WorldWideScience

Sample records for single stranded oligonucleotide

  1. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  2. In vivo recombineering of bacteriophage λ by PCR fragments and single-strand oligonucleotides

    International Nuclear Information System (INIS)

    Oppenheim, Amos B.; Rattray, Alison J.; Bubunenko, Mikhail; Thomason, Lynn C.; Court, Donald L.

    2004-01-01

    We demonstrate that the bacteriophage λ Red functions efficiently recombine linear DNA or single-strand oligonucleotides (ss-oligos) into bacteriophage λ to create specific changes in the viral genome. Point mutations, deletions, and gene replacements have been created. While recombineering with oligonucleotides, we encountered other mutations accompanying the desired point mutational change. DNA sequence analysis suggests that these unwanted mutations are mainly frameshift deletions introduced during oligonucleotide synthesis

  3. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  4. Intercalation of single-strand oligonucleotides between nucleolipid anionic membranes: a neutron diffraction study.

    Science.gov (United States)

    Milani, Silvia; Berti, Debora; Dante, Silvia; Hauss, Thomas; Baglioni, Piero

    2009-04-07

    This contribution presents a neutron diffraction investigation of anionic lamellar phases composed of mixtures of 1-palmitoyl, 2-oleoyl phosphatidyl-nucleosides (POPN, where N is either adenosine or uridine), and POPC (1-palmitoyl,2-oleoyl-phosphatidyl-choline). Their behavior is studied for two different mole ratios and in the presence of nucleic acids. The samples are formed by the evaporation of liposomal dispersions prepared in water or in solutions containing single-strand oligonucleotides. Previous small angle X-ray scattering (SAXS) experiments on the system POPA/polyU (polyuridylic acid, high degree of polymerization, synthetic ribonucleic acid) proved that the insertion and ordering of the biopolymer in the phospholipid lamellae were driven by molecular recognition. In the present study, we extend the previous investigation to single-strand monodisperse oligonucleotides (50-mers). Structural details of the membranes were obtained from the analysis of the neutron diffraction scattering length density profiles. The evidence of direct and specific interactions, driven by molecular recognition between the nucleic polar heads of the nucleolipid and the single-strand nucleic acid, is strengthened by the comparison with identically charged bilayers formed by POPG/POPC. These results contribute to the understanding of the parameters governing the interactions between nucleolipid membranes and oligonucleotides, providing a novel strategy for the design of lipid-based vehicles for nucleic acids.

  5. Quantitation of ultraviolet-induced single-strand breaks using oligonucleotide chip

    International Nuclear Information System (INIS)

    Pal, Sukdeb; Kim, Min Jung; Choo, Jaebum; Kang, Seong Ho; Lee, Kyeong-Hee; Song, Joon Myong

    2008-01-01

    A simple, accurate and robust methodology was established for the direct quantification of ultraviolet (UV)-induced single-strand break (SSB) using oligonucleotide chip. Oligonucleotide chips were fabricated by covalently anchoring the fluorescent-labeled ssDNAs onto silicon dioxide chip surfaces. Assuming that the possibility of more than one UV-induced SSB to be generated in a small oligonucleotide is extremely low, SSB formation was investigated quantifying the endpoint probe density by fluorescence measurement upon UV irradiation. The SSB yields obtained based on the highly sensitive laser-induced fluorometric determination of fluorophore-labeled oligonucleotides were found to coincide well with that predicted from a theoretical extrapolation of the results obtained for plasmid DNAs using conventional agarose gel electrophoresis. The developed method has the potential to serve as a high throughput, sample-thrifty, and time saving tool to realize more realistic, and direct quantification of radiation and chemical-induced strand breaks. It will be especially useful for determining the frequency of SSBs or lesions convertible to SSBs by specific cleaving reagents or enzymes

  6. Characterization of the nanostructure of complexes formed by single- or double-stranded oligonucleotides with a cationic surfactant.

    Science.gov (United States)

    Liu, Xiaoyang; Abbott, Nicholas L

    2010-12-02

    We report the use of dynamic light scattering (DLS), small-angle neutron scattering (SANS), and small-angle X-ray scattering (SAXS) to characterize the nanostructure of complexes formed by either single- or double-stranded oligonucleotides with a cationic surfactant (cetyltrimethylammonium bromide, CTAB) in aqueous solution (1 mM Li(2)SO(4)). For single-stranded oligonucleotides 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', both the appearance of two Bragg peaks (at 0.14 and 0.28 Å(-1)) in SAXS spectra with a spacing of 1:2 and form factor fits to SANS spectra are consistent with the presence of multilamellar vesicles (with, on average, 6-9 layers with a periodicity of 45-48 Å). Some samples showed evidence of an additional Bragg peak (at 0.20 Å(-1)) associated with periodic packing (with a periodicity of 31 Å) of the oligonucleotides within the lamellae of the nanostructure. The nucleotide composition of the single-stranded oligonucleotides was also found to impact the number and size of the complexes formed with CTAB. In contrast to 5'-A(20)-3' and 5'-CCCCATTCTAGCAGCCCGGG-3', 5'-T(20)-3' did not change the state of aggregation of CTAB (globular micelles) over a wide range of oligonucleotide:CTAB charge ratios. These results support the proposition that hydrophobic interactions, as well as electrostatics, play a central role in the formation of complexes between cationic amphiphiles and single-stranded oligonucleotides and thus give rise to nanostructures that depend on nucleotide composition. In contrast to the single-stranded oligonucleotides, for double-stranded oligonucleotides mixed with CTAB, three Bragg peaks (0.13, 0.23, and 0.25 Å(-1)) in SAXS spectra with a spacing ratio of 1:√3:√4 and characteristic changes in SANS spectra indicate formation of a hexagonal nanostructure. Also, the composition of the double-stranded oligonucleotides did not measurably impact the nanostructure of complexes formed with CTAB, suggesting that electrostatic

  7. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  8. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  9. Assessing single-stranded oligonucleotide drug-induced effects in vitro reveals key risk factors for thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Sabine Sewing

    Full Text Available Single-stranded oligonucleotides (ON comprise a promising therapeutic platform that enables selective modulation of currently undruggable targets. The development of novel ON drug candidates has demonstrated excellent efficacy, but in certain cases also some safety liabilities were reported. Among them are events of thrombocytopenia, which have recently been evident in late stage trials with ON drugs. The underlying mechanisms are poorly understood and the risk for ON candidates causing such events cannot be sufficiently assessed pre-clinically. We investigated potential thrombocytopenia risk factors of ONs and implemented a set of in vitro assays to assess these risks. Our findings support previous observations that phosphorothioate (PS-ONs can bind to platelet proteins such as platelet collagen receptor glycoprotein VI (GPVI and activate human platelets in vitro to various extents. We also show that these PS-ONs can bind to platelet factor 4 (PF4. Binding to platelet proteins and subsequent activation correlates with ON length and connected to this, the number of PS in the backbone of the molecule. Moreover, we demonstrate that locked nucleic acid (LNA ribosyl modifications in the wings of the PS-ONs strongly suppress binding to GPVI and PF4, paralleled by markedly reduced platelet activation. In addition, we provide evidence that PS-ONs do not directly affect hematopoietic cell differentiation in culture but at higher concentrations show a pro-inflammatory potential, which might contribute to platelet activation. Overall, our data confirm that certain molecular attributes of ONs are associated with a higher risk for thrombocytopenia. We propose that applying the in vitro assays discussed here during the lead optimization phase may aid in deprioritizing ONs with a potential to induce thrombocytopenia.

  10. Mismatched single stranded antisense oligonucleotides can induce efficient dystrophin splice switching

    Directory of Open Access Journals (Sweden)

    Kole Ryszard

    2011-10-01

    Full Text Available Abstract Background Antisense oligomer induced exon skipping aims to reduce the severity of Duchenne muscular dystrophy by redirecting splicing during pre-RNA processing such that the causative mutation is by-passed and a shorter but partially functional Becker muscular dystrophy-like dystrophin isoform is produced. Normal exons are generally targeted to restore the dystrophin reading frame however, an appreciable subset of dystrophin mutations are intra-exonic and therefore have the potential to compromise oligomer efficiency, necessitating personalised oligomer design for some patients. Although antisense oligomers are easily personalised, it remains unclear whether all patient polymorphisms within antisense oligomer target sequences will require the costly process of producing and validating patient specific compounds. Methods Here we report preclinical testing of a panel of splice switching antisense oligomers, designed to excise exon 25 from the dystrophin transcript, in normal and dystrophic patient cells. These patient cells harbour a single base insertion in exon 25 that lies within the target sequence of an oligomer shown to be effective at removing exon 25. Results It was anticipated that such a mutation would compromise oligomer binding and efficiency. However, we show that, despite the mismatch an oligomer, designed and optimised to excise exon 25 from the normal dystrophin mRNA, removes the mutated exon 25 more efficiently than the mutation-specific oligomer. Conclusion This raises the possibility that mismatched AOs could still be therapeutically applicable in some cases, negating the necessity to produce patient-specific compounds.

  11. Conformation effects of CpG methylation on single-stranded DNA oligonucleotides: analysis of the opioid peptide dynorphin-coding sequences.

    Directory of Open Access Journals (Sweden)

    Malik Mumtaz Taqi

    Full Text Available Single-stranded DNA (ssDNA is characterized by high conformational flexibility that allows these molecules to adopt a variety of conformations. Here we used native polyacrylamide gel electrophoresis (PAGE, circular dichroism (CD spectroscopy and nuclear magnetic resonance (NMR spectroscopy to show that cytosine methylation at CpG sites affects the conformational flexibility of short ssDNA molecules. The CpG containing 37-nucleotide PDYN (prodynorphin fragments were used as model molecules. The presence of secondary DNA structures was evident from differences in oligonucleotide mobilities on PAGE, from CD spectra, and from formation of A-T, G-C, and non-canonical G-T base pairs observed by NMR spectroscopy. The oligonucleotides displayed secondary structures at 4°C, and some also at 37°C. Methylation at CpG sites prompted sequence-dependent formation of novel conformations, or shifted the equilibrium between different existing ssDNA conformations. The effects of methylation on gel mobility and base pairing were comparable in strength to the effects induced by point mutations in the DNA sequences. The conformational effects of methylation may be relevant for epigenetic regulatory events in a chromatin context, including DNA-protein or DNA-DNA recognition in the course of gene transcription, and DNA replication and recombination when double-stranded DNA is unwinded to ssDNA.

  12. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    Science.gov (United States)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  13. Optimizing anti-gene oligonucleotide 'Zorro-LNA' for improved strand invasion into duplex DNA

    DEFF Research Database (Denmark)

    Zaghloul, Eman M; Madsen, Andreas S; Moreno, Pedro M D

    2011-01-01

    established a method, which conclusively demonstrates that an LNA ON can strand invade into duplex DNA. To make Zorros smaller in size and easier to design, we synthesized 3'-5'-5'-3' single-stranded Zorro-LNA (ssZorro) by using both 3'- and 5'-phosphoramidites. With ssZorro, a significantly greater extent......Zorro-LNA (Zorro) is a newly developed, oligonucleotide (ON)-based, Z-shaped construct with the potential of specific binding to each strand of duplex DNA. The first-generation Zorros are formed by two hybridized LNA/DNA mixmers (2-ON Zorros) and was hypothesized to strand invade. We have now...... and rate of double-strand invasion (DSI) was obtained than with conventional 2-ON Zorros. Introducing hydrophilic PEG-linkers connecting the two strands did not significantly change the rate or extent of DSI as compared to ssZorro with a nucleotide-based linker, while the longest alkyl-chain linker tested...

  14. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  15. A novel setup for the determination of absolute cross sections for low-energy electron induced strand breaks in oligonucleotides - The effect of the radiosensitizer 5-fluorouracil

    International Nuclear Information System (INIS)

    Rackwitz, J.; Rankovic, M.L.; Milosavljevic, A.R.; Bald, I.

    2017-01-01

    Low-energy electrons (LEEs) play an important role in DNA radiation damage. Here we present a method to quantify LEE induced strand breakage in well-defined oligonucleotide single strands in terms of absolute cross sections. An LEE irradiation setup covering electron energies <500 eV is constructed and optimized to irradiate DNA origami triangles carrying well-defined oligonucleotide target strands. Measurements are presented for 10.0 and 5.5 eV for different oligonucleotide targets. The determination of absolute strand break cross sections is performed by atomic force microscopy analysis. An accurate fluence determination ensures small margins of error of the determined absolute single strand break cross sections σ_S_S_B. In this way, the influence of sequence modification with the radiosensitive 5-Fluorouracil ("5"FU) is studied using an absolute and relative data analysis. We demonstrate an increase in the strand break yields of "5"FU containing oligonucleotides by a factor of 1.5 to 1.6 compared with non-modified oligonucleotide sequences when irradiated with 10 eV electrons. (authors)

  16. Triplex-forming oligonucleotides: a third strand for DNA nanotechnology.

    Science.gov (United States)

    Chandrasekaran, Arun Richard; Rusling, David A

    2018-02-16

    DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical ('triplex') structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone.

