Single-molecule mechanics of protein-labelled DNA handles
Directory of Open Access Journals (Sweden)
Vivek S. Jadhav
2016-01-01
Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
Single-molecule analysis of DNA replication in Xenopus egg extracts
Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel
The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the
Nano-manipulation of single DNA molecules
International Nuclear Information System (INIS)
Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie
2004-01-01
Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
International Nuclear Information System (INIS)
Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira
2009-01-01
We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions
Quantifying DNA melting transitions using single-molecule force spectroscopy
International Nuclear Information System (INIS)
Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J
2009-01-01
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
Quantifying DNA melting transitions using single-molecule force spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu
2009-01-21
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
Directory of Open Access Journals (Sweden)
Fatemeh Moayed
Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Single-molecule chemical reactions on DNA origami
DEFF Research Database (Denmark)
Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru
2010-01-01
as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...
How to read and write mechanical information in DNA molecules
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET
Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William
2018-01-01
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...
Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy
Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto
2011-01-01
DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016
DNA analysis by single molecule stretching in nanofluidic biochips
DEFF Research Database (Denmark)
Abad, E.; Juarros, A.; Retolaza, A.
2011-01-01
Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET
Hohlbein, J.; Kapanidis, A.N.
2016-01-01
Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open
Single-molecule denaturation mapping of DNA in nanofluidic channels
DEFF Research Database (Denmark)
Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli
2010-01-01
Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Moayed, F.; Mashaghi, A.; Tans, S.J.
2013-01-01
Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an
Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems
Williams, Mark C
2011-01-01
This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...
Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.
2016-01-01
Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595
Single-molecule studies of DNA transcription using atomic force microscopy
International Nuclear Information System (INIS)
Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer
2012-01-01
Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels
Single Molecule Study of DNA Organization and Recombination
Xiao, Botao
We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force
Thermophoretic forces on DNA measured with a single-molecule spring balance
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe
2014-01-01
We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...
A single molecule DNA flow stretching microscope for undergraduates
Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.
2011-01-01
The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no
Analysis of DNA interactions using single-molecule force spectroscopy.
Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert
2013-06-01
Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.
Visualizing Single-molecule DNA Replication with Fluorescence Microscopy
Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van
2009-01-01
We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The
Single Molecule Screening of Disease DNA Without Amplification
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)
2006-01-01
The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
Multiplex single-molecule interaction profiling of DNA-barcoded proteins.
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M
2014-11-27
In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2006-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...
Developing DNA nanotechnology using single-molecule fluorescence.
Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal
2014-06-17
CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and
Chemo-mechanical pushing of proteins along single-stranded DNA.
Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M
2016-05-31
Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.
Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I
National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...
Single-strand DNA molecule translocation through nanoelectrode gaps
International Nuclear Information System (INIS)
Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W
2007-01-01
Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation
Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S
2018-04-18
Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.
Real-time single-molecule observation of rolling-circle DNA replication
Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van
2009-01-01
We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities
DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.
Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi
2017-12-06
We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
DEFF Research Database (Denmark)
Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders
2011-01-01
We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Single molecule DNA detection with an atomic vapor notch filter
Energy Technology Data Exchange (ETDEWEB)
Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)
2015-12-01
The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET
Directory of Open Access Journals (Sweden)
Mengyi Yang
2018-01-01
Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing
Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.
Directory of Open Access Journals (Sweden)
Jonghyun Park
2010-11-01
Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
DEFF Research Database (Denmark)
Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru
2010-01-01
DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....
Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments
International Nuclear Information System (INIS)
Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.
2007-01-01
We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
Single-molecule FRET unveils induced-fit mechanism for substrate selectivity in flap endonuclease 1
Rashid, Fahad
2017-02-23
Human flap endonuclease 1 (FEN1) and related structure-specific 5\\'nucleases precisely identify and incise aberrant DNA structures during replication, repair and recombination to avoid genomic instability. Yet, it is unclear how the 5\\'nuclease mechanisms of DNA distortion and protein ordering robustly mediate efficient and accurate substrate recognition and catalytic selectivity. Here, single-molecule sub-millisecond and millisecond analyses of FEN1 reveal a protein-DNA induced-fit mechanism that efficiently verifies substrate and suppresses off-target cleavage. FEN1 sculpts DNA with diffusion-limited kinetics to test DNA substrate. This DNA distortion mutually \\'locks\\' protein and DNA conformation and enables substrate verification with extreme precision. Strikingly, FEN1 never misses cleavage of its cognate substrate while blocking probable formation of catalytically competent interactions with noncognate substrates and fostering their pre-incision dissociation. These findings establish FEN1 has practically perfect precision and that separate control of induced-fit substrate recognition sets up the catalytic selectivity of the nuclease active site for genome stability.
Shirbini, Afnan
2017-05-01
Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.
Mechanical design of DNA nanostructures
Castro, Carlos E.; Su, Hai-Jun; Marras, Alexander E.; Zhou, Lifeng; Johnson, Joshua
2015-03-01
Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems.Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07153k
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination
Directory of Open Access Journals (Sweden)
Hsiu-Fang Fan
2018-05-01
Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.
Energy Technology Data Exchange (ETDEWEB)
Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2015-01-07
Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
Energy Technology Data Exchange (ETDEWEB)
Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)
2009-07-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
International Nuclear Information System (INIS)
Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.
2009-01-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation
International Nuclear Information System (INIS)
An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun
2007-01-01
We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Single molecular biology: coming of age in DNA replication.
Liu, Xiao-Jing; Lou, Hui-Qiang
2017-09-20
DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.
Multiplex single-molecule interaction profiling of DNA barcoded proteins
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.
2014-01-01
In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978
Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip
2014-10-21
Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
DNA under Force: Mechanics, Electrostatics, and Hydration
Directory of Open Access Journals (Sweden)
Jingqiang Li
2015-02-01
Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
Automation of a single-DNA molecule stretching device
DEFF Research Database (Denmark)
Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels
2015-01-01
We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...
Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V
2017-08-04
Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.
2008-01-01
Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of
Directory of Open Access Journals (Sweden)
Greta Zubaite
2017-02-01
Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.
Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions
Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.
2018-01-01
Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441
Directory of Open Access Journals (Sweden)
Ilko Bald
2014-09-01
Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.
Single-Molecule Stochastic Resonance
Directory of Open Access Journals (Sweden)
K. Hayashi
2012-08-01
Full Text Available Stochastic resonance (SR is a well-known phenomenon in dynamical systems. It consists of the amplification and optimization of the response of a system assisted by stochastic (random or probabilistic noise. Here we carry out the first experimental study of SR in single DNA hairpins which exhibit cooperatively transitions from folded to unfolded configurations under the action of an oscillating mechanical force applied with optical tweezers. By varying the frequency of the force oscillation, we investigate the folding and unfolding kinetics of DNA hairpins in a periodically driven bistable free-energy potential. We measure several SR quantifiers under varied conditions of the experimental setup such as trap stiffness and length of the molecular handles used for single-molecule manipulation. We find that a good quantifier of the SR is the signal-to-noise ratio (SNR of the spectral density of measured fluctuations in molecular extension of the DNA hairpins. The frequency dependence of the SNR exhibits a peak at a frequency value given by the resonance-matching condition. Finally, we carry out experiments on short hairpins that show how SR might be useful for enhancing the detection of conformational molecular transitions of low SNR.
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.
2018-01-01
Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.
Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J
2018-01-10
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...
DNA replication at the single-molecule level
Stratmann, S.A.; Oijen, A.M. van
2014-01-01
A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or
Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond
Directory of Open Access Journals (Sweden)
David eDavidson
2013-01-01
Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA
Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi
2012-03-14
We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.
Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai
2018-01-09
Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Single DNA denaturation and bubble dynamics
International Nuclear Information System (INIS)
Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level
Raducanu, Vlad-Stefan
2016-05-01
Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.
Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.
Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J
2003-10-01
Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.
International Nuclear Information System (INIS)
Yamamoto, Takatoki; Fujii, Teruo
2010-01-01
Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.
Seol, Yeonee; Zhang, Hongliang; Agama, Keli; Lorence, Nicholas; Pommier, Yves; Neuman, Keir C.
2015-01-01
Human nuclear type IB topoisomerase (Top1) inhibitors are widely used and powerful anti-cancer agents. In this study, we introduce and validate a single-molecule supercoil relaxation assay as a molecular pharmacology tool for characterizing therapeutically relevant Top1 inhibitors. Using this assay, we determined the effects on Top1 supercoil relaxation activity of four Top1 inhibitors; three clinically relevant: camptothecin, LMP-400, LMP-776 (both indenoisoquinoline derivatives), and one natural product in preclinical development, lamellarin-D. Our results demonstrate that Top1 inhibitors have two distinct effects on Top1 activity: a decrease in supercoil relaxation rate and an increase in religation inhibition. The type and magnitude of the inhibition mode depend both on the specific inhibitor and on the topology of the DNA substrate. In general, the efficacy of inhibition is significantly higher with supercoiled than with relaxed DNA substrates. Comparing single-molecule inhibition with cell growth inhibition (IC50) measurements showed a correlation between the binding time of the Top1 inhibitors and their cytotoxic efficacy, independent of the mode of inhibition. This study demonstrates that the single-molecule supercoil relaxation assay is a sensitive method to elucidate the detailed mechanisms of Top1 inhibitors and is relevant for the cellular efficacy of Top1 inhibitors. PMID:26351326
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon
2008-01-01
We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations
Fan, Hsiu-Fang
2012-01-01
Tyrosine family recombinases (YRs) are widely utilized in genome engineering systems because they can easily direct DNA rearrangement. Cre recombinases, one of the most commonly used types of YRs, catalyze site-specific recombination between two loxP sites without the need for high-energy cofactors, other accessory proteins or a specific DNA target sequence between the loxP sites. Previous structural, analytical ultracentrifuge and electrophoretic analyses have provided details of the reaction kinetics and mechanisms of Cre recombinase activity; whether there are reaction intermediates or side pathways involved has been left unaddressed. Using tethered particle motion (TPM), the Cre-mediated site-specific recombination process has been delineated, from beginning to end, at the single-molecule level, including the formation of abortive complexes and wayward complexes blocking inactive nucleoprotein complexes from entering the recombination process. Reversibility in the strand-cleavage/-ligation process and the formation of a thermally stable Holliday junction intermediate were observed within the Cre-mediated site-specific recombination process. Rate constants for each elementary step, which explain the overall reaction outcomes under various conditions, were determined. Taking the findings of this study together, they demonstrate the potential of single-molecule methodology as an alternative approach for exploring reaction mechanisms in detail. PMID:22467208
Single DNA denaturation and bubble dynamics
DEFF Research Database (Denmark)
Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
Controlled switching of single-molecule junctions by mechanical motion of a phenyl ring
Directory of Open Access Journals (Sweden)
Yuya Kitaguchi
2015-10-01
Full Text Available Mechanical methods for single-molecule control have potential for wide application in nanodevices and machines. Here we demonstrate the operation of a single-molecule switch made functional by the motion of a phenyl ring, analogous to the lever in a conventional toggle switch. The switch can be actuated by dual triggers, either by a voltage pulse or by displacement of the electrode, and electronic manipulation of the ring by chemical substitution enables rational control of the on-state conductance. Owing to its simple mechanics, structural robustness, and chemical accessibility, we propose that phenyl rings are promising components in mechanical molecular devices.
Single molecule insights on conformational selection and induced fit mechanism
DEFF Research Database (Denmark)
Hatzakis, Nikos
2014-01-01
. To describe the molecular basis of this behavior, two main mechanisms have been advanced: 'induced fit' and 'conformational selection'. Our understanding of these models relies primarily on NMR, computational studies and kinetic measurements. These techniques report the average behavior of a large ensemble...... of unsynchronized molecules, often masking intrinsic dynamic behavior of proteins and biologically significant transient intermediates. Single molecule measurements are emerging as a powerful tool for characterizing protein function. They offer the direct observation and quantification of the activity, abundance...
Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David
2015-12-01
Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ~5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer.
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
Directory of Open Access Journals (Sweden)
T Banerjee
Full Text Available DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM and spectroscopy (AFS. The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
Multiplexed single-molecule force spectroscopy using a centrifuge.
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P
2016-03-17
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.
Electrical properties and mechanical stability of anchoring groups for single-molecule electronics
Directory of Open Access Journals (Sweden)
Riccardo Frisenda
2015-07-01
Full Text Available We report on an experimental investigation of transport through single molecules, trapped between two gold nano-electrodes fabricated with the mechanically controlled break junction (MCBJ technique. The four molecules studied share the same core structure, namely oligo(phenylene ethynylene (OPE3, while having different aurophilic anchoring groups: thiol (SAc, methyl sulfide (SMe, pyridyl (Py and amine (NH2. The focus of this paper is on the combined characterization of the electrical and mechanical properties determined by the anchoring groups. From conductance histograms we find that thiol anchored molecules provide the highest conductance; a single-level model fit to current–voltage characteristics suggests that SAc groups exhibit a higher electronic coupling to the electrodes, together with better level alignment than the other three groups. An analysis of the mechanical stability, recording the lifetime in a self-breaking method, shows that Py and SAc yield the most stable junctions while SMe form short-lived junctions. Density functional theory combined with non-equlibrium Green’s function calculations help in elucidating the experimental findings.
Single DNA imaging and length quantification through a mobile phone microscope
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C
2015-04-01
DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.
Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.
Yang, Darren; Wong, Wesley P
2018-01-01
We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.
Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant
2017-11-01
Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...
Preface: Special Topic on Single-Molecule Biophysics.
Makarov, Dmitrii E; Schuler, Benjamin
2018-03-28
Single-molecule measurements are now almost routinely used to study biological systems and processes. The scope of this special topic emphasizes the physics side of single-molecule observations, with the goal of highlighting new developments in physical techniques as well as conceptual insights that single-molecule measurements bring to biophysics. This issue also comprises recent advances in theoretical physical models of single-molecule phenomena, interpretation of single-molecule signals, and fundamental areas of statistical mechanics that are related to single-molecule observations. A particular goal is to illustrate the increasing synergy between theory, simulation, and experiment in single-molecule biophysics.
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
In silico single-molecule manipulation of DNA with rigid body dynamics.
Directory of Open Access Journals (Sweden)
Pascal Carrivain
2014-02-01
Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.
Single Molecule Electronics and Devices
Tsutsui, Makusu; Taniguchi, Masateru
2012-01-01
The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345
Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.
Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph
2018-01-23
Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.
Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses
International Nuclear Information System (INIS)
Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.
2003-01-01
DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses
Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar
2016-01-01
The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712
Single molecule transcription profiling with AFM
International Nuclear Information System (INIS)
Reed, Jason; Mishra, Bud; Pittenger, Bede; Magonov, Sergei; Troke, Joshua; Teitell, Michael A; Gimzewski, James K
2007-01-01
Established techniques for global gene expression profiling, such as microarrays, face fundamental sensitivity constraints. Due to greatly increasing interest in examining minute samples from micro-dissected tissues, including single cells, unorthodox approaches, including molecular nanotechnologies, are being explored in this application. Here, we examine the use of single molecule, ordered restriction mapping, combined with AFM, to measure gene transcription levels from very low abundance samples. We frame the problem mathematically, using coding theory, and present an analysis of the critical error sources that may serve as a guide to designing future studies. We follow with experiments detailing the construction of high density, single molecule, ordered restriction maps from plasmids and from cDNA molecules, using two different enzymes, a result not previously reported. We discuss these results in the context of our calculations
Kühnemund, M; Nilsson, M
2015-05-15
Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.
Friedrich, Sarah; Wang, Tza-Huei
Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.
Energy Technology Data Exchange (ETDEWEB)
Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)
2016-05-01
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Applications of a single-molecule detection in early disease diagnosis and enzymatic reaction study
Energy Technology Data Exchange (ETDEWEB)
Li, Jiangwei [Iowa State Univ., Ames, IA (United States)
2008-01-01
Various single-molecule techniques were utilized for ultra-sensitive early diagnosis of viral DNA and antigen and basic mechanism study of enzymatic reactions. DNA of human papilloma virus (HPV) served as the screening target in a flow system. Alexa Fluor 532 (AF532) labeled single-stranded DNA probes were hybridized to the target HPV-16 DNA in solution. The individual hybridized molecules were imaged with an intensified charge-coupled device (ICCD) in two ways. In the single-color mode, target molecules were detected via fluorescence from hybridized probes only. This system could detect HPV-16 DNA in the presence of human genomic DNA down to 0.7 copy/cell and had a linear dynamic range of over 6 orders of magnitude. In the dual-color mode, fluorescence resonance energy transfer (FRET) was employed to achieve zero false-positive count. We also showed that DNA extracts from Pap test specimens did not interfere with the system. A surface-based method was used to improve the throughput of the flow system. HPV-16 DNA was hybridized to probes on a glass surface and detected with a total internal reflection fluorescence (TIRF) microscope. In the single-probe mode, the whole genome and target DNA were fluorescently labeled before hybridization, and the detection limit is similar to the flow system. In the dual-probe mode, a second probe was introduced. The linear dynamic range covers 1.44-7000 copies/cell, which is typical of early infection to near-cancer stages. The dual-probe method was tested with a crudely prepared sample. Even with reduced hybridization efficiency caused by the interference of cellular materials, we were still able to differentiate infected cells from healthy cells. Detection and quantification of viral antigen with a novel single-molecule immunosorbent assay (SMISA) was achieved. Antigen from human immunodeficiency virus type 1(HIV-1) was chosen to be the target in this study. The target was sandwiched between a monoclonal capture antibody and a
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
TALE proteins search DNA using a rotationally decoupled mechanism.
Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M
2016-10-01
Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.
Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason
2009-03-01
The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.
Single-Molecule Plasmon Sensing: Current Status and Future Prospects.
Taylor, Adam B; Zijlstra, Peter
2017-08-25
Single-molecule detection has long relied on fluorescent labeling with high quantum-yield fluorophores. Plasmon-enhanced detection circumvents the need for labeling by allowing direct optical detection of weakly emitting and completely nonfluorescent species. This review focuses on recent advances in single molecule detection using plasmonic metal nanostructures as a sensing platform, particularly using a single particle-single molecule approach. In the past decade two mechanisms for plasmon-enhanced single-molecule detection have been demonstrated: (1) by plasmonically enhancing the emission of weakly fluorescent biomolecules, or (2) by monitoring shifts of the plasmon resonance induced by single-molecule interactions. We begin with a motivation regarding the importance of single molecule detection, and advantages plasmonic detection offers. We describe both detection mechanisms and discuss challenges and potential solutions. We finalize by highlighting the exciting possibilities in analytical chemistry and medical diagnostics.
Central dogma at the single-molecule level in living cells.
Li, Gene-Wei; Xie, X Sunney
2011-07-20
Gene expression originates from individual DNA molecules within living cells. Like many single-molecule processes, gene expression and regulation are stochastic, that is, sporadic in time. This leads to heterogeneity in the messenger-RNA and protein copy numbers in a population of cells with identical genomes. With advanced single-cell fluorescence microscopy, it is now possible to quantify transcriptomes and proteomes with single-molecule sensitivity. Dynamic processes such as transcription-factor binding, transcription and translation can be monitored in real time, providing quantitative descriptions of the central dogma of molecular biology and the demonstration that a stochastic single-molecule event can determine the phenotype of a cell.
Konishi, Tatsuya; Kiguchi, Manabu; Takase, Mai; Nagasawa, Fumika; Nabika, Hideki; Ikeda, Katsuyoshi; Uosaki, Kohei; Ueno, Kosei; Misawa, Hiroaki; Murakoshi, Kei
2013-01-23
The in situ observation of geometrical and electronic structural dynamics of a single molecule junction is critically important in order to further progress in molecular electronics. Observations of single molecular junctions are difficult, however, because of sensitivity limits. Here, we report surface-enhanced Raman scattering (SERS) of a single 4,4'-bipyridine molecule under conditions of in situ current flow in a nanogap, by using nano-fabricated, mechanically controllable break junction (MCBJ) electrodes. When adsorbed at room temperature on metal nanoelectrodes in solution to form a single molecule junction, statistical analysis showed that nontotally symmetric b(1) and b(2) modes of 4,4'-bipyridine were strongly enhanced relative to observations of the same modes in solid or aqueous solutions. Significant changes in SERS intensity, energy (wavenumber), and selectivity of Raman vibrational bands that are coincident with current fluctuations provide information on distinct states of electronic and geometrical structure of the single molecule junction, even under large thermal fluctuations occurring at room temperature. We observed the dynamics of 4,4'-bipyridine motion between vertical and tilting configurations in the Au nanogap via b(1) and b(2) mode switching. A slight increase in the tilting angle of the molecule was also observed by noting the increase in the energies of Raman modes and the decrease in conductance of the molecular junction.
Shirbini, Afnan
2017-01-01
and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image
Extracting Models in Single Molecule Experiments
Presse, Steve
2013-03-01
Single molecule experiments can now monitor the journey of a protein from its assembly near a ribosome to its proteolytic demise. Ideally all single molecule data should be self-explanatory. However data originating from single molecule experiments is particularly challenging to interpret on account of fluctuations and noise at such small scales. Realistically, basic understanding comes from models carefully extracted from the noisy data. Statistical mechanics, and maximum entropy in particular, provide a powerful framework for accomplishing this task in a principled fashion. Here I will discuss our work in extracting conformational memory from single molecule force spectroscopy experiments on large biomolecules. One clear advantage of this method is that we let the data tend towards the correct model, we do not fit the data. I will show that the dynamical model of the single molecule dynamics which emerges from this analysis is often more textured and complex than could otherwise come from fitting the data to a pre-conceived model.
Fabrication of birefringent nanocylinders for single-molecule force and torque measurement
Li, Ping-Chun; Chang, Jen-Chien; La Porta, Arthur; Yu, Edward T.
2014-06-01
Optically anisotropic subwavelength scale dielectric particles have been shown to enable studies of the mechanical properties of bio-molecules via optical trapping and manipulation. However, techniques emphasized to date for fabrication of such particles generally suffer from limited uniformity and control over particle dimensions, or low throughput and high cost. Here, an approach for rapid, low-cost, fabrication of large quantities of birefringent quartz nanocylinders with dimensions optimized for optical torque wrench experiments is described. For a typical process, 108 or more quartz cylinders with diameters of 500 nm and heights of 800 nm, with uniformity of ±5% in each dimension, can be fabricated over ˜10 cm2 areas, for binding to a single bio-molecule, and harvested for use in optical trapping experiments. Use of these structures to measure extensional and torsional dynamics of single DNA molecules is demonstrated with measured forces and torques shown to be in very good agreement with previously reported results.
Fabrication of birefringent nanocylinders for single-molecule force and torque measurement
International Nuclear Information System (INIS)
Li, Ping-Chun; T Yu, Edward; Chang, Jen-Chien; La Porta, Arthur
2014-01-01
Optically anisotropic subwavelength scale dielectric particles have been shown to enable studies of the mechanical properties of bio-molecules via optical trapping and manipulation. However, techniques emphasized to date for fabrication of such particles generally suffer from limited uniformity and control over particle dimensions, or low throughput and high cost. Here, an approach for rapid, low-cost, fabrication of large quantities of birefringent quartz nanocylinders with dimensions optimized for optical torque wrench experiments is described. For a typical process, 10 8 or more quartz cylinders with diameters of 500 nm and heights of 800 nm, with uniformity of ±5% in each dimension, can be fabricated over ∼10 cm 2 areas, for binding to a single bio-molecule, and harvested for use in optical trapping experiments. Use of these structures to measure extensional and torsional dynamics of single DNA molecules is demonstrated with measured forces and torques shown to be in very good agreement with previously reported results. (papers)
Two-stage DNA compaction induced by silver ions suggests a cooperative binding mechanism
Jiang, Wen-Yan; Ran, Shi-Yong
2018-05-01
The interaction between silver ions and DNA plays an important role in the therapeutic use of silver ions and in related technologies such as DNA sensors. However, the underlying mechanism has not been fully understood. In this study, the dynamics of Ag+-DNA interaction at a single-molecule level was studied using magnetic tweezers. AgNO3 solutions with concentrations ranging from 1 μM to 20 μM led to a 1.4-1.8 μm decrease in length of a single λ-DNA molecule, indicating that Ag+ has a strong binding with DNA, causing the DNA conformational change. The compaction process comprises one linear declining stage and another sigmoid-shaped stage, which can be attributed to the interaction mechanism. Considering the cooperative effect, the sigmoid trend was well explained using a phenomenological model. By contrast, addition of silver nanoparticle solution induced no detectable transition of DNA. The dependence of the interaction on ionic strength and DNA concentration was examined via morphology characterization and particle size distribution measurement. The size of the Ag+-DNA complex decreased with an increase in Ag+ ionic strength ranging from 1 μM to 1 mM. Morphology characterization confirmed that silver ions induced DNA to adopt a compacted globular conformation. At a fixed [AgNO3]:[DNA base pairs] ratio, increasing DNA concentration led to increased sizes of the complexes. Intermolecular interaction is believed to affect the Ag+-DNA complex formation to a large extent.
Single-molecule experiments in biological physics: methods and applications.
Ritort, F
2006-08-16
I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.
Single-molecule experiments in biological physics: methods and applications
International Nuclear Information System (INIS)
Ritort, F
2006-01-01
I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives. (topical review)
Single molecule detection, thermal fluctuation and life
YANAGIDA, Toshio; ISHII, Yoshiharu
2017-01-01
Single molecule detection has contributed to our understanding of the unique mechanisms of life. Unlike artificial man-made machines, biological molecular machines integrate thermal noises rather than avoid them. For example, single molecule detection has demonstrated that myosin motors undergo biased Brownian motion for stepwise movement and that single protein molecules spontaneously change their conformation, for switching to interactions with other proteins, in response to thermal fluctuation. Thus, molecular machines have flexibility and efficiency not seen in artificial machines. PMID:28190869
Handbook of Single-Molecule Biophysics
Hinterdorfer, Peter
2009-01-01
The last decade has seen the development of a number of novel biophysical methods that allow the manipulation and study of individual biomolecules. The ability to monitor biological processes at this fundamental level of sensitivity has given rise to an improved understanding of the underlying molecular mechanisms. Through the removal of ensemble averaging, distributions and fluctuations of molecular properties can be characterized, transient intermediates identified, and catalytic mechanisms elucidated. By applying forces on biomolecules while monitoring their activity, important information can be obtained on how proteins couple function to structure. The Handbook of Single-Molecule Biophysics provides an introduction to these techniques and presents an extensive discussion of the new biological insights obtained from them. Coverage includes: Experimental techniques to monitor and manipulate individual biomolecules The use of single-molecule techniques in super-resolution and functional imaging Single-molec...
Real-time monitoring and manipulation of single bio-molecules in free solution
Energy Technology Data Exchange (ETDEWEB)
Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)
2005-01-01
The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored
Automated imaging system for single molecules
Schwartz, David Charles; Runnheim, Rodney; Forrest, Daniel
2012-09-18
There is provided a high throughput automated single molecule image collection and processing system that requires minimal initial user input. The unique features embodied in the present disclosure allow automated collection and initial processing of optical images of single molecules and their assemblies. Correct focus may be automatically maintained while images are collected. Uneven illumination in fluorescence microscopy is accounted for, and an overall robust imaging operation is provided yielding individual images prepared for further processing in external systems. Embodiments described herein are useful in studies of any macromolecules such as DNA, RNA, peptides and proteins. The automated image collection and processing system and method of same may be implemented and deployed over a computer network, and may be ergonomically optimized to facilitate user interaction.
Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface
Energy Technology Data Exchange (ETDEWEB)
Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)
2005-01-01
Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.
Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.
2015-03-01
Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Mechanisms of Cellular Proteostasis: Insights from Single-Molecule Approaches
Bustamante, Carlos J.; Kaiser, Christian M.; Maillard, Rodrigo A.; Goldman, Daniel H.; Wilson, Christian A.M.
2015-01-01
Cells employ a variety of strategies to maintain proteome homeostasis. Beginning during protein biogenesis, the translation machinery and a number of molecular chaperones promote correct de novo folding of nascent proteins even before synthesis is complete. Another set of molecular chaperones helps to maintain proteins in their functional, native state. Polypeptides that are no longer needed or pose a threat to the cell, such as misfolded proteins and aggregates, are removed in an efficient and timely fashion by ATP-dependent proteases. In this review, we describe how applications of single-molecule manipulation methods, in particular optical tweezers, are shedding new light on the molecular mechanisms of quality control during the life cycles of proteins. PMID:24895851
International Nuclear Information System (INIS)
Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.
2011-01-01
To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)
Nakamura, Yuki; Umeki, Nobuhisa; Abe, Mitsuhiro; Sako, Yasushi
2017-10-26
Noonan syndrome (NS) is a congenital hereditary disorder associated with developmental and cardiac defects. Some patients with NS carry mutations in SOS, a guanine nucleotide exchange factor (GEF) for the small GTPase RAS. NS mutations have been identified not only in the GEF domain, but also in various domains of SOS, suggesting that multiple mechanisms disrupt SOS function. In this study, we examined three NS mutations in different domains of SOS to clarify the abnormality in its translocation to the plasma membrane, where SOS activates RAS. The association and dissociation kinetics between SOS tagged with a fluorescent protein and the living cell surface were observed in single molecules. All three mutants showed increased affinity for the plasma membrane, inducing excessive RAS signalling. However, the mechanisms by which their affinity was increased were specific to each mutant. Conformational disorder in the resting state, increased probability of a conformational change on the plasma membrane, and an increased association rate constant with the membrane receptor are the suggested mechanisms. These different properties cause the specific phenotypes of the mutants, which should be rescuable with different therapeutic strategies. Therefore, single-molecule kinetic analyses of living cells are useful for the pathological analysis of genetic diseases.
