detection of eight Shiga toxin-producing Escherichia coli in food samples by melting curve analysis.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2015-12-23

    Shiga toxin-producing Escherichia coli (STEC) are pathogenic strains of E. coli that can cause bloody diarrhea and kidney failure. Seven STEC serogroups, O157, O26, O45, O103, O111, O121 and O145 are responsible for more than 71% of the total infections caused by this group of pathogens. All seven serogroups are currently considered as adulterants in non-intact beef products in the U.S. In this study, two multiplex melt curve real-time PCR assays with internal amplification controls (IACs) were standardized for the detection of eight STEC serogroups. The first multiplex assay targeted E. coli serogroups O145, O121, O104, and O157; while the second set detected E. coli serogroups O26, O45, O103 and O111. The applicability of the assays was tested using 11 different meat and produce samples. For food samples spiked with a cocktail of four STEC serogroups with a combined count of 10 CFU/25 g food, all targets of the multiplex assays were detected after an enrichment period of 6h. The assays also worked efficiently when 325 g of food samples were spiked with 10 CFU of STECs. The assays are not dependent on fluorescent-labeled probes or immunomagnetic beads, and can be used for the detection of eight STEC serogroups in less than 11h. Routine preliminary screening of STECs in food samples is performed by testing for the presence of STEC virulence genes. The assays developed in this study can be useful as a first- or second-tier test for the identification of the eight O serogroup-specific genes in suspected food samples. Copyright © 2015. Published by Elsevier B.V.

  17. A PCR method targeting internal transcribed spacers: the simultaneous detection of Babesia bigemina and Babesia bovis in cattle.

    Science.gov (United States)

    Liu, Junlong; Guan, Guiquan; Liu, Aihong; Li, Youquan; Yin, Hong; Luo, Jianxun

    2014-03-01

    In this study, two pairs of oligonucleotide primers were designed according to the nucleotide sequence of the internal transcribed spacers (ITSs) of Babesia bigemina and B. bovis isolates from China. The primers were used in a multiplex PCR to detect parasite DNA in blood samples from cattle. There was no cross reactions with B. ovata, B. major, B. sp. Kashi, Theileria annulata, T. sergenti, T. sinensis or normal bovine DNA. The sensitivity of multiplex PCR assay was 1 pg and 10 pg DNA for B. bigemina and B. bovis, respectively. A total of 260 field blood samples collected from cattle in five provinces of China were analyzed by multiplex PCR and light microscopy. PCR testing revealed that 7.3% (19/260) and 5.8% (15/260) of cattle were positive for B. bigemina and B. bovis and 1.2% (3/260) of cattle were co-infected with B. bigemina and B. bovis. Using light microscopy, 2.3% (6/260) and 1.5% (4/260) of cattle were infected by B. bigemina and B. bovis, respectively, and no co-infection was found. The results showed that the multiplex PCR developed in the present study could be an alternative diagnostic tool for the detection of B. bovis and B. bigemina infection in cattle.

  18. Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii.

    Science.gov (United States)

    Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N

    2017-09-01

    Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.

  19. Mapping Cellular Hierarchy by Single-Cell Analysis of the Cell Surface Repertoire

    OpenAIRE

    Guo, Guoji; Luc, Sidinh; Marco, Eugenio; Lin, Ta-Wei; Peng, Cong; Kerenyi, Marc A.; Beyaz, Semir; Kim, Woojin; Xu, Jian; Das, Partha Pratim; Neff, Tobias; Zou, Keyong; Yuan, Guo-Cheng; Orkin, Stuart H.

    2013-01-01

    Stem cell differentiation pathways are most often studied at the population level, whereas critical decisions are executed at the level of single cells. We have established a highly multiplexed, quantitative PCR assay to profile in an unbiased manner a panel of all commonly used cell surface markers (280 genes) from individual cells. With this method we analyzed over 1500 single cells throughout the mouse hematopoietic system, and illustrate its utility for revealing important biological insi...

  20. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Nandagopal Murugan

    2018-02-01

    Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

  1. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  2. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC.

    Directory of Open Access Journals (Sweden)

    Zachary F Phillips

    Full Text Available We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification-an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC, is a single-shot variant of Differential Phase Contrast (DPC, which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps for various in vitro cell samples and c. elegans in a micro-fluidic channel.

  3. Monitoring bacterial faecal contamination in waters using multiplex ...

    African Journals Online (AJOL)

    Monitoring of sanitary quality or faecal pollution in water is currently based on quantifying some bacterial indicators such as Escherichia coli and faecal enterococci. Using a multiplex real-time PCR assay for faecal enterococci and Bacteroides spp., the detection of faecal contamination in non-treated water can be done in a ...

  4. Validation of the performance of a GMO multiplex screening assay based on microarray detection

    NARCIS (Netherlands)

    Leimanis, S.; Hamels, S.; Naze, F.; Mbongolo, G.; Sneyers, M.; Hochegger, R.; Broll, H.; Roth, L.; Dallmann, K.; Micsinai, A.; Dijk, van J.P.; Kok, E.J.

    2008-01-01

    A new screening method for the detection and identification of GMO, based on the use of multiplex PCR followed by microarray, has been developed and is presented. The technology is based on the identification of quite ubiquitous GMO genetic target elements first amplified by PCR, followed by direct

  5. One-step simultaneous detection of Ureaplasma parvum and genotypes SV1, SV3 and SV6 from clinical samples using PlexPCR technology.