  17. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Synthesis of a gene for the HIV transactivator protein TAT by a novel single stranded approach involving in vivo gap repair.

    OpenAIRE

    Adams, S E; Johnson, I D; Braddock, M; Kingsman, A J; Kingsman, S M; Edwards, R M

    1988-01-01

    The synthesis of a gene for the HIV TAT protein is described using a novel approach that capitalises on the ability to synthesise oligonucleotides of greater than 100 bp in length. It involves the synthesis of large oligomers covering one strand of the desired gene in its entirety and the use of small complementary bridging and adapter oligonucleotides to direct the assembly and cloning of the large oligomers. After ligation to the cloning vector the partially single stranded intermediate is ...

  19. Understanding the similarity in thermophoresis between single- and double-stranded DNA or RNA

    Science.gov (United States)

    Reichl, Maren; Herzog, Mario; Greiss, Ferdinand; Wolff, Manuel; Braun, Dieter

    2015-06-01

    Thermophoresis is the movement of molecules in a temperature gradient. For aqueous solutions its microscopic basis is debated. Understanding thermophoresis for this case is, however, important since it proved very useful to detect the binding affinity of biomolecules and since thermophoresis could have played an important role in early molecular evolution. Here we discuss why the thermophoresis of single- and double-stranded oligonucleotides - DNA and RNA - is surprisingly similar. This finding is understood by comparing the spherical capacitor model for single-stranded species with the case of a rod-shaped model for double-stranded oligonucleotides. The approach describes thermophoresis of DNA and RNA with fitted effective charges consistent with electrophoresis measurements and explains the similarity between single- and double-stranded species. We could not confirm the sign change for the thermophoresis of single- versus double-stranded DNA in crowded solutions containing polyethylene glycol [Y. T. Maeda, T. Tlusty, and A. Libchaber, Proc. Natl. Acad. Sci. USA 109, 17972 (2012), 10.1073/pnas.1215764109], but find a salt-independent offset while the Debye length dependence still satisfies the capacitor model. Overall, the analysis documents the continuous progress in the microscopic understanding of thermophoresis.

  20. Scalable Amplification of Strand Subsets from Chip-Synthesized Oligonucleotide Libraries (Open Access)

    Science.gov (United States)

    2015-11-16

    Institute, 450 Brookline Avenue, Boston, Massachusetts 02215, USA. 2Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240...quantities (each) would receive a boost from a largely reduced oligonucleotide cost and an automatable production pipeline . Methods Materials. Enzymes...genome-wide codon replacement . Science 333, 348–353 (2011). 13. Yamada, N. A. et al. Visualization of fine-scale genomic structure by oligonucleotide-based

  1. Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems.

    Science.gov (United States)

    Musumeci, Domenica; Rozza, Lucia; Merlino, Antonello; Paduano, Luigi; Marzo, Tiziano; Massai, Lara; Messori, Luigi; Montesarchio, Daniela

    2015-08-21

    The interaction of the anticancer Ru(iii) complex AziRu - in comparison with its analogue NAMI-A, currently in advanced clinical trials as an antimetastatic agent - with DNA model systems, both single stranded and duplex oligonucleotides, was investigated using a combined approach, including absorption UV-vis spectroscopy, circular dichroism (CD) and electrospray mass spectrometry (ESI-MS) techniques. UV-vis absorption spectra of the Ru complexes were recorded at different times in a pseudo-physiological solution, to monitor the ligand exchange processes in the absence and in the presence of the examined oligonucleotides. CD experiments provided information on the overall conformational changes of the DNA model systems induced by these metal complexes. UV- and CD-monitored thermal denaturation studies were performed to analyse the effects of AziRu and NAMI-A on the stability of the duplex structures. ESI-MS experiments, carried out on the oligonucleotide/metal complex mixtures under investigation, allowed us to detect the formation of stable adducts between the guanine-containing oligomers and the ruthenium complexes. These data unambiguously demonstrate that both AziRu and NAMI-A can interact with the DNA model systems. Although very similar in their structures, the two metal compounds manifest a markedly different reactivity with the examined sequences, respectively, with either a naked Ru(3+) ion or a Ru(Im)(3+) (Im = imidazole) fragment being incorporated into the oligonucleotide structure via stable linkages.

  2. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  3. Charge enhancement of single-stranded DNA in negative electrospray ionization using the supercharging reagent meta-nitrobenzyl alcohol.

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1% m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1% m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  4. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  5. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  6. Design Considerations for Array CGH to OligonucleotideArrays

    Energy Technology Data Exchange (ETDEWEB)

    Baldocchi, R.A.; Glynne, R.J.; Chin, K.; Kowbel, D.; Collins, C.; Mack, D.H.; Gray, J.W.

    2005-03-04

    Background: Representational oligonucleotide microarray analysis has been developed for detection of single nucleotide polymorphisms and/or for genome copy number changes. In this process, the intensity of hybridization to oligonucleotides arrays is increased by hybridizing a polymerase chain reaction (PCR)-amplified representation of reduced genomic complexity. However, hybridization to some oligonucleotides is not sufficiently high to allow precise analysis of that portion of the genome. Methods: In an effort to identify aspects of oligonucleotide hybridization affecting signal intensity, we explored the importance of the PCR product strand to which each oligonucleotide is homologous and the sequence of the array oligonucleotides. We accomplished this by hybridizing multiple PCR-amplified products to oligonucleotide arrays carrying two sense and two antisense 50-mer oligonucleotides for each PCR amplicon. Results: In some cases, hybridization intensity depended more strongly on the PCR amplicon strand (i.e., sense vs. antisense) than on the detection oligonucleotide sequence. In other cases, the oligonucleotide sequence seemed to dominate. Conclusion: Oligonucleotide arrays for analysis of DNA copy number or for single nucleotide polymorphism content should be designed to carry probes to sense and antisense strands of each PCR amplicon to ensure sufficient hybridization and signal intensity.

  7. Peptide-LNA oligonucleotide conjugates

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte

    2013-01-01

    properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper...

  8. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  9. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    Science.gov (United States)

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  10. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  11. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  12. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  13. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  14. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  15. A comparative analysis of measles virus RNA by oligonucleotide fingerprinting

    International Nuclear Information System (INIS)

    Stephenson, J.R.; Meulen, V. ter

    1982-01-01

    Isolates from two cases of acute measles, one case of acute measles encephalitis and three patients with subacute sclerosing panencephalitis were compared. This comparison was based upon the electrophoretic analysis of T 1 oligonucleotides from single-stranded, full-length RNA isolated from cytoplasmic nucleocapsids. Although all viruses have oligonucleotides in common, each isolate generated a unique pattern of oligonucleotides. However, no group of oligonucleotides was observed which would allow differentiation between viruses isolated from acute infections and those isolated from CNS diseases; indicating that probably all measles viruses differ in their nucleotide sequence, regardless of origin. (Author)

  16. Single-Labeled Oligonucleotides Showing Fluorescence Changes upon Hybridization with Target Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Gil Tae Hwang

    2018-01-01

    Full Text Available Sequence-specific detection of nucleic acids has been intensively studied in the field of molecular diagnostics. In particular, the detection and analysis of single-nucleotide polymorphisms (SNPs is crucial for the identification of disease-causing genes and diagnosis of diseases. Sequence-specific hybridization probes, such as molecular beacons bearing the fluorophore and quencher at both ends of the stem, have been developed to enable DNA mutation detection. Interestingly, DNA mutations can be detected using fluorescently labeled oligonucleotide probes with only one fluorophore. This review summarizes recent research on single-labeled oligonucleotide probes that exhibit fluorescence changes after encountering target nucleic acids, such as guanine-quenching probes, cyanine-containing probes, probes containing a fluorophore-labeled base, and microenvironment-sensitive probes.

  17. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  18. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  19. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  20. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  1. Monomer dynamics in single- and double-stranded DNA coils

    Science.gov (United States)

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2007-09-01

    In our paper (Tothova et al., Czech. J. Phys. 55, 221 (2005)), the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique (R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)) has been interpreted within the bead-spring theory. Optimizing the joint Rouse-Zimm model to the experimental data, the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dynamics have been determined. Recently, these data have been corrected (R. Shusterman et al., Phys. Rev. Lett. 98, 029901 (2007)). In the present work, the fits of the theory to the new data are given. The main conclusions of our preceding paper remain unchanged but some of the polymer parameters have changed. The new data allow a significantly better agreement with the theory than the previous ones. Our calculations confirm that dsDNA follows mainly the classical Zimm-type kinetics rather than the Rouse one as it was proposed by Shusterman et al. Single-stranded DNA also behaves predominantly as the Zimm polymer. To support these conclusions, we analyze the draining effects on the monomer dynamics and the applicability of simple “universal” laws, according to which the monomer mean square displacement scales with the time as t1/2 and t2/3 for the Rouse and Zimm polymers, respectively.

  2. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  3. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  4. Offset configurations for single- and double-strand DNA inside single-walled carbon nanotubes.

    Science.gov (United States)

    Alshehri, Mansoor H; Cox, Barry J; Hill, James M

    2014-01-01

    Nanotechnology is a rapidly expanding research area, and it is believed that the unique properties of molecules at the nano-scale will prove to be of substantial benefit to mankind, especially so in medicine and electronics. Here we use applied mathematical modelling exploiting the basic principles of mechanics and the 6-12 Lennard-Jones potential function together with the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities. We consider the equilibrium offset positions for both single-strand and double-strand DNA molecules inside a single-walled carbon nanotube, and we predict offset positions with reference to the cross-section of the carbon nanotube. For the double-strand DNA, the potential energy is determined for the general case for any helical phase angle ϕ, but we also consider a special case when ϕ = π, which leads to a substantial simplification in the analytical expression for the energy. As might be expected, our results confirm that the global minimum energy positions for a single-strand DNA molecule and a double-strand DNA molecule will lie off axis and they become closer to the tube wall as the radius of the tube increases.

  5. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  6. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  7. Escherichia coli Single-Stranded DNA-Binding Protein: NanoESI-MS Studies of Salt-Modulated Subunit Exchange and DNA Binding Transactions

    Science.gov (United States)

    Mason, Claire E.; Jergic, Slobodan; Lo, Allen T. Y.; Wang, Yao; Dixon, Nicholas E.; Beck, Jennifer L.

    2013-02-01

    Single-stranded DNA-binding proteins (SSBs) are ubiquitous oligomeric proteins that bind with very high affinity to single-stranded DNA and have a variety of essential roles in DNA metabolism. Nanoelectrospray ionization mass spectrometry (nanoESI-MS) was used to monitor subunit exchange in full-length and truncated forms of the homotetrameric SSB from Escherichia coli. Subunit exchange in the native protein was found to occur slowly over a period of hours, but was significantly more rapid in a truncated variant of SSB from which the eight C-terminal residues were deleted. This effect is proposed to result from C-terminus mediated stabilization of the SSB tetramer, in which the C-termini interact with the DNA-binding cores of adjacent subunits. NanoESI-MS was also used to examine DNA binding to the SSB tetramer. Binding of single-stranded oligonucleotides [one molecule of (dT)70, one molecule of (dT)35, or two molecules of (dT)35] was found to prevent SSB subunit exchange. Transfer of SSB tetramers between discrete oligonucleotides was also observed and is consistent with predictions from solution-phase studies, suggesting that SSB-DNA complexes can be reliably analyzed by ESI mass spectrometry.

  8. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  9. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  10. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  11. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  12. Mechanism of adsorption of single and double stranded DNA on gold and silver nanoparticles: Investigating some important parameters in bio-sensing applications.

    Science.gov (United States)

    Farkhari, Nahid; Abbasian, Sara; Moshaii, Ahmad; Nikkhah, Maryam

    2016-12-01

    The mechanism of adsorption of single and double stranded DNAs on colloidal gold and silver nanoparticles has been studied by measuring the resistance of the nanoparticles, surrounded by various oligonucleotides, against salt induced aggregation. It is shown that both single and double stranded DNAs can be adsorbed on the metal nanoparticles and the adsorption strength is determined by the interaction between various bases of DNA and the nanoparticles. By changing the salt concentration, the difference between adsorption of various DNA strands on the nanoparticles can be specified. The results indicate that a key parameter in success of a sensing assay of DNA hybridization is the salt concentration which should be greater than a minimum threshold depending on the nanoparticles characteristics. We have also investigated the interaction mechanism between various DNA bases with the metal nanoparticles. For both gold and silver nanoparticles, adenine has the highest and thymine has the lowest attachment to the nanoparticles. From surface enhanced Raman spectroscopy (SERS) data of various bases in the presence of gold nanoparticles, the probable interaction points in the bases with the nanoparticles have been determined, which are mainly the nitrogen sites of these oligonucleotides. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  14. Regions of incompatibility in single-stranded DNA bacteriophages phi X174 and G4

    NARCIS (Netherlands)

    van der Avoort, H. G.; van der Ende, A.; van Arkel, G. A.; Weisbeek, P. J.