Deep learning for single-molecule science
Albrecht, Tim; Slabaugh, Gregory; Alonso, Eduardo; Al-Arif, SM Masudur R.
2017-10-01
Exploring and making predictions based on single-molecule data can be challenging, not only due to the sheer size of the datasets, but also because a priori knowledge about the signal characteristics is typically limited and poor signal-to-noise ratio. For example, hypothesis-driven data exploration, informed by an expectation of the signal characteristics, can lead to interpretation bias or loss of information. Equally, even when the different data categories are known, e.g., the four bases in DNA sequencing, it is often difficult to know how to make best use of the available information content. The latest developments in machine learning (ML), so-called deep learning (DL) offer interesting, new avenues to address such challenges. In some applications, such as speech and image recognition, DL has been able to outperform conventional ML strategies and even human performance. However, to date DL has not been applied much in single-molecule science, presumably in part because relatively little is known about the ‘internal workings’ of such DL tools within single-molecule science as a field. In this Tutorial, we make an attempt to illustrate in a step-by-step guide how one of those, a convolutional neural network (CNN), may be used for base calling in DNA sequencing applications. We compare it with a SVM as a more conventional ML method, and discuss some of the strengths and weaknesses of the approach. In particular, a ‘deep’ neural network has many features of a ‘black box’, which has important implications on how we look at and interpret data.
Directory of Open Access Journals (Sweden)
Haowei Wang
Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.
Directory of Open Access Journals (Sweden)
Kai-Chun Chang
2012-01-01
Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Mechanisms of mutagenesis: DNA replication in the presence of DNA damage.
Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F Peter; Zhang, Huidong
2016-01-01
Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, Escherichia coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.
Programmed Switching of Single Polymer Conformation on DNA Origami
DEFF Research Database (Denmark)
Krissanaprasit, Abhichart; Madsen, Mikael; Knudsen, Jakob Bach
2016-01-01
-molecule conjugated polymer. The polymer is functionalized with short single-stranded (ss) DNA strands that extend from the backbone of the polymer and serve as handles. The DNA polymer conjugate can be aligned on DNA origami in three well-defined geometries (straight line, left-turned, and right-turned pattern......) by DNA hybridization directed by single-stranded guiding strands and ssDNA tracks extending from the origami surface and polymer handle. We demonstrate switching of a conjugated organic polymer conformation between left- and right-turned conformations of the polymer on DNA origami based on toehold...
Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T
2018-01-23
Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Molecular mechanisms of DNA photodamage
International Nuclear Information System (INIS)
Starrs, S.M.
2000-05-01
Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric
Single-Molecule Interfacial Electron Transfer
Energy Technology Data Exchange (ETDEWEB)
Lu, H. Peter [Bowling Green State Univ., Bowling Green, OH (United States). Dept. of Chemistry and Center for Photochemical Sciences
2017-11-28
This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static and dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO2 nanoparticle surfaces by using ultrafast single-molecule
Elastic Properties of Nucleic Acids by Single-Molecule Force Spectroscopy.
Camunas-Soler, Joan; Ribezzi-Crivellari, Marco; Ritort, Felix
2016-07-05
We review the current knowledge on the use of single-molecule force spectroscopy techniques to extrapolate the elastic properties of nucleic acids. We emphasize the lesser-known elastic properties of single-stranded DNA. We discuss the importance of accurately determining the elastic response in pulling experiments, and we review the simplest models used to rationalize the experimental data as well as the experimental approaches used to pull single-stranded DNA. Applications used to investigate DNA conformational transitions and secondary structure formation are also highlighted. Finally, we provide an overview of the effects of salt and temperature and briefly discuss the effects of contour length and sequence dependence.
Fabrication of Low Noise Borosilicate Glass Nanopores for Single Molecule Sensing.
Directory of Open Access Journals (Sweden)
Jayesh A Bafna
Full Text Available We show low-cost fabrication and characterization of borosilicate glass nanopores for single molecule sensing. Nanopores with diameters of ~100 nm were fabricated in borosilicate glass capillaries using laser assisted glass puller. We further achieve controlled reduction and nanometer-size control in pore diameter by sculpting them under constant electron beam exposure. We successfully fabricate pore diameters down to 6 nm. We next show electrical characterization and low-noise behavior of these borosilicate nanopores and compare their taper geometries. We show, for the first time, a comprehensive characterization of glass nanopore conductance across six-orders of magnitude (1M-1μM of salt conditions, highlighting the role of buffer conditions. Finally, we demonstrate single molecule sensing capabilities of these devices with real-time translocation experiments of individual λ-DNA molecules. We observe distinct current blockage signatures of linear as well as folded DNA molecules as they undergo voltage-driven translocation through the glass nanopores. We find increased signal to noise for single molecule detection for higher trans-nanopore driving voltages. We propose these nanopores will expand the realm of applications for nanopore platform.
Abdalla, S; Obaid, A; Al-Marzouki, F M
2017-12-01
Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a
Difference Raman spectroscopy of DNA molecules
International Nuclear Information System (INIS)
Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu
2015-01-01
In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule
Characterizing single-molecule FRET dynamics with probability distribution analysis.
Santoso, Yusdi; Torella, Joseph P; Kapanidis, Achillefs N
2010-07-12
Probability distribution analysis (PDA) is a recently developed statistical tool for predicting the shapes of single-molecule fluorescence resonance energy transfer (smFRET) histograms, which allows the identification of single or multiple static molecular species within a single histogram. We used a generalized PDA method to predict the shapes of FRET histograms for molecules interconverting dynamically between multiple states. This method is tested on a series of model systems, including both static DNA fragments and dynamic DNA hairpins. By fitting the shape of this expected distribution to experimental data, the timescale of hairpin conformational fluctuations can be recovered, in good agreement with earlier published results obtained using different techniques. This method is also applied to studying the conformational fluctuations in the unliganded Klenow fragment (KF) of Escherichia coli DNA polymerase I, which allows both confirmation of the consistency of a simple, two-state kinetic model with the observed smFRET distribution of unliganded KF and extraction of a millisecond fluctuation timescale, in good agreement with rates reported elsewhere. We expect this method to be useful in extracting rates from processes exhibiting dynamic FRET, and in hypothesis-testing models of conformational dynamics against experimental data.
Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates
DEFF Research Database (Denmark)
Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru
2012-01-01
Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...
Single-molecule force-conductance spectroscopy of hydrogen-bonded complexes
Pirrotta, Alessandro; De Vico, Luca; Solomon, Gemma C.; Franco, Ignacio
2017-03-01
The emerging ability to study physical properties at the single-molecule limit highlights the disparity between what is observable in an ensemble of molecules and the heterogeneous contributions of its constituent parts. A particularly convenient platform for single-molecule studies are molecular junctions where forces and voltages can be applied to individual molecules, giving access to a series of electromechanical observables that can form the basis of highly discriminating multidimensional single-molecule spectroscopies. Here, we computationally examine the ability of force and conductance to inform about molecular recognition events at the single-molecule limit. For this, we consider the force-conductance characteristics of a prototypical class of hydrogen bonded bimolecular complexes sandwiched between gold electrodes. The complexes consist of derivatives of a barbituric acid and a Hamilton receptor that can form up to six simultaneous hydrogen bonds. The simulations combine classical molecular dynamics of the mechanical deformation of the junction with non-equilibrium Green's function computations of the electronic transport. As shown, in these complexes hydrogen bonds mediate transport either by directly participating as a possible transport pathway or by stabilizing molecular conformations with enhanced conductance properties. Further, we observe that force-conductance correlations can be very sensitive to small changes in the chemical structure of the complexes and provide detailed information about the behavior of single molecules that cannot be gleaned from either measurement alone. In fact, there are regions during the elongation that are only mechanically active, others that are only conductance active, and regions where both force and conductance changes as the complex is mechanically manipulated. The implication is that force and conductance provide complementary information about the evolution of molecules in junctions that can be used to
Direct single-molecule dynamic detection of chemical reactions.
Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng
2018-02-01
Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.
Torque Measurement at the Single Molecule Level
Forth, Scott; Sheinin, Maxim Y.; Inman, James; Wang, Michelle D.
2017-01-01
Methods for exerting and measuring forces on single molecules have revolutionized the study of the physics of biology. However, it is often the case that biological processes involve rotation or torque generation, and these parameters have been more difficult to access experimentally. Recent advances in the single molecule field have led to the development of techniques which add the capability of torque measurement. By combining force, displacement, torque, and rotational data, a more comprehensive description of the mechanics of a biomolecule can be achieved. In this review, we highlight a number of biological processes for which torque plays a key mechanical role. We describe the various techniques that have been developed to directly probe the torque experienced by a single molecule, and detail a variety of measurements made to date using these new technologies. We conclude by discussing a number of open questions and propose systems of study which would be well suited for analysis with torsional measurement techniques. PMID:23541162
TOPICAL REVIEW: Single-molecule experiments in biological physics: methods and applications
Ritort, F.
2006-08-01
I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.
Energy Technology Data Exchange (ETDEWEB)
Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki
2016-12-01
Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.
Single Molecule Nanoelectrochemistry in Electrical Junctions.
Nichols, Richard J; Higgins, Simon J
2016-11-15
It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical
Single-molecule imaging and manipulation of biomolecular machines and systems.
Iino, Ryota; Iida, Tatsuya; Nakamura, Akihiko; Saita, Ei-Ichiro; You, Huijuan; Sako, Yasushi
2018-02-01
Biological molecular machines support various activities and behaviors of cells, such as energy production, signal transduction, growth, differentiation, and migration. We provide an overview of single-molecule imaging methods involving both small and large probes used to monitor the dynamic motions of molecular machines in vitro (purified proteins) and in living cells, and single-molecule manipulation methods used to measure the forces, mechanical properties and responses of biomolecules. We also introduce several examples of single-molecule analysis, focusing primarily on motor proteins and signal transduction systems. Single-molecule analysis is a powerful approach to unveil the operational mechanisms both of individual molecular machines and of systems consisting of many molecular machines. Quantitative, high-resolution single-molecule analyses of biomolecular systems at the various hierarchies of life will help to answer our fundamental question: "What is life?" This article is part of a Special Issue entitled "Biophysical Exploration of Dynamical Ordering of Biomolecular Systems" edited by Dr. Koichi Kato. Copyright © 2017 Elsevier B.V. All rights reserved.
A general approach to break the concentration barrier in single-molecule imaging
Loveland, Anna B.
2012-09-09
Single-molecule fluorescence imaging is often incompatible with physiological protein concentrations, as fluorescence background overwhelms an individual molecule\\'s signal. We solve this problem with a new imaging approach called PhADE (PhotoActivation, Diffusion and Excitation). A protein of interest is fused to a photoactivatable protein (mKikGR) and introduced to its surface-immobilized substrate. After photoactivation of mKikGR near the surface, rapid diffusion of the unbound mKikGR fusion out of the detection volume eliminates background fluorescence, whereupon the bound molecules are imaged. We labeled the eukaryotic DNA replication protein flap endonuclease 1 with mKikGR and added it to replication-competent Xenopus laevis egg extracts. PhADE imaging of high concentrations of the fusion construct revealed its dynamics and micrometer-scale movements on individual, replicating DNA molecules. Because PhADE imaging is in principle compatible with any photoactivatable fluorophore, it should have broad applicability in revealing single-molecule dynamics and stoichiometry of macromolecular protein complexes at previously inaccessible fluorophore concentrations. © 2012 Nature America, Inc. All rights reserved.
Enoki, Toshiaki; Kiguchi, Manabu
2018-03-01
Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.
DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes.
Dong, Lifeng
2009-11-18
A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of direct ethanol/methanol fuel cells and nanoscale electronics.
Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.
Cao, Chan; Long, Yi-Tao
2018-02-20
Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis
SINGLE MOLECULE APPROACHES TO BIOLOGY, 2010 GORDON RESEARCH CONFERENCE, JUNE 27-JULY 2, 2010, ITALY
Energy Technology Data Exchange (ETDEWEB)
Professor William Moerner
2010-07-09
The 2010 Gordon Conference on Single-Molecule Approaches to Biology focuses on cutting-edge research in single-molecule science. Tremendous technical developments have made it possible to detect, identify, track, and manipulate single biomolecules in an ambient environment or even in a live cell. Single-molecule approaches have changed the way many biological problems are addressed, and new knowledge derived from these approaches continues to emerge. The ability of single-molecule approaches to avoid ensemble averaging and to capture transient intermediates and heterogeneous behavior renders them particularly powerful in elucidating mechanisms of biomolecular machines: what they do, how they work individually, how they work together, and finally, how they work inside live cells. The burgeoning use of single-molecule methods to elucidate biological problems is a highly multidisciplinary pursuit, involving both force- and fluorescence-based methods, the most up-to-date advances in microscopy, innovative biological and chemical approaches, and nanotechnology tools. This conference seeks to bring together top experts in molecular and cell biology with innovators in the measurement and manipulation of single molecules, and will provide opportunities for junior scientists and graduate students to present their work in poster format and to exchange ideas with leaders in the field. A number of excellent poster presenters will be selected for short oral talks. Topics as diverse as single-molecule sequencing, DNA/RNA/protein interactions, folding machines, cellular biophysics, synthetic biology and bioengineering, force spectroscopy, new method developments, superresolution imaging in cells, and novel probes for single-molecule imaging will be on the program. Additionally, the collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings in the beauty of the Il Ciocco site in
Molecular mechanisms of DNA photodamage
Energy Technology Data Exchange (ETDEWEB)
Starrs, S.M
2000-05-01
Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA){sub n} and (GA){sub n}, and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a
Droplet Microfluidics for Compartmentalized Cell Lysis and Extension of DNA from Single-Cells
Zimny, Philip; Juncker, David; Reisner, Walter
Current single cell DNA analysis methods suffer from (i) bias introduced by the need for molecular amplification and (ii) limited ability to sequence repetitive elements, resulting in (iii) an inability to obtain information regarding long range genomic features. Recent efforts to circumvent these limitations rely on techniques for sensing single molecules of DNA extracted from single-cells. Here we demonstrate a droplet microfluidic approach for encapsulation and biochemical processing of single-cells inside alginate microparticles. In our approach, single-cells are first packaged inside the alginate microparticles followed by cell lysis, DNA purification, and labeling steps performed off-chip inside this microparticle system. The alginate microparticles are then introduced inside a micro/nanofluidic system where the alginate is broken down via a chelating buffer, releasing long DNA molecules which are then extended inside nanofluidic channels for analysis via standard mapping protocols.
DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae
Boiteux, Serge; Jinks-Robertson, Sue
2013-01-01
DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164
Single-tube library preparation for degraded DNA
DEFF Research Database (Denmark)
Carøe, Christian; Gopalakrishnan, Shyam; Vinner, Lasse
2018-01-01
these obstacles and enable higher throughput are therefore of interest to researchers working with degraded DNA. 2.In this study, we compare four Illumina library preparation protocols, including two “single-tube” methods developed for this study with the explicit aim of improving data quality and reducing...... of chemically damaged and highly fragmented DNA molecules. In particular, the enzymatic reactions and DNA purification steps during library preparation can result in DNA template loss and sequencing biases, affecting downstream analyses. The development of library preparation methods that circumvent...... preparation time and expenses. The methods are tested on grey wolf (Canis lupus) museum specimens. 3.We found single-tube protocols increase library complexity, yield more reads that map uniquely to the reference genome, reduce processing time, and may decrease laboratory costs by 90%. 4.Given the advantages...
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...
Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA
Directory of Open Access Journals (Sweden)
Weixin Qian
2014-08-01
Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.
Fast temporal fluctuations in single-molecule junctions.
Ochs, Roif; Secker, Daniel; Elbing, Mark; Mayor, Marcel; Weber, Heiko B
2006-01-01
The noise within the electrical current through single-molecule junctions is studied cryogenic temperature. The organic sample molecules were contacted with the mechanically controlled break-junction technique. The noise spectra refer to a where only few Lorentzian fluctuators occur in the conductance. The frequency dependence shows qualitative variations from sample to sample.
Single-Molecule Analysis for RISC Assembly and Target Cleavage.
Sasaki, Hiroshi M; Tadakuma, Hisashi; Tomari, Yukihide
2018-01-01
RNA-induced silencing complex (RISC) is a small RNA-protein complex that mediates silencing of complementary target RNAs. Biochemistry has been successfully used to characterize the molecular mechanism of RISC assembly and function for nearly two decades. However, further dissection of intermediate states during the reactions has been warranted to fill in the gaps in our understanding of RNA silencing mechanisms. Single-molecule analysis with total internal reflection fluorescence (TIRF) microscopy is a powerful imaging-based approach to interrogate complex formation and dynamics at the individual molecule level with high sensitivity. Combining this technique with our recently established in vitro reconstitution system of fly Ago2-RISC, we have developed a single-molecule observation system for RISC assembly. In this chapter, we summarize the detailed protocol for single-molecule analysis of chaperone-assisted assembly of fly Ago2-RISC as well as its target cleavage reaction.
International Nuclear Information System (INIS)
Waters, R.
1980-01-01
The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not
Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.
2018-01-01
The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784
Programmable motion of DNA origami mechanisms.
Marras, Alexander E; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E
2015-01-20
DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank-slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼ minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach.
Programmable motion of DNA origami mechanisms
Marras, Alexander E.; Zhou, Lifeng; Su, Hai-Jun; Castro, Carlos E.
2015-01-01
DNA origami enables the precise fabrication of nanoscale geometries. We demonstrate an approach to engineer complex and reversible motion of nanoscale DNA origami machine elements. We first design, fabricate, and characterize the mechanical behavior of flexible DNA origami rotational and linear joints that integrate stiff double-stranded DNA components and flexible single-stranded DNA components to constrain motion along a single degree of freedom and demonstrate the ability to tune the flexibility and range of motion. Multiple joints with simple 1D motion were then integrated into higher order mechanisms. One mechanism is a crank–slider that couples rotational and linear motion, and the other is a Bennett linkage that moves between a compacted bundle and an expanded frame configuration with a constrained 3D motion path. Finally, we demonstrate distributed actuation of the linkage using DNA input strands to achieve reversible conformational changes of the entire structure on ∼minute timescales. Our results demonstrate programmable motion of 2D and 3D DNA origami mechanisms constructed following a macroscopic machine design approach. PMID:25561550
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.
Directory of Open Access Journals (Sweden)
Marijn T J van Loenhout
Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.
Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain
2010-04-22
Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G
Single-Molecule View of Small RNA-Guided Target Search and Recognition.
Globyte, Viktorija; Kim, Sung Hyun; Joo, Chirlmin
2018-05-20
Most everyday processes in life involve a necessity for an entity to locate its target. On a cellular level, many proteins have to find their target to perform their function. From gene-expression regulation to DNA repair to host defense, numerous nucleic acid-interacting proteins use distinct target search mechanisms. Several proteins achieve that with the help of short RNA strands known as guides. This review focuses on single-molecule advances studying the target search and recognition mechanism of Argonaute and CRISPR (clustered regularly interspaced short palindromic repeats) systems. We discuss different steps involved in search and recognition, from the initial complex prearrangement into the target-search competent state to the final proofreading steps. We focus on target search mechanisms that range from weak interactions, to one- and three-dimensional diffusion, to conformational proofreading. We compare the mechanisms of Argonaute and CRISPR with a well-studied target search system, RecA.
Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan
1999-01-01
By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first
Single molecules and nanotechnology
Vogel, Horst
2007-01-01
This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.
International Nuclear Information System (INIS)
Wu, N.; Wang, Q.
2012-01-01
The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.
Single-molecule force-conductance spectroscopy of hydrogen-bonded complexes
DEFF Research Database (Denmark)
Pirrotta, Alessandro; De Vico, Luca; Solomon, Gemma C.
2017-01-01
to inform about molecular recognition events at the single-molecule limit. For this, we consider the force-conductance characteristics of a prototypical class of hydrogen bonded bimolecular complexes sandwiched between gold electrodes. The complexes consist of derivatives of a barbituric acid and a Hamilton...... is mechanically manipulated. The implication is that force and conductance provide complementary information about the evolution of molecules in junctions that can be used to interrogate basic structure-transport relations at the single-molecule limit....
Directory of Open Access Journals (Sweden)
Sungsoo Na
2009-09-01
Full Text Available Quantitative understanding of the mechanical behavior of biological liquid crystals such as proteins is essential for gaining insight into their biological functions, since some proteins perform notable mechanical functions. Recently, single-molecule experiments have allowed not only the quantitative characterization of the mechanical behavior of proteins such as protein unfolding mechanics, but also the exploration of the free energy landscape for protein folding. In this work, we have reviewed the current state-of-art in single-molecule bioassays that enable quantitative studies on protein unfolding mechanics and/or various molecular interactions. Specifically, single-molecule pulling experiments based on atomic force microscopy (AFM have been overviewed. In addition, the computational simulations on single-molecule pulling experiments have been reviewed. We have also reviewed the AFM cantilever-based bioassay that provides insight into various molecular interactions. Our review highlights the AFM-based single-molecule bioassay for quantitative characterization of biological liquid crystals such as proteins.
Solid-state nanopores for scanning single molecules and mimicking biology
Kowalczyk, S.W.
2011-01-01
Solid-state nanopores, nanometer-size holes in a thin synthetic membrane, are a versatile tool for the detection and manipulation of charged biomolecules. This thesis describes mostly experimental work on DNA translocation through solid-state nanopores, which we study at the single-molecule level.
A new microcavity design for single molecule detection
International Nuclear Information System (INIS)
Steiner, M.; Schleifenbaum, F.; Stupperich, C.; Failla, A.V.; Hartschuh, A.; Meixner, A.J.
2006-01-01
We present a new microcavity design which allows for efficient detection of single molecules by measuring the molecular fluorescence emission coupled into a resonant cavity mode. The Fabry-Perot-type microresonator consists of two silver mirrors separated by a thin polymer film doped with dye molecules in ultralow concenctration. By slightly tilting one of the mirrors different cavity lengths can be selected within the same sample. Locally, on a μm scale, the microcavity still acts as a planar Fabry-Perot resonator. Using scanning confocal fluorescence microscopy, single emitters on resonance with a single mode of the microresonator can be spatially addressed. Our microcavity is demonstrated to be well-suited for investigating the coupling mechanism between single quantum emitters and single modes of the electromagnetic field. The microcavity layout could be integrated in a lab-on-a-microchip design for ultrasensitive microfluidic analytics and can be considered as an important improvement for single photon sources based on single molecules operating at room temperature
A single thiazole orange molecule forms an exciplex in a DNA i-motif.
Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei
2014-06-18
A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.
Serag, Maged F.
2014-10-06
Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.
Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi
2014-01-01
Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.
International Nuclear Information System (INIS)
Zhang Jingdong; Chi Qijin; Albrecht, Tim; Kuznetsov, Alexander M.; Grubb, Mikala; Hansen, Allan G.; Wackerbarth, Hainer; Welinder, Anne C.; Ulstrup, Jens
2005-01-01
Surface structures controlled at the nanometer and single-molecule levels, with functions crucially determined by interfacial electron transfer (ET) are broadly reported in recent years, with different kinds of electrochemically controlled nanoscale/single molecule systems. One is the broad class of metallic and semiconductor-based nanoparticles, nano-arrays, nanotubes, and nanopits. Others are based on self-assembled molecular monolayers. The latter extend to bioelectrochemical systems with redox metalloproteins and DNA-based molecules as targets. We overview here some recent achievements in areas of interfacial electrochemical ET systems, mapped to the nanoscale and single-molecule levels. Focus is on both experimental and theoretical studies in our group. Systems addressed are organized monolayers of redox active transition metal complexes, and metalloproteins and metalloenzymes on single-crystal Au(1 1 1)-electrode surfaces. These systems have been investigated by voltammetry, spectroscopy, microcantilever technology, and scanning probe microscopy. A class of Os-complexes has shown suitable as targets for electrochemical in situ scanning tunnelling microscopy (STM), with close to single-molecule scanning tunnelling spectroscopic (STS) features. Mapping of redox metalloproteins from the three major classes, i.e. blue copper proteins, heme proteins, and iron-sulfur proteins, at the monolayer and single-molecule levels have also been achieved. In situ STM and spectroscopy of redox molecules and biomolecules have been supported by new theoretical frames, which extend established theory of interfacial electrochemical ET. The electrochemical nanoscale and single-molecule systems discussed are compared with other recent nanoscale and single-molecule systems with conspicuous device-like properties, particularly unimolecular rectifiers and single-molecule transistors. Both of these show analogies to electrochemical in situ STM features of redox molecules and
Energy Technology Data Exchange (ETDEWEB)
Caillet-Fauquet, P; Defais, M; Radman, M [Brussels Univ. (Belgium)
1977-11-25
Genetic analysis has revealed that radiation and many chemical mutagens induce in bacteria an error-prone DNA repair process which is responsible for their mutagenic effect. The biochemical mechanism of this inducible error-prone repair has been studied by analysis of the first round of DNA synthesis on ultraviolet light-irradiated phiX174 DNA in both intact and ultraviolet light-irradiated host cells. Intracellular phiX174 DNA was extracted, subjected to isopycnic CsCl density-gradient analysis, hydroxylapatite chromatography and digestion by single-strand-specific endonuclease S/sub 1/. Ultraviolet light-induced photolesions in viral DNA cause a permanent blockage of DNA synthesis in intact Escherichia coli cells. However, when host cells were irradiated and incubated to induce fully the error-prone repair system, a significant fraction of irradiated phiX174 DNA molecules can be fully replicated. Thus, inducible error-prone repair in E.coli is manifested by an increased capacity for DNA synthesis on damaged phiX174 DNA. Chloramphenicol (100 ..mu.. g/ml), which is an inhibitor of the inducible error-prone DNA repair, is also an inhibitor of this particular inducible DNA synthesis.
Directory of Open Access Journals (Sweden)
Zach Hensel
Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.
Research Update: Molecular electronics: The single-molecule switch and transistor
Directory of Open Access Journals (Sweden)
Kai Sotthewes
2014-01-01
Full Text Available In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected to macroscopic leads and how the transport properties of the molecule can be measured. Based on this knowledge we have realized two single-molecule devices: a molecular switch and a molecular transistor. The switch can be opened and closed at will by carefully adjusting the separation between the electrical contacts and the voltage drop across the contacts. This single-molecular switch operates in a broad temperature range from cryogenic temperatures all the way up to room temperature. Via mechanical gating, i.e., compressing or stretching of the octanethiol molecule, by varying the contact's interspace, we are able to systematically adjust the conductance of the electrode-octanethiol-electrode junction. This two-terminal single-molecule transistor is very robust, but the amplification factor is rather limited.
Friedman, Jonathan R.; Sarachik, Myriam P.
2010-04-01
Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.
Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.
Biological mechanisms, one molecule at a time
Tinoco, Ignacio; Gonzalez, Ruben L.
2011-01-01
The last 15 years have witnessed the development of tools that allow the observation and manipulation of single molecules. The rapidly expanding application of these technologies for investigating biological systems of ever-increasing complexity is revolutionizing our ability to probe the mechanisms of biological reactions. Here, we compare the mechanistic information available from single-molecule experiments with the information typically obtained from ensemble studies and show how these two experimental approaches interface with each other. We next present a basic overview of the toolkit for observing and manipulating biology one molecule at a time. We close by presenting a case study demonstrating the impact that single-molecule approaches have had on our understanding of one of life's most fundamental biochemical reactions: the translation of a messenger RNA into its encoded protein by the ribosome. PMID:21685361
On the identification techniques for ionizing radiation structure breaks in the DNA molecule
International Nuclear Information System (INIS)
Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.
2012-01-01
In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)
Single Molecule Detection in Living Biological Cells using Carbon Nanotube Optical Probes
Strano, Michael
2009-03-01
osmotic pressure gradients will be discussed, as well as its potential as a unique transduction mechanism for a new class of implantable sensors. [4pt] [1] Saito, R., Dresselhaus, G. & Dresselhaus, M. S. Physical Properties of Carbon Nanotubes (Imperial College Press, London, 1998). [0pt] [2] Barone, P. W., Baik, S., Heller, D. A. & Strano, M. S. Near-Infrared Optical Sensors Based on Single-Walled Carbon Nanotubes. Nature Materials 4, 86-92 (2005). [0pt] [3] Jeng, E. S., Moll, A. E., Roy, A. C., Gastala, J. B. & Strano, M. S. Detection of DNA hybridization using the near infrared band-gap fluorescence of single-walled carbon nanotubes. Nano Letters 6, 371-375 (2006). [0pt] [4] Heller, D. A. et al. Optical detection of DNA conformational polymorphism on single-walled carbon nanotubes. Science 311, 508-511 (2006).
Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.
Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing
2017-04-01
The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.
Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA
International Nuclear Information System (INIS)
Shokri, Leila; Williams, Mark C; Rouzina, Ioulia
2009-01-01
Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork
Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.
Directory of Open Access Journals (Sweden)
Scott S Walker
Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.
Vesicle Encapsulation Studies Reveal that Single Molecule Ribozyme Heterogeneities Are Intrinsic
Okumus, Burak; Wilson, Timothy J.; Lilley, David M. J.; Ha, Taekjip
2004-01-01
Single-molecule measurements have revealed that what were assumed to be identical molecules can differ significantly in their static and dynamic properties. One of the most striking examples is the hairpin ribozyme, which was shown to exhibit two to three orders of magnitude variation in folding kinetics between molecules. Although averaged behavior of single molecules matched the bulk solution data, it was not possible to exclude rigorously the possibility that the variations around the mean values arose from different ways of interacting with the surface environment. To test this, we minimized the molecules' interaction with the surface by encapsulating DNA or RNA molecules inside 100- to 200-nm diameter unilamellar vesicles, following the procedures described by Haran and coworkers. Vesicles were immobilized on a supported lipid bilayer via biotin-streptavidin linkages. We observed no direct binding of DNA or RNA on the supported bilayer even at concentrations exceeding 100 nM, indicating that these molecules do not bind stably on the membrane. Since the vesicle diameter is smaller than the resolution of optical microscopy, the lateral mobility of the molecules is severely constrained, allowing long observation periods. We used fluorescence correlation spectroscopy, nuclease digestion, and external buffer exchange to show that the molecules were indeed encapsulated within the vesicles. When contained within vesicles, the natural form of the hairpin ribozyme exhibited 50-fold variation in both folding and unfolding rates in 0.5 mM Mg2+, which is identical to what was observed from the molecules tethered directly on the surface. This strongly indicates that the observed heterogeneity in dynamic properties does not arise as an artifact of surface attachment, but is intrinsic to the nature of the molecules. PMID:15454471
Observation of Single-Protein and DNA Macromolecule Collisions on Ultramicroelectrodes.
Dick, Jeffrey E; Renault, Christophe; Bard, Allen J
2015-07-08
Single-molecule detection is the ultimate sensitivity in analytical chemistry and has been largely unavailable in electrochemical analysis. Here, we demonstrate the feasibility of detecting electrochemically inactive single biomacromolecules, such as enzymes, antibodies, and DNA, by blocking a solution redox reaction when molecules adsorb and block electrode sites. By oxidizing a large concentration of potassium ferrocyanide on an ultramicroelectrode (UME, radius ≤150 nm), time-resolved, discrete adsorption events of antibodies, enzymes, DNA, and polystyrene nanospheres can be differentiated from the background by their "footprint". Further, by assuming that the mass transport of proteins to the electrode surface is controlled mainly by diffusion, a size estimate using the Stokes-Einstein relationship shows good agreement of electrochemical data with known protein sizes.
Directory of Open Access Journals (Sweden)
Max Greenfeld
Full Text Available Single molecule studies have expanded rapidly over the past decade and have the ability to provide an unprecedented level of understanding of biological systems. A common challenge upon introduction of novel, data-rich approaches is the management, processing, and analysis of the complex data sets that are generated. We provide a standardized approach for analyzing these data in the freely available software package SMART: Single Molecule Analysis Research Tool. SMART provides a format for organizing and easily accessing single molecule data, a general hidden Markov modeling algorithm for fitting an array of possible models specified by the user, a standardized data structure and graphical user interfaces to streamline the analysis and visualization of data. This approach guides experimental design, facilitating acquisition of the maximal information from single molecule experiments. SMART also provides a standardized format to allow dissemination of single molecule data and transparency in the analysis of reported data.
Detection of DNA hybridizations using solid-state nanopores
International Nuclear Information System (INIS)
Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng
2010-01-01
We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.
Detection of DNA hybridizations using solid-state nanopores
Energy Technology Data Exchange (ETDEWEB)
Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)
2010-08-20
We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.
Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens
Energy Technology Data Exchange (ETDEWEB)
Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.
2015-09-14
Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.
Molecular electronics--resonant transport through single molecules.
Lörtscher, Emanuel; Riel, Heike
2010-01-01
The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.
Single-photon sources based on single molecules in solids
International Nuclear Information System (INIS)
Moerner, W E
2004-01-01
Single molecules in suitable host crystals have been demonstrated to be useful single-photon emitters both at liquid-helium temperatures and at room temperature. The low-temperature source achieved controllable emission of single photons from a single terrylene molecule in p-terphenyl by an adiabatic rapid passage technique. In contrast with almost all other single-molecule systems, terrylene single molecules show extremely high photostability under continuous, high-intensity irradiation. A room-temperature source utilizing this material has been demonstrated, in which fast pumping into vibrational sidebands of the electronically excited state achieved efficient inversion of the emissive level. This source yielded a single-photon emission probability p(1) of 0.86 at a detected count rate near 300 000 photons s -1 , with very small probability of emission of more than one photon. Thus, single molecules in solids can be considered as contenders for applications of single-photon sources such as quantum key distribution
Spectrally resolved single-molecule electrometry
Ruggeri, F.; Krishnan, M.
2018-03-01
Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.
Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai
2018-01-01
Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:
Detection of kinetic change points in piece-wise linear single molecule motion
Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.
2018-03-01
Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.
Enzymatic production of single-molecule FISH and RNA capture probes.
Gaspar, Imre; Wippich, Frank; Ephrussi, Anne
2017-10-01
Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules
International Nuclear Information System (INIS)
Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.
1979-01-01
The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage
Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors
DEFF Research Database (Denmark)
Fu, Yanming; Zeng, Dongdong; Chao, Jie
2013-01-01
nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...
Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.
Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano
2016-01-01
DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
Synthesis of single-molecule nanocars.
Vives, Guillaume; Tour, James M
2009-03-17
The drive to miniaturize devices has led to a variety of molecular machines inspired by macroscopic counterparts such as molecular motors, switches, shuttles, turnstiles, barrows, elevators, and nanovehicles. Such nanomachines are designed for controlled mechanical motion and the transport of nanocargo. As researchers miniaturize devices, they can consider two complementary approaches: (1) the "top-down" approach, which reduces the size of macroscopic objects to reach an equivalent microscopic entity using photolithography and related techniques and (2) the "bottom-up" approach, which builds functional microscopic or nanoscopic entities from molecular building blocks. The top-down approach, extensively used by the semiconductor industry, is nearing its scaling limits. On the other hand, the bottom-up approach takes advantage of the self-assembly of smaller molecules into larger networks by exploiting typically weak molecular interactions. But self-assembly alone will not permit complex assembly. Using nanomachines, we hope to eventually consider complex, enzyme-like directed assembly. With that ultimate goal, we are currently exploring the control of nanomachines that would provide a basis for the future bottom-up construction of complex systems. This Account describes the synthesis of a class of molecular machines that resemble macroscopic vehicles. We designed these so-called nanocars for study at the single-molecule level by scanning probe microscopy (SPM). The vehicles have a chassis connected to wheel-terminated axles and convert energy inputs such as heat, electric fields, or light into controlled motion on a surface, ultimately leading to transport of nanocargo. At first, we used C(60) fullerenes as wheels, which allowed the demonstration of a directional rolling mechanism of a nanocar on a gold surface by STM. However, because of the low solubility of the fullerene nanocars and the incompatibility of fullerenes with photochemical processes, we developed new
A New Theoretical Approach to Single-Molecule Fluorescence Optical Studies of RNA Dynamics
International Nuclear Information System (INIS)
Zhao Xinghai; Shan Guangcun; Bao Shuying
2011-01-01
Single-molecule fluorescence spectroscopy in condensed phases has many important chemical and biological applications. The single-molecule fluorescence measurements contain information about conformational dynamics on a vast range of time scales. Based on the data analysis protocols methodology proposed by X. Sunney Xie, the theoretical study here mainly focuses on the single-molecule studies of single RNA with interconversions among different conformational states, to with a single FRET pair attached. We obtain analytical expressions for fluorescence lifetime correlation functions that relate changes in fluorescence lifetime to the distance-dependent FRET mechanism within the context of the Smoluchowski diffusion model. The present work establishes useful guideline for the single-molecule studies of biomolecules to reveal the complicated folding dynamics of single RNA molecules at nanometer scale.
Estimating single molecule conductance from spontaneous evolution of a molecular contact
Gil, M.; Malinowski, T.; Iazykov, M.; Klein, H. R.
2018-03-01
We present an original method to estimate the conductivity of a single molecule anchored to nanometric-sized metallic electrodes, using a Mechanically Controlled Break Junction operated at room temperature in the liquid. We record the conductance through the metal/molecules/metal nanocontact while keeping the metallic electrodes at a fixed distance. Taking advantage of thermal diffusion and electromigration, we let the contact naturally explore the more stable configurations around a chosen conductance value. The conductance of a single molecule is estimated from a statistical analysis of raw conductance and conductance standard deviation data for molecular contacts containing up to 14 molecules. The single molecule conductance values are interpreted as time-averaged conductance of an ensemble of conformers at thermal equilibrium.
Mechanical Response of Single Filamin A (ABP-280) Molecules and Its Role in the Actin/Filamin A Gel
Sano, Ryoko; Furuike, Shou; Ito, Tadanao; Ohashi, Kazuyo; Yamazaki, Masahito
2004-04-01
Actin/filamin A gel plays important roles in mechanical response of cells. We found a force (50 to 220 pN)-induced unfolding of single filamin A molecules using AFM, and have proposed a hypothesis on the role of single filamin A in the novel property of viscoelasticity of actin/filamin A gel. We also investigated structure and its dynamics of actin/filamin A gel formed in a giant liposome using fluorescence microscopy.
48-spot single-molecule FRET setup with periodic acceptor excitation
Ingargiola, Antonino; Segal, Maya; Gulinatti, Angelo; Rech, Ivan; Labanca, Ivan; Maccagnani, Piera; Ghioni, Massimo; Weiss, Shimon; Michalet, Xavier
2018-03-01
Single-molecule Förster resonance energy transfer (smFRET) allows measuring distances between donor and acceptor fluorophores on the 3-10 nm range. Solution-based smFRET allows measurement of binding-unbinding events or conformational changes of dye-labeled biomolecules without ensemble averaging and free from surface perturbations. When employing dual (or multi) laser excitation, smFRET allows resolving the number of fluorescent labels on each molecule, greatly enhancing the ability to study heterogeneous samples. A major drawback to solution-based smFRET is the low throughput, which renders repetitive measurements expensive and hinders the ability to study kinetic phenomena in real-time. Here we demonstrate a high-throughput smFRET system that multiplexes acquisition by using 48 excitation spots and two 48-pixel single-photon avalanche diode array detectors. The system employs two excitation lasers allowing separation of species with one or two active fluorophores. The performance of the system is demonstrated on a set of doubly labeled double-stranded DNA oligonucleotides with different distances between donor and acceptor dyes along the DNA duplex. We show that the acquisition time for accurate subpopulation identification is reduced from several minutes to seconds, opening the way to high-throughput screening applications and real-time kinetics studies of enzymatic reactions such as DNA transcription by bacterial RNA polymerase.
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.
Gopinath, Ashwin; Rothemund, Paul W K
2014-12-23
Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.
2012 Gordon Research Conference, Single molecule approaches to biology, July 15-20 2012
Energy Technology Data Exchange (ETDEWEB)
Fernandez, Julio M. [Columbia Univ., New York, NY (United States)
2012-04-20
Single molecule techniques are rapidly occupying a central role in biological research at all levels. This transition was made possible by the availability and dissemination of robust techniques that use fluorescence and force probes to track the conformation of molecules one at a time, in vitro as well as in live cells. Single-molecule approaches have changed the way many biological problems are studied. These novel techniques provide previously unobtainable data on fundamental biochemical processes that are essential for all forms of life. The ability of single-molecule approaches to avoid ensemble averaging and to capture transient intermediates and heterogeneous behavior renders them particularly powerful in elucidating mechanisms of the molecular systems that underpin the functioning of living cells. Hence, our conference seeks to disseminate the implementation and use of single molecule techniques in the pursuit of new biological knowledge. Topics covered include: Molecular Motors on the Move; Origin And Fate Of Proteins; Physical Principles Of Life; Molecules and Super-resolution Microscopy; Nanoswitches In Action; Active Motion Or Random Diffusion?; Building Blocks Of Living Cells; From Molecular Mechanics To Physiology; Tug-of-war: Force Spectroscopy Of Single Proteins.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Directory of Open Access Journals (Sweden)
Luisina De Tullio
2017-10-01
Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.
DEFF Research Database (Denmark)
Alstrup, J.; Norrman, K.; Jørgensen, M.
2006-01-01
Degradation mechanisms in organic and polymer photovoltaics are addressed through the study of an organic photovoltaic molecule based on a single phenylene-vinylene-type oligomer molecule. The synthesis of such a model compound with different end-groups is presented that allows for assignment...... of degradation products from different parts of the molecule. Photovoltaic devices with and without C(60) have been prepared and their characteristics under AM1.5 conditions are reported. The degradation of the active phenylene-vinylene compound in darkness and after 20h of illumination were investigated using...... a mass spectrometric technique (time-of-flight secondary ion mass spectrometry) allowing elucidation of the oxidative degradation pathways. (c) 2006 Elsevier B.V. All rights reserved....
Kong, Muwen; Beckwitt, Emily C.; Springall, Luke; Kad, Neil M.; Van Houten, Bennett
2017-01-01
Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesion...
International Nuclear Information System (INIS)
Reed, Jason; Hsueh, Carlin; Gimzewski, James K; Mishra, Bud
2008-01-01
We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing
Greenfeld, Max; van de Meent, Jan-Willem; Pavlichin, Dmitri S; Mabuchi, Hideo; Wiggins, Chris H; Gonzalez, Ruben L; Herschlag, Daniel
2015-01-16
Single-molecule techniques have emerged as incisive approaches for addressing a wide range of questions arising in contemporary biological research [Trends Biochem Sci 38:30-37, 2013; Nat Rev Genet 14:9-22, 2013; Curr Opin Struct Biol 2014, 28C:112-121; Annu Rev Biophys 43:19-39, 2014]. The analysis and interpretation of raw single-molecule data benefits greatly from the ongoing development of sophisticated statistical analysis tools that enable accurate inference at the low signal-to-noise ratios frequently associated with these measurements. While a number of groups have released analysis toolkits as open source software [J Phys Chem B 114:5386-5403, 2010; Biophys J 79:1915-1927, 2000; Biophys J 91:1941-1951, 2006; Biophys J 79:1928-1944, 2000; Biophys J 86:4015-4029, 2004; Biophys J 97:3196-3205, 2009; PLoS One 7:e30024, 2012; BMC Bioinformatics 288 11(8):S2, 2010; Biophys J 106:1327-1337, 2014; Proc Int Conf Mach Learn 28:361-369, 2013], it remains difficult to compare analysis for experiments performed in different labs due to a lack of standardization. Here we propose a standardized single-molecule dataset (SMD) file format. SMD is designed to accommodate a wide variety of computer programming languages, single-molecule techniques, and analysis strategies. To facilitate adoption of this format we have made two existing data analysis packages that are used for single-molecule analysis compatible with this format. Adoption of a common, standard data file format for sharing raw single-molecule data and analysis outcomes is a critical step for the emerging and powerful single-molecule field, which will benefit both sophisticated users and non-specialists by allowing standardized, transparent, and reproducible analysis practices.
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Entangled photons from single atoms and molecules
Nordén, Bengt
2018-05-01
The first two-photon entanglement experiment performed 50 years ago by Kocher and Commins (KC) provided isolated pairs of entangled photons from an atomic three-state fluorescence cascade. In view of questioning of Bell's theorem, data from these experiments are re-analyzed and shown sufficiently precise to confirm quantum mechanical and dismiss semi-classical theory without need for Bell's inequalities. Polarization photon correlation anisotropy (A) is useful: A is near unity as predicted quantum mechanically and well above the semi-classic range, 0 ⩽ A ⩽ 1 / 2 . Although yet to be found, one may envisage a three-state molecule emitting entangled photon pairs, in analogy with the KC atomic system. Antibunching in fluorescence from single molecules in matrix and entangled photons from quantum dots promise it be possible. Molecules can have advantages to parametric down-conversion as the latter photon distribution is Poissonian and unsuitable for producing isolated pairs of entangled photons. Analytical molecular applications of entangled light are also envisaged.
Adib, Artur B.
In the last two decades or so, a collection of results in nonequilibrium statistical mechanics that departs from the traditional near-equilibrium framework introduced by Lars Onsager in 1931 has been derived, yielding new fundamental insights into far-from-equilibrium processes in general. Apart from offering a more quantitative statement of the second law of thermodynamics, some of these results---typified by the so-called "Jarzynski equality"---have also offered novel means of estimating equilibrium quantities from nonequilibrium processes, such as free energy differences from single-molecule "pulling" experiments. This thesis contributes to such efforts by offering three novel results in nonequilibrium statistical mechanics: (a) The entropic analog of the Jarzynski equality; (b) A methodology for estimating free energies from "clamp-and-release" nonequilibrium processes; and (c) A directly measurable symmetry relation in chemical kinetics similar to (but more general than) chemical detailed balance. These results share in common the feature of remaining valid outside Onsager's near-equilibrium regime, and bear direct applicability in protein folding kinetics as well as in single-molecule free energy estimation.
A Starting Point for Fluorescence-Based Single-Molecule Measurements in Biomolecular Research
Directory of Open Access Journals (Sweden)
Alexander Gust
2014-09-01
Full Text Available Single-molecule fluorescence techniques are ideally suited to provide information about the structure-function-dynamics relationship of a biomolecule as static and dynamic heterogeneity can be easily detected. However, what type of single-molecule fluorescence technique is suited for which kind of biological question and what are the obstacles on the way to a successful single-molecule microscopy experiment? In this review, we provide practical insights into fluorescence-based single-molecule experiments aiming for scientists who wish to take their experiments to the single-molecule level. We especially focus on fluorescence resonance energy transfer (FRET experiments as these are a widely employed tool for the investigation of biomolecular mechanisms. We will guide the reader through the most critical steps that determine the success and quality of diffusion-based confocal and immobilization-based total internal reflection fluorescence microscopy. We discuss the specific chemical and photophysical requirements that make fluorescent dyes suitable for single-molecule fluorescence experiments. Most importantly, we review recently emerged photoprotection systems as well as passivation and immobilization strategies that enable the observation of fluorescently labeled molecules under biocompatible conditions. Moreover, we discuss how the optical single-molecule toolkit has been extended in recent years to capture the physiological complexity of a cell making it even more relevant for biological research.
Electron microscope autoradiography of isolated DNA molecules
International Nuclear Information System (INIS)
Delain, Etienne; Bouteille, Michel
1980-01-01
Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections
Fluorescent Biosensors Based on Single-Molecule Counting.
Ma, Fei; Li, Ying; Tang, Bo; Zhang, Chun-Yang
2016-09-20
Biosensors for highly sensitive, selective, and rapid quantification of specific biomolecules make great contributions to biomedical research, especially molecular diagnostics. However, conventional methods for biomolecular assays often suffer from insufficient sensitivity and poor specificity. In some case (e.g., early disease diagnostics), the concentration of target biomolecules is too low to be detected by these routine approaches, and cumbersome procedures are needed to improve the detection sensitivity. Therefore, there is an urgent need for rapid and ultrasensitive analytical tools. In this respect, single-molecule fluorescence approaches may well satisfy the requirement and hold promising potential for the development of ultrasensitive biosensors. Encouragingly, owing to the advances in single-molecule microscopy and spectroscopy over past decades, the detection of single fluorescent molecule comes true, greatly boosting the development of highly sensitive biosensors. By in vitro/in vivo labeling of target biomolecules with proper fluorescent tags, the quantification of certain biomolecule at the single-molecule level is achieved. In comparison with conventional ensemble measurements, single-molecule detection-based analytical methods possess the advantages of ultrahigh sensitivity, good selectivity, rapid analysis time, and low sample consumption. Consequently, single-molecule detection may be potentially employed as an ideal analytical approach to quantify low-abundant biomolecules with rapidity and simplicity. In this Account, we will summarize our efforts for developing a series of ultrasensitive biosensors based on single-molecule counting. Single-molecule counting is a member of single-molecule detection technologies and may be used as a very simple and ultrasensitive method to quantify target molecules by simply counting the individual fluorescent bursts. In the fluorescent sensors, the signals of target biomolecules may be translated to the
Single Fluorescent Molecules as Nano-Illuminators for Biological Structure and Function
Moerner, W. E.
2011-03-01
Since the first optical detection and spectroscopy of a single molecule in a solid (Phys. Rev. Lett. {62}, 2535 (1989)), much has been learned about the ability of single molecules to probe local nanoenvironments and individual behavior in biological and nonbiological materials in the absence of ensemble averaging that can obscure heterogeneity. Because each single fluorophore acts a light source roughly 1 nm in size, microscopic imaging of individual fluorophores leads naturally to superlocalization, or determination of the position of the molecule with precision beyond the optical diffraction limit, simply by digitization of the point-spread function from the single emitter. For example, the shape of single filaments in a living cell can be extracted simply by allowing a single molecule to move through the filament (PNAS {103}, 10929 (2006)). The addition of photoinduced control of single-molecule emission allows imaging beyond the diffraction limit (super-resolution) and a new array of acronyms (PALM, STORM, F-PALM etc.) and advances have appeared. We have used the native blinking and switching of a common yellow-emitting variant of green fluorescent protein (EYFP) reported more than a decade ago (Nature {388}, 355 (1997)) to achieve sub-40 nm super-resolution imaging of several protein structures in the bacterium Caulobacter crescentus: the quasi-helix of the actin-like protein MreB (Nat. Meth. {5}, 947 (2008)), the cellular distribution of the DNA binding protein HU (submitted), and the recently discovered division spindle composed of ParA filaments (Nat. Cell Biol. {12}, 791 (2010)). Even with these advances, better emitters would provide more photons and improved resolution, and a new photoactivatable small-molecule emitter has recently been synthesized and targeted to specific structures in living cells to provide super-resolution images (JACS {132}, 15099 (2010)). Finally, a new optical method for extracting three-dimensional position information based on
International Nuclear Information System (INIS)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi
2017-01-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi
2017-03-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
Single-molecule electronics: Cooling individual vibrational modes by the tunneling current.
Lykkebo, Jacob; Romano, Giuseppe; Gagliardi, Alessio; Pecchia, Alessandro; Solomon, Gemma C
2016-03-21
Electronic devices composed of single molecules constitute the ultimate limit in the continued downscaling of electronic components. A key challenge for single-molecule electronics is to control the temperature of these junctions. Controlling heating and cooling effects in individual vibrational modes can, in principle, be utilized to increase stability of single-molecule junctions under bias, to pump energy into particular vibrational modes to perform current-induced reactions, or to increase the resolution in inelastic electron tunneling spectroscopy by controlling the life-times of phonons in a molecule by suppressing absorption and external dissipation processes. Under bias the current and the molecule exchange energy, which typically results in heating of the molecule. However, the opposite process is also possible, where energy is extracted from the molecule by the tunneling current. Designing a molecular "heat sink" where a particular vibrational mode funnels heat out of the molecule and into the leads would be very desirable. It is even possible to imagine how the vibrational energy of the other vibrational modes could be funneled into the "cooling mode," given the right molecular design. Previous efforts to understand heating and cooling mechanisms in single molecule junctions have primarily been concerned with small models, where it is unclear which molecular systems they correspond to. In this paper, our focus is on suppressing heating and obtaining current-induced cooling in certain vibrational modes. Strategies for cooling vibrational modes in single-molecule junctions are presented, together with atomistic calculations based on those strategies. Cooling and reduced heating are observed for two different cooling schemes in calculations of atomistic single-molecule junctions.
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
Energy Technology Data Exchange (ETDEWEB)
Laurence, Ted Alfred [Univ. of California, Berkeley, CA (United States)
2002-01-01
Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS
International Nuclear Information System (INIS)
Laurence, Ted Alfred
2002-01-01
Single-molecule methods have the potential to provide information about conformational dynamics and molecular interactions that cannot be obtained by other methods. Removal of ensemble averaging provides several benefits, including the ability to detect heterogeneous populations and the ability to observe asynchronous reactions. Single-molecule diffusion methodologies using fluorescence resonance energy transfer (FRET) are developed to monitor conformational dynamics while minimizing perturbations introduced by interactions between molecules and surfaces. These methods are used to perform studies of the folding of Chymotrypsin Inhibitor 2, a small, single-domain protein, and of single-stranded DNA (ssDNA) homopolymers. Confocal microscopy is used in combination with sensitive detectors to detect bursts of photons from fluorescently labeled biomolecules as they diffuse through the focal volume. These bursts are analyzed to extract fluorescence resonance energy transfer (FRET) efficiency. Advances in data acquisition and analysis techniques that are providing a more complete picture of the accessible molecular information are discussed. Photon Arrival-time Interval Distribution (PAID) analysis is a new method for monitoring macromolecular interactions by fluorescence detection with simultaneous determination of coincidence, brightness, diffusion time, and occupancy (proportional to concentration) of fluorescently-labeled molecules undergoing diffusion in a confocal detection volume. This method is based on recording the time of arrival of all detected photons, and then plotting the two-dimensional histogram of photon pairs, where one axis is the time interval between each pair of photons 1 and 2, and the second axis is the number of other photons detected in the time interval between photons 1 and 2. PAID is related to Fluorescence Correlation Spectroscopy (FCS) by a collapse of this histogram onto the time interval axis. PAID extends auto- and cross-correlation FCS
Single-molecule spectroscopy of amino acids and peptides by recognition tunnelling
Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, Jongone; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart
2014-06-01
The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single-molecule protein sequencing is a critical step in the search for protein biomarkers. Here, we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules, then measuring the electron tunnelling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic `fingerprints' associated with each binding motif. With this recognition tunnelling technique, we are able to identify D and L enantiomers, a methylated amino acid, isobaric isomers and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore.
International Nuclear Information System (INIS)
Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui
2011-01-01
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
Hoang, Tony; Patel, Dhruv S; Halvorsen, Ken
2016-08-01
The centrifuge force microscope (CFM) was recently introduced as a platform for massively parallel single-molecule manipulation and analysis. Here we developed a low-cost and self-contained CFM module that works directly within a commercial centrifuge, greatly improving accessibility and ease of use. Our instrument incorporates research grade video microscopy, a power source, a computer, and wireless transmission capability to simultaneously monitor many individually tethered microspheres. We validated the instrument by performing single-molecule force shearing of short DNA duplexes. For a 7 bp duplex, we observed over 1000 dissociation events due to force dependent shearing from 2 pN to 12 pN with dissociation times in the range of 10-100 s. We extended the measurement to a 10 bp duplex, applying a 12 pN force clamp and directly observing single-molecule dissociation over an 85 min experiment. Our new CFM module facilitates simple and inexpensive experiments that dramatically improve access to single-molecule analysis.
Structural Transitions in Supercoiled Stretched DNA
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.
Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R
2017-01-01
During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.
Highly parallel translation of DNA sequences into small molecules.
Directory of Open Access Journals (Sweden)
Rebecca M Weisinger
Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.
Mechanisms of Surface-Mediated DNA Hybridization
2015-01-01
Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278
Ballmann, Stefan; Härtle, Rainer; Coto, Pedro B.; Elbing, Mark; Mayor, Marcel; Bryce, Martin R.; Thoss, Michael; Weber, Heiko B.
2012-08-01
We analyze quantum interference and decoherence effects in single-molecule junctions both experimentally and theoretically by means of the mechanically controlled break junction technique and density-functional theory. We consider the case where interference is provided by overlapping quasidegenerate states. Decoherence mechanisms arising from electronic-vibrational coupling strongly affect the electrical current flowing through a single-molecule contact and can be controlled by temperature variation. Our findings underline the universal relevance of vibrations for understanding charge transport through molecular junctions.
De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C
2017-10-17
Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao
2018-03-25
The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The elastic theory of a single DNA molecule
Indian Academy of Sciences (India)
methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.
DNA origami compliant nanostructures with tunable mechanical properties.
Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E
2014-01-28
DNA origami enables fabrication of precise nanostructures by programming the self-assembly of DNA. While this approach has been used to make a variety of complex 2D and 3D objects, the mechanical functionality of these structures is limited due to their rigid nature. We explore the fabrication of deformable, or compliant, objects to establish a framework for mechanically functional nanostructures. This compliant design approach is used in macroscopic engineering to make devices including sensors, actuators, and robots. We build compliant nanostructures by utilizing the entropic elasticity of single-stranded DNA (ssDNA) to locally bend bundles of double-stranded DNA into bent geometries whose curvature and mechanical properties can be tuned by controlling the length of ssDNA strands. We demonstrate an ability to achieve a wide range of geometries by adjusting a few strands in the nanostructure design. We further developed a mechanical model to predict both geometry and mechanical properties of our compliant nanostructures that agrees well with experiments. Our results provide a basis for the design of mechanically functional DNA origami devices and materials.