    Science.gov (United States)

    Payne, M S; Furfaro, L L; Tucker, R; Tan, L Y; Mokany, E

    2017-08-01

    Ureaplasma spp. are associated with preterm birth. In recent times, it has become apparent that Ureaplasma parvum, but not Ureaplasma urealyticum, is of most relevance. We recently demonstrated this in Australian pregnant women and using high-resolution melt (HRM) PCR, further showed that U. parvum genotype SV6 was of particular significance. However, our assay was unable to identify multiple genotypes in the same sample, required a separate species-level qPCR for low titre samples and was not ideal for diagnostic laboratories due to the nature of HRM PCR result interpretation. Consequently, our current study developed a novel, one-step PlexPCR assay capable of detecting U. parvum and genotypes SV1, SV3 and SV6 in a single reaction directly from clinical samples. We then validated this using vaginal swab DNA from our Australian cohort of pregnant women. The PlexPCR was highly sensitive, detecting all targets to between 0.4 × 10 -5  ng DNA (SV3) and 0.4 × 10 -6  ng DNA (U. parvum, SV1 and SV6). Compared to our HRM PCR, the PlexPCR defined genotype distribution in all seven cases previously reported as 'mixed', and detected another eight cases where multiple genotypes (two) were present in samples previously reported as single genotypes using HRM PCR. Ureaplasma spp. have been associated with prematurity for decades, however, only a minority of studies have examined this beyond the genus level. In those that have, Ureaplasma parvum has been strongly associated with preterm birth. We recently demonstrated this in Australian women and further showed that U. parvum genotype SV6 was of particular significance. Our PlexPCR assay allows rapid detection and concurrent genotyping of U. parvum in clinical samples and may be of particular interest to obstetricians, particularly those caring for women at a high risk of preterm birth, and any other disease phenotypes where U. parvum is of interest. © 2017 The Authors. Letters in Applied Microbiology published by John

  6. High core count single-mode multicore fiber for dense space division multiplexing

    DEFF Research Database (Denmark)

    Aikawa, K.; Sasaki, Y.; Amma, Y.

    2016-01-01

    Multicore fibers and few-mode fibers have the potential to realize dense-space-division multiplexing systems. Several dense-space-division multiplexing system transmission experiments over multicore fibers and few-mode fibers have been demonstrated so far. Multicore fibers, including recent resul...

  7. Simultaneous Detection of Key Bacterial Pathogens Related to Pneumonia and Meningitis Using Multiplex PCR Coupled With Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    2018-04-01

    Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.

  8. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Natália Malaguti

    2015-01-01

    Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  9. Comparison between Conventional OCDMA and Subcarrier Multiplexing SAC OCDMA System Based on Single Photodiode Detection

    OpenAIRE

    Ahmad N. A. A; Junita M. N; Aljunid Syed Alwi; Che Beson Mohd Rashidi; Endut Rosdisham

    2017-01-01

    This paper demonstrates the comparison between conventional OCDMA system and subcarrier multiplexing (SCM) SAC-OCDMA system by applying Recursive Combinatorial (RC) code based on single photodiode detection (SPD). SPD is used in the receiver part to reduce the effect of multiple access interference (MAI) which contributes as a dominant noise in incoherent SAC-OCDMA systems. From this analysis, the performance of SCM OCDMA network could be improved by using lower data rates and higher received...

  10. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    2014-01-01

    Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

  11. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Science.gov (United States)

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  12. Using multiple PCR and CE with chemiluminescence detection for simultaneous qualitative and quantitative analysis of genetically modified organism.

    Science.gov (United States)

    Guo, Longhua; Qiu, Bin; Chi, Yuwu; Chen, Guonan

    2008-09-01

    In this paper, an ultrasensitive CE-CL detection system coupled with a novel double-on-column coaxial flow detection interface was developed for the detection of PCR products. A reliable procedure based on this system had been demonstrated for qualitative and quantitative analysis of genetically modified organism-the detection of Roundup Ready Soy (RRS) samples was presented as an example. The promoter, terminator, function and two reference genes of RRS were amplified with multiplex PCR simultaneously. After that, the multiplex PCR products were labeled with acridinium ester at the 5'-terminal through an amino modification and then analyzed by the proposed CE-CL system. Reproducibility of analysis times and peak heights for the CE-CL analysis were determined to be better than 0.91 and 3.07% (RSD, n=15), respectively, for three consecutive days. It was shown that this method could accurately and qualitatively detect RRS standards and the simulative samples. The evaluation in terms of quantitative analysis of RRS provided by this new method was confirmed by comparing our assay results with those of the standard real-time quantitative PCR (RT-QPCR) using SYBR Green I dyes. The results showed a good coherence between the two methods. This approach demonstrated the possibility for accurate qualitative and quantitative detection of GM plants in a single run.

  13. Comparison of Model Reliabilities from Single-Step and Bivariate Blending Methods

    DEFF Research Database (Denmark)

    Taskinen, Matti; Mäntysaari, Esa; Lidauer, Martin

    2013-01-01

    Model based reliabilities in genetic evaluation are compared between three methods: animal model BLUP, single-step BLUP, and bivariate blending after genomic BLUP. The original bivariate blending is revised in this work to better account animal models. The study data is extracted from...... be calculated. Model reliabilities by the single-step and the bivariate blending methods were higher than by animal model due to genomic information. Compared to the single-step method, the bivariate blending method reliability estimates were, in general, lower. Computationally bivariate blending method was......, on the other hand, lighter than the single-step method....

  14. Available number of multiplexed holograms based on signal-to-noise ratio analysis in reflection-type holographic memory using three-dimensional speckle-shift multiplexing.

    Science.gov (United States)

    Nishizaki, Tatsuya; Matoba, Osamu; Nitta, Kouichi

    2014-09-01

    The recording properties of three-dimensional speckle-shift multiplexing in reflection-type holographic memory are analyzed numerically. Three-dimensional recording can increase the number of multiplexed holograms by suppressing the cross-talk noise from adjacent holograms by using depth-direction multiplexing rather than in-plane multiplexing. Numerical results indicate that the number of multiplexed holograms in three-layer recording can be increased by 1.44 times as large as that of a single-layer recording when an acceptable signal-to-noise ratio is set to be 2 when NA=0.43 and the thickness of the recording medium is 0.5 mm.