    1984-01-01

    The intracellular presence of a recombinant plasmid containing the intercistronic region between the genes H and A of bacteriophage phi X174 strongly inhibits the conversion of infecting single-stranded phi X DNA to parental replicative-form DNA. Also, transfection with single-stranded or

  15. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  16. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  17. Terahertz response of DNA oligonucleotides on the surface of silicon nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [Peter the Great Saint-Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, Saint Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E.; Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, Saint Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)

    2016-09-15

    The possibility of identifying DNA oligonucleotides deposited onto the region of the edge channels of silicon nanostructures is considered. The role of various THz (terahertz) radiation harmonics of silicon nanostructures in the resonance response of oligonucleotides is analyzed. In particular, this makes it possible to compare single-stranded 100- and 50-mer DNA oligonucleotides. A technique for the rapid identification of different oligonucleotides by measuring changes in the conductance and transverse potential difference of silicon nanostructures with microcavities, embedded in the edge channels for selecting THz radiation characteristics, is proposed.

  18. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  20. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin.

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-13

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecule, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G • U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G • U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  1. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  2. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  3. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  4. Screening for Breast Cancer Using Near-Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2003-01-01

    .... In this study, we have successfully developed a new infrared method for the detection in a single strand of hair the presence of lipid deposits that were the putative cause of the observed x-ray patterns...

  5. Single slit interference made easy with a strand of hair and a laser

    Science.gov (United States)

    Messer, Rebecca

    2018-01-01

    Students can easily measure the width of a strand of their own hair with a monochromatic light source such as a laser. This inexpensive activity engages students in an application of single slit diffraction using Babinet's principle.

  6. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.

    OpenAIRE

    Barany, F; Boeke, J D

    1983-01-01

    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  7. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  8. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  9. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2016-01-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  10. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  11. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections...

  12. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  13. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  14. Antisense Oligonucleotide-Based Therapy for Neuromuscular Disease

    Directory of Open Access Journals (Sweden)

    Valentina Sardone

    2017-04-01

    Full Text Available Neuromuscular disorders such as Duchenne Muscular Dystrophy and Spinal Muscular Atrophy are neurodegenerative genetic diseases characterized primarily by muscle weakness and wasting. Until recently there were no effective therapies for these conditions, but antisense oligonucleotides, a new class of synthetic single stranded molecules of nucleic acids, have demonstrated promising experimental results and are at different stages of regulatory approval. The antisense oligonucleotides can modulate the protein expression via targeting hnRNAs or mRNAs and inducing interference with splicing, mRNA degradation, or arrest of translation, finally, resulting in rescue or reduction of the target protein expression. Different classes of antisense oligonucleotides are being tested in several clinical trials, and limitations of their clinical efficacy and toxicity have been reported for some of these compounds, while more encouraging results have supported the development of others. New generation antisense oligonucleotides are also being tested in preclinical models together with specific delivery systems that could allow some of the limitations of current antisense oligonucleotides to be overcome, to improve the cell penetration, to achieve more robust target engagement, and hopefully also be associated with acceptable toxicity. This review article describes the chemical properties and molecular mechanisms of action of the antisense oligonucleotides and the therapeutic implications these compounds have in neuromuscular diseases. Current strategies and carrier systems available for the oligonucleotides delivery will be also described to provide an overview on the past, present and future of these appealing molecules.

  15. Dynamics of RecA filaments on single-stranded DNA

    NARCIS (Netherlands)

    Van Loenhout, M.T.J.; Van der Heijden, T.; Kanaar, R.; Wyman, C.; Dekker, C.

    2009-01-01

    RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on

  16. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    NARCIS (Netherlands)

    A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)

    2013-01-01

    textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the

  17. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  18. Genetic heterogeneity of glucose-6-phosphate dehydrogenase deficiency revealed by single-strand conformation and sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Calabro, V.; Mason, P.J.; Luzzatto, L. (Hammersmith Hospital, London (United Kingdom)); Filosa, S.; Martini, G. (CNR, Naples (Italy)); Civitelli, D.; Cittadella, R.; Brancati, C. (CNR, Cosenza (Italy))

    1993-03-01

    The authors have carried out a systematic study of the molecular basis of glucose-6-phosphate dehydrogenase (G6PD) deficiency on a sample of 53 male subjects from Calabria, in southern Italy. Their sequential approach consisted of the following steps: (1) Partial biochemical characterization was used to pinpoint candidate known variants. The identity of these was then varified by restriction-enzyme or allele-specific oligonucleotide hybridization analysis of the appropriate PCR-amplified fragment. (2) On samples for which there was no obvious candidate mutation, they proceeded to amplify the entire coding region in eight fragments, followed by single-strand conformation polymorphism (SSCP) analysis of each fragment. (3) The next step was M13 phage cloning and sequencing of those individual fragments that were found to be abnormal by SSCP. Through this approach they have identified the molecular lesion in 51 of the 53 samples. In these they found a total of nine different G6PD-deficient variants, five of which (G6PD Mediterranean, G6PD A[sup [minus

  19. Stretching and controlled motion of single-stranded DNA in locally heated solid-state nanopores.

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B; Aksimentiev, Aleksei

    2013-08-27

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4-8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA.

  20. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

    1990-01-01

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  1. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  2. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  3. Laser ablation MC-ICPMS to study longitudinal stable isotopic variations in single human hair strands

    International Nuclear Information System (INIS)

    Santamaria-Fernandez, R.; Hearn, R.; Giner Martinez-Sierra, J.

    2009-01-01

    Full text: There is a need for novel approaches to measure stable isotopic variations in human tissues to provide information regarding the geographical origin and lifestyle of individuals. In this work, a method for the measurement of longitudinal sulfur isotopic variations in single hair strands has been developed. The method validation, uncertainty evaluation, in-house characterization of a horse hair sample and the potential of the method as a forensic tool to obtain information from single hair strands will be discussed. In addition, a new method for carbon isotope ratio measurements by MC-ICPMS has been developed and results will be presented. (author)

  4. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Petrov, S.I.

    1981-01-01

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  5. Characterization of a mitochondrially targeted single-stranded DNA-binding protein in Arabidopsis thaliana.

    Science.gov (United States)

    Edmondson, Andrew C; Song, Daqing; Alvarez, Luis A; Wall, Melisa K; Almond, David; McClellan, David A; Maxwell, Anthony; Nielsen, Brent L

    2005-04-01

    A gene encoding a predicted mitochondrially targeted single-stranded DNA binding protein (mtSSB) was identified in the Arabidopsis thaliana genome sequence. This gene (At4g11060) codes for a protein of 201 amino acids, including a 28-residue putative mitochondrial targeting transit peptide. Protein sequence alignment shows high similarity between the mtSSB protein and single-stranded DNA binding proteins (SSB) from bacteria, including residues conserved for SSB function. Phylogenetic analysis indicates a close relationship between this protein and other mitochondrially targeted SSB proteins. The predicted targeting sequence was fused with the GFP coding region, and the organellar localization of the expressed fusion protein was determined. Specific targeting to mitochondria was observed in in-vitro import experiments and by transient expression of a GFP fusion construct in Arabidopsis leaves after microprojectile bombardment. The mature mtSSB coding region was overexpressed in Escherichia coli and the protein was purified for biochemical characterization. The purified protein binds single-stranded, but not double-stranded, DNA. MtSSB stimulates the homologous strand-exchange activity of E. coli RecA. These results indicate that mtSSB is a functional homologue of the E. coli SSB, and that it may play a role in mitochondrial DNA recombination.

  6. Optimizing the design of oligonucleotides for homology directed gene targeting.

    Science.gov (United States)

    Miné-Hattab, Judith; Fleury, Geneviève; Prevost, Chantal; Dutreix, Marie; Viovy, Jean-Louis

    2011-04-05

    Gene targeting depends on the ability of cells to use homologous recombination to integrate exogenous DNA into their own genome. A robust mechanistic model of homologous recombination is necessary to fully exploit gene targeting for therapeutic benefit. In this work, our recently developed numerical simulation model for homology search is employed to develop rules for the design of oligonucleotides used in gene targeting. A Metropolis Monte-Carlo algorithm is used to predict the pairing dynamics of an oligonucleotide with the target double-stranded DNA. The model calculates the base-alignment between a long, target double-stranded DNA and a probe nucleoprotein filament comprised of homologous recombination proteins (Rad51 or RecA) polymerized on a single strand DNA. In this study, we considered different sizes of oligonucleotides containing 1 or 3 base heterologies with the target; different positions on the probe were tested to investigate the effect of the mismatch position on the pairing dynamics and stability. We show that the optimal design is a compromise between the mean time to reach a perfect alignment between the two molecules and the stability of the complex. A single heterology can be placed anywhere without significantly affecting the stability of the triplex. In the case of three consecutive heterologies, our modeling recommends using long oligonucleotides (at least 35 bases) in which the heterologous sequences are positioned at an intermediate position. Oligonucleotides should not contain more than 10% consecutive heterologies to guarantee a stable pairing with the target dsDNA. Theoretical modeling cannot replace experiments, but we believe that our model can considerably accelerate optimization of oligonucleotides for gene therapy by predicting their pairing dynamics with the target dsDNA.

  7. Optimizing the design of oligonucleotides for homology directed gene targeting.

    Directory of Open Access Journals (Sweden)

    Judith Miné-Hattab

    Full Text Available BACKGROUND: Gene targeting depends on the ability of cells to use homologous recombination to integrate exogenous DNA into their own genome. A robust mechanistic model of homologous recombination is necessary to fully exploit gene targeting for therapeutic benefit. METHODOLOGY/PRINCIPAL FINDINGS: In this work, our recently developed numerical simulation model for homology search is employed to develop rules for the design of oligonucleotides used in gene targeting. A Metropolis Monte-Carlo algorithm is used to predict the pairing dynamics of an oligonucleotide with the target double-stranded DNA. The model calculates the base-alignment between a long, target double-stranded DNA and a probe nucleoprotein filament comprised of homologous recombination proteins (Rad51 or RecA polymerized on a single strand DNA. In this study, we considered different sizes of oligonucleotides containing 1 or 3 base heterologies with the target; different positions on the probe were tested to investigate the effect of the mismatch position on the pairing dynamics and stability. We show that the optimal design is a compromise between the mean time to reach a perfect alignment between the two molecules and the stability of the complex. CONCLUSION AND SIGNIFICANCE: A single heterology can be placed anywhere without significantly affecting the stability of the triplex. In the case of three consecutive heterologies, our modeling recommends using long oligonucleotides (at least 35 bases in which the heterologous sequences are positioned at an intermediate position. Oligonucleotides should not contain more than 10% consecutive heterologies to guarantee a stable pairing with the target dsDNA. Theoretical modeling cannot replace experiments, but we believe that our model can considerably accelerate optimization of oligonucleotides for gene therapy by predicting their pairing dynamics with the target dsDNA.

  8. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  9. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  10. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    Bacteriophage P1 encodes a single-stranded DNA-binding protein (SSB-P1), which shows 66% amino acid sequence identity to the SSB protein of the host bacterium Escherichia coli. A phylogenetic analysis indicated that the P1 ssb gene coexists with its E. coli counterpart as an independent unit...

  11. Ion assisted structural collapse of a single stranded DNA: A molecular dynamics approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Soumadwip; Dixit, Himanshu; Chakrabarti, Rajarshi, E-mail: rajarshi@chem.iitb.ac.in

    2015-09-28

    Highlights: • The dynamics of a single-stranded DNA in presence of different concentrations of Mg{sup 2+} is investigated. • The initial DNA chain collapse is characterized by the formation of non-sequentially stacked base pairs. • The DNA chain re-swells at high concentrations of Mg{sup 2+} as a consequence of overcharging. - Abstract: The structure and dynamics of negatively charged nucleic acids strongly correlate with the concentration and charge of the oppositely charged counterions. It is well known that the structural collapse of DNA is favoured in the presence of additional salt, a source of excess oppositely charged ions. Under such conditions single stranded DNA adopts a collapsed coil like conformation, typically characterized by stacking base pairs. Using atomistic molecular dynamics simulation, we demonstrate that in the presence of additional divalent salt (MgCl{sub 2}) single stranded DNA with base sequence 5′-CGCGAATTCGCG-3′ (Dickerson Drew dodecamer) initially collapses and then expands with increasing salt concentration. This is due to the overcharging induced DNA chain swelling, a dominant factor at a higher divalent salt concentration. In a nutshell, our simulations show how in the presence of divalent salt, non-sequential base stacking and overcharging competes and affect single stranded DNA dynamics unlike a monovalent salt.