Single-Molecule Interfacial Electron Transfer
Energy Technology Data Exchange (ETDEWEB)
Ho, Wilson [Univ. of California, Irvine, CA (United States)
2018-02-03
Interfacial electron transfer (ET) plays an important role in many chemical and biological processes. Specifically, interfacial ET in TiO2-based systems is important to solar energy technology, catalysis, and environmental remediation technology. However, the microscopic mechanism of interfacial ET is not well understood with regard to atomic surface structure, molecular structure, bonding, orientation, and motion. In this project, we used two complementary methodologies; single-molecule fluorescence spectroscopy, and scanning-tunneling microscopy and spectroscopy (STM and STS) to address this scientific need. The goal of this project was to integrate these techniques and measure the molecular dependence of ET between adsorbed molecules and TiO2 semiconductor surfaces and the ET induced reactions such as the splitting of water. The scanning probe techniques, STM and STS, are capable of providing the highest spatial resolution but not easily time-resolved data. Single-molecule fluorescence spectroscopy is capable of good time resolution but requires further development to match the spatial resolution of the STM. The integrated approach involving Peter Lu at Bowling Green State University (BGSU) and Wilson Ho at the University of California, Irvine (UC Irvine) produced methods for time and spatially resolved chemical imaging of interfacial electron transfer dynamics and photocatalytic reactions. An integral aspect of the joint research was a significant exchange of graduate students to work at the two institutions. This project bridged complementary approaches to investigate a set of common problems by working with the same molecules on a variety of solid surfaces, but using appropriate techniques to probe under ambient (BGSU) and ultrahigh vacuum (UCI) conditions. The molecular level understanding of the fundamental interfacial electron transfer processes obtained in this joint project will be important for developing efficient light harvesting
Vibrationally coupled electron transport through single-molecule junctions
Energy Technology Data Exchange (ETDEWEB)
Haertle, Rainer
2012-04-26
Single-molecule junctions are among the smallest electric circuits. They consist of a molecule that is bound to a left and a right electrode. With such a molecular nanocontact, the flow of electrical currents through a single molecule can be studied and controlled. Experiments on single-molecule junctions show that a single molecule carries electrical currents that can even be in the microampere regime. Thereby, a number of transport phenomena have been observed, such as, for example, diode- or transistor-like behavior, negative differential resistance and conductance switching. An objective of this field, which is commonly referred to as molecular electronics, is to relate these transport phenomena to the properties of the molecule in the contact. To this end, theoretical model calculations are employed, which facilitate an understanding of the underlying transport processes and mechanisms. Thereby, one has to take into account that molecules are flexible structures, which respond to a change of their charge state by a profound reorganization of their geometrical structure or may even dissociate. It is thus important to understand the interrelation between the vibrational degrees of freedom of a singlemolecule junction and the electrical current flowing through the contact. In this thesis, we investigate vibrational effects in electron transport through singlemolecule junctions. For these studies, we calculate and analyze transport characteristics of both generic and first-principles based model systems of a molecular contact. To this end, we employ a master equation and a nonequilibrium Green's function approach. Both methods are suitable to describe this nonequilibrium transport problem and treat the interactions of the tunneling electrons on the molecular bridge non-perturbatively. This is particularly important with respect to the vibrational degrees of freedom, which may strongly interact with the tunneling electrons. We show in detail that the resulting
International Nuclear Information System (INIS)
Livneh, Z.
1986-01-01
Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed
Single Molecule Spectroscopy of Electron Transfer
International Nuclear Information System (INIS)
Holman, Michael; Zang, Ling; Liu, Ruchuan; Adams, David M.
2009-01-01
The objectives of this research are threefold: (1) to develop methods for the study electron transfer processes at the single molecule level, (2) to develop a series of modifiable and structurally well defined molecular and nanoparticle systems suitable for detailed single molecule/particle and bulk spectroscopic investigation, (3) to relate experiment to theory in order to elucidate the dependence of electron transfer processes on molecular and electronic structure, coupling and reorganization energies. We have begun the systematic development of single molecule spectroscopy (SMS) of electron transfer and summaries of recent studies are shown. There is a tremendous need for experiments designed to probe the discrete electronic and molecular dynamic fluctuations of single molecules near electrodes and at nanoparticle surfaces. Single molecule spectroscopy (SMS) has emerged as a powerful method to measure properties of individual molecules which would normally be obscured in ensemble-averaged measurement. Fluctuations in the fluorescence time trajectories contain detailed molecular level statistical and dynamical information of the system. The full distribution of a molecular property is revealed in the stochastic fluctuations, giving information about the range of possible behaviors that lead to the ensemble average. In the case of electron transfer, this level of understanding is particularly important to the field of molecular and nanoscale electronics: from a device-design standpoint, understanding and controlling this picture of the overall range of possible behaviors will likely prove to be as important as designing ia the ideal behavior of any given molecule.
Fast recognition of single molecules based on single-event photon statistics
International Nuclear Information System (INIS)
Dong Shuangli; Huang Tao; Liu Yuan; Wang Jun; Zhang Guofeng; Xiao Liantuan; Jia Suotang
2007-01-01
Mandel's Q parameter, which is determined from single-event photon statistics, provides an alternative way to recognize single molecules with fluorescence detection, other than the second-order correlation function. It is shown that the Q parameter of an assumed ideal double-molecule fluorescence with the same average photon number as that of the sample fluorescence can act as the criterion for single-molecule recognition. The influence of signal-to-background ratio and the error estimates for photon statistics are also presented. We have applied this method to ascertain single Cy5 dye molecules within hundreds of milliseconds
Energy Technology Data Exchange (ETDEWEB)
Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2011-01-24
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
Sobhy, M. A.
2011-11-07
Single-molecule fluorescence imaging is at the forefront of tools applied to study biomolecular dynamics both in vitro and in vivo. The ability of the single-molecule fluorescence microscope to conduct simultaneous multi-color excitation and detection is a key experimental feature that is under continuous development. In this paper, we describe in detail the design and the construction of a sophisticated and versatile multi-color excitation and emission fluorescence instrument for studying biomolecular dynamics at the single-molecule level. The setup is novel, economical and compact, where two inverted microscopes share a laser combiner module with six individual laser sources that extend from 400 to 640 nm. Nonetheless, each microscope can independently and in a flexible manner select the combinations, sequences, and intensities of the excitation wavelengths. This high flexibility is achieved by the replacement of conventional mechanical shutters with acousto-optic tunable filter (AOTF). The use of AOTF provides major advancement by controlling the intensities, duration, and selection of up to eight different wavelengths with microsecond alternation time in a transparent and easy manner for the end user. To our knowledge this is the first time AOTF is applied to wide-field total internal reflection fluorescence (TIRF) microscopy even though it has been commonly used in multi-wavelength confocal microscopy. The laser outputs from the combiner module are coupled to the microscopes by two sets of four single-mode optic fibers in order to allow for the optimization of the TIRF angle for each wavelength independently. The emission is split into two or four spectral channels to allow for the simultaneous detection of up to four different fluorophores of wide selection and using many possible excitation and photoactivation schemes. We demonstrate the performance of this new setup by conducting two-color alternating excitation single-molecule fluorescence resonance energy
A Brief Introduction to Single-Molecule Fluorescence Methods.
van den Wildenberg, Siet M J L; Prevo, Bram; Peterman, Erwin J G
2018-01-01
One of the more popular single-molecule approaches in biological science is single-molecule fluorescence microscopy, which will be the subject of the following section of this volume. Fluorescence methods provide the sensitivity required to study biology on the single-molecule level, but they also allow access to useful measurable parameters on time and length scales relevant for the biomolecular world. Before several detailed experimental approaches will be addressed, we will first give a general overview of single-molecule fluorescence microscopy. We start with discussing the phenomenon of fluorescence in general and the history of single-molecule fluorescence microscopy. Next, we will review fluorescent probes in more detail and the equipment required to visualize them on the single-molecule level. We will end with a description of parameters measurable with such approaches, ranging from protein counting and tracking, single-molecule localization super-resolution microscopy, to distance measurements with Förster Resonance Energy Transfer and orientation measurements with fluorescence polarization.
Nanopore arrays in a silicon membrane for parallel single-molecule detection: fabrication
Schmidt, Torsten; Zhang, Miao; Sychugov, Ilya; Roxhed, Niclas; Linnros, Jan
2015-08-01
Solid state nanopores enable translocation and detection of single bio-molecules such as DNA in buffer solutions. Here, sub-10 nm nanopore arrays in silicon membranes were fabricated by using electron-beam lithography to define etch pits and by using a subsequent electrochemical etching step. This approach effectively decouples positioning of the pores and the control of their size, where the pore size essentially results from the anodizing current and time in the etching cell. Nanopores with diameters as small as 7 nm, fully penetrating 300 nm thick membranes, were obtained. The presented fabrication scheme to form large arrays of nanopores is attractive for parallel bio-molecule sensing and DNA sequencing using optical techniques. In particular the signal-to-noise ratio is improved compared to other alternatives such as nitride membranes suffering from a high-luminescence background.
Braun, Joerg E; Serebrov, Victor
2017-01-01
Recent development of single-molecule techniques to study pre-mRNA splicing has provided insights into the dynamic nature of the spliceosome. Colocalization single-molecule spectroscopy (CoSMoS) allows following spliceosome assembly in real time at single-molecule resolution in the full complexity of cellular extracts. A detailed protocol of CoSMoS has been published previously (Anderson and Hoskins, Methods Mol Biol 1126:217-241, 2014). Here, we provide an update on the technical advances since the first CoSMoS studies including slide surface treatment, data processing, and representation. We describe various labeling strategies to generate RNA reporters with multiple dyes (or other moieties) at specific locations.
International Nuclear Information System (INIS)
Wang, Kun; Zhou, Jianfeng; Hamill, Joseph M.; Xu, Bingqian
2014-01-01
The contact effects of single-molecule break junctions on rectification behaviors were experimentally explored by a systematic control of anchoring groups of 1,4-disubstituted benzene molecular junctions. Single-molecule conductance and I-V characteristic measurements reveal a strong correlation between rectifying effects and the asymmetry in contacts. Analysis using energy band models and I-V calculations suggested that the rectification behavior is mainly caused by asymmetric coupling strengths at the two contact interfaces. Fitting of the rectification ratio by a modified Simmons model we developed suggests asymmetry in potential drop across the asymmetric anchoring groups as the mechanism of rectifying I-V behavior. This study provides direct experimental evidence and sheds light on the mechanisms of rectification behavior induced simply by contact asymmetry, which serves as an aid to interpret future single-molecule electronic behavior involved with asymmetric contact conformation
Directory of Open Access Journals (Sweden)
Huijun Xue
2017-10-01
Full Text Available Much of our knowledge in conventional biochemistry has derived from bulk assays. However, many stochastic processes and transient intermediates are hidden when averaged over the ensemble. The powerful technique of single-molecule fluorescence microscopy has made great contributions to the understanding of life processes that are inaccessible when using traditional approaches. In single-molecule studies, quantum dots (Qdots have several unique advantages over other fluorescent probes, such as high brightness, extremely high photostability, and large Stokes shift, thus allowing long-time observation and improved signal-to-noise ratios. So far, however, there is no convenient way to label proteins purified from budding yeast with Qdots. Based on BirA–Avi and biotin–streptavidin systems, we have established a simple method to acquire a Qdot-labeled protein and visualize its interaction with DNA using total internal reflection fluorescence microscopy. For proof-of-concept, we chose replication protein A (RPA and origin recognition complex (ORC as the proteins of interest. Proteins were purified from budding yeast with high biotinylation efficiency and rapidly labeled with streptavidin-coated Qdots. Interactions between proteins and DNA were observed successfully at the single-molecule level.
Directory of Open Access Journals (Sweden)
Samantha C Lewis
2015-02-01
Full Text Available Mitochondrial DNA (mtDNA encodes respiratory complex subunits essential to almost all eukaryotes; hence respiratory competence requires faithful duplication of this molecule. However, the mechanism(s of its synthesis remain hotly debated. Here we have developed Caenorhabditis elegans as a convenient animal model for the study of metazoan mtDNA synthesis. We demonstrate that C. elegans mtDNA replicates exclusively by a phage-like mechanism, in which multimeric molecules are synthesized from a circular template. In contrast to previous mammalian studies, we found that mtDNA synthesis in the C. elegans gonad produces branched-circular lariat structures with multimeric DNA tails; we were able to detect multimers up to four mtDNA genome unit lengths. Further, we did not detect elongation from a displacement-loop or analogue of 7S DNA, suggesting a clear difference from human mtDNA in regard to the site(s of replication initiation. We also identified cruciform mtDNA species that are sensitive to cleavage by the resolvase RusA; we suggest these four-way junctions may have a role in concatemer-to-monomer resolution. Overall these results indicate that mtDNA synthesis in C. elegans does not conform to any previously documented metazoan mtDNA replication mechanism, but instead are strongly suggestive of rolling circle replication, as employed by bacteriophages. As several components of the metazoan mitochondrial DNA replisome are likely phage-derived, these findings raise the possibility that the rolling circle mtDNA replication mechanism may be ancestral among metazoans.
Current rectification in a single molecule diode: the role of electrode coupling.
Sherif, Siya; Rubio-Bollinger, Gabino; Pinilla-Cienfuegos, Elena; Coronado, Eugenio; Cuevas, Juan Carlos; Agraït, Nicolás
2015-07-24
We demonstrate large rectification ratios (> 100) in single-molecule junctions based on a metal-oxide cluster (polyoxometalate), using a scanning tunneling microscope (STM) both at ambient conditions and at low temperature. These rectification ratios are the largest ever observed in a single-molecule junction, and in addition these junctions sustain current densities larger than 10(5) A cm(-2). By following the variation of the I-V characteristics with tip-molecule separation we demonstrate unambiguously that rectification is due to asymmetric coupling to the electrodes of a molecule with an asymmetric level structure. This mechanism can be implemented in other type of molecular junctions using both organic and inorganic molecules and provides a simple strategy for the rational design of molecular diodes.
Geertsema, Hylkje
2014-01-01
De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs
Muthusubramanian, N.; Galan, E.; Maity, C.; Eelkema, R.; Grozema, F. C.; van der Zant, H. S. J.
2016-07-01
We present a method to fabricate insulated gold mechanically controlled break junctions (MCBJ) by coating the metal with a thin layer of aluminum oxide using plasma enhanced atomic layer deposition. The Al2O3 thickness deposited on the MCBJ devices was varied from 2 to 15 nm to test the suppression of leakage currents in deionized water and phosphate buffered saline. Junctions coated with a 15 nm thick oxide layer yielded atomically sharp electrodes and negligible conductance counts in the range of 1 to 10-4 G0 (1 G0 = 77 μS), where single-molecule conductances are commonly observed. The insulated devices were used to measure the conductance of an amphiphilic oligophenylene ethynylene derivative in deionized water.
Modulation of intermolecular interactions in single-molecule magnets
Heroux, Katie Jeanne
Polynuclear manganese clusters exhibiting interesting magnetic and quantum properties have been an area of intense research since the discovery of the first single-molecule magnet (SMM) in 1993. These molecules, below their blocking temperature, function as single-domain magnetic particles which exhibit classical macroscale magnetic properties as well as quantum mechanical phenomena such as quantum tunnelling of magnetization (QTM) and quantum phase interference. The union of classical and quantum behavior in these nanomaterials makes SMMs ideal candidates for high-density information storage and quantum computing. However, environmental coupling factors (nuclear spins, phonons, neighboring molecules) must be minimized if such applications are ever to be fully realized. The focus of this work is making small structural changes in well-known manganese SMMs in order to drastically enhance the overall magnetic and quantum properties of the system. Well-isolated molecules of high crystalline quality should lead to well-defined energetic and spectral properties as well. An advantage of SMMs over bulk magnetic materials is that they can be chemically altered from a "bottom-up" approach providing a synthetic tool for tuning magnetic properties. This systematic approach is utilized in the work presented herein by incorporating bulky ligands and/or counterions to "isolate" the magnetic core of [Mn4] dicubane SMMs. Reducing intermolecular interactions in the crystal lattice (neighboring molecules, solvate molecules, dipolar interactions) is an important step toward developing viable quantum computing devices. Detailed bulk magnetic studies as well as single crystal magnetization hysteresis and high-frequency EPR studies on these sterically-isolated complexes show enhanced, and sometimes even unexpected, quantum dynamics. The importance of intra- and intermolecular interactions remains a common theme throughout this work, extending to other SMMs of various topology including
A brief introduction to single-molecule fluorescence methods
Wildenberg, S.M.J.L.; Prevo, B.; Peterman, E.J.G.; Peterman, EJG; Wuite, GJL
2011-01-01
One of the more popular single-molecule approaches in biological science is single-molecule fluorescence microscopy, which is the subject of the following section of this volume. Fluorescence methods provide the sensitivity required to study biology on the single-molecule level, but they also allow
A brief introduction to single-molecule fluorescence methods
van den Wildenberg, Siet M.J.L.; Prevo, Bram; Peterman, Erwin J.G.
2018-01-01
One of the more popular single-molecule approaches in biological science is single-molecule fluorescence microscopy, which will be the subject of the following section of this volume. Fluorescence methods provide the sensitivity required to study biology on the single-molecule level, but they also
Mammalian DNA single-strand break repair: an X-ra(y)ted affair.
Caldecott, K W
2001-05-01
The genetic stability of living cells is continuously threatened by the presence of endogenous reactive oxygen species and other genotoxic molecules. Of particular threat are the thousands of DNA single-strand breaks that arise in each cell, each day, both directly from disintegration of damaged sugars and indirectly from the excision repair of damaged bases. If un-repaired, single-strand breaks can be converted into double-strand breaks during DNA replication, potentially resulting in chromosomal rearrangement and genetic deletion. Consequently, cells have adopted multiple pathways to ensure the rapid and efficient removal of single-strand breaks. A general feature of these pathways appears to be the extensive employment of protein-protein interactions to stimulate both the individual component steps and the overall repair reaction. Our current understanding of DNA single-strand break repair is discussed, and testable models for the architectural coordination of this important process are presented. Copyright 2001 John Wiley & Sons, Inc.
DNA molecules and human therapeutics | Danquah | African Journal ...
African Journals Online (AJOL)
Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
Roxbury, Daniel
It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation
Light-Induced Switching of Tunable Single-Molecule Junctions
Sendler, Torsten; Luka-Guth, Katharina; Wieser, Matthias; Lokamani; Wolf, Jannic Sebastian; Helm, Manfred; Gemming, Sibylle; Kerbusch, Jochen; Scheer, Elke; Huhn, Thomas; Erbe, Artur
2015-01-01
A major goal of molecular electronics is the development and implementation of devices such as single-molecular switches. Here, measurements are presented that show the controlled in situ switching of diarylethene molecules from their nonconductive to conductive state in contact to gold nanoelectrodes via controlled light irradiation. Both the conductance and the quantum yield for switching of these molecules are within a range making the molecules suitable for actual devices. The conductance of the molecular junctions in the opened and closed states is characterized and the molecular level E 0, which dominates the current transport in the closed state, and its level broadening Γ are identified. The obtained results show a clear light-induced ring forming isomerization of the single-molecule junctions. Electron withdrawing side-groups lead to a reduction of conductance, but do not influence the efficiency of the switching mechanism. Quantum chemical calculations of the light-induced switching processes correlate these observations with the fundamentally different low-lying electronic states of the opened and closed forms and their comparably small modification by electron-withdrawing substituents. This full characterization of a molecular switch operated in a molecular junction is an important step toward the development of real molecular electronics devices.
Light-Induced Switching of Tunable Single-Molecule Junctions
Sendler, Torsten
2015-04-16
A major goal of molecular electronics is the development and implementation of devices such as single-molecular switches. Here, measurements are presented that show the controlled in situ switching of diarylethene molecules from their nonconductive to conductive state in contact to gold nanoelectrodes via controlled light irradiation. Both the conductance and the quantum yield for switching of these molecules are within a range making the molecules suitable for actual devices. The conductance of the molecular junctions in the opened and closed states is characterized and the molecular level E 0, which dominates the current transport in the closed state, and its level broadening Γ are identified. The obtained results show a clear light-induced ring forming isomerization of the single-molecule junctions. Electron withdrawing side-groups lead to a reduction of conductance, but do not influence the efficiency of the switching mechanism. Quantum chemical calculations of the light-induced switching processes correlate these observations with the fundamentally different low-lying electronic states of the opened and closed forms and their comparably small modification by electron-withdrawing substituents. This full characterization of a molecular switch operated in a molecular junction is an important step toward the development of real molecular electronics devices.
Czech Academy of Sciences Publication Activity Database
Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.
2006-01-01
Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006
Different responses to muon implantation in single- and double-stranded DNA
International Nuclear Information System (INIS)
Hubbard, Penny L.; Tani, Akiko; Oganesyan, Vasily S.; Butt, Julea N.; Cottrell, Stephen P.; Jayasooriya, Upali A.
2006-01-01
A model-free analysis of the longitudinal muon spin relaxation of muons implanted into single- and double-stranded DNA samples is reported. These samples show distinctly different responses to implanted muons with discontinuities of the integrated asymmetries at temperatures where these molecules are likely to have onset of molecular and electron dynamics
International Nuclear Information System (INIS)
Schneider, T.; Jahr, N.; Jatschka, J.; Csaki, A.; Stranik, O.; Fritzsche, W.
2013-01-01
The effect of DNA–DNA interaction on the localized surface plasmon resonance of single 80 nm gold nanoparticles is studied. Therefore, both the attachment of the capture DNA strands at the particle surface and the sequence-specific DNA binding (hybridization) of analyte DNA to the immobilized capture DNA is subject of investigations. The influence of substrate attachment chemistry, the packing density of DNA as controlled by an assisting layer of smaller molecules, and the distance as increased by a linker on the LSPR efficiency is investigated. The resulting changes in signal can be related to a higher hybridization efficiency of the analyte DNA to the immobilized capture DNA. The subsequent attachment of additional DNA strands to this system is studied, which allows for a multiple step detection of binding and an elucidation of the resulting resonance shifts. The detection limit was determined for the utilized DNA system by incubation with various concentration of analyte DNA. Although the method allows for a marker-free detection, we show that additional markers such as 20 nm gold particle labels increase the signal and thereby the sensitivity significantly. The study of resonance shift for various DNA lengths revealed that the resonance shift per base is stronger for shorter DNA molecules (20 bases) as compared to longer ones (46 bases).
Directory of Open Access Journals (Sweden)
Akira Kitamura
2018-07-01
Full Text Available Normal function and abnormal aggregation of transactivation response (TAR DNA/RNA-binding protein 43 kDa (TDP-43 are directly associated with the lethal genetic diseases: cystic fibrosis, amyotrophic lateral sclerosis (ALS, and frontotemporal lobar degeneration (FTLD. The binding of TDP-43 to single-stranded DNA (ssDNA or RNA is involved in transcriptional repression, regulation of RNA splicing, and RNA stabilization. Equilibrium dissociation constants (Kd of TDP-43 and ssDNA or RNA have been determined using various methods; however, methods that can measure Kd with high sensitivity in a short time using a small amount of TDP-43 in solution would be advantageous. Here, in order to determine the Kd of TDP-43 and fluorescence-labeled ssDNA as well as the binding stoichiometry, we use fluorescence correlation spectroscopy (FCS, which detects the slowed diffusion of molecular interactions in solution with single-molecule sensitivity, in addition to electrophoretic mobility shift assay (EMSA. Using tandem affinity chromatography of TDP-43 dually tagged with glutathione-S-transferase and poly-histidine tags, highly purified protein was obtained. FCS successfully detected specific interaction between purified TDP-43 and TG ssDNA repeats, with a Kd in the nanomolar range. The Kd of the TDP-43 mutant was not different from the wild type, although mutant oligomers, which did not bind ssDNA, were observed. Analysis of the fluorescence brightness per dimerized TDP-43/ssDNA complex was used to evaluate their binding stoichiometry. The results suggest that an assay combining FCS and EMSA can precisely analyze ssDNA recognition mechanisms, and that FCS may be applied for the rapid and quantitative determination of the interaction strength between TDP-43 and ssDNA or RNA. These methods will aid in the elucidation of the substrate recognition mechanism of ALS- and FTLD-associated variants of TDP-43.
New tools to study biophysical properties of single molecules and single cells
Directory of Open Access Journals (Sweden)
Márcio S. Rocha
2007-03-01
Full Text Available We present a review on two new tools to study biophysical properties of single molecules and single cells. A laser incident through a high numerical aperture microscope objective can trap small dielectric particles near the focus. This arrangement is named optical tweezers. This technique has the advantage to permit manipulation of a single individual object. We use optical tweezers to measure the entropic elasticity of a single DNA molecule and its interaction with the drug Psoralen. Optical tweezers are also used to hold a kidney cell MDCK away from the substrate to allow precise volume measurements of this single cell during an osmotic shock. This procedure allows us to obtain information about membrane water permeability and regulatory volume increase. Defocusing microscopy is a recent technique invented in our laboratory, which allows the observation of transparent objects, by simply defocusing the microscope in a controlled way. Our physical model of a defocused microscope shows that the image contrast observed in this case is proportional to the defocus distance and to the curvature of the transparent object. Defocusing microscopy is very useful to study motility and mechanical properties of cells. We show here the application of defocusing microscopy to measurements of macrophage surface fluctuations and their influence on phagocytosis.Apresentamos uma revisão de duas novas técnicas para estudar propriedades biofísicas de moléculas únicas e células únicas. Um laser incidindo em uma objetiva de microscópio de grande abertura numérica é capaz de aprisionar pequenas partículas dielétricas na região próxima ao foco. Este aparato é chamado de pinça óptica. Esta técnica tem a grande vantagem de permitir a manipulação de um objeto individual. Usamos a pinça óptica para medir a elasticidade entrópica de uma molécula única de DNA em sua interação com o fármaco Psoralen. A pinça óptica também é usada para segurar
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.
2017-06-06
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-06-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-01-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Single Molecule Biophysics Experiments and Theory
Komatsuzaki, Tamiki; Takahashi, Satoshi; Yang, Haw; Silbey, Robert J; Rice, Stuart A; Dinner, Aaron R
2011-01-01
Discover the experimental and theoretical developments in optical single-molecule spectroscopy that are changing the ways we think about molecules and atoms The Advances in Chemical Physics series provides the chemical physics field with a forum for critical, authoritative evaluations of advances in every area of the discipline. This latest volume explores the advent of optical single-molecule spectroscopy, and how atomic force microscopy has empowered novel experiments on individual biomolecules, opening up new frontiers in molecular and cell biology and leading to new theoretical approaches
Hsueh, Carlin
Nanotechnology has a unique and relatively untapped utility in the fields of medicine and dentistry at the level of single-biopolymer and -molecule diagnostics. In recent years atomic force microscopy (AFM) has garnered much interest due to its ability to obtain atomic-resolution of molecular structures and probe biophysical behaviors of biopolymers and proteins in a variety of biologically significant environments. The work presented in this thesis focuses on the nanoscale manipulation and observation of biopolymers to develop an innovative technology for personalized medicine while understanding complex biological systems. These studies described here primarily use AFM to observe biopolymer interactions with proteins and its surroundings with unprecedented resolution, providing a better understanding of these systems and interactions at the nanoscale. Transcriptional profiling, the measure of messenger RNA (mRNA) abundance in a single cell, is a powerful technique that detects "behavior" or "symptoms" at the tissue and cellular level. We have sought to develop an alternative approach, using our expertise in AFM and single molecule nanotechnology, to achieve a cost-effective high throughput method for sensitive detection and profiling of subtle changes in transcript abundance. The technique does not require amplification of the mRNA sample because the AFM provides three-dimensional views of molecules with unprecedented resolution, requires minimal sample preparation, and utilizes a simple tagging chemistry on cDNA molecules. AFM images showed collagen polymers in teeth and of Drebrin-A remodeling of filamentous actin structure and mechanics. AFM was used to image collagen on exposed dentine tubules and confirmed tubule occlusion with a desensitizing prophylaxis paste by Colgate-Palmolive. The AFM also superseded other microscopy tools in resolving F-actin helix remodeling and possible cooperative binding by a neuronal actin binding protein---Drebrin-A, an
Energy Technology Data Exchange (ETDEWEB)
Muthusubramanian, N.; Zant, H. S. J. van der [Kavli Institute of Nanoscience, Delft University of Technology, Lorentzweg 1, 2628 CJ Delft (Netherlands); Galan, E.; Maity, C.; Eelkema, R.; Grozema, F. C. [Department of Chemical Engineering, Delft University of Technology, Van der Maasweg 9, 2629 HZ Delft (Netherlands)
2016-07-04
We present a method to fabricate insulated gold mechanically controlled break junctions (MCBJ) by coating the metal with a thin layer of aluminum oxide using plasma enhanced atomic layer deposition. The Al{sub 2}O{sub 3} thickness deposited on the MCBJ devices was varied from 2 to 15 nm to test the suppression of leakage currents in deionized water and phosphate buffered saline. Junctions coated with a 15 nm thick oxide layer yielded atomically sharp electrodes and negligible conductance counts in the range of 1 to 10{sup −4} G{sub 0} (1 G{sub 0} = 77 μS), where single-molecule conductances are commonly observed. The insulated devices were used to measure the conductance of an amphiphilic oligophenylene ethynylene derivative in deionized water.