  15. Multiplex RT-PCR assay for differentiating European swine influenza virus subtypes H1N1, H1N2 and H3N2.

    Science.gov (United States)

    Chiapponi, Chiara; Moreno, Ana; Barbieri, Ilaria; Merenda, Marianna; Foni, Emanuela

    2012-09-01

    In Europe, three major swine influenza viral (SIV) subtypes (H1N1, H1N2 and H3N2) have been isolated in pigs. Developing a test that is able to detect and identify the subtype of the circulating strain rapidly during an outbreak of respiratory disease in the pig population is of essential importance. This study describes two multiplex RT-PCRs which distinguish the haemagglutinin (HA) gene and the neuraminidase (NA) gene of the three major subtypes of SIV circulating in Europe. The HA PCR was able to identify the lineage (avian or human) of the HA of H1 subtypes. The analytical sensitivity of the test, considered to be unique, was assessed using three reference viruses. The detection limit corresponded to 1×10(-1) TCID(50)/200μl for avian-like H1N1, 1×10(0) TCID(50)/200μl for human-like H1N2 and 1×10(1) TCID(50)/200μl for H3N2 SIV. The multiplex RT-PCR was first carried out on a collection of 70 isolated viruses showing 100% specificity and then on clinical samples, from which viruses had previously been isolated, resulting in an 89% positive specificity of the viral subtype. Finally, the test was able to identify the viral subtype correctly in 56% of influenza A positive samples, from which SIV had not been isolated previously. It was also possible to identify mixed viral infections and the circulation of a reassortant strain before performing genomic studies. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Clonal diversity and population genetic structure of arbuscular mycorrhizal fungi (Glomus spp.) studied by multilocus genotyping of single spores

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    A nested multiplex PCR (polymerase chain reaction) approach was used for multilocus genotyping of arbuscular mycorrhizal fungal populations. This method allowed us to amplify multiple loci from Glomus single spores in a single PCR amplification. Variable introns in the two protein coding genes Gm......FOX2 and GmTOR2 were applied as codominant genetic markers together with the LSU rDNA.   Genetic structure of Glomus spp. populations from an organically and a conventionally cultured field were compared by hierarchical sampling of spores from four plots in each field. Multilocus genotypes were...

  17. Topology-optimized silicon photonic wire mode (de)multiplexer

    DEFF Research Database (Denmark)

    Frellsen, Louise Floor; Frandsen, Lars Hagedorn; Ding, Yunhong

    2015-01-01

    We have designed and for the first time experimentally verified a topology optimized mode (de)multiplexer, which demultiplexes the fundamental and the first order mode of a double mode photonic wire to two separate single mode waveguides (and multiplexes vice versa). The device has a footprint...

  18. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  19. Development of a multiplex real-time PCR assay for detection of human enteric viruses other than norovirus using samples collected from gastroenteritis patients in Fukui Prefecture, Japan.

    Science.gov (United States)

    Kowada, Kazuaki; Takeuchi, Kenji; Hirano, Eiko; Toho, Miho; Sada, Kiyonao

    2018-01-01

    There are many varieties of gastroenteritis viruses, of which norovirus (NoV) accounts for over 90% of the viral food poisoning incidents in Japan. However, protocols for rapidly identifying other gastroenteritis viruses need to be established to investigate NoV-negative cases intensively. In this study, a multiplex real-time PCR assay targeting rotavirus A, rotavirus C, sapovirus, astrovirus, adenovirus, and enterovirus was developed using stool samples collected from gastroenteritis patients between 2010 and 2013 in Fukui Prefecture, Japan. Of the 126 samples collected sporadically from pediatric patients with suspected infectious gastroenteritis, 51 were positive for non-NoV target viruses, whereas 27 were positive for NoV, showing a high prevalence of non-NoV viruses in pediatric patients. In contrast, testing in 382 samples of 58 gastroenteritis outbreaks showed that non-NoV viruses were detected in 13 samples, with NoV in 267. Of the 267 NoV-positive patients, only two were co-infected with non-NoV target viruses, suggesting that testing for non-NoV gastroenteritis viruses in NoV-positive samples was mostly unnecessary in outbreak investigations. Given these results, multiplex real-time PCR testing for non-NoV gastroenteritis viruses, conducted separately from NoV testing, may be helpful to deal with two types of epidemiological investigations, regular surveillance of infectious gastroenteritis and urgent testing when gastroenteritis outbreaks occur. © 2017 Wiley Periodicals, Inc.

  20. Reconfigurable digital receiver for 8PSK subcarrier multiplexed and 16QAM single carrier phase‐modulated radio over fiber links

    DEFF Research Database (Denmark)

    Guerrero Gonzalez, Neil; Zibar, Darko; Yu, Xianbin

    2011-01-01

    A reconfigurable digital receiver based on the k‐means algorithm is proposed for phase‐modulated subcarrier multiplexed (SCM) and quadrature amplitude‐modulated single carrier, phase‐modulated radio‐over‐fiber links. We report successful demodulation after 40 km single mode fiber transmission wit...... with three 50 Mbaud 8PSK SCM signals and a 312.5 Mbaud 16QAM single carrier. © 2011 Wiley Periodicals, Inc. Microwave Opt Technol Lett 53:1015–1018, 2011; View this article online at wileyonlinelibrary.com. DOI 10.1002/mop.25905...

  1. Demonstration of Time Domain Multiplexed Readout for Magnetically Coupled Calorimeters

    Science.gov (United States)

    Porst, J.-P.; Adams, J. S.; Balvin, M.; Bandler, S.; Beyer, J.; Busch, S. E.; Drung, D.; Seidel, G. M.; Smith, S. J.; Stevenson, T. R.