  12. Screening for Breast Cancer Using Near Field Infrared Spectroscopy of a Single Strand of Hair

    National Research Council Canada - National Science Library

    Erramilli, Shyamsunder

    2001-01-01

    ... predisposition to breast cancer because of the breast of a mutation of the BRCA1 gene. We would like to develop a new method for the screening of breast cancer based on infrared spectroscopy of a single strand of human hair...

  13. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  14. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket.

    Science.gov (United States)

    Pham, Hanh T; Bergoin, Max; Tijssen, Peter

    2013-03-14

    The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  15. Acheta domesticus Volvovirus, a Novel Single-Stranded Circular DNA Virus of the House Cricket

    OpenAIRE

    Pham, Hanh T.; Bergoin, Max; Tijssen, Peter

    2013-01-01

    International audience; The genome of a novel virus of the house cricket consists of a 2,517-nucleotide (nt) circular single-stranded DNA (ssDNA) molecule with 4 open reading frames (ORFs). One ORF had a low identity to circovirus nucleotide sequences (NS). The unique properties of this volvovirus suggested that it belongs to a new virus family or genus.

  16. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    by kinase YwqD and phosphatase YwqE. Phosphorylation of B.subtilis SSB increased binding almost 200-fold to single-stranded DNA in vitro. Tyrosine phosphorylation of B.subtilis, S.coelicolor and Escherichia coli SSBs occured while they were expressed in E.coli, indicating that tyrosine phosphorylation...

  17. Efficient Skipping of Single Exon Duplications in DMD Patient-Derived Cell Lines Using an Antisense Oligonucleotide Approach.

    Science.gov (United States)

    Wein, Nicolas; Vulin, Adeline; Findlay, Andrew R; Gumienny, Felecia; Huang, Nianyuan; Wilton, Steve D; Flanigan, Kevin M

    2017-01-01

    Exon skipping strategies in Duchenne muscular dystrophy (DMD) have largely been directed toward altering splicing of exons flanking out-of-frame deletions, with the goal of restoring an open mRNA reading frame that leads to production of an internally deleted but partially functional dystrophin protein. We sought to apply exon skipping to duplication mutations, assuming that the inherently limited efficiency of antisense oligonucleotide-induced exon skipping would more frequently skip a single copy of a duplicated exon, rather than both and result in significant amounts of wild-type DMD mRNA. We tested this hypothesis in fibroblast cell lines derived from patients with a variety of single or multiple exon duplications that have been modified to allow transdifferentiation into a myogenic lineage. Using a variety of 2'O-methyl antisense oligonucleotides, significant skipping was induced for each duplication leading to a wild-type transcript as a major mRNA product. This study provides another proof of concept for the feasibility of therapeutic skipping in patients carrying exon duplications in order to express wild-type, full-length mRNA, although careful evaluation of the skipping efficiency should be performed as some exons are easier to skip than others. Such a personalized strategy is expected to be highly beneficial for this subset of DMD patients, compared to inducing expression of an internally-deleted dystrophin.

  18. Repair of ultraviolet light damage in Saccharomyces cerevisiae as studied with double- and single-stranded incoming DNAs

    International Nuclear Information System (INIS)

    Keszenman-Pereyra, D.; Hieda, K.

    1992-01-01

    Purified double- and single-stranded DNAs of the autonomously replicating vector M13RK9-T were irradiated with ultraviolet light (UV) in vitro and introduced into competent whole cells of Saccharomyces cerevisiae. Incoming double-stranded DNA was more sensitive to UV in excision repair-deficient rad2-1 cells than in proficient repair RAD + cells, while single-stranded DNA exhibited high sensitivity in both host cells. The results indicate that in yeast there is no effective rescue of UV-incoming single-stranded DNA by excision repair or other constitutive dark repair processes

  19. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  20. Electrical conduction and photoresponses of gamma-ray-irradiated single-stranded DNA/single-walled carbon nanotube composite systems

    Energy Technology Data Exchange (ETDEWEB)

    Hong, W.; Lee, E.M.; Kim, D.W.; Lee, Cheol Eui, E-mail: rscel@korea.ac.kr

    2015-04-15

    Highlights: •Effects of gamma-ray irradiation on single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. •Barrier for thermally activated conduction in the composite systems modified by the gamma-ray irradiation. •Photoresponses reveal photoexcitation and oxygen photodesorption modified by gamma-ray irradiation. -- Abstract: Effects of gamma-ray irradiation on the electrical conductivity and photoresponse have been studied for single-stranded DNA (ssDNA)/single-walled carbon nanotube (SWNT) composite films. The temperature-dependent electrical conductivity of the ssDNA/SWNT composite films, well described by a fluctuation-induced tunneling model, indicated modification of the barrier for thermally activated conduction by the gamma-ray irradiation. Besides, the photoresponse measurements indicated modified photoexcited charge carrier generation and oxygen photodesorption in the composite systems due to the gamma-ray irradiation.

  1. Evidence that single-stranded DNA breaks are a normal feature of koala sperm chromatin, while double-stranded DNA breaks are indicative of DNA damage.

    Science.gov (United States)

    Zee, Yeng Peng; López-Fernández, Carmen; Arroyo, F; Johnston, Stephen D; Holt, William V; Gosalvez, Jaime

    2009-08-01

    In this study, we have used single and double comet assays to differentiate between single- and double-stranded DNA damage in an effort to refine the interpretation of DNA damage in mature koala spermatozoa. We have also investigated the likelihood that single-stranded DNA breakage is part of the natural spermiogenic process in koalas, where its function would be the generation of structural bends in the DNA molecule so that appropriate packaging and compaction can occur. Koala spermatozoa were examined using the sperm chromatin dispersion test (SCDt) and comet assays to investigate non-orthodox double-stranded DNA. Comet assays were conducted under 1) neutral conditions; and 2) neutral followed by alkaline conditions (double comet assay); the latter technique enabled simultaneous visualisation of both single-stranded and double-stranded DNA breaks. Following the SCDt, there was a continuum of nuclear morphotypes, ranging from no apparent DNA fragmentation to those with highly dispersed and degraded chromatin. Dispersion morphotypes were mirrored by a similar diversity of comet morphologies that could be further differentiated using the double comet assay. The majority of koala spermatozoa had nuclei with DNA abasic-like residues that produced single-tailed comets following the double comet assay. The ubiquity of these residues suggests that constitutive alkali-labile sites are part of the structural configuration of the koala sperm nucleus. Spermatozoa with 'true' DNA fragmentation exhibited a continuum of comet morphologies, ranging from a more severe form of alkaline-susceptible DNA with a diffuse single tail to nuclei that exhibited both single- and double-stranded breaks with two comet tails.

  2. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  3. Phage annealing proteins promote oligonucleotide-directed mutagenesis in Escherichia coli and mouse ES cells

    Directory of Open Access Journals (Sweden)

    Muyrers Joep PP

    2003-01-01

    Full Text Available Abstract Background The phage protein pairs, RecE/RecT from Rac or Redα/Redβ from λ, initiate efficient double strand break repair (DSBR in Escherichia coli that has proven very useful for DNA engineering. These phage pairs initiate DSBR either by annealing or by another mechanism that is not defined. Results Here we report that these proteins also mediate single strand oligonucleotide repair (ssOR at high efficiencies. The ssOR activity, unlike DSBR, does not require a phage exonuclease (RecE or Redα but only requires a phage annealing protein (RecT or Redβ. Notably, the P22 phage annealing protein Erf, which does not mediate the same DSBR reactions, also delivers ssOR activity. By altering aspects of the oligonucleotides, we document length and design parameters that affect ssOR efficiency to show a simple relationship to homologies either side of the repair site. Notably, ssOR shows strand bias. Oligonucleotides that can prime lagging strand replication deliver more ssOR than their leading complements. This suggests a model in which the annealing proteins hybridize the oligonucleotides to single stranded regions near the replication fork. We also show that ssOR is a highly efficient way to engineer BACs and can be detected in a eukaryotic cell upon expression of a phage annealing protein. Conclusion Phage annealing proteins can initiate the recombination of single stranded oligonucleotides into endogenous targets in Escherichia coli at very high efficiencies. This expands the repertoire of useful DNA engineering strategies, shows promise for applications in eukaryotic cells, and has implications for the unanswered questions regarding DSBR mediated by RecE/RecT and Redα/Redβ.

  4. Sites of termination of in vitro DNA synthesis on psoralen phototreated single-stranded templates

    International Nuclear Information System (INIS)

    Piette, J.; Hearst, J.

    1985-01-01

    Single-stranded DNA has been photochemically induced to react with 4'-hydroxymethyl-4,5',8-trimethylpsoralen (HMT) and used as substrate for DNA replication with E. coli DNA polymerase I large fragment. By using the dideoxy sequencing procedure, it is possible to map the termination sites on the template photoreacted with HMT. These sites occur at the nucleotides preceding each thymine residue (and a few cytosine residues), emphasizing the fact that in a single-stranded stretch of DNA, HMT reacts with each thymine residue without any specificity regarding the flanking base sequence of the thymine residues. In addition, termination of DNA synthesis due to psoralen-adducted thymine is not influenced by the efficiency of the 3'-5' exonuclease proof-reading activity of the DNA polymerase. (author)

  5. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Leonard, J.C.; Merz, T.

    1982-01-01

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  6. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    Science.gov (United States)

    Hong, Ka Lok

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  7. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    OpenAIRE

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen...

  8. Biophysical characterization of the association of histones with single-stranded DNA.

    Science.gov (United States)

    Wang, Ying; van Merwyk, Luis; Tönsing, Katja; Walhorn, Volker; Anselmetti, Dario; Fernàndez-Busquets, Xavier

    2017-11-01

    Despite the profound current knowledge of the architecture and dynamics of nucleosomes, little is known about the structures generated by the interaction of histones with single-stranded DNA (ssDNA), which is widely present during replication and transcription. Non-denaturing gel electrophoresis, transmission electron microscopy, atomic force microscopy, magnetic tweezers. Histones have a high affinity for ssDNA in 0.15M NaCl ionic strength, with an apparent binding constant similar to that calculated for their association with double-stranded DNA (dsDNA). The length of DNA (number of nucleotides in ssDNA or base pairs in dsDNA) associated with a fixed core histone mass is the same for both ssDNA and dsDNA. Although histone-ssDNA complexes show a high tendency to aggregate, nucleosome-like structures are formed at physiological salt concentrations. Core histones are able to protect ssDNA from digestion by micrococcal nuclease, and a shortening of ssDNA occurs upon its interaction with histones. The purified (+) strand of a cloned DNA fragment of nucleosomal origin has a higher affinity for histones than the purified complementary (-) strand. At physiological ionic strength histones have high affinity for ssDNA, possibly associating with it into nucleosome-like structures. In the cell nucleus histones may spontaneously interact with ssDNA to facilitate their participation in the replication and transcription of chromatin. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Two highly thermostable paralogous single-stranded DNA-binding proteins from Thermoanaerobacter tengcongensis.

    Science.gov (United States)

    Olszewski, Marcin; Mickiewicz, Małgorzata; Kur, Józef

    2008-07-01

    The thermophilic bacterium Thermoanaerobacter tengcongensis has two single-stranded DNA-binding (SSB) proteins, designated TteSSB2 and TteSSB3. In a SSB complementation assay in Escherichia coli, only TteSSB3 took over the in vivo function of EcoSSB. We have cloned the ssb genes obtained by PCR and have developed E. coli overexpression systems. The TteSSB2 and TteSSB3 consist of 153 and 150 amino acids with a calculated molecular mass of 17.29 and 16.96 kDa, respectively. They are the smallest known bacterial SSB proteins. The homology between amino acid sequences of these proteins is 40% identity and 53% similarity. They are functional as homotetramers, with each monomer encoding one single-stranded DNA binding domain (OB-fold). In fluorescence titrations with poly(dT), both proteins bind single-stranded DNA with a binding site size of about 40 nt per homotetramer. Thermostability with half-life of about 30 s at 95 degrees C makes TteSSB3 similar to the known SSB of Thermus aquaticus (TaqSSB). The TteSSB2 was fully active even after 6 h incubation at 100 degrees C. Here, we show for the first time paralogous thermostable homotetrameric SSBs, which could be an attractive alternative for known homodimeric thermostable SSB proteins in their applications for molecular biology methods and analytical purposes.