Continuous throughput and long-term observation of single-molecule FRET without immobilization.
Tyagi, Swati; VanDelinder, Virginia; Banterle, Niccolò; Fuertes, Gustavo; Milles, Sigrid; Agez, Morgane; Lemke, Edward A
2014-03-01
We present an automated microfluidic platform that performs multisecond observation of single molecules with millisecond time resolution while bypassing the need for immobilization procedures. With this system, we confine biomolecules to a thin excitation field by reversibly collapsing microchannels to nanochannels. We demonstrate the power of our method by studying a variety of complex nucleic acid and protein systems, including DNA Holliday junctions, nucleosomes and human transglutaminase 2.
On theory of single-molecule transistor
International Nuclear Information System (INIS)
Tran Tien Phuc
2009-01-01
The results of the study on single-molecule transistor are mainly investigated in this paper. The structure of constructed single-molecule transistor is similar to a conventional MOSFET. The conductive channel of the transistors is a single-molecule of halogenated benzene derivatives. The chemical simulation software CAChe was used to design and implement for the essential parameter of the molecules utilized as the conductive channel. The GUI of Matlab has been built to design its graphical interface, calculate and plot the output I-V characteristic curves for the transistor. The influence of temperature, length and width of the conductive channel, and gate voltage is considered. As a result, the simulated curves are similar to the traditional MOSFET's. The operating temperature range of the transistors is wider compared with silicon semiconductors. The supply voltage for transistors is only about 1 V. The size of transistors in this research is several nanometers.
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Molecular electronics: the single molecule switch and transistor
Sotthewes, Kai; Geskin, Victor; Heimbuch, Rene; Kumar, Avijit; Zandvliet, Henricus J.W.
2014-01-01
In order to design and realize single-molecule devices it is essential to have a good understanding of the properties of an individual molecule. For electronic applications, the most important property of a molecule is its conductance. Here we show how a single octanethiol molecule can be connected
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Frisenda, R.; Perrin, M.L.; Van der Zant, H.S.J.
2015-01-01
We study single-molecule oligo(phenylene ethynylene)dithiol junctions by means of inelastic electron tunneling spectroscopy (IETS). The molecule is contacted with gold nano-electrodes formed with the mechanically controllable break junction technique. We record the IETS spectrum of the molecule from
Walters, Matthew; Bawuro, Musa; Christopher, Alfred; Knight, Alexander; Kraberger, Simona; Stainton, Daisy; Chapman, Hazel
2017-01-01
ABSTRACT Metagenomic approaches are rapidly expanding our knowledge of the diversity of viruses. In the fecal matter of Nigerian chimpanzees we recovered three gokushovirus genomes, one circular replication-associated protein encoding single-stranded DNA virus (CRESS), and a CRESS DNA molecule. PMID:28254982
DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.
Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg
2014-04-15
DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target
Observing single molecule chemical reactions on metal nanoparticles.
Energy Technology Data Exchange (ETDEWEB)
Emory, S. R. (Steven R.); Ambrose, W. Patrick; Goodwin, P. M. (Peter M); Keller, Richard A.
2001-01-01
We report the study of the photodecomposition of single Rhodamine 6G (R6G) dye molecules adsorbed on silver nanoparticles. The nanoparticles were immobilized and spatially isolated on polylysine-derivatized glass coverslips, and confocal laser microspectroscopy was used to obtain surface-enhanced Raman scattering (SERS) spectra from individual R6G molecules. The photodecomposition of these molecules was observed with 150-ms temporal resolution. The photoproduct was identified as graphitic carbon based on the appearance of broad SERS vibrational bands at 1592 cm{sup -1} and 1340 cm{sup -1} observed in both bulk and averaged single-molecule photoproduct spectra. In contrast, when observed at the single-molecule level, the photoproduct yielded sharp SERS spectra. The inhomogeneous broadening of the bulk SERS spectra is due to a variety of photoproducts in different surface orientations and is a characteristic of ensemble-averaged measurements of disordered systems. These single-molecule studies indicate a photodecomposition pathway by which the R6G molecule desorbs from the metal surface, an excited-state photoreaction occurs, and the R6G photoproduct(s) readsorbs to the surface. A SERS spectrum is obtained when either the intact R6G or the R6G photoproduct(s) are adsorbed on a SERS-active site. This work further illustrates the power of single-molecule spectroscopy (SMS) to reveal unique behaviors of single molecules that are not discernable with bulk measurements.
Single-Molecule Transport at a Rectifying GaAs Contact.
Vezzoli, Andrea; Brooke, Richard J; Ferri, Nicolò; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-02-08
In most single- or few-molecule devices, the contact electrodes are simple ohmic resistors. Here we describe a new type of single-molecule device in which metal and semiconductor contact electrodes impart a function, namely, current rectification, which is then modified by a molecule bridging the gap. We study junctions with the structure Au STM tip/X/n-GaAs substrate, where "X" is either a simple alkanedithiol or a conjugated unit bearing thiol/methylthiol contacts, and we detect current jumps corresponding to the attachment and detachment of single molecules. From the magnitudes of the current jumps we can deduce values for the conductance decay constant with molecule length that agree well with values determined from Au/molecule/Au junctions. The ability to impart functionality to a single-molecule device through the properties of the contacts as well as through the properties of the molecule represents a significant extension of the single-molecule electronics "tool-box".
SISGR: Room Temperature Single-Molecule Detection and Imaging by Stimulated Emission Microscopy
Energy Technology Data Exchange (ETDEWEB)
Xie, Xiaoliang Sunney [Harvard Univ., Cambridge, MA (United States). Dept. of Chemistry and Chemical Biology
2017-03-13
specificity than absorption and fluorescence. Current sensitivity limit of SRS microscopy has not yet reached single molecule detection. We proposed to capitalize on our state-of-the-art SRS microscopy and develop near-resonance enhanced SRS for single molecule detection of carotenoids and heme proteins. The specific aims we pursued are: (1) building the next SRS generation microscope that utilizes near resonance enhancement to allow detection and imaging of single molecules with undetectable fluorescence, such as -carotene. (2) using near-resonance SRS as a contrast mechanism to study dye-sensitize semiconductor interface, elucidating the heterogeneous electron ejection kinetics with high spatial and temporal resolution. (3) studying the binding and unbinding of oxygen in single hemoglobin molecules in order to gain molecular level understanding of the long-standing issue of cooperativity. The new methods developed in the fund period of this grant have advanced the detection sensitivity in many aspects. Near-resonance SRS improved the signal by using shorter wavelengths for SRS microscopy. Frequency modulation and multi-color SRS target the reduction of background to improve the chemical specificity of SRS while maintaining the high imaging speed. Time-domain coherent Raman scattering microscopy targets to reduce the noise floor of coherent Raman microscopy. These methods have already demonstrated first-of-a-kind new applications in biology and medical research. However, we are still one order of magnitude away from single molecule limit. It is important to continue to improve the laser specification and develop new imaging methods to finally achieve label-free single molecule microscopy.
Single molecule force spectroscopy: methods and applications in biology
International Nuclear Information System (INIS)
Shen Yi; Hu Jun
2012-01-01
Single molecule measurements have transformed our view of biomolecules. Owing to the ability of monitoring the activity of individual molecules, we now see them as uniquely structured, fluctuating molecules that stochastically transition between frequently many substrates, as two molecules do not follow precisely the same trajectory. Indeed, it is this discovery of critical yet short-lived substrates that were often missed in ensemble measurements that has perhaps contributed most to the better understanding of biomolecular functioning resulting from single molecule experiments. In this paper, we give a review on the three major techniques of single molecule force spectroscopy, and their applications especially in biology. The single molecular study of biotin-streptavidin interactions is introduced as a successful example. The problems and prospects of the single molecule force spectroscopy are discussed, too. (authors)
Investigating single molecule adhesion by atomic force spectroscopy.
Stetter, Frank W S; Kienle, Sandra; Krysiak, Stefanie; Hugel, Thorsten
2015-02-27
Atomic force spectroscopy is an ideal tool to study molecules at surfaces and interfaces. An experimental protocol to couple a large variety of single molecules covalently onto an AFM tip is presented. At the same time the AFM tip is passivated to prevent unspecific interactions between the tip and the substrate, which is a prerequisite to study single molecules attached to the AFM tip. Analyses to determine the adhesion force, the adhesion length, and the free energy of these molecules on solid surfaces and bio-interfaces are shortly presented and external references for further reading are provided. Example molecules are the poly(amino acid) polytyrosine, the graft polymer PI-g-PS and the phospholipid POPE (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine). These molecules are desorbed from different surfaces like CH3-SAMs, hydrogen terminated diamond and supported lipid bilayers under various solvent conditions. Finally, the advantages of force spectroscopic single molecule experiments are discussed including means to decide if truly a single molecule has been studied in the experiment.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.
Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L
2018-03-27
The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.
Transport mirages in single-molecule devices
Gaudenzi, R.; Misiorny, M.; Burzurí, E.; Wegewijs, M. R.; van der Zant, H. S. J.
2017-03-01
Molecular systems can exhibit a complex, chemically tailorable inner structure which allows for targeting of specific mechanical, electronic, and optical properties. At the single-molecule level, two major complementary ways to explore these properties are molecular quantum-dot structures and scanning probes. This article outlines comprehensive principles of electron-transport spectroscopy relevant to both these approaches and presents a new, high-resolution experiment on a high-spin single-molecule junction exemplifying these principles. Such spectroscopy plays a key role in further advancing our understanding of molecular and atomic systems, in particular, the relaxation of their spin. In this joint experimental and theoretical analysis, particular focus is put on the crossover between the resonant regime [single-electron tunneling] and the off-resonant regime [inelastic electron (co)tunneling spectroscopy (IETS)]. We show that the interplay of these two processes leads to unexpected mirages of resonances not captured by either of the two pictures alone. Although this turns out to be important in a large fraction of the possible regimes of level positions and bias voltages, it has been given little attention in molecular transport studies. Combined with nonequilibrium IETS—four-electron pump-probe excitations—these mirages provide crucial information on the relaxation of spin excitations. Our encompassing physical picture is supported by a master-equation approach that goes beyond weak coupling. The present work encourages the development of a broader connection between the fields of molecular quantum-dot and scanning probe spectroscopy.
Mechanisms of DNA replication termination.
Dewar, James M; Walter, Johannes C
2017-08-01
Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.
Computer systems for annotation of single molecule fragments
Schwartz, David Charles; Severin, Jessica
2016-07-19
There are provided computer systems for visualizing and annotating single molecule images. Annotation systems in accordance with this disclosure allow a user to mark and annotate single molecules of interest and their restriction enzyme cut sites thereby determining the restriction fragments of single nucleic acid molecules. The markings and annotations may be automatically generated by the system in certain embodiments and they may be overlaid translucently onto the single molecule images. An image caching system may be implemented in the computer annotation systems to reduce image processing time. The annotation systems include one or more connectors connecting to one or more databases capable of storing single molecule data as well as other biomedical data. Such diverse array of data can be retrieved and used to validate the markings and annotations. The annotation systems may be implemented and deployed over a computer network. They may be ergonomically optimized to facilitate user interactions.
Massively Parallel Single-Molecule Manipulation Using Centrifugal Force
Wong, Wesley; Halvorsen, Ken
2011-03-01
Precise manipulation of single molecules has led to remarkable insights in physics, chemistry, biology, and medicine. However, two issues that have impeded the widespread adoption of these techniques are equipment cost and the laborious nature of making measurements one molecule at a time. To meet these challenges, we have developed an approach that enables massively parallel single- molecule force measurements using centrifugal force. This approach is realized in the centrifuge force microscope, an instrument in which objects in an orbiting sample are subjected to a calibration-free, macroscopically uniform force- field while their micro-to-nanoscopic motions are observed. We demonstrate high- throughput single-molecule force spectroscopy with this technique by performing thousands of rupture experiments in parallel, characterizing force-dependent unbinding kinetics of an antibody-antigen pair in minutes rather than days. Currently, we are taking steps to integrate high-resolution detection, fluorescence, temperature control and a greater dynamic range in force. With significant benefits in efficiency, cost, simplicity, and versatility, single-molecule centrifugation has the potential to expand single-molecule experimentation to a wider range of researchers and experimental systems.
Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution
Energy Technology Data Exchange (ETDEWEB)
Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi
1986-09-01
The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks.
Single-strand breaks in supercoiled DNA induced by vacuum-UV radiation in aqueous solution
International Nuclear Information System (INIS)
Takakura, Kaoru; Ishikawa, Mitsuo; Hieda, Kotaro; Kobayashi, Katsumi; Ito, Atsushi; Ito, Takashi
1986-01-01
The induction of single-strand breaks in the DNA of plasmid pBR 322 by vacuum-UV radiation above 145 nm in aqueous solutions was studied in relation to the production of OH-radicals in water. The similarity and dissimilarity were examined on the wavelength dependence between the two effects. The maximum of single strand breaks at 150 nm could be explained by the action of OH-radicals derived from direct water photolysis: the maximum at 180 nm remains unexplained. There was no indication that the direct absorption of photon by the DNA molecule plays an important role in the production of single-strand breaks. (author)
Optical probing of single fluorescent molecules and proteins
Garcia Parajo, M.F.; Veerman, J.A.; Bouwhuis, R.; Bouwhuis, Rudo; van Hulst, N.F.; Vallée, R.A.L.
2001-01-01
Single-molecule detection and analysis of organic fluorescent molecules and proteins are presented, with emphasis on the underlying principles methodology and the application of single-molecule analysis at room temperature. This Minireview is mainly focused on the application of confocal and
Theoretical Investigations Regarding Single Molecules
DEFF Research Database (Denmark)
Pedersen, Kim Georg Lind
Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...
[The effect of spermine on acid-base equilibrium in DNA molecule].
Slonitskiĭ, S V; Kuptsov, V Iu
1990-01-01
The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.
Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics
Directory of Open Access Journals (Sweden)
Yuji Isshiki
2018-02-01
Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.
Novel approaches for single molecule activation and detection
Benfenati, Fabio; Torre, Vincent
2014-01-01
How can we obtain tools able to process and exchange information at the molecular scale In order to do this, it is necessary to activate and detect single molecules under controlled conditions. This book focuses on the generation of biologically-inspired molecular devices. These devices are based on the developments of new photonic tools able to activate and stimulate single molecule machines. Additionally, new light sensitive molecules can be selectively activated by photonic tools. These technological innovations will provide a way to control activation of single light-sensitive molecules, a
An all-electric single-molecule motor.
Seldenthuis, Johannes S; Prins, Ferry; Thijssen, Joseph M; van der Zant, Herre S J
2010-11-23
Many types of molecular motors have been proposed and synthesized in recent years, displaying different kinds of motion, and fueled by different driving forces such as light, heat, or chemical reactions. We propose a new type of molecular motor based on electric field actuation and electric current detection of the rotational motion of a molecular dipole embedded in a three-terminal single-molecule device. The key aspect of this all-electronic design is the conjugated backbone of the molecule, which simultaneously provides the potential landscape of the rotor orientation and a real-time measure of that orientation through the modulation of the conductivity. Using quantum chemistry calculations, we show that this approach provides full control over the speed and continuity of motion, thereby combining electrical and mechanical control at the molecular level over a wide range of temperatures. Moreover, chemistry can be used to change all key parameters of the device, enabling a variety of new experiments on molecular motors.
Landry, Markita P; McCall, Patrick M; Qi, Zhi; Chemla, Yann R
2009-10-21
Optical traps or "tweezers" use high-power, near-infrared laser beams to manipulate and apply forces to biological systems, ranging from individual molecules to cells. Although previous studies have established that optical tweezers induce photodamage in live cells, the effects of trap irradiation have yet to be examined in vitro, at the single-molecule level. In this study, we investigate trap-induced damage in a simple system consisting of DNA molecules tethered between optically trapped polystyrene microspheres. We show that exposure to the trapping light affects the lifetime of the tethers, the efficiency with which they can be formed, and their structure. Moreover, we establish that these irreversible effects are caused by oxidative damage from singlet oxygen. This reactive state of molecular oxygen is generated locally by the optical traps in the presence of a sensitizer, which we identify as the trapped polystyrene microspheres. Trap-induced oxidative damage can be reduced greatly by working under anaerobic conditions, using additives that quench singlet oxygen, or trapping microspheres lacking the sensitizers necessary for singlet state photoexcitation. Our findings are relevant to a broad range of trap-based single-molecule experiments-the most common biological application of optical tweezers-and may guide the development of more robust experimental protocols.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
A 3D-DNA Molecule Made of PlayMais
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks
A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)
2013-01-01
textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the
Joudeh, Luay
2017-04-01
The maturation of Okazaki fragments on the lagging strand in eukaryotes is mediated by a highly coordinated multistep process involving several proteins that ensure the accurate and efficient replication of genomic DNA. Human proliferating cell nuclear antigen (PCNA) that slides on double-stranded DNA is the key player that coordinates the access of various proteins to the different intermediary steps in this process. In this study, I am focusing on characterizing how PCNA recruits and stimulates the structure specific flap endonuclease 1 (FEN1) to process the aberrant double flap (DF) structures that are produced during maturation of Okazaki fragments. FEN1 distorts the DF structures into a bent conformer to place the scissile phosphate into the active site for cleavage. The product is a nick substrate that can be sealed by DNA ligase I whose recruitment is also mediated by its interaction with PCNA. Using single-molecule Förster resonance energy transfer (smFRET) measurements that simultaneously monitored bending and cleavage of various DF substrates by FEN1 alone or in the presence of PCNA, we found that FEN1 and PCNA bends cognate and non-cognate substrates but display remarkable selectivity to stabilize the bent conformer in cognate substrate while promoting the dissociation of non-cognate substrates. This mechanism provides efficiency and accuracy for FEN1 and PCNA to cleave the correct substrate while avoiding the deleterious cleavage of incorrect substrates. This work provides a true molecular level understanding of the key step during the maturation of Okazaki fragment and contributes towards the reconstitution of its entire activity at the single molecule level.
Spectroscopic characterization of Venus at the single molecule level.
David, Charlotte C; Dedecker, Peter; De Cremer, Gert; Verstraeten, Natalie; Kint, Cyrielle; Michiels, Jan; Hofkens, Johan
2012-02-01
Venus is a recently developed, fast maturating, yellow fluorescent protein that has been used as a probe for in vivo applications. In the present work the photophysical characteristics of Venus were analyzed spectroscopically at the bulk and single molecule level. Through time-resolved single molecule measurements we found that single molecules of Venus display pronounced fluctuations in fluorescence emission, with clear fluorescence on- and off-times. These fluorescence intermittencies were found to occupy a broad range of time scales, ranging from milliseconds to several seconds. Such long off-times can complicate the analysis of single molecule counting experiments or single-molecule FRET experiments. This journal is © The Royal Society of Chemistry and Owner Societies 2012
Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.
Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi
2016-03-24
For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mechanisms for radiation damage in DNA. Progress report, August 1, 1974--July 31, 1975
International Nuclear Information System (INIS)
Sevilla, M.D.
1975-01-01
A mechanism is proposed for radiation damage to DNA and a series of experiments utilizing electron spin resonance spectrometry to test the proposed mechanism is described. Investigations completed or nearing completion are: studies of electron transfer reactions in dinucleoside phosphates; studies of the anions of 5-nitropyrimidines and their reactions; and studies of protonation reactions at carbon sites in anion radicals of certain model compounds and aromatic amino acids. In the first study, the relative electron affinities of the DNA bases were determined in a model system of the DNA strand. In addition, study of the reactions of these anions showed that the thymine anion is the most reactive of the DNA bases in this model system. In the second study anisotropic and isotropic spectra of the anion radicals of 5-nitropyrimidines were characterized by newly developed computer simulation programs. Several of the anions were found to react to form iminoxy radicals. The third study showed that protonation reactions at carbon sites in anions are reactions which are general for molecules with unsaturated linkages. Thus, this mechanism is of significance to the radiolysis of many biological molecules, including DNA. (U.S.)
Lattice diffusion of a single molecule in solution
Ruggeri, Francesca; Krishnan, Madhavi
2017-12-01
The ability to trap a single molecule in an electrostatic potential well in solution has opened up new possibilities for the use of molecular electrical charge to study macromolecular conformation and dynamics at the level of the single entity. Here we study the diffusion of a single macromolecule in a two-dimensional lattice of electrostatic traps in solution. We report the ability to measure both the size and effective electrical charge of a macromolecule by observing single-molecule transport trajectories, typically a few seconds in length, using fluorescence microscopy. While, as shown previously, the time spent by the molecule in a trap is a strong function of its effective charge, we demonstrate here that the average travel time between traps in the landscape yields its hydrodynamic radius. Tailoring the pitch of the lattice thus yields two different experimentally measurable time scales that together uniquely determine both the size and charge of the molecule. Since no information is required on the location of the molecule between consecutive departure and arrival events at lattice sites, the technique is ideally suited to measurements on weakly emitting entities such as single molecules.
Muthusubramanian, Nandini; Maity, Chandan; Galan Garcia, Elena; Eelkema, Rienk; Grozema, Ferdinand; van der Zant, Herre; Kavli Institute of Nanoscience Collaboration; Department of Chemical Engineering Collaboration
We present a method for studying the effects of polar solvents on charge transport through organic/biological single molecules by developing solvent-compatible mechanically controlled break junctions of gold coated with a thin layer of aluminium oxide using plasma enhanced atomic layer deposition (ALD). The optimal oxide thickness was experimentally determined to be 15 nm deposited at ALD operating temperature of 300°C which yielded atomically sharp electrodes and reproducible single-barrier tunnelling behaviour across a wide conductance range between 1 G0 and 10-7 G0. The insulator protected MCBJ devices were found to be effective in various solvents such as deionized water, phosphate buffered saline, methanol, acetonitrile and dichlorobenzene. The yield of molecular junctions using such insulated electrodes was tested by developing a chemical protocol for synthesizing an amphipathic form of oligo-phenylene ethynylene (OPE3-PEO) with thioacetate anchoring groups. This work has further applications in studying effects of solvation, dipole orientation and other thermodynamic interactions on charge transport. Eu Marie Curie Initial Training Network (ITN). MOLECULAR-SCALE ELECTRONICS: ``MOLESCO'' Project Number 606728.
Experimental techniques for single cell and single molecule biomechanics
International Nuclear Information System (INIS)
Lim, C.T.; Zhou, E.H.; Li, A.; Vedula, S.R.K.; Fu, H.X.
2006-01-01
Stresses and strains that act on the human body can arise either from external physical forces or internal physiological environmental conditions. These biophysical interactions can occur not only at the musculoskeletal but also cellular and molecular levels and can determine the health and function of the human body. Here, we seek to investigate the structure-property-function relationship of cells and biomolecules so as to understand their important physiological functions as well as establish possible connections to human diseases. With the recent advancements in cell and molecular biology, biophysics and nanotechnology, several innovative and state-of-the-art experimental techniques and equipment have been developed to probe the structural and mechanical properties of biostructures from the micro- down to picoscale. Some of these experimental techniques include the optical or laser trap method, micropipette aspiration, step-pressure technique, atomic force microscopy and molecular force spectroscopy. In this article, we will review the basic principles and usage of these techniques to conduct single cell and single molecule biomechanics research
Mechanisms of free radical-induced damage to DNA.
Dizdaroglu, Miral; Jaruga, Pawel
2012-04-01
Endogenous and exogenous sources cause free radical-induced DNA damage in living organisms by a variety of mechanisms. The highly reactive hydroxyl radical reacts with the heterocyclic DNA bases and the sugar moiety near or at diffusion-controlled rates. Hydrated electron and H atom also add to the heterocyclic bases. These reactions lead to adduct radicals, further reactions of which yield numerous products. These include DNA base and sugar products, single- and double-strand breaks, 8,5'-cyclopurine-2'-deoxynucleosides, tandem lesions, clustered sites and DNA-protein cross-links. Reaction conditions and the presence or absence of oxygen profoundly affect the types and yields of the products. There is mounting evidence for an important role of free radical-induced DNA damage in the etiology of numerous diseases including cancer. Further understanding of mechanisms of free radical-induced DNA damage, and cellular repair and biological consequences of DNA damage products will be of outmost importance for disease prevention and treatment.
Extending Single-Molecule Microscopy Using Optical Fourier Processing
2015-01-01
This article surveys the recent application of optical Fourier processing to the long-established but still expanding field of single-molecule imaging and microscopy. A variety of single-molecule studies can benefit from the additional image information that can be obtained by modulating the Fourier, or pupil, plane of a widefield microscope. After briefly reviewing several current applications, we present a comprehensive and computationally efficient theoretical model for simulating single-molecule fluorescence as it propagates through an imaging system. Furthermore, we describe how phase/amplitude-modulating optics inserted in the imaging pathway may be modeled, especially at the Fourier plane. Finally, we discuss selected recent applications of Fourier processing methods to measure the orientation, depth, and rotational mobility of single fluorescent molecules. PMID:24745862
Hyeon, Changbong
2010-01-01
In recent years, single molecule force techniques have opened a new avenue to decipher the folding landscapes of biopolymers by allowing us to watch and manipulate the dynamics of individual proteins and nucleic acids. In single molecule force experiments, quantitative analyses of measurements employing sound theoretical models and molecular simulations play central role more than any other field. With a brief description of basic theories for force mechanics and molecular simulation techniqu...
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Strong plasmonic enhancement of single molecule photostability in silver dimer optical antennas
Directory of Open Access Journals (Sweden)
Kaminska Izabela
2018-02-01
Full Text Available Photobleaching is an effect terminating the photon output of fluorophores, limiting the duration of fluorescence-based experiments. Plasmonic nanoparticles (NPs can increase the overall fluorophore photostability through an enhancement of the radiative rate. In this work, we use the DNA origami technique to arrange a single fluorophore in the 12-nm gap of a silver NP dimer and study the number of emitted photons at the single molecule level. Our findings yielded a 30× enhancement in the average number of photons emitted before photobleaching. Numerical simulations are employed to rationalize our results. They reveal the effect of silver oxidation on decreasing the radiative rate enhancement.
International Nuclear Information System (INIS)
Shavitt, O.; Livneh, Z.
1989-01-01
Cloning of the phi X174 viral origin of replication into phage M13mp8 produced an M13-phi X174 chimera, the DNA of which directed efficient replicative-form----single-strand rolling replication in vitro. This replication assay was performed with purified phi X174-encoded gene A protein, Escherichia coli rep helicase, single-stranded DNA-binding protein, and DNA polymerase III holoenzyme. The nicking of replicative-form I (RFI) DNA by gene A protein was essentially unaffected by the presence of UV lesions in the DNA. However, unwinding of UV-irradiated DNA by the rep helicase was inhibited twofold as compared with unwinding of the unirradiated substrate. UV irradiation of the substrate DNA caused a strong inhibition in its ability to direct DNA synthesis. However, even DNA preparations that contained as many as 10 photodimers per molecule still supported the synthesis of progeny full-length single-stranded DNA. The appearance of full-length radiolabeled products implied at least two full rounds of replication, since the first round released the unlabeled plus viral strand of the duplex DNA. Pretreatment of the UV-irradiated DNA substrate with purified pyrimidine dimer endonuclease from Micrococcus luteus, which converted photodimer-containing supercoiled RFI DNA into relaxed, nicked RFII DNA and thus prevented its replication, reduced DNA synthesis by 70%. Analysis of radiolabeled replication products by agarose gel electrophoresis followed by autoradiography revealed that this decrease was due to a reduction in the synthesis of progeny full-length single-stranded DNA. This implies that 70 to 80% of the full-length DNA products produced in this system were synthesized on molecules that carried photodimers
Controlling single-molecule junction conductance by molecular interactions
Kitaguchi, Y.; Habuka, S.; Okuyama, H.; Hatta, S.; Aruga, T.; Frederiksen, T.; Paulsson, M.; Ueba, H.
2015-01-01
For the rational design of single-molecular electronic devices, it is essential to understand environmental effects on the electronic properties of a working molecule. Here we investigate the impact of molecular interactions on the single-molecule conductance by accurately positioning individual molecules on the electrode. To achieve reproducible and precise conductivity measurements, we utilize relatively weak π-bonding between a phenoxy molecule and a STM-tip to form and cleave one contact to the molecule. The anchoring to the other electrode is kept stable using a chalcogen atom with strong bonding to a Cu(110) substrate. These non-destructive measurements permit us to investigate the variation in single-molecule conductance under different but controlled environmental conditions. Combined with density functional theory calculations, we clarify the role of the electrostatic field in the environmental effect that influences the molecular level alignment. PMID:26135251
Counting molecules in cell-free DNA and single cells RNA
Karlsson, Kasper
2016-01-01
The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...