    2012-01-01

    Magnetically coupled calorimeters (MCC) have extremely high potential for x-ray applications due to the inherent high energy resolution capability and being non-dissipative. Although very high energy-resolution has been demonstrated, until now there has been no demonstration of multiplexed read-out. We report on the first realization of a time domain multiplexed (TDM) read-out. While this has many similarities with TDM of transition-edge-sensors (TES), for MGGs the energy resolution is limited by the SQUID read-out noise and requires the well established scheme to be altered in order to minimize degradation due to noise aliasing effects. In cur approach, each pixel is read out by a single first stage SQUID (SQ1) that is operated in open loop. The outputs of the SQ1 s are low-pass filtered with an array of low cross-talk inductors, then fed into a single-stage SQUID TD multiplexer. The multiplexer is addressed from room temperature and read out through a single amplifier channel. We present results achieved with a new detector platform. Noise performance is presented and compared to expectations. We have demonstrated multiplexed X-ray spectroscopy at 5.9keV with delta_FWHM=10eV. In an optimized setup, we show it is possible to multiplex 32 detectors without significantly degrading the Intrinsic detector resolution.

  2. A high-throughput multiplex method adapted for GMO detection.

    Science.gov (United States)

    Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

    2008-12-24

    A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

  3. Evaluation of two real-time multiplex PCR screening assays detecting fetal RHD in plasma from RhD negative women to ascertain the requirement for antenatal RhD prophylaxis

    DEFF Research Database (Denmark)

    Clausen, Frederik Banch; Krog, Grethe Risum; Rieneck, Klaus

    2011-01-01

    and 5. We used the same fluorescent dye for the exon 7 and 10 probes to increase sensitivity; exon 5 was VIC labeled. We evaluated possible inhibition of DNA amplification with dilution experiments. We then tested the two multiplex assays with DNA extracted from 97 plasma samples from 38 RhD negative......OBJECTIVE: To evaluate two different multiplex real-time PCR assays detecting fetal RHD for screening of RhD negative women in relation to antenatal RhD prophylaxis. METHODS: We designed a duplex assay for the detection of RHD exon 7 and 10 and a triplex assay for the detection of RHD exon 7, 10...... assay (exon 7/10), accuracy was 94.2%. Detection of exon 5 was less reliable. CONCLUSION: The duplex assay using exon 7/10 was the most reliable for prenatal prediction of fetal RhD type as a candidate assay for screening of RhD negative women in relation to antenatal RhD prophylaxis. The triplex assay...

  4. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  5. Rapid and inexpensive body fluid identification by RNA profiling-based multiplex High Resolution Melt (HRM analysis [v1; ref status: indexed, http://f1000r.es/2hj

    Directory of Open Access Journals (Sweden)

    Erin K. Hanson

    2013-12-01

    Full Text Available Positive identification of the nature of biological material present on evidentiary items can be crucial for understanding the circumstances surrounding a crime. However, traditional protein-based methods do not permit the identification of all body fluids and tissues, and thus molecular based strategies for the conclusive identification of all forensically relevant biological fluids and tissues need to be developed. Messenger RNA (mRNA profiling is an example of such a molecular-based approach. Current mRNA body fluid identification assays involve capillary electrophoresis (CE or quantitative RT-PCR (qRT-PCR platforms, each with its own limitations. Both platforms require the use of expensive fluorescently labeled primers or probes. CE-based assays require separate amplification and detection steps thus increasing the analysis time. For qRT-PCR assays, only 3-4 markers can be included in a single reaction since each requires a different fluorescent dye. To simplify mRNA profiling assays, and reduce the time and cost of analysis, we have developed single- and multiplex body fluid High Resolution Melt (HRM assays for the identification of common forensically relevant biological fluids and tissues. The incorporated biomarkers include IL19 (vaginal secretions, IL1F7 (skin, ALAS2 (blood, MMP10 (menstrual blood, HTN3 (saliva and TGM4 (semen.  The HRM assays require only unlabeled PCR primers and a single saturating intercalating fluorescent dye (Eva Green. Each body-fluid-specific marker can easily be identified by the presence of a distinct melt peak. Usually, HRM assays are used to detect variants or isoforms for a single gene target. However, we have uniquely developed duplex and triplex HRM assays to permit the simultaneous detection of multiple targets per reaction. Here we describe the development and initial performance evaluation of the developed HRM assays. The results demonstrate the potential use of HRM assays for rapid, and relatively

  6. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  7. MiniX-STR multiplex system population study in Japan and application to degraded DNA analysis.

    Science.gov (United States)

    Asamura, H; Sakai, H; Kobayashi, K; Ota, M; Fukushima, H

    2006-05-01

    We sought to evaluate a more effective system for analyzing X-chromosomal short tandem repeats (X-STRs) in highly degraded DNA. To generate smaller amplicon lengths, we designed new polymerase chain reaction (PCR) primers for DXS7423, DXS6789, DXS101, GATA31E08, DXS8378, DXS7133, DXS7424, and GATA165B12 at X-linked short tandem repeat (STR) loci, devising two miniX-multiplex PCR systems. Among 333 Japanese individuals, these X-linked loci were detected in amplification products ranging in length from 76 to 169 bp, and statistical analyses of the eight loci indicated a high usefulness for the Japanese forensic practice. Results of tests on highly degraded DNA indicated the miniX-STR multiplex strategies to be an effective system for analyzing degraded DNA. We conclude that analysis by the current miniX-STR multiplex systems offers high effectiveness for personal identification from degraded DNA samples.

  8. Empirical evaluation of humpback whale telomere length estimates; quality control and factors causing variability in the singleplex and multiplex qPCR methods

    DEFF Research Database (Denmark)

    Olsen, Morten Tange; Bérubé, Martine; Robbins, Jooke

    2012-01-01

    BACKGROUND:Telomeres, the protective cap of chromosomes, have emerged as powerful markers of biological age and life history in model and non-model species. The qPCR method for telomere length estimation is one of the most common methods for telomere length estimation, but has received recent...... steps of qPCR. In order to evaluate the utility of the qPCR method for telomere length estimation in non-model species, we carried out four different qPCR assays directed at humpback whale telomeres, and subsequently performed a rigorous quality control to evaluate the performance of each assay. RESULTS...... to 40% depending on assay and quantification method, however this variation only affected telomere length estimates in the worst performing assays. CONCLUSION:Our results suggest that seemingly well performing qPCR assays may contain biases that will only be detected by extensive quality control...