  10. The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

    Science.gov (United States)

    Richardson, Tomas T; Harran, Omar; Murray, Heath

    2016-06-16

    DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

  11. A neutral glyoxal gel electrophoresis method for the detection and semi-quantitation of DNA single-strand breaks.

    Science.gov (United States)

    Pachkowski, Brian; Nakamura, Jun

    2013-01-01

    Single-strand breaks are among the most prevalent lesions found in DNA. Traditional electrophoretic methods (e.g., the Comet assay) used for investigating these lesions rely on alkaline conditions to denature DNA prior to electrophoresis. However, the presence of alkali-labile sites in DNA can result in the introduction of additional single-strand breaks upon alkali treatment during DNA sample processing. Herein, we describe a neutral glyoxal gel electrophoresis assay which is based on alkali-free DNA denaturation and is suitable for qualitative and semi-quantitative analyses of single-strand breaks in DNA isolated from different organisms.

  12. Developing single-molecule TPM experiments for direct observation of successful RecA-mediated strand exchange reaction.

    Science.gov (United States)

    Fan, Hsiu-Fang; Cox, Michael M; Li, Hung-Wen

    2011-01-01

    RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5'-to-3' fashion, using a synapse segment with a wide and continuous size distribution.

  13. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    DEFF Research Database (Denmark)

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager

    2016-01-01

    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split......The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts...

  14. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    Science.gov (United States)

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Functionalization of PVC membrane with ss oligonucleotides for a potentiometric biosensor.

    Science.gov (United States)

    Shishkanova, T V; Volf, R; Krondak, M; Král, V

    2007-05-15

    A novel application of a single stranded (ss) oligonucleotide as an active component of polymeric membrane in an ion-selective electrode (ISE) is described. The original oligonucleotides, oligo(dA)(15), modified by cholesterol, triphenylmethyl and hexadecyl derivatives, were immobilized into poly(vinyl chloride) (PVC) membrane using extraction protocol. In parallel, the adsorption protocol was used to immobilize unmodified oligo(dA)(15) on the PVC membrane based on tridodecylmethyammonium chloride (TDDMA(+)Cl(-)). Immobilization of ss oligonucleotide probe through spacer was more effective for the potentiometric detection of the hybridization between complementary oligonucleotides. It was found that cholesterol-oligo(dA)(15) modified membranes were sensitive toward complementary oligo(dT)(15) in the concentration range 2-80 nM at pH 7. An explanation for the detection mechanism is proposed.

  16. Human topoisomerase IIIalpha is a single-stranded DNA decatenase that is stimulated by BLM and RMI1

    DEFF Research Database (Denmark)

    Yang, Jay; Bachrati, Csanad Z; Ou, Jiongwen

    2010-01-01

    -passage mechanism. We generated single-stranded catenanes that resemble the proposed dissolution intermediate recognized by human topoisomerase IIIalpha. We demonstrate that human topoisomerase IIIalpha is a single-stranded DNA decatenase that is specifically stimulated by the BLM-RMI1 pair. In addition, RMI1......Human topoisomerase IIIalpha is a type IA DNA topoisomerase that functions with BLM and RMI1 to resolve DNA replication and recombination intermediates. BLM, human topoisomerase IIIalpha, and RMI1 catalyze the dissolution of double Holliday junctions into noncrossover products via a strand...

  17. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  18. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  19. Radiobiological study on DNA strand breaks and repair using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Ikushima, Takaji

    1994-01-01

    Single cell gel electrophoresis (SCGE) provides a novel method to measure DNA damage in individual cells and more importantly, to assess heterogeneity in response within a mixed population of cells. Cells embedded in agarose are lysed, subjected to electrophoresis, stained with a fluorescent DNA-specific dye, and viewed under a fluorescence microscope. Damaged cells display 'comets', broken DNA migrating farther to the anode in the electric field. We have previously used this technique to quantify DNA damage induced by moderate doses of low and high LET radiations in cultured Chinese hamster cells. The assay has been optimized in terms of lysing and electrophoresis conditions, and applied to analyse the DNA strand breaks, their repair kinetics and heterogeneity in response in individual Chinese hamster cells exposed to gamma-rays, and to KUR thermal neutrons with and without 10 B or to KEK PF monochromatic soft X-rays as well as to a radio-mimetic agent, neocarzinostatin. The DNA double-strand breaks induced by boron-neutron captured reactions were repaired at a slower rate, but a heterogeneity in response might not contribute to the difference. The neocarzinostatin-induced DNA damage were efficiently repaired in a dose-dependent fashion. The initial amount of gamma-ray induced DNA double-strand breaks was not significantly altered in cells pre-exposed to very low adapting dose. (author)

  20. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  1. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  2. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  3. Pharmacokinetics and Toxicity in Rats and Monkeys of coDbait: A Therapeutic Double-stranded DNA Oligonucleotide Conjugated to Cholesterol

    Directory of Open Access Journals (Sweden)

    Anne Schlegel

    2012-01-01

    Full Text Available Increased DNA repair activity in cancer cells is one of their primary mechanisms of resistance to current radio- and chemotherapies. The molecule coDbait is the first candidate in a new class of drugs that target the double-strand DNA break repair pathways with the aim of overcoming these resistances. coDbait is a 32-base pair (bp double-stranded DNA molecule with a cholesterol moiety covalently attached to its 5′-end to facilitate its cellular uptake. We report here the preclinical pharmacokinetic and toxicology studies of subcutaneous coDbait administration in rodents and monkeys. Maximum plasma concentration occurred between 2 to 4 hours in rats and at 4 hours in monkeys. Increase in mean AUC0–24h was linear with dose reaching 0.5 mg·h/ml for the highest dose injected (32 mg for both rats and monkeys. No sex-related differences in maximum concentration (Cmax nor AUC0–24h were observed. We extrapolated these pharmacokinetic results to humans as the subcutaneous route has been selected for evaluation in clinical trials. Tri-weekly administration of coDbait (from 8 to 32 mg per dose for 4 weeks was overall well tolerated in rats and monkeys as no morbidity/mortality nor changes in clinical chemistry and histopathology parameters considered to be adverse effects have been observed.

  4. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    . We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices......Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells...

  5. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    a principal component analysis of the CD spectra, we extract fingerprint spectra of both the cyclobutane pyrimidine dimer (CPD) and the pyrimidine (6-4) pyrimidone photoadduct (64PP). Extending the CD measurements to the vacuum ultraviolet region in combination with systematic examinations of size effects...... of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer...

  6. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  7. Single-strand-conformation polymorphism of ribosomal DNA for rapid species differentiation in genus Phytophthora.

    Science.gov (United States)

    Kong, Ping; Hong, Chuanxue; Richardson, Patricia A; Gallegly, Mannon E

    2003-08-01

    Single-strand-conformation polymorphism (SSCP) of ribosomal DNA of 29 species (282 isolates) of Phytophthora was characterized in this study. Phytophthora boehmeriae, Phytophthora botryosa, Phytophthora cactorum, Phytophthora cambivora, Phytophthora capsici, Phytophthora cinnamomi, Phytophthora colocasiae, Phytophthora fragariae, Phytophthora heveae, Phytophthora hibernalis, Phytophthora ilicis, Phytophthora infestans, Phytophthora katsurae, Phytophthora lateralis, Phytophthora meadii, Phytophthora medicaginis, Phytophthora megakarya, Phytophthora nicotianae, Phytophthora palmivora, Phytophthora phaseoli, Phytophthora pseudotsugae, Phytophthora sojae, Phytophthora syringae, and Phytophthora tropicalis each showed a unique SSCP pattern. Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, and Phytophthora megasperma each had more than one distinct pattern. A single-stranded DNA ladder also was developed, which facilitates comparison of SSCP patterns within and between gels. With a single DNA fingerprint, 277 isolates of Phytophthora recovered from irrigation water and plant tissues in Virginia were all correctly identified into eight species at substantially reduced time, labor, and cost. The SSCP analysis presented in this work will aid in studies on taxonomy, genetics, and ecology of the genus Phytophthora.

  8. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  9. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  10. Quenching of Single-Walled Carbon Nanotube Fluorescence by Dissolved Oxygen Reveals Selective Single-Stranded DNA Affinities.

    Science.gov (United States)

    Zheng, Yu; Bachilo, Sergei M; Weisman, R Bruce

    2017-05-04

    The selective interactions between short oligomers of single-stranded DNA (ssDNA) and specific structures of single-walled carbon nanotubes have been exploited in powerful methods for nanotube sorting. We report here that nanotubes coated with ssDNA also display selective interactions through the selective quenching of nanotube fluorescence by dissolved oxygen. In aqueous solutions equilibrated under 1 atm of O 2 , emission intensity from semiconducting nanotubes is reduced by between 9 and 40%, varying with the combination of ssDNA sequence and nanotube structure. This quenching reverses promptly and completely on the removal of dissolved O 2 and may be due to physisorption on nanotube surfaces. Fluorescence quenching offers a simple, nondestructive approach for studying the structure-selective interactions of ssDNA with single-walled carbon nanotubes and identifying recognition sequences.

  11. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  12. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  13. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  15. Zinc(II) and the single-stranded DNA binding protein of bacteriophage T4

    International Nuclear Information System (INIS)

    Gauss, P.; Krassa, K.B.; McPheeters, D.S.; Nelson, M.A.; Gold, L.

    1987-01-01

    The DNA binding domain of the gene 32 protein of the bacteriophage T4 contains a single zinc-finger sequence. The gene 32 protein is an extensively studied member of a class of proteins that bind relatively nonspecifically to single-stranded DNA. The authors have sequenced and characterized mutations in gene 32 whose defective proteins are activated by increasing the Zn(II) concentration in the growth medium. The results identify a role for the gene 32 protein in activation of T4 late transcription. Several eukaryotic proteins with zinc fingers participate in activation of transcription, and the gene 32 protein of T4 should provide a simple, well-characterized system in which genetics can be utilized to study the role of a zinc finger in nucleic acid binding and gene expression

  16. The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks.

    Science.gov (United States)

    Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J

    2013-06-27

    Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  17. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Alessia Balestrini

    2013-06-01

    Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.

  18. A single-strand specific lesion drives MMS-induced hyper-mutability at a double-strand break in yeast.

    Science.gov (United States)

    Yang, Yong; Gordenin, Dmitry A; Resnick, Michael A

    2010-08-05

    Localized hyper-mutability (LHM) can be important in evolution, immunity, and genetic diseases. We previously reported that single-strand DNA (ssDNA) can be an important source of damage-induced LHM in yeast. Here, we establish that the generation of LHM by methyl methanesulfonate (MMS) during repair of a chromosomal double-strand break (DSB) can result in over 0.2 mutations/kb, which is approximately 20,000-fold higher than the MMS-induced mutation density without a DSB. The MMS-induced mutations associated with DSB repair were primarily due to substitutions via translesion DNA synthesis at damaged cytosines, even though there are nearly 10 times more MMS-induced lesions at other bases. Based on this mutation bias, the promutagenic lesion dominating LHM is likely 3-methylcytosine, which is single-strand specific. Thus, the dramatic increase in mutagenesis at a DSB is concluded to result primarily from the generation of non-repairable lesions in ssDNA associated with DSB repair along with efficient induction of highly mutagenic ssDNA-specific lesions. These findings with MMS-induced LHM have broad biological implications for unrepaired damage generated in ssDNA and possibly ssRNA. Published by Elsevier B.V.

  19. Ion Density Analysis of Single-Stranded DNA in Liquid Crystal

    Science.gov (United States)

    Iwabata, Kazuki; Seki, Yasutaka; Toizumi, Ryota; Shimada, Yuki; Furue, Hirokazu; Sakaguchi, Kengo

    2013-09-01

    With the widespread use of liquid crystals (LCs) in liquid crystal displays, we have looked into the application of liquid crystals in biotechnology. The purpose of the study described here is to investigate the physical properties of DNA using LCs. Synthetic oligonucleotide molecules were dispersed in MLC6884, the sample injected into antiparallel cells, and the amount of mobile ions was measured. The LC cell doped with oligonucleotide molecules showed a sequence-dependent, specific correlation between oligonucleotide concentration and the amount of mobile ions in the LC cells. In the framework of the Stokes model and polyacrylamide gel electrophoresis (PAGE) analysis, we speculate that this result arises from the difference in ion mobility, which is caused by the shape of the oligonucleotide molecule in the LC.

  20. 1H NMR determination of base-pair lifetimes in oligonucleotides containing single base mismatches.