Shedding Light on Protein Folding, Structural and Functional Dynamics by Single Molecule Studies
Directory of Open Access Journals (Sweden)
Krutika Bavishi
2014-11-01
Full Text Available The advent of advanced single molecule measurements unveiled a great wealth of dynamic information revolutionizing our understanding of protein dynamics and behavior in ways unattainable by conventional bulk assays. Equipped with the ability to record distribution of behaviors rather than the mean property of a population, single molecule measurements offer observation and quantification of the abundance, lifetime and function of multiple protein states. They also permit the direct observation of the transient and rarely populated intermediates in the energy landscape that are typically averaged out in non-synchronized ensemble measurements. Single molecule studies have thus provided novel insights about how the dynamic sampling of the free energy landscape dictates all aspects of protein behavior; from its folding to function. Here we will survey some of the state of the art contributions in deciphering mechanisms that underlie protein folding, structural and functional dynamics by single molecule fluorescence microscopy techniques. We will discuss a few selected examples highlighting the power of the emerging techniques and finally discuss the future improvements and directions.
Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.
Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S
2013-10-01
Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.
Firman, Keith; Evans, Luke; Youell, James
2012-07-16
This review describes a European-funded project in the area of Synthetic Biology. The project seeks to demonstrate the application of engineering techniques and methodologies to the design and construction of a biosensor for detecting drug-target interactions at the single-molecule level. Production of the proteins required for the system followed the principle of previously described "bioparts" concepts (a system where a database of biological parts - promoters, genes, terminators, linking tags and cleavage sequences - is used to construct novel gene assemblies) and cassette-type assembly of gene expression systems (the concept of linking different "bioparts" to produce functional "cassettes"), but problems were quickly identified with these approaches. DNA substrates for the device were also constructed using a cassette-system. Finally, micro-engineering was used to build a magnetoresistive Magnetic Tweezer device for detection of single molecule DNA modifying enzymes (motors), while the possibility of constructing a Hall Effect version of this device was explored. The device is currently being used to study helicases from Plasmodium as potential targets for anti-malarial drugs, but we also suggest other potential uses for the device. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Zero-mode waveguide nanophotonic structures for single molecule characterization
Crouch, Garrison M.; Han, Donghoon; Bohn, Paul W.
2018-05-01
Single-molecule characterization has become a crucial research tool in the chemical and life sciences, but limitations, such as limited concentration range, inability to control molecular distributions in space, and intrinsic phenomena, such as photobleaching, present significant challenges. Recent developments in non-classical optics and nanophotonics offer promising routes to mitigating these restrictions, such that even low affinity (K D ~ mM) biomolecular interactions can be studied. Here we introduce and review specific nanophotonic devices used to support single molecule studies. Optical nanostructures, such as zero-mode waveguides (ZMWs), are usually fabricated in thin gold or aluminum films and serve to confine the observation volume of optical microspectroscopy to attoliter to zeptoliter volumes. These simple nanostructures allow individual molecules to be isolated for optical and electrochemical analysis, even when the molecules of interest are present at high concentration (µM–mM) in bulk solution. Arrays of ZMWs may be combined with optical probes such as single molecule fluorescence, single molecule fluorescence resonance energy transfer, and fluorescence correlation spectroscopy for distributed analysis of large numbers of single-molecule reactions or binding events in parallel. Furthermore, ZMWs may be used as multifunctional devices, for example by combining optical and electrochemical functions in a single discrete architecture to achieve electrochemical ZMWs. In this review, we will describe the optical properties, fabrication, and applications of ZMWs for single-molecule studies, as well as the integration of ZMWs into systems for chemical and biochemical analysis.
International Nuclear Information System (INIS)
Cleaver, J.E.; Rose, R.; Mitchell, D.L.
1990-01-01
Episomal plasmids and viruses in mammalian cells present small targets for X-ray-induced DNA damage. At doses up to 100 Gy, DNA strand breaks or endonuclease III-sensitive sites were not discernible in 10.3-kb Epstein-Barr virus-based plasmid DNA or in 4.9-kb defective simian virus 40 DNA. DNA replication in these small molecules, however, was inhibited strongly by X-ray doses of greater than or equal to 20 Gy, decreasing to only 20 to 40% of control values. Inhibition was relieved slightly by growth in caffeine but was increased by growth in 3-aminobenzamide. Inhibition of DNA replication in episomal DNA molecules that are too small to sustain significant damage directly to their DNA may be due to either (a) a trans-acting diffusible factor that transfers the consequences of DNA breakage to episomes and to other replicating molecules, (b) a cis-acting mechanism in which episomes are structurally linked to genomic chromatin, and replication of both episomal and chromosomal replicons is under common control, or (c) radiation damage on other cellular structures unrelated to DNA. The resolution of these cellular mechanisms may shed light on the X-ray-resistant replication in ataxia-telangiectasia and may suggest strategies for molecular characterization of potential trans- or cis-acting factors
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Thousand-fold enhancement of single-molecule fluorescence near a single gold nanorod
Yuan, H.; Khatua, S.; Zijlstra, P.; Yorulmaz, M.; Orrit, M.
2013-01-01
Single molecules: Large enhancements of single-molecule fluorescence up to 1100 times by using synthesized gold nanorods are reported (see picture). This high enhancement is achieved by selecting a dye with its adsorption and emission close to the surface plasmon resonance of the gold nanorods
James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John
2016-01-15
The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M
2016-08-02
Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.
Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.
Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D
2007-12-15
The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
International Nuclear Information System (INIS)
Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S
2008-01-01
Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters
Single Molecule Conductance of Oligothiophene Derivatives
Dell, Emma J.
This thesis studies the electronic properties of small organic molecules based on the thiophene motif. If we are to build next-generation devices, advanced materials must be designed which possess requisite electronic functionality. Molecules present attractive candidates for these ad- vanced materials since nanoscale devices are particularly sought after. However, selecting a molecule that is suited to a certain electronic function remains a challenge, and characterization of electronic behavior is therefore critical. Single molecule conductance measurements are a powerful tool to determine properties on the nanoscale and, as such, can be used to investigate novel building blocks that may fulfill the design requirements of next-generation devices. Combining these conductance results with strategic chemical synthesis allows for the development of new families of molecules that show attractive properties for future electronic devices. Since thiophene rings are the fruitflies of organic semiconductors on the bulk scale, they present an intriguing starting point for building functional materials on the nanoscale, and therefore form the structural basis of all molecules studied herein. First, the single-molecule conductance of a family of bithiophene derivatives was measured. A broad distribution in the single-molecule conductance of bithiophene was found compared with that of a biphenyl. This increased breadth in the conductance distribution was shown to be explained by the difference in 5-fold symmetry of thiophene rings as compared to the 6-fold symmetry of benzene rings. The reduced symmetry of thiophene rings results in a restriction on the torsion angle space available to these molecules when bound between two metal electrodes in a junction, causing each molecular junction to sample a different set of conformers in the conductance measurements. By contrast, the rotations of biphenyl are essentially unimpeded by junction binding, allowing each molecular junction
Varela, Juan A.; Dupuis, Julien P.; Etchepare, Laetitia; Espana, Agnès; Cognet, Laurent; Groc, Laurent
2016-03-01
Single-molecule imaging has changed the way we understand many biological mechanisms, particularly in neurobiology, by shedding light on intricate molecular events down to the nanoscale. However, current single-molecule studies in neuroscience have been limited to cultured neurons or organotypic slices, leaving as an open question the existence of fast receptor diffusion in intact brain tissue. Here, for the first time, we targeted dopamine receptors in vivo with functionalized quantum dots and were able to perform single-molecule tracking in acute rat brain slices. We propose a novel delocalized and non-inflammatory way of delivering nanoparticles (NPs) in vivo to the brain, which allowed us to label and track genetically engineered surface dopamine receptors in neocortical neurons, revealing inherent behaviour and receptor activity regulations. We thus propose a NP-based platform for single-molecule studies in the living brain, opening new avenues of research in physiological and pathological animal models.
Control of electrical conduction in DNA using hole doping
Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji
2002-03-01
Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications
Sequence specificity of alkali-labile DNA damage photosensitized by suprofen.
Starrs, S M; Davies, R J
2000-09-01
On irradiation at UVB wavelengths, in aerated neutral aqueous solution, the anti-inflammatory drug suprofen (SP) photosensitizes the production of alkali-labile cleavage sites in DNA much more efficiently than direct strand breaks. It is active at submillimolar concentrations despite having no significant binding affinity for DNA. Gel sequencing studies utilizing 32P-end-labeled oligonucleotides have revealed that piperidine-sensitive lesions are formed predominantly at the positions of guanine (G) bases, with the extent of modification being UV dose- and SP concentration-dependent. Quite distinct patterns of G-specific damage are observed in single-stranded and duplex DNA molecules. The uniform attack at all G residues in single-stranded DNA, which is enhanced in D2O, is compatible with a Type-II mechanism. SP is a known generator of singlet oxygen whose participation in the reaction is supported by the effects of quenchers and scavengers. In duplex DNA, piperidine-induced cleavage occurs with high selectivity at the 5'-G of GG and (less prominently) GA doublets. This behavior is characteristic of a Type-I process involving electron transfer from DNA to photoexcited SP molecules. The ability of SP to sensitize the formation of Type-I and Type-II photo-oxidation products from 2'-deoxyguanosine attests to the feasibility of competing mechanisms in DNA.
Improved Dye Stability in Single-Molecule Fluorescence Experiments
EcheverrÍa Aitken, Colin; Marshall, R. Andrew; Pugi, Joseph D.
Complex biological systems challenge existing single-molecule methods. In particular, dye stability limits observation time in singlemolecule fluorescence applications. Current approaches to improving dye performance involve the addition of enzymatic oxygen scavenging systems and small molecule additives. We present an enzymatic oxygen scavenging system that improves dye stability in single-molecule experiments. Compared to the currently-employed glucose-oxidase/catalase system, the protocatechuate-3,4-dioxygenase system achieves lower dissolved oxygen concentration and stabilizes single Cy3, Cy5, and Alexa488 fluorophores. Moreover, this system possesses none of the limitations associated with the glucose oxidase/catalase system. We also tested the effects of small molecule additives in this system. Biological reducing agents significantly destabilize the Cy5 fluorophore as a function of reducing potential. In contrast, anti-oxidants stabilize the Cy3 and Alexa488 fluorophores. We recommend use of the protocatechuate-3,4,-dioxygenase system with antioxidant additives, and in the absence of biological reducing agents. This system should have wide application to single-molecule fluorescence experiments.
MAGNETIC TWEEZERS FOR THE STUDY OF DNA TRACKING MOTORS
Manosas, Maria; Meglio, Adrien; Spiering, Michelle M.; Ding, Fangyuan; Benkovic, Stephen J.; Barre, François-Xavier; Saleh, Omar A.; Allemand, Jean François; Bensimon, David; Croquette, Vincent
2011-01-01
Single-molecule manipulation methods have opened a new vista on the study of molecular motors. Here we describe the use of magnetic traps for the investigation of the mechanism of DNA based motors, in particular helicases and translocases. PMID:20627163
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-01-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208
Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid
Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena
2013-01-01
The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905
Cell biochemistry studied by single-molecule imaging.
Mashanov, G I; Nenasheva, T A; Peckham, M; Molloy, J E
2006-11-01
Over the last decade, there have been remarkable developments in live-cell imaging. We can now readily observe individual protein molecules within living cells and this should contribute to a systems level understanding of biological pathways. Direct observation of single fluorophores enables several types of molecular information to be gathered. Temporal and spatial trajectories enable diffusion constants and binding kinetics to be deduced, while analyses of fluorescence lifetime, intensity, polarization or spectra give chemical and conformational information about molecules in their cellular context. By recording the spatial trajectories of pairs of interacting molecules, formation of larger molecular complexes can be studied. In the future, multicolour and multiparameter imaging of single molecules in live cells will be a powerful analytical tool for systems biology. Here, we discuss measurements of single-molecule mobility and residency at the plasma membrane of live cells. Analysis of diffusional paths at the plasma membrane gives information about its physical properties and measurement of temporal trajectories enables rates of binding and dissociation to be derived. Meanwhile, close scrutiny of individual fluorophore trajectories enables ideas about molecular dimerization and oligomerization related to function to be tested directly.
Probing Intranuclear Environments at the Single-Molecule Level
Grünwald, David; Martin, Robert M.; Buschmann, Volker; Bazett-Jones, David P.; Leonhardt, Heinrich; Kubitscheck, Ulrich; Cardoso, M. Cristina
2008-01-01
Genome activity and nuclear metabolism clearly depend on accessibility, but it is not known whether and to what extent nuclear structures limit the mobility and access of individual molecules. We used fluorescently labeled streptavidin with a nuclear localization signal as an average-sized, inert protein to probe the nuclear environment. The protein was injected into the cytoplasm of mouse cells, and single molecules were tracked in the nucleus with high-speed fluorescence microscopy. We analyzed and compared the mobility of single streptavidin molecules in structurally and functionally distinct nuclear compartments of living cells. Our results indicated that all nuclear subcompartments were easily and similarly accessible for such an average-sized protein, and even condensed heterochromatin neither excluded single molecules nor impeded their passage. The only significant difference was a higher frequency of transient trappings in heterochromatin, which lasted only tens of milliseconds. The streptavidin molecules, however, did not accumulate in heterochromatin, suggesting comparatively less free volume. Interestingly, the nucleolus seemed to exclude streptavidin, as it did many other nuclear proteins, when visualized by conventional fluorescence microscopy. The tracking of single molecules, nonetheless, showed no evidence for repulsion at the border but relatively unimpeded passage through the nucleolus. These results clearly show that single-molecule tracking can provide novel insights into mobility of proteins in the nucleus that cannot be obtained by conventional fluorescence microscopy. Our results suggest that nuclear processes may not be regulated at the level of physical accessibility but rather by local concentration of reactants and availability of binding sites. PMID:18065482
Energy Technology Data Exchange (ETDEWEB)
Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.
2009-05-11
The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.
Single molecule image formation, reconstruction and processing: introduction.
Ashok, Amit; Piestun, Rafael; Stallinga, Sjoerd
2016-07-01
The ability to image at the single molecule scale has revolutionized research in molecular biology. This feature issue presents a collection of articles that provides new insights into the fundamental limits of single molecule imaging and reports novel techniques for image formation and analysis.
Single-Molecule Photocurrent at a Metal-Molecule-Semiconductor Junction.
Vezzoli, Andrea; Brooke, Richard J; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-11-08
We demonstrate here a new concept for a metal-molecule-semiconductor nanodevice employing Au and GaAs contacts that acts as a photodiode. Current-voltage traces for such junctions are recorded using a STM, and the "blinking" or "I(t)" method is used to record electrical behavior at the single-molecule level in the dark and under illumination, with both low and highly doped GaAs samples and with two different types of molecular bridge: nonconjugated pentanedithiol and the more conjugated 1,4-phenylene(dimethanethiol). Junctions with highly doped GaAs show poor rectification in the dark and a low photocurrent, while junctions with low doped GaAs show particularly high rectification ratios in the dark (>10 3 for a 1.5 V bias potential) and a high photocurrent in reverse bias. In low doped GaAs, the greater thickness of the depletion layer not only reduces the reverse bias leakage current, but also increases the volume that contributes to the photocurrent, an effect amplified by the point contact geometry of the junction. Furthermore, since photogenerated holes tunnel to the metal electrode assisted by the HOMO of the molecular bridge, the choice of the latter has a strong influence on both the steady state and transient metal-molecule-semiconductor photodiode response. The control of junction current via photogenerated charge carriers adds new functionality to single-molecule nanodevices.
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr
2003-01-01
Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.
Sensing single electrons with single molecules
International Nuclear Information System (INIS)
Plakhotnik, Taras
2007-01-01
We propose a new methodology for probing transport of just one electron, a process of great importance both in nature and in artificial devices. Our idea for locating a single electron is analogues to the conventional GPS where signals from several satellites are used to locate a macro object. Using fluorescent molecules as tiny sensors, it is possible to determine 3D displacement vector of an electron
Molecular electronics with single molecules in solid-state devices
DEFF Research Database (Denmark)
Moth-Poulsen, Kasper; Bjørnholm, Thomas
2009-01-01
The ultimate aim of molecular electronics is to understand and master single-molecule devices. Based on the latest results on electron transport in single molecules in solid-state devices, we focus here on new insights into the influence of metal electrodes on the energy spectrum of the molecule...
Inhibition of DNA glycosylases via small molecule purine analogs.
Directory of Open Access Journals (Sweden)
Aaron C Jacobs
Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.
Anselmetti, Dario; Bartels, Frank Wilco; Becker, Anke; Decker, Björn; Eckel, Rainer; McIntosh, Matthew; Mattay, Jochen; Plattner, Patrik; Ros, Robert; Schäfer, Christian; Sewald, Norbert
2008-02-19
Tunable and switchable interaction between molecules is a key for regulation and control of cellular processes. The translation of the underlying physicochemical principles to synthetic and switchable functional entities and molecules that can mimic the corresponding molecular functions is called reverse molecular engineering. We quantitatively investigated autoinducer-regulated DNA-protein interaction in bacterial gene regulation processes with single atomic force microscopy (AFM) molecule force spectroscopy in vitro, and developed an artificial bistable molecular host-guest system that can be controlled and regulated by external signals (UV light exposure and thermal energy). The intermolecular binding functionality (affinity) and its reproducible and reversible switching has been proven by AFM force spectroscopy at the single-molecule level. This affinity-tunable optomechanical switch will allow novel applications with respect to molecular manipulation, nanoscale rewritable molecular memories, and/or artificial ion channels, which will serve for the controlled transport and release of ions and neutral compounds in the future.
Detection of gas molecules on single Mn adatom adsorbed graphyne: a DFT-D study
Lu, Zhansheng; Lv, Peng; Ma, Dongwei; Yang, Xinwei; Li, Shuo; Yang, Zongxian
2018-02-01
As one of the prominent applications in intelligent systems, gas sensing technology has attracted great interest in both industry and academia. In the current study, the pristine graphyne (GY) without and with a single Mn atom is investigated to detect the gas molecules (CO, CH4, CO2, NH3, NO and O2). The pristine GY is promising to detect O2 molecules because of its chemical adsorption on GY with large electron transfer. The great stability of the Mn/GY is found, and the Mn atom prefers to anchor at the alkyne ring as a single atom. Upon single Mn atom anchoring, the sensitivity and selectivity of GY based gas sensors is significantly improved for various molecules, except CH4. The recovery time of the Mn/GY after detecting the gas molecules may help to appraise the detection efficiency for the Mn/GY. The current study will help to understand the mechanism of detecting the gas molecules, and extend the potentially fascinating applications of GY-based materials.
Single molecule microscopy and spectroscopy: concluding remarks.
van Hulst, Niek F
2015-01-01
Chemistry is all about molecules: control, synthesis, interaction and reaction of molecules. All too easily on a blackboard, one draws molecules, their structures and dynamics, to create an insightful picture. The dream is to see these molecules in reality. This is exactly what "Single Molecule Detection" provides: a look at molecules in action at ambient conditions; a breakthrough technology in chemistry, physics and biology. Within the realms of the Royal Society of Chemistry, the Faraday Discussion on "Single Molecule Microscopy and Spectroscopy" was a very appropriate topic for presentation, deliberation and debate. Undoubtedly, the Faraday Discussions have a splendid reputation in stimulating scientific debates along the traditions set by Michael Faraday. Interestingly, back in the 1830's, Faraday himself pursued an experiment that led to the idea that atoms in a compound were joined by an electrical component. He placed two opposite electrodes in a solution of water containing a dissolved compound, and observed that one of the elements of the compound accumulated on one electrode, while the other was deposited on the opposite electrode. Although Faraday was deeply opposed to atomism, he had to recognize that electrical forces were responsible for the joining of atoms. Probably a direct view on the atoms or molecules in his experiment would have convinced him. As such, Michael Faraday might have liked the gathering at Burlington House in September 2015 (). Surely, with the questioning eyes of his bust on the 1st floor corridor, the non-believer Michael Faraday has incited each passer-by to enter into discussion and search for deeper answers at the level of single molecules. In these concluding remarks, highlights of the presented papers and discussions are summarized, complemented by a conclusion on future perspectives.
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
International Nuclear Information System (INIS)
Pham, Quang Trung
2014-01-01
molecule in Geant4 by reading PDB (Protein Data Bank) files representing twelve base pairs of the DNA molecule and a di-nucleosome (347 base pairs). Finally, we developed a tool to correlate the positions of direct energy deposit in liquid water with the coordinates of the base pairs of DNA to calculate the number of single and double strand breaks in DNA. All calculations in this work were performed on the European Grid Infrastructure; performance tests are available to estimate the utility of this type of architecture for Monte Carlo calculations. (author) [fr
Lee, Young Kwang; Low-Nam, Shalini T; Chung, Jean K; Hansen, Scott D; Lam, Hiu Yue Monatrice; Alvarez, Steven; Groves, Jay T
2017-04-28
The guanine nucleotide exchange factor (GEF) Son of Sevenless (SOS) plays a critical role in signal transduction by activating Ras. Here we introduce a single-molecule assay in which individual SOS molecules are captured from raw cell lysate using Ras-functionalized supported membrane microarrays. This enables characterization of the full-length SOS protein, which has not previously been studied in reconstitution due to difficulties in purification. Our measurements on the full-length protein reveal a distinct role of the C-terminal proline-rich (PR) domain to obstruct the engagement of allosteric Ras independently of the well-known N-terminal domain autoinhibition. This inhibitory role of the PR domain limits Grb2-independent recruitment of SOS to the membrane through binding of Ras·GTP in the SOS allosteric binding site. More generally, this assay strategy enables characterization of the functional behaviour of GEFs with single-molecule precision but without the need for purification.
International Nuclear Information System (INIS)
Sharma, Ajeet K; Chowdhury, Debashish
2013-01-01
A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)
Lucius, Aaron L; Maluf, Nasib K; Fischer, Christopher J; Lohman, Timothy M
2003-10-01
Helicase-catalyzed DNA unwinding is often studied using "all or none" assays that detect only the final product of fully unwound DNA. Even using these assays, quantitative analysis of DNA unwinding time courses for DNA duplexes of different lengths, L, using "n-step" sequential mechanisms, can reveal information about the number of intermediates in the unwinding reaction and the "kinetic step size", m, defined as the average number of basepairs unwound between two successive rate limiting steps in the unwinding cycle. Simultaneous nonlinear least-squares analysis using "n-step" sequential mechanisms has previously been limited by an inability to float the number of "unwinding steps", n, and m, in the fitting algorithm. Here we discuss the behavior of single turnover DNA unwinding time courses and describe novel methods for nonlinear least-squares analysis that overcome these problems. Analytic expressions for the time courses, f(ss)(t), when obtainable, can be written using gamma and incomplete gamma functions. When analytic expressions are not obtainable, the numerical solution of the inverse Laplace transform can be used to obtain f(ss)(t). Both methods allow n and m to be continuous fitting parameters. These approaches are generally applicable to enzymes that translocate along a lattice or require repetition of a series of steps before product formation.
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Semisynthetic protein nanoreactor for single-molecule chemistry
Lee, Joongoo; Bayley, Hagan
2015-01-01
The modulation of ionic current flowing through an individual protein pore provides information at the single-molecule level about chemical reactions occurring within the pore. However, chemistry investigated in this way has been largely confined to the reactions of thiolates, presented by the side chains of cysteine residues. The introduction of unnatural amino acids would provide a large variety of reactive side chains with which additional single-molecule chemistry could be investigated. H...
Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.
Jobert, Laure; Nilsen, Hilde
2014-07-01
The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
Energy Technology Data Exchange (ETDEWEB)
Yu, L.D., E-mail: yuld@thep-center.org [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Prakrajang, K. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Faculty of Science, Maejo University, Chiang Mai 50290 (Thailand); Phanchaisri, B. [Institute of Science and Technology Research, Chiang Mai University, Chiang Mai 50200 (Thailand); Thongkumkoon, P. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thopan, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Singkarat, S. [Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)
2014-05-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.
Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells
International Nuclear Information System (INIS)
Yu, L.D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.
2014-01-01
Highlights: • Ion bombardment could induce DNA transfer into E. coli cells. • The DNA transfer induction depended on ion energy and fluence. • The mechanism was associated with the bacterial cell envelope structure. • A mechanism phase diagram was proposed to summarize the mechanism. - Abstract: As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10–20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence
Isshiki, Yuji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2018-03-14
Structural and electronic detail at the metal-molecule interface has a significant impact on the charge transport across the molecular junctions, but its precise understanding and control still remain elusive. On the single-molecule scale, the metal-molecule interface structures and relevant charge transport properties are subject to fluctuation, which contain the fundamental science of single-molecule transport and implication for manipulability of the transport properties in electronic devices. Here, we present a comprehensive approach to investigate the fluctuation in the metal-molecule interface in single-molecule junctions, based on current-voltage ( I- V) measurements in combination with first-principles simulation. Contrary to conventional molecular conductance studies, this I- V approach provides a correlated statistical description of both the degree of electronic coupling across the metal-molecule interface and the molecular orbital energy level. This statistical approach was employed to study fluctuation in single-molecule junctions of 1,4-butanediamine (DAB), pyrazine (PY), 4,4'-bipyridine (BPY), and fullerene (C 60 ). We demonstrate that molecular-dependent fluctuation of σ-, π-, and π-plane-type interfaces can be captured by analyzing the molecular orbital (MO) energy level under mechanical perturbation. While the MO level of DAB with the σ-type interface shows weak distance dependence and fluctuation, the MO level of PY, BPY, and C 60 features unique distance dependence and molecular-dependent fluctuation against the mechanical perturbation. The MO level of PY and BPY with the σ+π-type interface increases with the increase in the stretch distance. In contrast, the MO level of C 60 with the π-plane-type interface decreases with the increase in the stretching perturbation. This study provides an approach to resolve the structural and electronic fluctuation in the single-molecule junctions and insight into the molecular-dependent fluctuation in
The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks
Directory of Open Access Journals (Sweden)
Alessia Balestrini
2013-06-01
Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.
Single Molecules as Optical Probes for Structure and Dynamics
Orrit, Michel
Single molecules and single nanoparticles are convenient links between the nanoscale world and the laboratory. We discuss the limits for their optical detection by three different methods: fluorescence, direct absorption, and photothermal detection. We briefly review some recent illustrations of qualitatively new information gathered from single-molecule signals: intermittency of the fluorescence intensity, acoustic vibrations of nanoparticles (1-100 GHz) or of extended defects in molecular crystals (0.1-1 MHz), and dynamical heterogeneity in glass-forming molecular liquids. We conclude with an outlook of future uses of single-molecule methods in physical chemistry, soft matter, and material science.
Magnetization reversal in single molecule magnets
Bokacheva, Louisa
2002-09-01
I have studied the magnetization reversal in single molecule magnets (SMMs). SMMs are Van der Waals crystals, consisting of identical molecules containing transition metal ions, with high spin and large uniaxial magnetic anisotropy. They can be considered as ensembles of identical, iso-oriented nanomagnets. At high temperature, these materials behave as superparamagnets and their magnetization reversal occurs by thermal activation. At low temperature they become blocked, and their magnetic relaxation occurs via thermally assisted tunneling or pure quantum tunneling through the anisotropy barrier. We have conducted detailed experimental studies of the magnetization reversal in SMM material Mn12-acetate (Mn12) with S = 10. Low temperature measurements were conducted using micro-Hall effect magnetometry. We performed hysteresis and relaxation studies as a function of temperature, transverse field, and magnetization state of the sample. We identified magnetic sublevels that dominate the tunneling at a given field, temperature and magnetization. We observed a crossover between thermally assisted and pure quantum tunneling. The form of this crossover depends on the magnitude and direction of the applied field. This crossover is abrupt (first-order) and occurs in a narrow temperature interval (tunneling mechanisms in Mn12.
Quantum design rules for single molecule logic gates.
Renaud, N; Hliwa, M; Joachim, C
2011-08-28
Recent publications have demonstrated how to implement a NOR logic gate with a single molecule using its interaction with two surface atoms as logical inputs [W. Soe et al., ACS Nano, 2011, 5, 1436]. We demonstrate here how this NOR logic gate belongs to the general family of quantum logic gates where the Boolean truth table results from a full control of the quantum trajectory of the electron transfer process through the molecule by very local and classical inputs practiced on the molecule. A new molecule OR gate is proposed for the logical inputs to be also single metal atoms, one per logical input.
Frisenda, Riccardo; Perrin, Mickael L; van der Zant, Herre S J
2015-01-01
We study single-molecule oligo(phenylene ethynylene)dithiol junctions by means of inelastic electron tunneling spectroscopy (IETS). The molecule is contacted with gold nano-electrodes formed with the mechanically controllable break junction technique. We record the IETS spectrum of the molecule from direct current measurements, both as a function of time and electrode separation. We find that for fixed electrode separation the molecule switches between various configurations, which are characterized by different IETS spectra. Similar variations in the IETS signal are observed during atomic rearrangements upon stretching of the molecular junction. Using quantum chemistry calculations, we identity some of the vibrational modes which constitute a chemical fingerprint of the molecule. In addition, changes can be attributed to rearrangements of the local molecular environment, in particular at the molecule-electrode interface. This study shows the importance of taking into account the interaction with the electrodes when describing inelastic contributions to transport through single-molecule junctions.
Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
International Nuclear Information System (INIS)
Saito, Toshiro; Takahashi, Satoshi; Obara, Takayuki; Itabashi, Naoshi; Imai, Kazumichi
2011-01-01
We fabricated platinum bowtie nanostructure arrays producing fluorescence enhancement and evaluated their performance using two-photon photoluminescence and single-molecule fluorescence measurements. A comprehensive selection of suitable materials was explored by electromagnetic simulation and Pt was chosen as the plasmonic material for visible light excitation near 500 nm, which is preferable for multicolor dye-labeling applications like DNA sequencing. The observation of bright photoluminescence (λ = 500-600 nm) from each Pt nanostructure, induced by irradiation at 800 nm with a femtosecond laser pulse, clearly indicates that a highly enhanced local field is created near the Pt nanostructure. The attachment of a single dye molecule was attempted between the Pt triangles of each nanostructure by using selective immobilization chemistry. The fluorescence intensities of the single dye molecule localized on the nanostructures were measured. A highly enhanced fluorescence, which was increased by a factor of 30, was observed. The two-photon photoluminescence intensity and fluorescence intensity showed qualitatively consistent gap size dependence. However, the average fluorescence enhancement factor was rather repressed even in the nanostructure with the smallest gap size compared to the large growth of photoluminescence. The variation of the position of the dye molecule attached to the nanostructure may influence the wide distribution of the fluorescence enhancement factor and cause the rather small average value of the fluorescence enhancement factor.
Ordered array of CoPc-vacancies filled with single-molecule rotors
Xie, Zheng-Bo; Wang, Ya-Li; Tao, Min-Long; Sun, Kai; Tu, Yu-Bing; Yuan, Hong-Kuan; Wang, Jun-Zhong
2018-05-01
We report the highly ordered array of CoPc-vacancies and the single-molecule rotors inside the vacancies. When CoPc molecules are deposited on Cd(0001) at low-temperature, three types of molecular vacancies appeared randomly in the CoPc monolayer. Annealing the sample to higher temperature leads to the spontaneous phase separation and self-organized arrangement of the vacancies. Highly ordered arrays of two-molecule vacancies and single-molecule vacancies have been obtained. In particular, there is a rotating CoPc molecule inside each single-molecule vacancy, which constitutes the array of single-molecule rotors. These results provide a new routine to fabricate the nano-machines on a large scale.
Single-Molecule Detection in Nanogap-Embedded Plasmonic Gratings
Directory of Open Access Journals (Sweden)
Biyan Chen
2015-07-01
Full Text Available We introduce nanogap-embedded silver plasmonic gratings for single-molecule (SM visualization using an epifluorescence microscope. This silver plasmonic platform was fabricated by a cost-effective nano-imprint lithography technique, using an HD DVD template. DNA/ RNA duplex molecules tagged with Cy3/Cy5 fluorophores were immobilized on SiO 2 -capped silver gratings. Light was coupled to the gratings at particular wavelengths and incident angles to form surface plasmons. The SM fluorescence intensity of the fluorophores at the nanogaps showed approximately a 100-fold mean enhancement with respect to the fluorophores observed on quartz slides using an epifluorescence microscope. This high level of enhancement was due to the concentration of surface plasmons at the nanogaps. When nanogaps imaged with epifluorescence mode were compared to quartz imaged using total internal reflection fluorescence (TIRF microscopy, more than a 30-fold mean enhancement was obtained. Due to the SM fluorescence enhancement of plasmonic gratings and the correspondingly high emission intensity, the required laser power can be reduced, resulting in a prolonged detection time prior to photobleaching. This simple platform was able to perform SM studies with a low-cost epifluorescence apparatus, instead of the more expensive TIRF or confocal microscopes, which would enable SM analysis to take place in most scientific laboratories.
Revealing time bunching effect in single-molecule enzyme conformational dynamics.
Lu, H Peter
2011-04-21
In this perspective, we focus our discussion on how the single-molecule spectroscopy and statistical analysis are able to reveal enzyme hidden properties, taking the study of T4 lysozyme as an example. Protein conformational fluctuations and dynamics play a crucial role in biomolecular functions, such as in enzymatic reactions. Single-molecule spectroscopy is a powerful approach to analyze protein conformational dynamics under physiological conditions, providing dynamic perspectives on a molecular-level understanding of protein structure-function mechanisms. Using single-molecule fluorescence spectroscopy, we have probed T4 lysozyme conformational motions under the hydrolysis reaction of a polysaccharide of E. coli B cell walls by monitoring the fluorescence resonant energy transfer (FRET) between a donor-acceptor probe pair tethered to T4 lysozyme domains involving open-close hinge-bending motions. Based on the single-molecule spectroscopic results, molecular dynamics simulation, a random walk model analysis, and a novel 2D statistical correlation analysis, we have revealed a time bunching effect in protein conformational motion dynamics that is critical to enzymatic functions. Bunching effect implies that conformational motion times tend to bunch in a finite and narrow time window. We show that convoluted multiple Poisson rate processes give rise to the bunching effect in the enzymatic reaction dynamics. Evidently, the bunching effect is likely common in protein conformational dynamics involving in conformation-gated protein functions. In this perspective, we will also discuss a new approach of 2D regional correlation analysis capable of analyzing fluctuation dynamics of complex multiple correlated and anti-correlated fluctuations under a non-correlated noise background. Using this new method, we are able to map out any defined segments along the fluctuation trajectories and determine whether they are correlated, anti-correlated, or non-correlated; after which, a
Electrochemical proton relay at the single-molecule level
DEFF Research Database (Denmark)
Kuznetsov, A. M.; Medvedev, I. G.; Ulstrup, Jens
2009-01-01
A scheme for the experimental study of single-proton transfer events, based on proton-coupled two-electron transfer between a proton donor and a proton acceptor molecule confined in the tunneling gap between two metal leads in electrolyte solution is suggested. Expressions for the electric current...... are derived and compared with formalism for electron tunneling through redox molecules. The scheme allows studying the kinetics of proton and hydrogen atom transfer as well as kinetic isotope effects at the single-molecule level under electrochemical potential control....
Coherent interaction of single molecules and plasmonic nanowires
Gerhardt, Ilja; Grotz, Bernhard; Siyushev, Petr; Wrachtrup, Jörg
2017-09-01
Quantum plasmonics opens the option to integrate complex quantum optical circuitry onto chip scale devices. In the past, often external light sources were used and nonclassical light was coupled in and out of plasmonic structures, such as hole arrays or waveguide structures. Another option to launch single plasmonic excitations is the coupling of single emitters in the direct proximity of, e.g., a silver or gold nanostructure. Here, we present our attempts to integrate the research of single emitters with wet-chemically grown silver nanowires. The emitters of choice are single organic dye molecules under cryogenic conditions, which are known to act as high-brightness and extremely narrow-band single photon sources. Another advantage is their high optical nonlinearity, such that they might mediate photon-photon interactions on the nanoscale. We report on the coupling of a single molecule fluorescence emission through the wire over the length of several wavelengths. The transmission of coherently emitted photons is proven by an extinction type experiment. As for influencing the spectral properties of a single emitter, we are able to show a remote change of the line-width of a single terrylene molecule, which is in close proximity to the nanowire.
Concentrating and labeling genomic DNA in a nanofluidic array
DEFF Research Database (Denmark)
Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.
2018-01-01
, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...
Molecular dynamics simulation of a DNA containing a single strand break
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, H.; Siebers, G.; Furukawa, A.; Otagiri, N.; Osman, R
2002-07-01
Molecular dynamics simulations were performed for a dodecamer DNA containing a single strand break (SSB), which has been represented by a 3'-OH deoxyribose and 5'-OH phosphate in the middle of the strand. Molecular force field parameters of the 5'-OH phosphate region were determined from an ab initio calculation at the HF/6-31G level using the program package GAMESS. The DNA was placed in a periodic boundary box with water molecules and Na+ counter-ions to produce a neutralised system. After minimisation, the system was heated to 300 K, equilibrated and a production run at constant NTP was executed for 1 ns using AMBER 4.1. Snapshots of the SSB-containing DNA and a detailed analysis of the equilibriated average structure revealed surprisingly small conformational changes compared to normal DNA. However, dynamic properties calculated using the essential dynamics method showed some features that may be important for the recognition of this damage by repair enzymes. (author)
Pi, Jiang; Jin, Hua; Yang, Fen; Chen, Zheng W.; Cai, Jiye
2014-10-01
The cell membrane, which consists of a viscous phospholipid bilayer, different kinds of proteins and various nano/micrometer-sized domains, plays a very important role in ensuring the stability of the intracellular environment and the order of cellular signal transductions. Exploring the precise cell membrane structure and detailed functions of the biomolecules in a cell membrane would be helpful to understand the underlying mechanisms involved in cell membrane signal transductions, which could further benefit research into cell biology, immunology and medicine. The detection of membrane biomolecules at the single molecule level can provide some subtle information about the molecular structure and the functions of the cell membrane. In particular, information obtained about the molecular mechanisms and other information at the single molecule level are significantly different from that detected from a large amount of biomolecules at the large-scale through traditional techniques, and can thus provide a novel perspective for the study of cell membrane structures and functions. However, the precise investigations of membrane biomolecules prompts researchers to explore cell membranes at the single molecule level by the use of in situ imaging methods, as the exact conformation and functions of biomolecules are highly controlled by the native cellular environment. Recently, the in situ single molecule imaging of cell membranes has attracted increasing attention from cell biologists and immunologists. The size of biomolecules and their clusters on the cell surface are set at the nanoscale, which makes it mandatory to use high- and super-resolution imaging techniques to realize the in situ single molecule imaging of cell membranes. In the past few decades, some amazing imaging techniques and instruments with super resolution have been widely developed for molecule imaging, which can also be further employed for the in situ single molecule imaging of cell membranes. In
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
International Nuclear Information System (INIS)
Ishii, Takaaki; Murayama, Yoshihiro; Katano, Atsuto; Maki, Kosuke; Kuwajima, Kunihiro; Sano, Masaki
2008-01-01
Single-molecule manipulation techniques have given experimental access to unfolding intermediates of proteins that are inaccessible in conventional experiments. A detailed characterization of the intermediates is a challenging problem that provides new possibilities for directly probing the energy landscape of proteins. We investigated single-molecule mechanical unfolding of a small globular protein, staphylococcal nuclease (SNase), using atomic force microscopy. The unfolding trajectories of the protein displayed sub-molecular and stochastic behavior with typical lengths corresponding to the size of the unfolded substructures. Our results support the view that the single protein unfolds along multiple pathways as suggested in recent theoretical studies. Moreover, we found the drastic change, caused by the ligand and inhibitor bindings, in the mechanical unfolding dynamics
Elastin-like Polypeptide Linkers for Single-Molecule Force Spectroscopy.
Ott, Wolfgang; Jobst, Markus A; Bauer, Magnus S; Durner, Ellis; Milles, Lukas F; Nash, Michael A; Gaub, Hermann E
2017-06-27
Single-molecule force spectroscopy (SMFS) is by now well established as a standard technique in biophysics and mechanobiology. In recent years, the technique has benefitted greatly from new approaches to bioconjugation of proteins to surfaces. Indeed, optimized immobilization strategies for biomolecules and refined purification schemes are being steadily adapted and improved, which in turn has enhanced data quality. In many previously reported SMFS studies, poly(ethylene glycol) (PEG) was used to anchor molecules of interest to surfaces and/or cantilever tips. The limitation, however, is that PEG exhibits a well-known trans-trans-gauche to all-trans transition, which results in marked deviation from standard polymer elasticity models such as the worm-like chain, particularly at elevated forces. As a result, the assignment of unfolding events to protein domains based on their corresponding amino acid chain lengths is significantly obscured. Here, we provide a solution to this problem by implementing unstructured elastin-like polypeptides as linkers to replace PEG. We investigate the suitability of tailored elastin-like polypeptides linkers and perform direct comparisons to PEG, focusing on attributes that are critical for single-molecule force experiments such as linker length, monodispersity, and bioorthogonal conjugation tags. Our results demonstrate that by avoiding the ambiguous elastic response of mixed PEG/peptide systems and instead building the molecular mechanical systems with only a single bond type with uniform elastic properties, we improve data quality and facilitate data analysis and interpretation in force spectroscopy experiments. The use of all-peptide linkers allows alternative approaches for precisely defining elastic properties of proteins linked to surfaces.
The spontaneous formation of single-molecule junctions via terminal alkynes
International Nuclear Information System (INIS)
Pla-Vilanova, Pepita; Aragonès, Albert C; Sanz, Fausto; Darwish, Nadim; Diez-Perez, Ismael; Ciampi, Simone
2015-01-01
Herein, we report the spontaneous formation of single-molecule junctions via terminal alkyne contact groups. Self-assembled monolayers that form spontaneously from diluted solutions of 1, 4-diethynylbenzene (DEB) were used to build single-molecule contacts and assessed using the scanning tunneling microscopy-break junction technique (STM-BJ). The STM-BJ technique in both its dynamic and static approaches was used to characterize the lifetime (stability) and the conductivity of a single-DEB wire. It is demonstrated that single-molecule junctions form spontaneously with terminal alkynes and require no electrochemical control or chemical deprotonation. The alkyne anchoring group was compared against typical contact groups exploited in single-molecule studies, i.e. amine (benzenediamine) and thiol (benzendithiol) contact groups. The alkyne contact showed a conductance magnitude comparable to that observed with amine and thiol groups. The lifetime of the junctions formed from alkynes were only slightly less than that of thiols and greater than that observed for amines. These findings are important as (a) they extend the repertoire of chemical contacts used in single-molecule measurements to 1-alkynes, which are synthetically accessible and stable and (b) alkynes have a remarkable affinity toward silicon surfaces, hence opening the door for the study of single-molecule transport on a semiconducting electronic platform. (fast track communication)
Simple Laboratory methods to measure cell proliferation using DNA synthesis property
Directory of Open Access Journals (Sweden)
Madhavan H N
2007-01-01
Full Text Available This is a mini-review on the techniques to measure proliferation of cells by estimation of DNA synthesis. This is not an exhaustive review of literature, but a bird’s eye view of a few selected articles which may provide the technical details to the readers.The nucleus of a cell occupies about 10-30% of the cells space, depends on the type of genetic material (DNA -DeoxyriboNucleic Acid. DNA is a long, double-stranded, helical molecule which carries the genetic information. Duplication of the DNA takes place by the phenomena of replication. One copy of double-stranded DNA molecule forms two double-stranded DNA molecules. DNA replication is the fundamental process used in all living organisms as it is the basis for biological inheritance. This process is known also as Mitosis in somatic cells. In Mitosis, the duplication process results in two genetically identical "daughter" cells from a single "parent" cell. The resulting double-stranded DNA molecules are identical; proof reading and error-checking mechanisms exist to ensure near perfect pair. Mitosis is divided into six phases: prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.
Rotation of a single molecule within a supramolecular bearing
DEFF Research Database (Denmark)
Gimzewski, J.K.; Joachim, C.; Schlittler, R.R.
1998-01-01
Experimental visualization and verification of a single-molecule rotor operating within a supramolecular bearing is reported. Using a scanning tunneling microscope, single molecules were observed to exist in one of two spatially defined states Laterally separated by 0.26 nanometers. One...
Molecular electronics with single molecules in solid-state devices.
Moth-Poulsen, Kasper; Bjørnholm, Thomas
2009-09-01
The ultimate aim of molecular electronics is to understand and master single-molecule devices. Based on the latest results on electron transport in single molecules in solid-state devices, we focus here on new insights into the influence of metal electrodes on the energy spectrum of the molecule, and on how the electron transport properties of the molecule depend on the strength of the electronic coupling between it and the electrodes. A variety of phenomena are observed depending on whether this coupling is weak, intermediate or strong.
Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli
International Nuclear Information System (INIS)
Petrov, S.I.
1981-01-01
Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA
Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey
2014-10-17
Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Chou, Y. C.
2018-04-01
The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Single-molecule optical genome mapping of a human HapMap and a colorectal cancer cell line.
Teo, Audrey S M; Verzotto, Davide; Yao, Fei; Nagarajan, Niranjan; Hillmer, Axel M
2015-01-01
Next-generation sequencing (NGS) technologies have changed our understanding of the variability of the human genome. However, the identification of genome structural variations based on NGS approaches with read lengths of 35-300 bases remains a challenge. Single-molecule optical mapping technologies allow the analysis of DNA molecules of up to 2 Mb and as such are suitable for the identification of large-scale genome structural variations, and for de novo genome assemblies when combined with short-read NGS data. Here we present optical mapping data for two human genomes: the HapMap cell line GM12878 and the colorectal cancer cell line HCT116. High molecular weight DNA was obtained by embedding GM12878 and HCT116 cells, respectively, in agarose plugs, followed by DNA extraction under mild conditions. Genomic DNA was digested with KpnI and 310,000 and 296,000 DNA molecules (≥ 150 kb and 10 restriction fragments), respectively, were analyzed per cell line using the Argus optical mapping system. Maps were aligned to the human reference by OPTIMA, a new glocal alignment method. Genome coverage of 6.8× and 5.7× was obtained, respectively; 2.9× and 1.7× more than the coverage obtained with previously available software. Optical mapping allows the resolution of large-scale structural variations of the genome, and the scaffold extension of NGS-based de novo assemblies. OPTIMA is an efficient new alignment method; our optical mapping data provide a resource for genome structure analyses of the human HapMap reference cell line GM12878, and the colorectal cancer cell line HCT116.
A plasmonic biosensor with single-molecule sensitivity
Zijlstra, P.; Paulo, P.M.R.; Yuan, H.; Khatua, S.; Yorulmaz, M.; Orrit, M.
2013-01-01
The plasmon resonance of a single metal nanoparticle induces an enhancement of the local electromagnetic field. We exploit this field enhancement to detect single molecules that are (1) poorly fluorescent or (2) completely non-fluorescent.
Inhibition mechanisms of hemoglobin, immunoglobulin G, and whole blood in digital and real-time PCR.
Sidstedt, Maja; Hedman, Johannes; Romsos, Erica L; Waitara, Leticia; Wadsö, Lars; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter
2018-04-01
Blood samples are widely used for PCR-based DNA analysis in fields such as diagnosis of infectious diseases, cancer diagnostics, and forensic genetics. In this study, the mechanisms behind blood-induced PCR inhibition were evaluated by use of whole blood as well as known PCR-inhibitory molecules in both digital PCR and real-time PCR. Also, electrophoretic mobility shift assay was applied to investigate interactions between inhibitory proteins and DNA, and isothermal titration calorimetry was used to directly measure effects on DNA polymerase activity. Whole blood caused a decrease in the number of positive digital PCR reactions, lowered amplification efficiency, and caused severe quenching of the fluorescence of the passive reference dye 6-carboxy-X-rhodamine as well as the double-stranded DNA binding dye EvaGreen. Immunoglobulin G was found to bind to single-stranded genomic DNA, leading to increased quantification cycle values. Hemoglobin affected the DNA polymerase activity and thus lowered the amplification efficiency. Hemoglobin and hematin were shown to be the molecules in blood responsible for the fluorescence quenching. In conclusion, hemoglobin and immunoglobulin G are the two major PCR inhibitors in blood, where the first affects amplification through a direct effect on the DNA polymerase activity and quenches the fluorescence of free dye molecules, and the latter binds to single-stranded genomic DNA, hindering DNA polymerization in the first few PCR cycles. Graphical abstract PCR inhibition mechanisms of hemoglobin and immunoglobulin G (IgG). Cq quantification cycle, dsDNA double-stranded DNA, ssDNA single-stranded DNA.
The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks.
Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J
2013-06-27
Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Jobst, Markus A; Milles, Lukas F; Schoeler, Constantin; Ott, Wolfgang; Fried, Daniel B; Bayer, Edward A; Gaub, Hermann E; Nash, Michael A
2015-10-31
Receptor-ligand pairs are ordinarily thought to interact through a lock and key mechanism, where a unique molecular conformation is formed upon binding. Contrary to this paradigm, cellulosomal cohesin-dockerin (Coh-Doc) pairs are believed to interact through redundant dual binding modes consisting of two distinct conformations. Here, we combined site-directed mutagenesis and single-molecule force spectroscopy (SMFS) to study the unbinding of Coh:Doc complexes under force. We designed Doc mutations to knock out each binding mode, and compared their single-molecule unfolding patterns as they were dissociated from Coh using an atomic force microscope (AFM) cantilever. Although average bulk measurements were unable to resolve the differences in Doc binding modes due to the similarity of the interactions, with a single-molecule method we were able to discriminate the two modes based on distinct differences in their mechanical properties. We conclude that under native conditions wild-type Doc from Clostridium thermocellum exocellulase Cel48S populates both binding modes with similar probabilities. Given the vast number of Doc domains with predicted dual binding modes across multiple bacterial species, our approach opens up new possibilities for understanding assembly and catalytic properties of a broad range of multi-enzyme complexes.
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on
2013-01-01
SUMMARY Homologous recombination is a universal process, conserved from bacteriophage to human, which is important for the repair of double-strand DNA breaks. Recombination in mitochondrial DNA (mtDNA) was documented more than 4 decades ago, but the underlying molecular mechanism has remained elusive. Recent studies have revealed the presence of a Rad52-type recombination system of bacteriophage origin in mitochondria, which operates by a single-strand annealing mechanism independent of the canonical RecA/Rad51-type recombinases. Increasing evidence supports the notion that, like in bacteriophages, mtDNA inheritance is a coordinated interplay between recombination, repair, and replication. These findings could have profound implications for understanding the mechanism of mtDNA inheritance and the generation of mtDNA deletions in aging cells. PMID:24006472
Stereoelectronic Effect-Induced Conductance Switching in Aromatic Chain Single-Molecule Junctions.
Xin, Na; Wang, Jinying; Jia, Chuancheng; Liu, Zitong; Zhang, Xisha; Yu, Chenmin; Li, Mingliang; Wang, Shuopei; Gong, Yao; Sun, Hantao; Zhang, Guanxin; Liu, Zhirong; Zhang, Guangyu; Liao, Jianhui; Zhang, Deqing; Guo, Xuefeng
2017-02-08
Biphenyl, as the elementary unit of organic functional materials, has been widely used in electronic and optoelectronic devices. However, over decades little has been fundamentally understood regarding how the intramolecular conformation of biphenyl dynamically affects its transport properties at the single-molecule level. Here, we establish the stereoelectronic effect of biphenyl on its electrical conductance based on the platform of graphene-molecule single-molecule junctions, where a specifically designed hexaphenyl aromatic chain molecule is covalently sandwiched between nanogapped graphene point contacts to create stable single-molecule junctions. Both theoretical and temperature-dependent experimental results consistently demonstrate that phenyl twisting in the aromatic chain molecule produces different microstates with different degrees of conjugation, thus leading to stochastic switching between high- and low-conductance states. These investigations offer new molecular design insights into building functional single-molecule electrical devices.
Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach
Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.
2018-06-01
DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.
Highly multiplexed targeted DNA sequencing from single nuclei.
Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E
2016-02-01
Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.
Single particle tracking and single molecule energy transfer
Bräuchle, Christoph; Michaelis, Jens
2009-01-01
Closing a gap in the literature, this handbook gathers all the information on single particle tracking and single molecule energy transfer. It covers all aspects of this hot and modern topic, from detecting virus entry to membrane diffusion, and from protein folding using spFRET to coupled dye systems, as well recent achievements in the field. Throughout, the first-class editors and top international authors present content of the highest quality, making this a must-have for physical chemists, spectroscopists, molecular physicists and biochemists.
Electrons, Photons, and Force: Quantitative Single-Molecule Measurements from Physics to Biology
2011-01-01
Single-molecule measurement techniques have illuminated unprecedented details of chemical behavior, including observations of the motion of a single molecule on a surface, and even the vibration of a single bond within a molecule. Such measurements are critical to our understanding of entities ranging from single atoms to the most complex protein assemblies. We provide an overview of the strikingly diverse classes of measurements that can be used to quantify single-molecule properties, including those of single macromolecules and single molecular assemblies, and discuss the quantitative insights they provide. Examples are drawn from across the single-molecule literature, ranging from ultrahigh vacuum scanning tunneling microscopy studies of adsorbate diffusion on surfaces to fluorescence studies of protein conformational changes in solution. PMID:21338175
International Nuclear Information System (INIS)
2006-01-01
This conference was organized around 9 sessions: -) single molecule, -) quantum optics, -) hole-burning materials and mechanisms, -) single nano-particle spectroscopy, -) dephasing and spectral diffusion, -) microwave photonics, -) biological systems, -) rare earth doped materials, -) novel laser sources. This document gathers only the slides of the presentations
Energy Technology Data Exchange (ETDEWEB)
NONE
2006-07-01
This conference was organized around 9 sessions: -) single molecule, -) quantum optics, -) hole-burning materials and mechanisms, -) single nano-particle spectroscopy, -) dephasing and spectral diffusion, -) microwave photonics, -) biological systems, -) rare earth doped materials, -) novel laser sources. This document gathers only the slides of the presentations.
Migliori, Amy; Arya, Gaurav; Smith, Douglas E.
2012-10-01
Bacteriophage T4 is a double stranded DNA virus that infects E.coli by injecting the viral genome through the cellular wall of a host cell. The T4 genome must be ejected from the viral capsid with sufficient force to ensure infection. To generate high ejection forces, the genome is packaged to high density within the viral capsid. A DNA translocation motor, in which the protein gp17 hydrolyzes ATP and binds to the DNA, is responsible for translocating the genome into the capsid during viral maturation of T4. This motor generates forces in excess of 60 pN and packages DNA at rates exceeding 2000 base pairs/second (bp/s)1. Understanding these small yet powerful motors is important, as they have many potential applications. Though much is known about the activity of these motors from bulk and single molecule biophysical techniques, little is known about their detailed molecular mechanism. Recently, two structures of gp17 have been obtained: a high-resolution X-ray crystallographic structure showing a monomeric compacted form of the enzyme, and a cryo-electron microscopic structure of the extended form of gp17 in complex with actively packaging prohead complexes. Comparison of these two structures indicates several key differences, and a model has been proposed to explain the translocation action of the motor2. Key to this model are a set of residues forming ion pairs across two domains of the gp17 molecule that are proposed to be involved in force generation by causing the collapse of the extended form of gp17. Using a dual optical trap to measure the rates of DNA packaging and the generated forces, we present preliminary mutational data showing that these several of these ion pairs are important to motor function. We have also performed preliminary free energy calculations on the extended and collapsed state of gp17, to confirm that these interdomain ion pairs have large contributions to the change in free energy that occurs upon the collapse of gp17 during the
The structure of DNA by direct imaging
Marini, Monica
2015-08-28
The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.
The structure of DNA by direct imaging
Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.
2015-01-01
The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.
Single molecule transcription factor dynamics in the syncytial Drosophila embryo
Darzacq, Xavier
During early development in the Drosophila embryo, cell fates are determined over the course of just 2 hours with exquisite spatio-temoral precision. One of the key regulators of this process is the transcription factor Bicoid which forms a concentration gradient across the long axis of the embryo. Although Bicoids' primary role is activation at the anterior, where concentrations are highest, it is also known to play a role in the posterior where there are only 100s of molecules per nucleus. Understanding how Bicoid can find its target at such low concentrations has remained intractable, largely due to the inability to perform single molecule imaging in the context of the developing embryo. Here we use lattice light sheet microscopy to overcome the technical barriers of sample thickness and auto-fluorescence to characterize the single molecule dynamics of Bicoid. We find that off-rates do not vary across the embryo and that instead the on-rates are modulated through the formation of clusters that enrich local concentration. This data is contrary to the current concentration dependent model of Bicoid function since local concentration within the nucleus is now a regulated parameter and suggests a previously unknown mechanism for regulation at extremely low concentrations.
The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.
Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro
2017-10-03
Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Mechanical response of collagen molecule under hydrostatic compression
International Nuclear Information System (INIS)
Saini, Karanvir; Kumar, Navin
2015-01-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Mechanical response of collagen molecule under hydrostatic compression.
Saini, Karanvir; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights
Mechanical response of collagen molecule under hydrostatic compression
Energy Technology Data Exchange (ETDEWEB)
Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Electron transfer behaviour of biological macromolecules towards the single-molecule level
DEFF Research Database (Denmark)
Zhang, Jingdong; Grubb, Mikala; Hansen, Allan Glargaard
2003-01-01
is combined with state-of-the-art physical electrochemistry with emphasis on single-crystal, atomically planar electrode surfaces, in situ scanning tunnelling microscopy (STM) and other surface techniques. These approaches have brought bioelectrochemistry important steps forward towards the nanoscale...... and single-molecule levels.We discuss here these advances with reference to two specific redox metalloproteins, the blue single-copper protein Pseudomonas aeruginosa azurin and the single-haem protein Saccharomyces cerevisiae yeast cytochrome c, and a short oligonucleotide. Both proteins can be immobilized...... electron transfer (ET) function retained. In situ STM can also address the microscopic mechanisms for electron tunnelling through the biomolecules and offers novel notions such as coherent multi-ET between the substrate and tip via the molecular redox levels. This differs in important respects from...
Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O
2017-08-01
Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Schonhoft, Joseph D; Stivers, James T
2013-04-16
Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.
Electrochemical single-molecule conductivity of duplex and quadruplex DNA
DEFF Research Database (Denmark)
Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens
2017-01-01
Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...
Dulin, D.; Berghuis, B.A.; Depken, S.M.; Dekker, N.H.
2015-01-01
Single-molecule experiments provide a unique means for real-time observation of the activity of individual biomolecular machines. Through such techniques, insights into the mechanics of for example, polymerases, helicases, and packaging motors have been gleaned. Here we describe the recent advances
Lucius, Aaron L.; Maluf, Nasib K.; Fischer, Christopher J.; Lohman, Timothy M.
2003-01-01
Helicase-catalyzed DNA unwinding is often studied using “all or none” assays that detect only the final product of fully unwound DNA. Even using these assays, quantitative analysis of DNA unwinding time courses for DNA duplexes of different lengths, L, using “n-step” sequential mechanisms, can reveal information about the number of intermediates in the unwinding reaction and the “kinetic step size”, m, defined as the average number of basepairs unwound between two successive rate limiting steps in the unwinding cycle. Simultaneous nonlinear least-squares analysis using “n-step” sequential mechanisms has previously been limited by an inability to float the number of “unwinding steps”, n, and m, in the fitting algorithm. Here we discuss the behavior of single turnover DNA unwinding time courses and describe novel methods for nonlinear least-squares analysis that overcome these problems. Analytic expressions for the time courses, fss(t), when obtainable, can be written using gamma and incomplete gamma functions. When analytic expressions are not obtainable, the numerical solution of the inverse Laplace transform can be used to obtain fss(t). Both methods allow n and m to be continuous fitting parameters. These approaches are generally applicable to enzymes that translocate along a lattice or require repetition of a series of steps before product formation. PMID:14507688
Isolated single-molecule magnets on native gold.
Zobbi, Laura; Mannini, Matteo; Pacchioni, Mirko; Chastanet, Guillaume; Bonacchi, Daniele; Zanardi, Chiara; Biagi, Roberto; Del Pennino, Umberto; Gatteschi, Dante; Cornia, Andrea; Sessoli, Roberta
2005-03-28
The incorporation of thioether groups in the structure of a Mn12 single-molecule magnet, [Mn12(O12)(L)16(H2O)4] with L = 4-(methylthio)benzoate, is a successful route to the deposition of well-separated clusters on native gold surfaces and to the addressing of individual molecules by scanning tunnelling microscopy.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-06-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode. Author contributions: F.E., H.B.W., and M.M. designed research; M.E., R.O., M.K., M.F., F.E., H.B.W., and M.M. performed research; M.E., R.O., M.K., M.F., C.v.H., F.W., F.E., H.B.W., and M.M. contributed new reagents/analytic tools; M.E., R.O., M.K., C.v.H., F.E., H.B.W., and M.M. analyzed data; and F.E., H.B.W., and M.M. wrote the paper.This paper was submitted directly (Track II) to the PNAS office.Abbreviations: A, acceptor; D, donor; MCB, mechanically controlled break junction.Data deposition: The atomic coordinates have been deposited in the Cambridge Structural Database, Cambridge Crystallographic Data Centre, Cambridge CB2 1EZ, United Kingdom (CSD reference no. 241632).
Dynamic translocation of ligand-complexed DNA through solid-state nanopores with optical tweezers
International Nuclear Information System (INIS)
Sischka, Andy; Spiering, Andre; Anselmetti, Dario; Khaksar, Maryam; Laxa, Miriam; Koenig, Janine; Dietz, Karl-Josef
2010-01-01
We investigated the threading and controlled translocation of individual lambda-DNA (λ-DNA) molecules through solid-state nanopores with piconewton force sensitivity, millisecond time resolution and picoampere ionic current sensitivity with a set-up combining quantitative 3D optical tweezers (OT) with electrophysiology. With our virtually interference-free OT set-up the binding of RecA and single peroxiredoxin protein molecules to λ-DNA was quantitatively investigated during dynamic translocation experiments where effective forces and respective ionic currents of the threaded DNA molecule through the nanopore were measured during inward and outward sliding. Membrane voltage-dependent experiments of reversible single protein/DNA translocation scans yield hysteresis-free, asymmetric single-molecule fingerprints in the measured force and conductance signals that can be attributed to the interplay of optical trap and electrostatic nanopore potentials. These experiments allow an exact localization of the bound protein along the DNA strand and open fascinating applications for label-free detection of DNA-binding ligands, where structural and positional binding phenomena can be investigated at a single-molecule level.
Atomic-Scale Control of Electron Transport through Single Molecules
DEFF Research Database (Denmark)
Wang, Y. F.; Kroger, J.; Berndt, R.
2010-01-01
Tin-phthalocyanine molecules adsorbed on Ag(111) were contacted with the tip of a cryogenic scanning tunneling microscope. Orders-of-magnitude variations of the single-molecule junction conductance were achieved by controllably dehydrogenating the molecule and by modifying the atomic structure...
Silicon photon-counting avalanche diodes for single-molecule fluorescence spectroscopy
Michalet, Xavier; Ingargiola, Antonino; Colyer, Ryan A.; Scalia, Giuseppe; Weiss, Shimon; Maccagnani, Piera; Gulinatti, Angelo; Rech, Ivan; Ghioni, Massimo
2014-01-01
Solution-based single-molecule fluorescence spectroscopy is a powerful experimental tool with applications in cell biology, biochemistry and biophysics. The basic feature of this technique is to excite and collect light from a very small volume and work in a low concentration regime resulting in rare burst-like events corresponding to the transit of a single molecule. Detecting photon bursts is a challenging task: the small number of emitted photons in each burst calls for high detector sensitivity. Bursts are very brief, requiring detectors with fast response time and capable of sustaining high count rates. Finally, many bursts need to be accumulated to achieve proper statistical accuracy, resulting in long measurement time unless parallelization strategies are implemented to speed up data acquisition. In this paper we will show that silicon single-photon avalanche diodes (SPADs) best meet the needs of single-molecule detection. We will review the key SPAD parameters and highlight the issues to be addressed in their design, fabrication and operation. After surveying the state-of-the-art SPAD technologies, we will describe our recent progress towards increasing the throughput of single-molecule fluorescence spectroscopy in solution using parallel arrays of SPADs. The potential of this approach is illustrated with single-molecule Förster resonance energy transfer measurements. PMID:25309114
Piatnytskyi, Dmytro V.; Zdorevskyi, Oleksiy O.; Perepelytsya, Sergiy M.; Volkov, Sergey N.
2015-11-01
Changes in the medium of biological cells under ion beam irradiation has been considered as a possible cause of cell function disruption in the living body. The interaction of hydrogen peroxide, a long-lived molecular product of water radiolysis, with active sites of DNA macromolecule was studied, and the formation of stable DNA-peroxide complexes was considered. The phosphate groups of the macromolecule backbone were picked out among the atomic groups of DNA double helix as a probable target for interaction with hydrogen peroxide molecules. Complexes consisting of combinations including: the DNA phosphate group, H2O2 and H2O molecules, and Na+ counterion, were considered. The counterions have been taken into consideration insofar as under the natural conditions they neutralise DNA sugar-phosphate backbone. The energy of the complexes have been determined by considering the electrostatic and the Van der Waals interactions within the framework of atom-atom potential functions. As a result, the stability of various configurations of molecular complexes was estimated. It was shown that DNA phosphate groups and counterions can form stable complexes with hydrogen peroxide molecules, which are as stable as the complexes with water molecules. It has been demonstrated that the formation of stable complexes of H2O2-Na+-PO4- may be detected experimentally by observing specific vibrations in the low-frequency Raman spectra. The interaction of H2O2 molecule with phosphate group of the double helix backbone can disrupt DNA biological function and induce the deactivation of the cell genetic apparatus. Thus, the production of hydrogen peroxide molecules in the nucleus of living cells can be considered as an additional mechanism by which high-energy ion beams destroy tumour cells during ion beam therapy. Contribution to the Topical Issue "COST Action Nano-IBCT: Nano-scale Processes Behind Ion-Beam Cancer Therapy", edited by Andrey Solov'yov, Nigel Mason, Gustavo García, Eugene
Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun
2016-05-24
DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.
Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong
2014-02-01
Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2016-05-28
The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.
Evaluation of the Kinetic Property of Single-Molecule Junctions by Tunneling Current Measurements.
Harashima, Takanori; Hasegawa, Yusuke; Kiguchi, Manabu; Nishino, Tomoaki
2018-01-01
We investigated the formation and breaking of single-molecule junctions of two kinds of dithiol molecules by time-resolved tunneling current measurements in a metal nanogap. The resulting current trajectory was statistically analyzed to determine the single-molecule conductance and, more importantly, to reveal the kinetic property of the single-molecular junction. These results suggested that combining a measurement of the single-molecule conductance and statistical analysis is a promising method to uncover the kinetic properties of the single-molecule junction.
Kaneko, Satoshi; Takahashi, Ryoji; Fujii, Shintaro; Nishino, Tomoaki; Kiguchi, Manabu
2017-04-12
The formation process and atomic structures were investigated for single pyrazine molecular junctions sandwiched by three different Au, Ag, and Cu electrodes using a mechanically controllable break junction technique in ultrahigh vacuum conditions at 300 K. We demonstrated that the formation process of the single-molecule junction crucially depended on the choice of the metal electrodes. While single-molecule junction showing two distinct conductance states were found for the Au electrodes, only the single conductance state was evident for the Ag electrodes, and there was no junction formation for the Cu electrodes. These results suggested that metal-molecule interaction dominates the formation process and probability of the single-molecule junction. In addition to the metal-molecule interaction, temperature affected the formation process of the single-molecule junction. The single pyrazine molecular junction formed between Au electrodes exhibited significant temperature dependence where the junction-formation probability was about 8% at 300 K, while there was no junction-formation at 100 K. Instead of the junction formation, an Au atomic wire was formed at the low temperature. This study provides insight into the tuning of the junction-forming process for single-molecule junctions, which is needed to construct device structures on a single molecule scale.
Inelastic transport and low-bias rectification in a single-molecule diode.
Hihath, Joshua; Bruot, Christopher; Nakamura, Hisao; Asai, Yoshihiro; Díez-Pérez, Ismael; Lee, Youngu; Yu, Luping; Tao, Nongjian
2011-10-25
Designing, controlling, and understanding rectification behavior in molecular-scale devices has been a goal of the molecular electronics community for many years. Here we study the transport behavior of a single molecule diode, and its nonrectifying, symmetric counterpart at low temperatures, and at both low and high biases to help elucidate the electron-phonon interactions and transport mechanisms in the rectifying system. We find that the onset of current rectification occurs at low biases, indicating a significant change in the elastic transport pathway. However, the peaks in the inelastic electron tunneling (IET) spectrum are antisymmetric about zero bias and show no significant changes in energy or intensity in the forward or reverse bias directions, indicating that despite the change in the elastic transmission probability there is little impact on the inelastic pathway. These results agree with first principles calculations performed to evaluate the IETS, which also allow us to identify which modes are active in the single molecule junction.
Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.
2015-01-01
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...
Single molecules and single nanoparticles as windows to the nanoscale
Caldarola, Martín; Orrit, Michel
2018-05-01
Since the first optical detection of single molecules, they have been used as nanometersized optical sensors to explore the physical properties of materials and light-matter interaction at the nanoscale. Understanding nanoscale properties of materials is fundamental for the development of new technology that requires precise control of atoms and molecules when the quantum nature of matter cannot be ignored. In the following lines, we illustrate this journey into nanoscience with some experiments from our group.
Alternative types of molecule-decorated atomic chains in Au–CO–Au single-molecule junctions
Directory of Open Access Journals (Sweden)
Zoltán Balogh
2015-06-01
Full Text Available We investigate the formation and evolution of Au–CO single-molecule break junctions. The conductance histogram exhibits two distinct molecular configurations, which are further investigated by a combined statistical analysis. According to conditional histogram and correlation analysis these molecular configurations show strong anticorrelations with each other and with pure Au monoatomic junctions and atomic chains. We identify molecular precursor configurations with somewhat higher conductance, which are formed prior to single-molecule junctions. According to detailed length analysis two distinct types of molecule-affected chain-formation processes are observed, and we compare these results to former theoretical calculations considering bridge- and atop-type molecular configurations where the latter has reduced conductance due to destructive Fano interference.
DEFF Research Database (Denmark)
Danilov, Andrey; Kubatkin, Sergey; Kafanov, Sergey
2008-01-01
We report on single molecule electron transport measurements of two oligophenylenevinylene (OPV3) derivatives placed in a nanogap between gold (Au) or lead (Pb) electrodes in a field effect transistor device. Both derivatives contain thiol end groups that allow chemical binding to the electrodes....... One derivative has additional methylene groups separating the thiols from the delocalized -electron system. The insertion of methylene groups changes the open state conductance by 3-4 orders of magnitude and changes the transport mechanism from a coherent regime with finite zero-bias conductance...
Energy Technology Data Exchange (ETDEWEB)
Peressinotto, Valdirene Sullas Teixeira
2007-07-01
Single- and double-stranded DNA (deoxyribonucleic acid) molecules can strongly bind to single-walled carbon nanotubes (SWNT) via non-covalent interactions. Under certain conditions, the DNA molecule spontaneously self-assembles into a helical wrapping around the tubular structure of the carbon nanotubes to form DNA/SWNT hybrids, which are both stable and soluble in water. This system has recently received extensive attention, since, besides rendering SWNTs dispersible in water as individual tubes, the DNA hybrids are very promising candidates for many applications in nanotechnology and molecular biology. All the possible applications for DNA-SWNT hybrids require, however, a fully understanding of DNA-nanotube wrapping mechanism which is still lacking in the literature. In this context, the aim of this work was to investigate the non-covalent interaction in aqueous medium between SWNTs and synthetic DNA segments having a known nucleotide sequence. Initially, the study was focused on poly d(GT)n sequences (n = 10, 30 and 45) that contain a sequence of alternating guanine and thymine bases and for which the efficiency to disperse and separate carbon nanotubes has already been demonstrated. Besides the size of GT sequences, the effects of ionic strength and pH in the interaction were also investigated. Afterwards, we studied the interaction of SWNT with DNA molecules that contain only a single type of nitrogenous base (DNA homopolymers), which has not been reported in details in the literature. We investigated homopolymers of poly dA{sub 20}, poly dT{sub 20}, poly dC{sub 20} and the duplex poly dA{sub 20}:dT{sub 20}. Most of the study was carried out with small-diameter HiPco SWNTs (with diameters between 0.7 and 1.2 nm). In some studies, SWNTs with diameter around 1.4 nm, synthesized via laser ablation and arc-discharge methods, were also investigated. The arc-discharge nanotubes used in this study were functionalized with carboxylic groups (-COOH) due to their
Probe DNA-Cisplatin Interaction with Solid-State Nanopores
Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration
2014-03-01
Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.
Radiobiology of DNA strand breakage
International Nuclear Information System (INIS)
Johansen, I.
1975-01-01
The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls
Second-strand cDNA synthesis: classical method
International Nuclear Information System (INIS)
Gubler, U.
1987-01-01
The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Single Molecule Spectroscopy on Photosynthetic Pigment-Protein Complexes
Jelezko, F; Schuler, S; Thews, E; Tietz, C; Wechsler, A; Wrachtrup, J
2001-01-01
Single molecule spectroscopy was applied to unravel the energy transfer pathway in photosynthetic pigment-protein complexes. Detailed analysis of excitation and fluorescence emission spectra has been made for peripheral plant antenna LHC II and Photosystem I from cyanobacterium Synechococcus elongatus. Optical transitions of individual pigments were resolved under nonselective excitation of antenna chlorophylls. High-resolution fluorescence spectroscopy of individual plant antenna LHC II indicates that at low temperatures, the excitation energy is localized on the red-most Chl a pool absorbing at 680 nm. More than one pigment molecule is responsible for the fluorescence emission of the LHC II trimer. The spectral lines of single Chl a molecules absorbing at 675 nm are broadened because of the Foerster energy transfer towards the red-most pigments. Low-temperature spectroscopy on single PS I trimers indicates that two subgroups of pigments, which are present in the red antenna pool, differ by the strength of t...
Mechanisms of DNA uptake by cells
Energy Technology Data Exchange (ETDEWEB)
Lacks, S.A.
1977-01-01
Three categories of cellular uptake of DNA can be distinguished. First, in the highly transformable bacteria, such as Diplococcus pneumoniae, Haemophilus influenzae and Bacillus subtilis, elaborate mechanisms of DNA transport have evolved, presumably for the purpose of genetic exchange. These mechanisms can introduce substantial amounts of DNA into the cell. Second, methods have been devised for the forced introduction of DNA by manipulation of bacterial cells under nonphysiological conditions. By such means small but significant amounts of DNA have been introduced into various bacteria, including Escherichia coli. Third, mammalian cells are able to take up biologically active DNA. This has been most clearly demonstrated with viral DNA, although the mechanism of uptake is not well understood. The intention, here, is to survey current understanding of the various mechanisms of DNA uptake. A review of experience with the bacterial systems may throw some light on the mammalian system and lead to suggestions for enhancing DNA uptake by mammalian cells.
Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes
Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.
2015-01-01
Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076
Loading dynamics of a sliding DNA clamp.
Cho, Won-Ki
2014-05-22
Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.
Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.
2013-01-01
In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Electron Paramagnetic Resonance of a Single NV Nanodiamond Attached to an Individual Biomolecule.
Teeling-Smith, Richelle M; Jung, Young Woo; Scozzaro, Nicolas; Cardellino, Jeremy; Rampersaud, Isaac; North, Justin A; Šimon, Marek; Bhallamudi, Vidya P; Rampersaud, Arfaan; Johnston-Halperin, Ezekiel; Poirier, Michael G; Hammel, P Chris
2016-05-10
Electron paramagnetic resonance (EPR), an established and powerful methodology for studying atomic-scale biomolecular structure and dynamics, typically requires in excess of 10(12) labeled biomolecules. Single-molecule measurements provide improved insights into heterogeneous behaviors that can be masked in ensemble measurements and are often essential for illuminating the molecular mechanisms behind the function of a biomolecule. Here, we report EPR measurements of a single labeled biomolecule. We selectively label an individual double-stranded DNA molecule with a single nanodiamond containing nitrogen-vacancy centers, and optically detect the paramagnetic resonance of nitrogen-vacancy spins in the nanodiamond probe. Analysis of the spectrum reveals that the nanodiamond probe has complete rotational freedom and that the characteristic timescale for reorientation of the nanodiamond probe is slow compared with the transverse spin relaxation time. This demonstration of EPR spectroscopy of a single nanodiamond-labeled DNA provides the foundation for the development of single-molecule magnetic resonance studies of complex biomolecular systems. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Mechanical transduction via a single soft polymer
Hou, Ruizheng; Wang, Nan; Bao, Weizhu; Wang, Zhisong
2018-04-01
Molecular machines from biology and nanotechnology often depend on soft structures to perform mechanical functions, but the underlying mechanisms and advantages or disadvantages over rigid structures are not fully understood. We report here a rigorous study of mechanical transduction along a single soft polymer based on exact solutions to the realistic three-dimensional wormlike-chain model and augmented with analytical relations derived from simpler polymer models. The results reveal surprisingly that a soft polymer with vanishingly small persistence length below a single chemical bond still transduces biased displacement and mechanical work up to practically significant amounts. This "soft" approach possesses unique advantages over the conventional wisdom of rigidity-based transduction, and potentially leads to a unified mechanism for effective allosterylike transduction and relay of mechanical actions, information, control, and molecules from one position to another in molecular devices and motors. This study also identifies an entropy limit unique to the soft transduction, and thereby suggests a possibility of detecting higher efficiency for kinesin motor and mutants in future experiments.
Metal-Controlled Magnetoresistance at Room Temperature in Single-Molecule Devices.
Aragonès, Albert C; Aravena, Daniel; Valverde-Muñoz, Francisco J; Real, José Antonio; Sanz, Fausto; Díez-Pérez, Ismael; Ruiz, Eliseo
2017-04-26
The appropriate choice of the transition metal complex and metal surface electronic structure opens the possibility to control the spin of the charge carriers through the resulting hybrid molecule/metal spinterface in a single-molecule electrical contact at room temperature. The single-molecule conductance of a Au/molecule/Ni junction can be switched by flipping the magnetization direction of the ferromagnetic electrode. The requirements of the molecule include not just the presence of unpaired electrons: the electronic configuration of the metal center has to provide occupied or empty orbitals that strongly interact with the junction metal electrodes and that are close in energy to their Fermi levels for one of the electronic spins only. The key ingredient for the metal surface is to provide an efficient spin texture induced by the spin-orbit coupling in the topological surface states that results in an efficient spin-dependent interaction with the orbitals of the molecule. The strong magnetoresistance effect found in this kind of single-molecule wire opens a new approach for the design of room-temperature nanoscale devices based on spin-polarized currents controlled at molecular level.
Single-Molecule Chemistry with Surface- and Tip-Enhanced Raman Spectroscopy.
Zrimsek, Alyssa B; Chiang, Naihao; Mattei, Michael; Zaleski, Stephanie; McAnally, Michael O; Chapman, Craig T; Henry, Anne-Isabelle; Schatz, George C; Van Duyne, Richard P
2017-06-14
Single-molecule (SM) surface-enhanced Raman spectroscopy (SERS) and tip-enhanced Raman spectroscopy (TERS) have emerged as analytical techniques for characterizing molecular systems in nanoscale environments. SERS and TERS use plasmonically enhanced Raman scattering to characterize the chemical information on single molecules. Additionally, TERS can image single molecules with subnanometer spatial resolution. In this review, we cover the development and history of SERS and TERS, including the concept of SERS hot spots and the plasmonic nanostructures necessary for SM detection, the past and current methodologies for verifying SMSERS, and investigations into understanding the signal heterogeneities observed with SMSERS. Moving on to TERS, we cover tip fabrication and the physical origins of the subnanometer spatial resolution. Then, we highlight recent advances of SMSERS and TERS in fields such as electrochemistry, catalysis, and SM electronics, which all benefit from the vibrational characterization of single molecules. SMSERS and TERS provide new insights on molecular behavior that would otherwise be obscured in an ensemble-averaged measurement.
Tamaki, Takashi; Ogawa, Takuji
2017-09-05
This review highlights molecular design for nonlinear and nonsymmetric single-molecule electronic properties such as rectification, negative differential resistance, and switching, which are important components of future single-molecule information processing devices. Perspectives on integrated "molecular circuits" are also provided. Nonlinear and nonsymmetric single-molecule electronics can be designed by utilizing (1) asymmetric molecular cores, (2) asymmetric anchoring groups, (3) an asymmetric junction environment, and (4) asymmetric electrode materials. This review mainly focuses on the design of molecular cores.
Single-Molecule Light-Sheet Imaging of Suspended T Cells.
Ponjavic, Aleks; McColl, James; Carr, Alexander R; Santos, Ana Mafalda; Kulenkampff, Klara; Lippert, Anna; Davis, Simon J; Klenerman, David; Lee, Steven F
2018-05-08
Adaptive immune responses are initiated by triggering of the T cell receptor. Single-molecule imaging based on total internal reflection fluorescence microscopy at coverslip/basal cell interfaces is commonly used to study this process. These experiments have suggested, unexpectedly, that the diffusional behavior and organization of signaling proteins and receptors may be constrained before activation. However, it is unclear to what extent the molecular behavior and cell state is affected by the imaging conditions, i.e., by the presence of a supporting surface. In this study, we implemented single-molecule light-sheet microscopy, which enables single receptors to be directly visualized at any plane in a cell to study protein dynamics and organization in live, resting T cells. The light sheet enabled the acquisition of high-quality single-molecule fluorescence images that were comparable to those of total internal reflection fluorescence microscopy. By comparing the apical and basal surfaces of surface-contacting T cells using single-molecule light-sheet microscopy, we found that most coated-glass surfaces and supported lipid bilayers profoundly affected the diffusion of membrane proteins (T cell receptor and CD45) and that all the surfaces induced calcium influx to various degrees. Our results suggest that, when studying resting T cells, surfaces are best avoided, which we achieve here by suspending cells in agarose. Copyright © 2018. Published by Elsevier Inc.
Theory on the Mechanism of DNA Renaturation: Stochastic Nucleation and Zipping.
Directory of Open Access Journals (Sweden)
Gnanapragasam Niranjani
Full Text Available Renaturation of the complementary single strands of DNA is one of the important processes that requires better understanding in the view of molecular biology and biological physics. Here we develop a stochastic dynamical model on the DNA renaturation. According to our model there are at least three steps in the renaturation process viz. nonspecific-contact formation, correct-contact formation and nucleation, and zipping. Most of the earlier two-state models combined nucleation with nonspecific-contact formation step. In our model we suggest that it is considerably meaningful when we combine the nucleation with the zipping since nucleation is the initial step of zipping and nucleated and zipping molecules are indistinguishable. Nonspecific contact formation step is a pure three-dimensional diffusion controlled collision process. Whereas nucleation involves several rounds of one-dimensional slithering and internal displacement dynamics of one single strand of DNA on the other complementary strand in the process of searching for the correct-contact and then initiate nucleation. Upon nucleation, the stochastic zipping follows to generate a fully renatured double stranded DNA. It seems that the square-root dependency of the overall renaturation rate constant on the length of reacting single strands originates mainly from the geometric constraints in the diffusion controlled nonspecific-contact formation step. Further the inverse scaling of the renaturation rate on the viscosity of reaction medium also originates from nonspecific contact formation step. On the other hand the inverse scaling of the renaturation rate with the sequence complexity originates from the stochastic zipping which involves several rounds of crossing over the free-energy barrier at microscopic levels. When the sequence of renaturing single strands of DNA is repetitive with less complexity then the cooperative effects will not be noticeable since the parallel zipping will be a
Graphical models for inferring single molecule dynamics
Directory of Open Access Journals (Sweden)
Gonzalez Ruben L
2010-10-01
Full Text Available Abstract Background The recent explosion of experimental techniques in single molecule biophysics has generated a variety of novel time series data requiring equally novel computational tools for analysis and inference. This article describes in general terms how graphical modeling may be used to learn from biophysical time series data using the variational Bayesian expectation maximization algorithm (VBEM. The discussion is illustrated by the example of single-molecule fluorescence resonance energy transfer (smFRET versus time data, where the smFRET time series is modeled as a hidden Markov model (HMM with Gaussian observables. A detailed description of smFRET is provided as well. Results The VBEM algorithm returns the model’s evidence and an approximating posterior parameter distribution given the data. The former provides a metric for model selection via maximum evidence (ME, and the latter a description of the model’s parameters learned from the data. ME/VBEM provide several advantages over the more commonly used approach of maximum likelihood (ML optimized by the expectation maximization (EM algorithm, the most important being a natural form of model selection and a well-posed (non-divergent optimization problem. Conclusions The results demonstrate the utility of graphical modeling for inference of dynamic processes in single molecule biophysics.
Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan
2011-01-25
DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.
International Nuclear Information System (INIS)
Tanzer, K.
2015-01-01
Since it was discovered in the year 2000 that secondary electrons with energies below 20 eV, which are the most abundant secondary species produced upon the interaction of ionizing radiation with biological tissue, can induce severe damages in the DNA such as single and double strand breaks, the interest for the study of the interaction of electrons with essential molecules of the human body has grown immensely. Double strand breaks can lead to cancer and are therefore a substantial threat to human health, however, the radiation research community is not sure how these strand breaks are formed upon interaction with ionizing radiation. The fact that even electrons with energies well below the ionization threshold can induce great damage in biological molecules via a resonant process called dissociative electron attachment (DEA), has even furthered the interest in these electron interactions, as it was shown to be a very efficient decomposition mechanism. A variety of studies, such as DEA studies to components of the DNA, for example, have been undertaken so far to shed more light on the role electrons play in the radiation damage of biomolecules. In this thesis two nucleobases, adenine and hypoxanthine, have been studied by observing their response towards low-energy electrons. It has been found that these nucleobases behave in a similar manner upon low-energy electron interaction, as do other nucleobases, that have been studied previously. The loss of hydrogen is suspected to act as a precursor for the decomposition of the DNA and the nucleobases can also undergo ring cleavage, which will induce substantial damage in the DNA. Furthermore, the search for improved and more efficient methods for the treatment of cancer is as important as ever, considering the ever-rising number of cancer deaths. Radiotherapy has proven to be one of the best treatments for tumors, but was found to be ineffective in hypoxic - oxygen deprived - tumors. Compounds called radiosensitizers