  9. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jakociunas, Tadas; Bonde, Ida; Herrgard, Markus

    2015-01-01

    CRISPR/Cas9 is a simple and efficient tool for targeted and marker-free genome engineering. Here, we report the development and successful application of a multiplex CRISPR/Cas9 system for genome engineering of up to 5 different genomic loci in one transformation step in baker's yeast Saccharomyces...... cerevisiae. To assess the specificity of the tool we employed genome re-sequencing to screen for off-target sites in all single knock-out strains targeted by different gRNAs. This extensive analysis identified no more genome variants in CRISPR/Cas9 engineered strains compared to wild-type reference strains...

  10. Immunization of Epidemics in Multiplex Networks

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks. PMID:25401755

  11. Immunization of epidemics in multiplex networks.

    Science.gov (United States)

    Zhao, Dawei; Wang, Lianhai; Li, Shudong; Wang, Zhen; Wang, Lin; Gao, Bo

    2014-01-01

    Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted) immunization and layer node-based random (targeted) immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER) random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF) networks.

  12. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Directory of Open Access Journals (Sweden)

    Henrich Birgit

    2008-04-01

    Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

  13. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Science.gov (United States)

    Schaeffer, Anke; Henrich, Birgit

    2008-01-01

    Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

  14. Molecular differentiation of Opisthorchis viverrini and Clonorchis sinensis eggs by multiplex real-time PCR with high resolution melting analysis.

    Science.gov (United States)

    Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Laummaunwai, Porntip; Lulitanond, Viraphong; Doanh, Pham Ngoc; Maleewong, Wanchai

    2013-12-01

    Opisthorchis viverrini and Clonorchis sinensis are parasites known to be carcinogenic and causative agents of cholangiocarcinoma in Asia. The standard method for diagnosis for those parasite infections is stool examination to detect parasite eggs. However, the method has low sensitivity, and eggs of O. viverrini and C. sinensis are difficult to distinguish from each other and from those of some other trematodes. Here, we report a multiplex real-time PCR coupled with high resolution melting (HRM) analysis for the differentiation of O. viverrini and C. sinensis eggs in fecal samples. Using 2 pairs of species-specific primers, DNA sequences from a portion of the mitochondrial NADH dehydrogenase subunit 2 (nad 2) gene, were amplified to generate 209 and 165 bp products for O. viverrini and C. sinensis, respectively. The distinct characteristics of HRM patterns were analyzed, and the melting temperatures peaked at 82.4±0.09℃ and 85.9±0.08℃ for O. viverrini and C. sinensis, respectively. This technique was able to detect as few as 1 egg of O. viverrini and 2 eggs of C. sinensis in a 150 mg fecal sample, which is equivalent to 7 and 14 eggs per gram of feces, respectively. The method is species-specific, rapid, simple, and does not require fluorescent probes or post-PCR processing for discrimination of eggs of the 2 species. It offers a new tool for differentiation and detection of Asian liver fluke infections in stool specimens.

  15. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting.

    Directory of Open Access Journals (Sweden)

    Jermaine Khumalo

    Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.

  16. Molecular traceability of the species origin of meats using multiplex ...

    African Journals Online (AJOL)

    The objective of this study was the designing of a fast and reliable multiplex polymerase chain reaction (PCR) identification system for testing the pure and mixed species origin of meat samples. For conducting this research, different primers were designed for each species according to the conserved region of mitochondrial ...

  17. Virus reactivations after autologous hematopoietic stem cell transplantation detected by multiplex PCR assay.

    Science.gov (United States)

    Inazawa, Natsuko; Hori, Tsukasa; Nojima, Masanori; Saito, Makoto; Igarashi, Keita; Yamamoto, Masaki; Shimizu, Norio; Yoto, Yuko; Tsutsumi, Hiroyuki

    2017-02-01

    Several studies have indicated that viral reactivations following allogeneic hematopoietic stem cell transplantation (allo-HSCT) are frequent, but viral reactivations after autologous HSCT (auto-HSCT) have not been investigated in detail. We performed multiplex polymerase chain reaction (PCR) assay to examine multiple viral reactivations simultaneously in 24 patients undergoing auto-HSCT between September 2010 and December 2012. Weekly whole blood samples were collected from pre- to 42 days post-HSCT, and tested for the following 13 viruses; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, adeno virus (ADV), BK virus (BKV), JC virus (JCV), parvovirus B19 (B19V), and hepatitis B virus (HBV).  Fifteen (63%) patients had at least one type of viral reactivation. HHV6 (n = 10; 41.7%) was most frequently detected followed by EBV (n = 7; 29.2%). HHV-6 peaked on day 21 after HSCT and promptly declined. In addition, HBV, CMV, HHV7, and B19V were each detected in one patient. HHV6 reactivation was detected in almost half the auto-HSCT patients, which was similar to the incidence in allo-HSCT patients. The incidence of EBV was unexpectedly high. Viral infections in patients undergoing auto-HSCT were higher than previously reported in other studies. Although there were no particular complications of viral infection, we should pay attention to possible viral reactivations in auto-HSCT patients. J. Med. Virol. 89:358-362, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. QPCR: Application for real-time PCR data management and analysis

    Directory of Open Access Journals (Sweden)

    Eichhorn Heiko

    2009-08-01

    Full Text Available Abstract Background Since its introduction quantitative real-time polymerase chain reaction (qPCR has become the standard method for quantification of gene expression. Its high sensitivity, large dynamic range, and accuracy led to the development of numerous applications with an increasing number of samples to be analyzed. Data analysis consists of a number of steps, which have to be carried out in several different applications. Currently, no single tool is available which incorporates storage, management, and multiple methods covering the complete analysis pipeline. Results QPCR is a versatile web-based Java application that allows to store, manage, and analyze data from relative quantification qPCR experiments. It comprises a parser to import generated data from qPCR instruments and includes a variety of analysis methods to calculate cycle-threshold and amplification efficiency values. The analysis pipeline includes technical and biological replicate handling, incorporation of sample or gene specific efficiency, normalization using single or multiple reference genes, inter-run calibration, and fold change calculation. Moreover, the application supports assessment of error propagation throughout all analysis steps and allows conducting statistical tests on biological replicates. Results can be visualized in customizable charts and exported for further investigation. Conclusion We have developed a web-based system designed to enhance and facilitate the analysis of qPCR experiments. It covers the complete analysis workflow combining parsing, analysis, and generation of charts into one single application. The system is freely available at http://genome.tugraz.at/QPCR