    Science.gov (United States)

    Bhattacharya, Pratip K; Cha, Julie; Barton, Jacqueline K

    2002-11-01

    Proton nuclear magnetic resonance (NMR) spectroscopy is employed to characterize the kinetics of base-pair opening in a series of 9mer duplexes containing different single base mismatches. The imino protons from the different mismatched, as well as fully matched, duplexes are assigned from the imino-imino region in the WATERGATE NOESY spectra. The exchange kinetics of the imino protons are measured from selective longitudinal relaxation times. In the limit of infinite exchange catalyst concentration, the exchange times of the mismatch imino protons extrapolate to much shorter lifetimes than are commonly observed for an isolated GC base pair. Different mismatches exhibit different orders of base-pair lifetimes, e.g. a TT mismatch has a shorter base-pair lifetime than a GG mismatch. The effect of the mismatch was observed up to a distance of two neighboring base pairs. This indicates that disruption in the duplex caused by the mismatch is quite localized. The overall order of base-pair lifetimes in the selected sequence context of the base pair is GC > GG > AA > CC > AT > TT. Interestingly, the fully matched AT base pair has a shorter base-pair lifetime relative to many of the mismatches. Thus, in any given base pair, the exchange lifetime can exhibit a strong dependence on sequence context. These findings may be relevant to the way mismatch recognition is accomplished by proteins and small molecules.

  1. Empirical model for matching spectrophotometric reflectance of yarn windings and multispectral imaging reflectance of single strands of yarns.

    Science.gov (United States)

    Luo, Lin; Shen, Hui-Liang; Shao, Si-Jie; Xin, John

    2015-08-01

    The state-of-the-art multispectral imaging system can directly acquire the reflectance of a single strand of yarn that is impossible for traditional spectrophotometers. Instead, the spectrophotometric reflectance of a yarn winding, which is constituted by yarns wound on a background card, is regarded as the yarn reflectance in textile. While multispectral imaging systems and spectrophotometers can be separately used to acquire the reflectance of a single strand of yarn and corresponding yarn winding, the quantitative relationship between them is not yet known. In this paper, the relationship is established based on models that describe the spectral response of a spectrophotometer to a yarn winding and that of a multispectral imaging system to a single strand of yarn. The reflectance matching function from a single strand of yarn to corresponding yarn winding is derived to be a second degree polynomial function, which coefficients are the solutions of a constrained nonlinear optimization problem. Experiments on 100 pairs of samples show that the proposed approach can reduce the color difference between yarn windings and single strands of yarns from 2.449 to 1.082 CIEDE2000 units. The coefficients of the optimal reflection matching function imply that the reflectance of a yarn winding measured by a spectrophotometer consists of not only the intrinsic reflectance of yarn but also the nonignorable interreflection component between yarns.

  2. Substrate-assisted 2D DNA lattices and algorithmic lattices from single-stranded tiles.

    Science.gov (United States)

    Kim, Junghoon; Ha, Tai Hwan; Park, Sung Ha

    2015-08-07

    We present a simple route to circumvent kinetic traps which affect many types of DNA nanostructures in their self-assembly process. Using this method, a new 2D DNA lattice made up of short, single-stranded tile (SST) motifs was created. Previously, the growth of SST DNA assemblies was restricted to 1D (tubes and ribbons) or finite-sized 2D (molecular canvases). By utilizing the substrate-assisted growth method, sets of SSTs were designed as unit cells to self-assemble into periodic and aperiodic 2D lattices which continuously grow both along and orthogonal to the helical axis. Notably, large-scale (∼1 μm(2)) fully periodic 2D lattices were fabricated using a minimum of just 2 strand species. Furthermore, the ability to create 2D lattices from a few motifs enables certain rules to be encoded into these SSTs to carry out algorithmic self-assembly. A set of these motifs was designed to execute simple 1-input 1-output COPY and NOT algorithms, the space-time manifestations which were aperiodic 2D algorithmic SST lattices. The methodology presented here can be straightforwardly applied to other motifs which fall into this type of kinetic trap to create novel DNA crystals.

  3. Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages.

    Science.gov (United States)

    Kodaira, K; Godson, N G; Taketo, A

    1995-01-25

    The minus origins for complementary strand DNA synthesis (-ori) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, phi K, alpha 3, and St-1 closely resemble each other in DNA structure and contain two potential secondary hairpin loops (I and II) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the -ori regions of phi K and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the phi K mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several phi K and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway.

  4. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    Science.gov (United States)

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  5. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  6. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  7. The effects of radioprotective agents on the radiation-induced DNA single strand breaks

    International Nuclear Information System (INIS)

    Rhiu, Sung Ryul; Ko, Kyung Hwan; Jung, In Yong; Cho, Chul Ku; Kim, Tae Hwan; Park, Woo Wiun; Kim, Sung Ho; Ji, Young Hoon; Kim, Kyung Jung; Bang, Hio Chang; Jung, Young Suk; Choi, Moon Sik

    1992-04-01

    With the increased use of atomic energy in science, industry, medicine and public power production, the probability of nuclear accidents certainly appears to be on the increase. Therefore, early medical diagnosis and first-aid are needed urgently to establish an efficient treatment. We carried out the studies of radiation protector such as DDC, MEA, WR-2721 and variety of decontaminator with a view to establishing the protective measure and diagnostic standards for safety of worker and neighbors living around the radiation area in case of occurring the accidental contamination. In this experiment, we examined radiation-induced DNA single strand breaks as one of the study on molecular biology of the response of cells to radiation because an understanding of the radiation-induced damage in molecular level would add to our knowledge of radiation protection and treatment. (Author)

  8. Detection of antibodies to single-stranded DNA in naturally acquired and experimentally induced viral hepatitis

    Energy Technology Data Exchange (ETDEWEB)

    Gust, I.D.; Feinstone, S.M.; Purcell, R.H.; Alter, H.J.

    1980-01-01

    A sensitive ''Farr'' assay, utilizing /sup 125/I-labelled DNA was developed for detecting antibody to single-stranded DNA (anti-ssDNA). The test was shown to be specific and as sensitive as assays using /sup 14/C-labelled DNA, for the detection of antibody in patients with connective tissue diseases. Groups of sera from patients with naturally acquired viral hepatitis and experimentally infected chimpanzees were tested for anti-ssDNA by the /sup 125/I assay and by counterimmunoelectrophoresis (CIEP). No consistent pattern was observed with either technique, indicating the elevated levels of this antibody are not as reliable markers of parenchymal liver damage as had been previously suggested.

  9. Visualization of DNA Double-Strand Break Repair at the Single-Molecule Level

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S.; Li, Shuyi; Mernaugh, Raymond; Wragg, Stephanie; Takeda, Yoshihiko

    2003-03-27

    Exposure to low doses of ionizing radiation is universal. The signature injury from ionizing radiation exposure is induction of DNA double-strand breaks (DSBs). The first line of defense against DSBs is direct ligation of broken DNA ends via the nonhomologous end-joining pathway. Because even a relatively high environmental exposure induces only a few DSBs per cell, our current understanding of the response to this exposure is limited by the ability to measure DSB repair events reliably in situ at a single-molecule level. To address this need, we have taken advantage of biological amplification, measuring relocalization of proteins and detection of protein phosphorylation as a surrogate for detection of broken ends themselves. We describe the use of specific antibodies to investigate the kinetics and mechanism of repair of very small numbers of DSBs in human cells by the nonhomologous end-joining pathway.

  10. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata).

    Science.gov (United States)

    Jackson, Elliot W; Bistolas, Kalia S I; Button, Jason B; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates.

  11. Radioimmunoassay of single-stranded DNA antibodies for control of diagnosis and therapy

    International Nuclear Information System (INIS)

    Meffert, H.; Boehm, F.; Soennichsen, N.; Gens, J.

    1980-01-01

    Several years experience in quantitative determination of single-stranded DNA antibodies is reported and the normal range as well as the diagnostic hit rate of the method is outlined. In the controls the mean DNA attachment rate was 1.5% and the upper normal range limit was 12.8%, the risk of erroneous rejection being 1%. The DNA binding rate was greater than 12.8% in 74.7% of untreated patients suffering from lupus erythematodes visceralis, in 47.6% of patients with circumscribed sclerodermia, in 14.4% of patients with progressive sclerodermia, and in 10.3% of those suffering from lupus erythematodes chronicus. The findings emphasize the importance of regulatory mechanisms of the immune system to the process of autosensitization

  12. Identifying the Location of a Single Protein along the DNA Strand Using Solid-State Nanopores.

    Science.gov (United States)

    Yu, Jae-Seok; Lim, Min-Cheol; Huynh, Duyen Thi Ngoc; Kim, Hyung-Jun; Kim, Hyun-Mi; Kim, Young-Rok; Kim, Ki-Bum

    2015-05-26

    Solid-state nanopore has been widely studied as an effective tool to detect and analyze small biomolecules, such as DNA, RNA, and proteins, at a single molecule level. In this study, we demonstrate a rapid identification of the location of zinc finger protein (ZFP), which is bound to a specific locus along the length of a double-stranded DNA (dsDNA) to a single protein resolution using a low noise solid-state nanopore. When ZFP labeled DNAs were driven through a nanopore by an externally applied electric field, characteristic ionic current signals arising from the passage of the DNA/ZFP complex and bare DNA were detected, which enabled us to identify the locations of ZFP binding site. We examined two DNAs with ZFP binding sites at different positions and found that the location of the additional current drop derived from the DNA/ZFP complex is well-matched with a theoretical one along the length of the DNA molecule. These results suggest that the protein binding site on DNA can be mapped or that genetic information can be read at a single molecule level using solid-state nanopores.

  13. Alpha-Helical Fragaceatoxin C Nanopore Engineered for Double-Stranded and Single-Stranded Nucleic Acid Analysis

    NARCIS (Netherlands)

    Wloka, Carsten; Mutter, Natalie Lisa; Soskine, Misha; Maglia, Giovanni

    2016-01-01

    Nanopores are used in single-molecule DNA analysis and sequencing. Herein, we show that Fragaceatoxin C (FraC), an α-helical pore-forming toxin from an actinoporin protein family, can be reconstituted in sphingomyelin-free standard planar lipid bilayers. We engineered FraC for DNA analysis and show

  14. Synthesis of modified oligonucleotides for repair and replication studies of single and double radio-induced DNA lesions

    International Nuclear Information System (INIS)

    Muller, E.

    2002-01-01

    Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the

  15. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  16. Sensitive multiplex RNA quantification using capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Shin, Gi Won; Hwang, Hee Sung; Nam, Hong Gil; Oh, Mi-Hwa; Jung, Gyoo Yeol

    2010-05-01

    Quantification of RNA provides information crucial for various biological studies, including analysis of mRNA expression and that of microRNAs. Reverse transcription (RT) coupled with real-time polymerase chain reaction (PCR) is known to be the most accurate method for quantifying nucleic acids, and thus represents the state-of-the-art for RNA quantification. However, the use of real-time PCR for RNA quantification is limited to a single target per analytical run because of reductions in quantification power and limitations of fluorescence dyes associated with multiplex applications. Here, we report a novel multiplex RNA quantification method that uses capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) coupled with modified RT and asymmetric PCR. The reverse transcripts of seven in vitro transcribed RNAs were modified with common sequence tags and amplified by asymmetric PCR using primers specific to the common tags. The resulting amplicons were separated and quantified by CE-SSCP. A series of experiments using different amounts of RNA demonstrated that the assay had a limit of detection of 2 amol and a dynamic range of approximately 10(5). These results clearly indicate the potential of this method to provide robust and precise multiplex RNA quantification.

  17. Folding of single-stranded DNA quadruplexes containing an autonomously stable mini-hairpin loop.

    Science.gov (United States)

    Balkwill, Graham D; Garner, Thomas P; Searle, Mark S

    2009-05-01

    The single-stranded DNA quadruplex motif TG(3)-L(1)-G(3)-L(2)-G(3)-L(3)-G(3)T (where L(1), L(2) and L(3) are the three loop sequences) was used as a template for probing the effects of the loop sequences on stability and folding topology. An autonomously stable mini-hairpin sequence (ACGTAGT) was inserted into the central loop (L(2)) of different sequences with intrinsic propensities to form either parallel or anti-parallel structures. Single nucleotides (T) at positions L(1) and L(3) strongly favour the formation of a parallel structure with the L(2) hairpin insert affecting stability in the same way as a T(7) loop. However, in the context of an anti-parallel quadruplex with T(3) loops in positions L(1) and L(3), the mini-hairpin in the central loop forms a stable structure which enhances the T(m) of the quadruplex by approximately 10 degrees C when compared with the T(7) insert. The CD and UV melting data show that base pairing interactions within the ACGTAGT hairpin loop sequence, when accommodated as a diagonal loop in an anti-parallel structure, can enhance stability and lead to novel quadruplex structures, adding complexity to the folding landscape and expanding the potential repertoire of sequences that are able to regulate gene expression in vivo.

  18. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  19. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  20. Single-strand conformation polymorphism analysis of ribosomal DNA for detection of Phytophthora ramorum directly from plant tissues

    Science.gov (United States)

    Ping Kong; Patricia A. Richardson; Chuanxue Hong; Thomas L. Kubisiak

    2006-01-01

    At the first Sudden Oak Death Science Symposium, we reported on the use of a single strand conformation polymorphism (SSCP) analysis for rapid identification of Phytophthora ramorum in culture. We have since assessed and improved the fingerprinting technique for detecting this pathogen directly from plant tissues. The improved SSCP protocol uses a...