  19. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  20. Improving Genetic Evaluation of Litter Size Using a Single-step Model

    DEFF Research Database (Denmark)

    Guo, Xiangyu; Christensen, Ole Fredslund; Ostersen, Tage

    A recently developed single-step method allows genetic evaluation based on information from phenotypes, pedigree and markers simultaneously. This paper compared reliabilities of predicted breeding values obtained from single-step method and the traditional pedigree-based method for two litter size...... traits, total number of piglets born (TNB), and litter size at five days after birth (Ls 5) in Danish Landrace and Yorkshire pigs. The results showed that the single-step method combining phenotypic and genotypic information provided more accurate predictions than the pedigree-based method, not only...

  1. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Science.gov (United States)

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  2. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    Directory of Open Access Journals (Sweden)

    Maria Frølund

    Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  3. Immunization of epidemics in multiplex networks.

    Directory of Open Access Journals (Sweden)

    Dawei Zhao

    Full Text Available Up to now, immunization of disease propagation has attracted great attention in both theoretical and experimental researches. However, vast majority of existing achievements are limited to the simple assumption of single layer networked population, which seems obviously inconsistent with recent development of complex network theory: each node could possess multiple roles in different topology connections. Inspired by this fact, we here propose the immunization strategies on multiplex networks, including multiplex node-based random (targeted immunization and layer node-based random (targeted immunization. With the theory of generating function, theoretical analysis is developed to calculate the immunization threshold, which is regarded as the most critical index for the effectiveness of addressed immunization strategies. Interestingly, both types of random immunization strategies show more efficiency in controlling disease spreading on multiplex Erdös-Rényi (ER random networks; while targeted immunization strategies provide better protection on multiplex scale-free (SF networks.

  4. Molecular identification of Pseudoplatystoma sp. fish fillets by Multiplex PCR / Identificação molecular de filés de peixe Pseudoplatystoma sp. por PCR-Multiplex

    Directory of Open Access Journals (Sweden)

    Cátia Maria de Oliveira Lobo

    2014-08-01

    Full Text Available Nuclear and mitochondrial genes were used as molecular markers for verifying the iden-tity of fish fillets marketed as pintado (Pseudoplatystoma corruscans. Based on THE polymorphisms of nuclear DNA (RAG2, globin, and EF1 genes and mitochondrial regions (16S, we examined whether the fillets originated from inbred species of pintado or from hybrids derived from crosses between cachara (P. reticulatum and pintado. Nuclear genes from both species were detected in the analyzed fillets (n = 29. This clearly iden-tified these fish as interspecific hybrids (or F1/first filial generation of the type “cacha-pinta,” resulting from a cross between female cachara and male pintado. These results demonstrate that monitoring fish fillet trading is crucial for detecting discrepancies between the marketed species and related information declared on the label. Species that are frequently hybridized, such as pintado and cachara, require special attention. -------------------------------------------------------------------- Marcadores moleculares (PCR-Multiplex de genes nucleares e mitocondriais foram uti-lizados para verificar a identidade molecular de filés de peixe comercializados como pintado (Pseudoplatystoma corruscans com base em polimorfismos de regiões do DNA nuclear (genes RAG2, globina e EF1 e mitocondriais (16S para verificar se os filés per-tenciam a espécie pura de pintado ou se eram híbridos derivados do cruzamento entre cachara (Pseudoplatystoma reticulatum e pintado (Pseudoplatystoma corruscans. Os filés analisados (n = 29 apresentaram genes nucleares de ambas espécies P. corruscans e P. reticulatum, e desta forma, foram identificados como híbridos interespecíficos ou F1 (primeira geração filial do tipo “cachapinta” resultante do cruzamento entre uma fêmea de cachara e um macho de pintado. Estes resultados mostram que o monitora-mento da comercialização de filés de peixe é fundamental para identificar situações onde

  5. Brazilian ground beef authentication by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Andrey Carlos do Sacramento de Oliveira

    2018-02-01

    Full Text Available ABSTRACT: The aim of the present study was to assess the efficacy ofmultiplex PCR in detecting the adulterationof commercially available ground beefvia addition and/orsubstitution ofground buffalo meat. Experimentally adulterated ground beefsamples were prepared in triplicate, and dilutions of DNA from Bos taurus and Bubalusbubalis were prepared to determine the detection limit of the method. Concurrently, 91 ground meatsamples sold as “ground beef” were collected from differentstores in northern Brazil andanalyzed bymultiplex PCR. Buffalo DNA was detected in 17.5% of the collected ground meat samples.Our results showed that multiplex PCR is an efficient method for detectingthe incorporation of groundbuffalo meatatpercentages ranging from 10 to 100% and the incorporation of beef at percentages ranging from0.1 to 100% intoground meat samples.

  6. Centrality in earthquake multiplex networks

    Science.gov (United States)

    Lotfi, Nastaran; Darooneh, Amir Hossein; Rodrigues, Francisco A.

    2018-06-01

    Seismic time series has been mapped as a complex network, where a geographical region is divided into square cells that represent the nodes and connections are defined according to the sequence of earthquakes. In this paper, we map a seismic time series to a temporal network, described by a multiplex network, and characterize the evolution of the network structure in terms of the eigenvector centrality measure. We generalize previous works that considered the single layer representation of earthquake networks. Our results suggest that the multiplex representation captures better earthquake activity than methods based on single layer networks. We also verify that the regions with highest seismological activities in Iran and California can be identified from the network centrality analysis. The temporal modeling of seismic data provided here may open new possibilities for a better comprehension of the physics of earthquakes.