  1. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  2. Conductive composites for oligonucleotide detection

    Directory of Open Access Journals (Sweden)

    David C. Ferrier

    2018-02-01

    Full Text Available A new method for oligonucleotide detection is presented based on oligonucleotide cross-linked polymer composites. Conductive carbon nanoparticles are incorporated into a DNA-functionalised polymer, containing partially complementary oligonucleotide cross-linkers, which is polymerised in situ upon interdigitated electrodes. In the presence of an aqueous solution of a specific analyte oligonucleotide sequence, the cross-linkers are cleaved, leading to increased swelling. As the polymer swells the relative density of the conductive particles decreases, leading to an easily measurable decrease in electrical conductivity. We demonstrate that such are capable of discriminating between analyte and control solutions, with single-base specificity, in under 3 min. The lower detection limit of these composites is of the order of 10 nM. The swelling characteristics of these composites is confirmed by optical imaging and the effects of varying temperature upon such composites are also reported.

  3. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Boye, E.; Johansen, I.; Brustad, T.

    1976-01-01

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 2 0 C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 2 0 C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  4. Single and double strand breaks induced by 3H incorporated in DNA of cultured human kidney cells

    International Nuclear Information System (INIS)

    Tisljar-Lentulis, G.; Henneberg, P.; Mielke, T.; Feinendegen, L.E.

    1978-01-01

    In the course of the investigations of the biological effects of radionuclides incorporated in DNA single (SSB) and double strand breaks (DSB) caused tritium-decay were measured and compared with respective data resulting from 125 I. Tritium bound to thymidine and iododeoxyuridine seems to be more effective than tritium bound to other DNA-precursors. On the basis of decay, methyl- 3 H thymidine appears to be more effective with regard to the production of strand breaks than 3 H in position 6 of the pyrimidine ring. Based on the numbers of strand-breaks per rad, position 6 is more effective in accordance with data obtained by F. Krasin et al. The ratio of SSBs to DSBs per tritium decay appears to be approximately 8 in mammlian cells. Not only SSBs but also DSBs induced by 3 H in mammalian cells are reapairable. (orig./AJ) [de

  5. ExoMeth sequencing of DNA: eliminating the need for subcloning and oligonucleotide primers.

    Science.gov (United States)

    Sorge, J A; Blinderman, L A

    1989-01-01

    A method is reported for sequencing DNA based on exonuclease III digestion and strand protection by using modified nucleoside triphosphates. Up to 10 kilobases of sequence information may be obtained from each strand of a given template without subcloning. Prior knowledge of the restriction map is not important; prior knowledge of any of the sequence is not required. Nor are oligonucleotide primers needed. Double-stranded cosmids, plasmids, lambda phage, or linear molecules (including amplified molecules) may be used as starting material. The method creates a single-stranded template from these starting molecules, thus generating high-quality sequence ladders. Most commonly used DNA polymerases may be utilized, including reverse transcriptase and T7 DNA polymerase. The approach is "ordered", so little time is wasted on redundant sequencing. Images PMID:2556705

  6. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  7. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-05

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity*

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L.

    2015-01-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome. PMID:25903123

  9. Effect of Conformational Entropy on the Nanomechanics of Microcantilever-Based Single-Stranded DNA Sensors

    Directory of Open Access Journals (Sweden)

    Zou-Qing Tan

    2014-09-01

    Full Text Available An entropy-controlled bending mechanism is presented to study the nanomechanics of microcantilever-based single-stranded DNA (ssDNA sensors. First; the conformational free energy of the ssDNA layer is given with an improved scaling theory of thermal blobs considering the curvature effect; and the mechanical energy of the non-biological layer is described by Zhang’s two-variable method for laminated beams. Then; an analytical model for static deflections of ssDNA microcantilevers is formulated by the principle of minimum energy. The comparisons of deflections predicted by the proposed model; Utz–Begley’s model and Hagan’s model are also examined. Numerical results show that the conformational entropy effect on microcantilever deflections cannot be ignored; especially at the conditions of high packing density or long chain systems; and the variation of deflection predicted by the proposed analytical model not only accords with that observed in the related experiments qualitatively; but also appears quantitatively closer to the experimental values than that by the preexisting models. In order to improve the sensitivity of static-mode biosensors; it should be as small as possible to reduce the substrate stiffness.

  10. In vitro selection and characterization of single stranded DNA aptamers for luteolin: A possible recognition tool.

    Science.gov (United States)

    Tuma Sabah, Jinan; Zulkifli, Razauden Mohamed; Shahir, Shafinaz; Ahmed, Farediah; Abdul Kadir, Mohammed Rafiq; Zakaria, Zarita

    2018-03-06

    Distinctive bioactivities possessed by luteolin (3', 4', 5, 7-tetrahydroxy-flavone) are advantageous for sundry practical applications. This paper reports the in vitro selection and characterization of single stranded-DNA (ssDNA) aptamers, specific for luteolin (LUT). 76-mer library containing 1015 randomized ssDNA were screened via systematic evolution of ligands by exponential enrichment (SELEX). The recovered ssDNA pool from the 8th round was amplified with unlabeled primers and cloned into PSTBlue-1 vector prior to sequencing. 22 of LUT-binding aptamer variants were further classified into one of the seven groups based on their N40 random sequence regions, wherein one representative from each group was characterized. The dissociation constant of aptamers designated as LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively with high binding affinity towards LUT. Prediction analysis of the secondary structure suggested discrete features with typical loop and stem motifs. Furthermore, LUT#3 displayed higher specificity with insignificant binding toward kaempferol and quercetin despite its structural and functional similarity compared to LUT#28 and LUT#20. Further LUT#3 can detect free luteolin within 0.2-1 mM in solution. It was suggested that LUT#3 aptamer were the most suitable for LUT recognition tool at laboratory scale based on the condition tested. Copyright © 2018. Published by Elsevier Inc.

  11. New Method for Differentiation of Granuloviruses (Betabaculoviruses Based on Multitemperature Single Stranded Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Martyna Krejmer-Rabalska

    2017-12-01

    Full Text Available Baculoviruses have been used as biopesticides for decades. Recently, due to the excessive use of chemical pesticides there is a need for finding new agents that may be useful in biological protection. Sometimes few isolates or species are discovered in one host. In the past few years, many new baculovirus species have been isolated from environmental samples, thoroughly characterized and thanks to next generation sequencing methods their genomes are being deposited in the GenBank database. Next generation sequencing (NGS methodology is the most certain way of detection, but it has many disadvantages. During our studies, we have developed a method based on Polymerase chain reaction (PCR followed by Multitemperature Single Stranded Conformational Polymorphism (MSSCP which allows for distinguishing new granulovirus isolates in only a few hours and at low-cost. On the basis of phylogenetic analysis of betabaculoviruses, representative species have been chosen. The alignment of highly conserved genes—granulin and late expression factor-9, was performed and the degenerate primers were designed to amplify the most variable, short DNA fragments flanked with the most conserved sequences. Afterwards, products of PCR reaction were analysed by MSSCP technique. In our opinion, the proposed method may be used for screening of new isolates derived from environmental samples.

  12. Delayed repair of DNA single-strand breaks does not increase cytogenetic damage

    International Nuclear Information System (INIS)

    Morgan, W.F.; Djordjevic, M.C.; Jostes, R.F.; Pantelias, G.E.

    1985-01-01

    DNA damage and cytogenetic effects of ionizing radiation were investigated in Chinese hamster ovary (CHO) cells and unstimulated human peripheral blood lymphocytes. DNA damage and repair were analysed by alkaline elution under conditions that predominantly measured DNA single-strand breaks (ssb). X-radiation (2.5 Gy) induced ssb in both CHO cells and unstimulated lymphocytes, and the breaks were repaired within 30 and 90 min, respectively. This rapid repair was delayed by the poly(ADP-ribose) polymerase inhibitor, 3-aminobenzamide (3AB). The cytogenetic effects of the 3AB-induced delay in DNA repair were examined by analysing sister chromatid exchange (SCE) frequency in CHO cells and fragmentation of prematurely condensed chromosomes (PCC) in unstimulated human lymphocytes after 2.5 Gy of X-rays. Although 3AB delayed the rejoining of DNA ssb, this delay did not result in increased cytogenetic damage manifested as either SCE or fragmentation of PCC. These results indicate that the rapidly rejoining DNA ssb are not important in the production of chromosome damage. (author)

  13. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  14. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  15. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  16. Detection of short single-strand DNA homopolymers with ultrathin Si3N4 nanopores.

    Science.gov (United States)

    Ma, Jian; Qiu, Yinghua; Yuan, Zhishan; Zhang, Yin; Sha, Jingjie; Liu, Lei; Sun, Litao; Ni, Zhonghua; Yi, Hong; Li, Deyu; Chen, Yunfei

    2015-08-01

    A series of nanopores with diameters ranging from 2.5 to 63 nm are fabricated on a reduced Si3N4 membrane by focused ion beam and high energy electron beam. Through measuring the blocked ionic currents for DNA strands threading linearly through those solid-state nanopores, it is found that the blockade ionic current is proportional to the square of the hydrodynamic diameter of the DNA strand. With the nanopore diameter reduced to be comparable with that of DNA strands, the hydrodynamic diameter of the DNA becomes smaller, which is attributed to the size confinement effects. The duration time for the linear DNA translocation events increases monotonically with the nanopore length. By comparing the spatial configurations of DNA strands through nanopores with different diameters, it is found that the nanopore with large diameter has enough space to allow the DNA strand to translocate through with complex conformation. With the decrease of the nanopore diameter, the folded part of the DNA is prone to be straightened by the nanopore, which leads to the increase in the occurrence frequency of the linear DNA translocation events. Reducing the diameter of the nanopore to 2.5 nm allows the detection and discrimination of three nucleotide "G" and three nucleotide "T" homopolymer DNA strands based on differences in their physical dimensions.

  17. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  18. Mutability dynamics of an emergent single stranded DNA virus in a naïve host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  19. Carboplatin enhances the production and persistence of radiation-induced DNA single-strand breaks

    International Nuclear Information System (INIS)

    Yang, L.; Douple, E.B.; O'Hara, J.A.; Wang, H.J.

    1995-01-01

    Fluorometric analysis of DNA unwinding and alkaline elution were used to investigate the production and persistence of DNA single-strand breaks (SSBs) in Chinese hamster V79 and xrs-5 cells treated with the chemotherapeutic agent carboplatin in combination with radiation. Carboplatin was administered to cells before irradiation in hypoxic conditions, or the drug was added immediately after irradiation during the postirradiation recovery period in air. The results of DNA unwinding studies suggest that carboplatin enhances the production of radiation-induced SSBs in hypoxic V79 cells and xrs-5 cells by a factor of 1.86 and 1.83, respectively, when combined with radiation compared to the SSBs produced by irradiation alone. Carboplatin alone did not produce a measureable number of SSBs. Alkaline elution profiles also indicated that the rate of elution of SSBs was higher in cells treated with the carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs by a factor of 1.46 in V79 cells with 20 Gy irradiation and by a factor of 2.02 in xrs-5 cells with 20 Gy irradiation. When carboplatin is present after irradiation and during the postirradiation recovery period, the rejoining of radiation-induced SSBs is inhibited during this postirradiation incubation period (radiopotentiation) with a relative inhibition factor at 1 h postirradiation of 1.25 in V79 cells and 1.15 in xrs-5 cells. An increased production and persistence of SSBs resulting from the interaction of carboplatin with radiation may be an important step in the mechanism responsible for the potentiated cell killing previously from studies in animal tumors and in cultured cells. 31 refs., 7 figs

  20. Distinct circular single-stranded DNA viruses exist in different soil types.

    Science.gov (United States)

    Reavy, Brian; Swanson, Maud M; Cock, Peter J A; Dawson, Lorna; Freitag, Thomas E; Singh, Brajesh K; Torrance, Lesley; Mushegian, Arcady R; Taliansky, Michael

    2015-06-15

    The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. A high throughput system for the preparation of single stranded templates grown in microculture.