  7. PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.

    Science.gov (United States)

    Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H

    2014-04-15

    Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.

  8. Colloid-based multiplexed method for screening plant biomass-degrading glycoside hydrolase activities in microbial communities

    Energy Technology Data Exchange (ETDEWEB)

    Reindl, W.; Deng, K.; Gladden, J.M.; Cheng, G.; Wong, A.; Singer, S.W.; Singh, S.; Lee, J.-C.; Yao, J.-S.; Hazen, T.C.; Singh, A.K; Simmons, B.A.; Adams, P.D.; Northen, T.R.

    2011-05-01

    The enzymatic hydrolysis of long-chain polysaccharides is a crucial step in the conversion of biomass to lignocellulosic biofuels. The identification and characterization of optimal glycoside hydrolases is dependent on enzyme activity assays, however existing methods are limited in terms of compatibility with a broad range of reaction conditions, sample complexity, and especially multiplexity. The method we present is a multiplexed approach based on Nanostructure-Initiator Mass Spectrometry (NIMS) that allowed studying several glycolytic activities in parallel under diverse assay conditions. Although the substrate analogs carried a highly hydrophobic perfluorinated tag, assays could be performed in aqueous solutions due colloid formation of the substrate molecules. We first validated our method by analyzing known {beta}-glucosidase and {beta}-xylosidase activities in single and parallel assay setups, followed by the identification and characterization of yet unknown glycoside hydrolase activities in microbial communities.

  9. Prevalence and antimicrobial susceptibilities of anaerobic bacteria isolated from perforated corneal ulcers by culture and multiplex PCR: an evaluation in cases with keratitis and endophthalmitis.

    Science.gov (United States)

    Tokman, Hrisi Bahar; İskeleli, Güzin; Dalar, Zeynep Güngördü; Kangaba, Achille Aime; Demirci, Mehmet; Akay, Hatice K; Borsa, Bariş Ata; Algingil, Reyhan Çalişkan; Kocazeybek, Bekir S; Torun, Müzeyyen Mamal; Kiraz, Nuri

    2014-01-01

    Anaerobic bacteria play an important role in eye infections; however, there is limited epidemiologic data based on the the role of these bacteria in the etiology of keratitis and endophthalmitis. The aim of this re- search is to determine the prevalence of anaerobic bacteria in perforated corneal ulcers of patients with keratitis and endophthalmitis and to evaluate their antimicrobial susceptibilities. Corneal scrapings were taken by the ophthalmologist using sterile needles. For the isolation of anaerobic bacteria, samples were inoculated on specific media and were incubated under anaerobic conditions obtained with Anaero-Gen (Oxoid & Mitsubishi Gas Company) in anaerobic jars (Oxoid USA, Inc. Columbia, MD, USA). The molecular identification of anaerobic bacteria was performed by multiplex PCR and the susceptibilities of an- aerobic bacteria to penicillin, chloramphenicol, and clindamycin were determined with the E test (bioMerieux). 51 strains of anaerobic bacteria belonging to four different genuses were detected by multiplex PCR and only 46 strains were isolated by culture. All of them were found susceptible to chloramphenicol whereas penicillin resistance was found in 13.3% of P.anaerobius strains, clindamycin resistance was found in 34.8% of P.acnes and 13.3% of P. anaerobius strains. Additionnaly, one strain of P. granulosum was found resistant to clindamycin, one strain of B. fragilis and one strain of P.melaninogenica were found resistant to penicillin and clindamycin. Routine analyses of anaerobes in perforated corneal ulcers is inevitable and usage of appropriate molecular methods, for the detection of bacteria responsible from severe infections which might not be deter- mined by cultivation, may serve for the early decision of the appropriate treatment. Taking into account the in- creasing antimicrobial resistance of anaerobic bacteria, alternative eye specific antibiotics effective against anaer- obes are needed to achieve a successful treatment.

  10. Solubilization of Single-walled Carbon Nanotubes with Single- stranded DNA Generated from Asymmetric PCR

    Directory of Open Access Journals (Sweden)

    Chunhai Fan

    2007-07-01

    Full Text Available Carbon nanotubes (CNTs can be effectively dispersed and functionalized bywrapping with long single-stranded DNA (ssDNA synthesized by asymmetric PCR. ThessDNA-CNTs attached on surface of glass carbon electrode made it possible forelectrochemical analysis and sensing, which was demonstrated by reduction of H2O2 onhemoglobin/ssDNA-CNTs modified electrodes. This research showed the potentialapplication of DNA-functionalised CNTs in construction of future electrochemicalbiosensors.

  11. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Yiwen [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Duarte, Gabriela R.M. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Universidade Federal de Goiás, Goiânia, GO 74690-900 (Brazil); Poe, Brian L.; Riehl, Paul S. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Santos, Fernando M. dos; Martin-Didonet, Claudia C.G. [Universidade Estadual de Goiás, Anápolis, GO 75132-400 (Brazil); Carrilho, Emanuel [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos, SP 13566-590 (Brazil); Instituto Nacional de Ciência e Tecnologia de Bioanalítica, CP 6154, Campinas, SP 13083-970 (Brazil); Landers, James P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia Health Science Center, Charlottesville, VA (United States)

    2015-12-11

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s{sup −1} with a cooling rate of roughly −12 ± 0.9 °C s{sup −1} assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low

  12. A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control

    International Nuclear Information System (INIS)

    Ouyang, Yiwen; Duarte, Gabriela R.M.; Poe, Brian L.; Riehl, Paul S.; Santos, Fernando M. dos; Martin-Didonet, Claudia C.G.; Carrilho, Emanuel; Landers, James P.

    2015-01-01

    Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s −1 with a cooling rate of roughly −12 ± 0.9 °C s −1 assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification

  13. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  14. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  15. Single-step link of the superdeformed band in 143Eu

    International Nuclear Information System (INIS)

    Atac, A.; Bergstroem, M.H.; Nyberg, J.; Persson, J.; Herskind, B.; Joss, D.T.; Lipoglavsek, M.; Tucek, K.

    1996-01-01

    A discrete γ-ray ransition with an energy of 3360.6 keV deexciting the second lowest SD state in 143 Eu has been discovered. It carries 3.2 % of the full intensity of the band and feeds into a nearly spherical state which is above the I = 35/2 (+) , E x =4947 keV level. The exact placement of the single-step link is, however, not established due to the specially complicated level scheme in the region of interest. The energy of the single-step link agrees well with the previously determined two-step links. (orig.)

  16. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Escherichia coli H-Genotyping PCR: a Complete and Practical Platform for Molecular H Typing.

    Science.gov (United States)

    Banjo, Masaya; Iguchi, Atsushi; Seto, Kazuko; Kikuchi, Taisei; Harada, Tetsuya; Scheutz, Flemming; Iyoda, Sunao

    2018-06-01

    In Escherichia coli , more than 180 O groups and 53 H types have been recognized. The O:H serotyping of E. coli strains is an effective method for identifying strains with pathogenic potential and classifying them into clonal groups. In particular, the serotyping of Shiga toxin-producing E. coli (STEC) strains provides valuable information to evaluate the routes, sources, and prevalence of agents in outbreak investigations and surveillance. Here, we present a complete and practical PCR-based H-typing system, E. coli H-genotyping PCR, consisting of 10 multiplex PCR kits with 51 single PCR primer pairs. Primers were designed based on a detailed comparative analysis of sequences from all H-antigen (flagellin)-encoding genes, fliC and its homologs. The specificity of this system was confirmed by using all H type reference strains. Additionally, 362 serotyped wild strains were also used to evaluate its practicality. All 277 H-type-identified isolates gave PCR products that corresponded to the results of serological H typing. Moreover, 76 nonmotile and nine untypeable strains could be successfully subtyped into any H type by the PCR system. The E. coli H-genotyping PCR developed here allows broader, rapid, and low-cost subtyping of H types and will assist epidemiological studies as well as surveillance of pathogenic E. coli . Copyright © 2018 American Society for Microbiology.

  18. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    OpenAIRE

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  19. Single-cell qPCR on dispersed primary pituitary cells -an optimized protocol

    Directory of Open Access Journals (Sweden)

    Haug Trude M

    2010-11-01

    Full Text Available Abstract Background The incidence of false positives is a potential problem in single-cell PCR experiments. This paper describes an optimized protocol for single-cell qPCR measurements in primary pituitary cell cultures following patch-clamp recordings. Two different cell harvesting methods were assessed using both the GH4 prolactin producing cell line from rat, and primary cell culture from fish pituitaries. Results Harvesting whole cells followed by cell lysis and qPCR performed satisfactory on the GH4 cell line. However, harvesting of whole cells from primary pituitary cultures regularly produced false positives, probably due to RNA leakage from cells ruptured during the dispersion of the pituitary cells. To reduce RNA contamination affecting the results, we optimized the conditions by harvesting only the cytosol through a patch pipette, subsequent to electrophysiological experiments. Two important factors proved crucial for reliable harvesting. First, silanizing the patch pipette glass prevented foreign extracellular RNA from attaching to charged residues on the glass surface. Second, substituting the commonly used perforating antibiotic amphotericin B with β-escin allowed efficient cytosol harvest without loosing the giga seal. Importantly, the two harvesting protocols revealed no difference in RNA isolation efficiency. Conclusion Depending on the cell type and preparation, validation of the harvesting technique is extremely important as contaminations may give false positives. Here we present an optimized protocol allowing secure harvesting of RNA from single cells in primary pituitary cell culture following perforated whole cell patch clamp experiments.

  20. Multiplex pyrosequencing assay using AdvISER-MH-PYRO algorithm: a case for rapid and cost-effective genotyping analysis of prostate cancer risk-associated SNPs.

    Science.gov (United States)

    Ambroise, Jérôme; Butoescu, Valentina; Robert, Annie; Tombal, Bertrand; Gala, Jean-Luc

    2015-06-25

    Single Nucleotide Polymorphisms (SNPs) identified in Genome Wide Association Studies (GWAS) have generally moderate association with related complex diseases. Accordingly, Multilocus Genetic Risk Scores (MGRSs) have been computed in previous studies in order to assess the cumulative association of multiple SNPs. When several SNPs have to be genotyped for each patient, using successive uniplex pyrosequencing reactions increases analytical reagent expenses and Turnaround Time (TAT). While a set of several pyrosequencing primers could theoretically be used to analyze multiplex amplicons, this would generate overlapping primer-specific pyro-signals that are visually uninterpretable. In the current study, two multiplex assays were developed consisting of a quadruplex (n=4) and a quintuplex (n=5) polymerase chain reaction (PCR) each followed by multiplex pyrosequencing analysis. The aim was to reliably but rapidly genotype a set of prostate cancer-related SNPs (n=9). The nucleotide dispensation order was selected using SENATOR software. Multiplex pyro-signals were analyzed using the new AdvISER-MH-PYRO software based on a sparse representation of the signal. Using uniplex assays as gold standard, the concordance between multiplex and uniplex assays was assessed on DNA extracted from patient blood samples (n = 10). All genotypes (n=90) generated with the quadruplex and the quintuplex pyroquencing assays were perfectly (100 %) concordant with uniplex pyrosequencing. Using multiplex genotyping approach for analyzing a set of 90 patients allowed reducing TAT by approximately 75 % (i.e., from 2025 to 470 min) while reducing reagent consumption and cost by approximately 70 % (i.e., from ~229 US$ /patient to ~64 US$ /patient). This combination of quadruplex and quintuplex pyrosequencing and PCR assays enabled to reduce the amount of DNA required for multi-SNP analysis, and to lower the global TAT and costs of SNP genotyping while providing results as reliable as uniplex