    Science.gov (United States)

    Kolner, D E; Guilfoyle, R A; Smith, L M

    1994-01-01

    A high throughput system for the preparation of single stranded M13 sequencing templates is described. Supernatants from clones grown in 48-well plates are treated with a chaotropic agent to dissociate the phage coat protein. Using a semi-automated cell harvester, the free nucleic acid is bound to a glass fiber filter in the presence of chaotrope and then washed with ethanol by aspiration. Individual glass fiber discs are punched out on the cell harvester and dried briefly. The DNA samples are then eluted in water by centrifugation. The processing time from 96 microcultures to sequence quality templates is approximately 1 hr. Assuming the ability to sequence 400 bases per clone, a 0.5 megabase per day genome sequencing facility will require 6250 purified templates a week. Toward accomplishing this goal we have developed a procedure which is a modification of a method that uses a chaotropic agent and glass fiber filter (Kristensen et al., 1987). By exploiting the ability of a cell harvester to uniformly aspirate and wash 96 samples, a rapid system for high quality template preparation has been developed. Other semi-automated systems for template preparation have been developed using commercially available robotic workstations like the Biomek (Mardis and Roe, 1989). Although minimal human intervention is required, processing time is at least twice as long. Custom systems based on paramagnetic beads (Hawkins et al., 1992) produce DNA in insufficient quantity for direct sequencing and therefore require cycle sequencing. These systems require custom programing, have a fairly high initial cost and have not proven to be as fast as the method reported here.

  2. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  3. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  4. Ammonia disinfection of hatchery waste for elimination of single-stranded RNA viruses.

    Science.gov (United States)

    Emmoth, Eva; Ottoson, Jakob; Albihn, Ann; Belák, Sándor; Vinnerås, Björn

    2011-06-01

    Hatchery waste, an animal by-product of the poultry industry, needs sanitation treatment before further use as fertilizer or as a substrate in biogas or composting plants, owing to the potential presence of opportunistic pathogens, including zoonotic viruses. Effective sanitation is also important in viral epizootic outbreaks and as a routine, ensuring high hygiene standards on farms. This study examined the use of ammonia at different concentrations and temperatures to disinfect hatchery waste. Inactivation kinetics of high-pathogenic avian influenza virus H7N1 and low-pathogenic avian influenza virus H5N3, as representatives of notifiable avian viral diseases, were determined in spiked hatchery waste. Bovine parainfluenza virus type 3, feline coronavirus, and feline calicivirus were used as models for other important avian pathogens, such as Newcastle disease virus, infectious bronchitis virus, and avian hepatitis E virus. Bacteriophage MS2 was also monitored as a stable indicator. Coronavirus was the most sensitive virus, with decimal reduction (D) values of 1.2 and 0.63 h after addition of 0.5% (wt/wt) ammonia at 14 and 25°C, respectively. Under similar conditions, high-pathogenic avian influenza H7N1 was the most resistant, with D values of 3.0 and 1.4 h. MS2 was more resistant than the viruses to all treatments and proved to be a suitable indicator of viral inactivation. The results indicate that ammonia treatment of hatchery waste is efficient in inactivating enveloped and naked single-stranded RNA viruses. Based on the D values and confidence intervals obtained, guidelines for treatment were proposed, and one was successfully validated at full scale at a hatchery, with MS2 added to hatchery waste.

  5. Genomic analysis of Pseudomonas putida phage tf with localized single-strand DNA interruptions.

    Directory of Open Access Journals (Sweden)

    Anatoly S Glukhov

    Full Text Available The complete sequence of the 46,267 bp genome of the lytic bacteriophage tf specific to Pseudomonas putida PpG1 has been determined. The phage genome has two sets of convergently transcribed genes and 186 bp long direct terminal repeats. The overall genomic architecture of the tf phage is similar to that of the previously described Pseudomonas aeruginosa phages PaP3, LUZ24 and phiMR299-2, and 39 out of the 72 products of predicted tf open reading frames have orthologs in these phages. Accordingly, tf was classified as belonging to the LUZ24-like bacteriophage group. However, taking into account very low homology levels between tf DNA and that of the other phages, tf should be considered as an evolutionary divergent member of the group. Two distinguishing features not reported for other members of the group were found in the tf genome. Firstly, a unique end structure--a blunt right end and a 4-nucleotide 3'-protruding left end--was observed. Secondly, 14 single-chain interruptions (nicks were found in the top strand of the tf DNA. All nicks were mapped within a consensus sequence 5'-TACT/RTGMC-3'. Two nicks were analyzed in detail and were shown to be present in more than 90% of the phage population. Although localized nicks were previously found only in the DNA of T5-like and phiKMV-like phages, it seems increasingly likely that this enigmatic structural feature is common to various other bacteriophages.

  6. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  7. Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid)

    DEFF Research Database (Denmark)

    Babu, B. Ravindra; Prasad, Ashok K.; Trikha, Smriti

    2002-01-01

    . The phosphoramidite approach was used for automated incorporation of the LNA-type beta-configured C-aryl monomers 17a-17e into short DNA and 2'-OMe-RNA/LNA strands. It is shown that universal hybridization can be obtained with a conformationally restricted monomer as demonstrated most convincingly for the pyrene LNA...... monomer 17d, both in a DNA context and in an RNA-like context. Increased binding affinity of oligonucleotide probes for universal hybridization can be induced by combining the pyrene LNA monomer 17d with affinity-enhancing 2'-OMe-RNA/LNA monomers....

  8. Detection of hybridization of single-strand DNA PCR products in temperature change process by a novel metal-clamping piezoelectric sensor.

    Science.gov (United States)

    Chen, Qinghai; Bian, Zhiheng; Hua, Xing; Yao, Chunyan; Wu, Wei; Zhang, Xue; Zhang, Bo; Huang, Junfu; Tang, Wanli; Fu, Weiling

    2010-05-15

    Oligonucleotide probes on the sensor surface can be hybridized with single-strand DNA (ssDNA) that is formed from PCR products in ice bath after degeneration. Thus, detection of PCR products by piezoelectric sensors requires the participation of ssDNA PCR products in ice bath. When PCR products in ice bath are added into the buffer of the sensor well at room temperature, there will be a temperature change process during mixing. However, it still remains unclear whether the temperature change affects the frequency baseline stability of the sensor and the result judgment, which is the basic condition for detecting hybridization of nucleic acid. In this study, we detected the hybridization of HPV PCR products during temperature change process by a self-designed adjustable metal-clamping piezoelectric sensor. The study mainly involves sensor adjustment, probe immobilization and ice bath sample addition (at different concentrations and different volumes). The response curve of basic frequency in temperature change process showed three stages, i.e., increase, decrease to baseline, and continuous decrease to stability. The early increase of frequency and duration of the time can reach 55+/-7.4 Hz and 39 min when 40 microL sample (0-1 degrees C) was added into 110 microL buffer (25 degrees C). The frequency increase effect caused by temperature difference at early stage depends on the volume ratio of two liquids and on the temperature difference. The results indicate that we should pay more attention to possibly small volume of PCR products in ice bath and minor temperature difference of two liquids in operation. 2010 Elsevier B.V. All rights reserved.

  9. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  10. Addendum to "Monomer motion in single- and double-stranded DNA coils" [arXiv: cond-mat/0509399

    OpenAIRE

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2007-01-01

    In our work [J. Tothova et al., cond-mat/0509399] the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique [R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)] has been interpreted within the joint Rouse-Zimm theory. Optimizing the theory to the experimental data the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dy...

  11. Selective binding and reverse transcription inhibition of single-strand poly(A) RNA by metal TMPyP complexes.

    Science.gov (United States)

    Zhou, Zhu-Xin; Gao, Feng; Chen, Xing; Tian, Xiang-Jing; Ji, Liang-Nian

    2014-10-06

    Ni-, Cu-, and Zn-TMPyP are capable of binding to single-strand poly(A) RNA with high preference and affinity and inhibiting the reverse transcription of RNA by both M-MuLV and HIV-1 reverse transcriptase. With 10 nM azidothymidine, the IC50 value of M-TMPyP could be lowered to 10(-1) μM order.

  12. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect

    International Nuclear Information System (INIS)

    Tang Dedong; Huang Shanglian; Chen Weimin; Jiang Jianshan

    2008-01-01

    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C −1 , and repeating errors of tension are less than 0.15%, which meet the measurement requirements

  13. Study of a steel strand tension sensor with difference single bypass excitation structure based on the magneto-elastic effect

    Science.gov (United States)

    Tang, Dedong; Huang, Shanglian; Chen, Weimin; Jiang, Jianshan

    2008-04-01

    With many steel strands used in various important machines and architectural structures, health monitoring of strand tension becomes more and more important to ensure the equipment or structures' safety. Contrasted with the method of vibration frequency and strain gages, the method of measuring the steel strand tension based on the magneto-elastic effect is more capable of meeting the requirements of health monitoring. Yet the structure of the sensor is mainly a sleeve structure, and the steel strand to be measured serves as the core of primary and secondary solenoids. This structure is very difficult to fix and maintain. On the other hand, a change of temperature will strongly affect measurement results, and experiments prove that temperature error compensation by using a temperature compensation curve is not effective enough. Therefore in this paper the principle of a cable tension sensor based on the magneto-elastic effect is expounded, the theory of temperature influence is explored, a difference structure by single bypass excitation is devised, its magnetic loop is analyzed, an experiment is designed, and experiments on temperature compensation and pulling tension are carried out. The experiment results indicated that the structure of the sensor is feasible, temperature errors can be compensated for automatically, after which temperature errors become less than 0.012 MPa °C-1, and repeating errors of tension are less than 0.15%, which meet the measurement requirements.

  14. Radiation-induced DNA single-strand scission and its rejoining in spermatogonia and spermatozoa of mouse

    International Nuclear Information System (INIS)

    Ono, T.; Okada, S.

    1977-01-01

    Gamma-ray-induced DNA single-strand scissions and the ability to repair the scissions in spermatogonia from young mice and in spermatozoa from adult mice were studied quantitatively by an alkaline sucrose density-gradient centrifugation method. The average size of DNAs in non-irradiated spermatogonia was 2.6-3.0xx10 8 daltons, similar to those of a spermatid-rich population, and the size of DNA in non-irradiated spermatozoa was 1.2x10 8 daltons. In spermatogonia, the radiosensitivity of DNA was 0.42 single-strand breaks/10 12 daltons of DNA/rad in oxic conditions and only 0.24 under anoxic conditions. In spermatozoa the break efficiency of DNA was 0.22 single-strand breaks/10 12 daltons of DNA/rad under oxic conditions and altered little under anoxic irradiation. The DNA scissions were efficiently repaired in spermatogonia within 10 min, whereas the breaks in spermatozoa were not rejoined at all even after two days of post-irradiation time. The radiosensitivities of DNA, repair capability and non- and/or slowreparable DNA scissions were compared in spermatogonium-rich, spermatid-rich and spermatozoanrich populations

  15. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  16. Effects of 3-Deoxyadenosine (Cordycepin) on the repair of X-ray-induced DNA single- and double-strand breaks in chinese hamster V79 cells

    International Nuclear Information System (INIS)

    Hiraoka, Wakako; Kuwabara, Mikinori; Sato, Fumiaki

    1990-01-01

    The ability of cordycepin to inhibit the repair of DNA strand breaks was examined with X-irradiated Chinese hamster V79 cells in log-phase culture. A filter elution technique revealed that 70 μM cordycepin did not inhibit the repair of single-strand breaks but inhibited the repair of double-strand breaks. These findings confirmed the fact that the increase in the lethality of cordycepin in X-irradiated cultured mammalian cells was attributable to unrepaired DNA double-strand breaks. (author)

  17. The Adsorption of Short Single-Stranded DNA Oligomers on Mineral Surfaces

    Science.gov (United States)

    Kopstein, M.; Sverjensky, D. A.; Hazen, R. M.; Cleaves, H. J.

    2009-12-01

    Previous studies have described feasible pathways for the synthesis of simple organic building blocks such as formaldehyde and hydrogen cyanide, and their reaction to form more complex biomolecules such as nucleotide bases, amino acids and sugars (Miller and Orgel 1974, Miller and Cleaves 2006). However, the polymerization of monomers into a useful genetic material remains problematic (Orgel 2004). Organic building blocks were unlikely to polymerize from very dilute aqueous solution in the primitive oceans. Mineral surface adsorption has been suggested as a possible mechanism for concentrating the necessary building blocks (Bernal 1951). This study focused on the adsorption behavior of single-stranded DNA homo-oligomers of adenine and thymine (including the monomers, dimers, tetramers, hexamers, octomers, and decamers) with five different mineral surfaces (pyrite, rutile, hematite, olivine and calcite). Adsorption was studied in 0.1 M pH 8.1 KHCO3 with0.05 M NaCl as background electrolyte. Solutions were mixed for 24 hours at room temperature, centrifuged and the supernatants analyzed by UV/visible spectrophotometry. Equilibrium solution concentrations were measured and used to determine the number of moles adsorbed per square meter. Langmuir isotherms were constructed using the experimental data. It was found that adenine-containing molecules tend to bind much more strongly than thymine-containing molecules. It was also found that the number of moles adsorbed at saturation tends to fall with increasing chain length, while adsorption affinity tends to rise. Oligomer length appears to affect adsorption more than the mineral type. These results may have implications for the primordial organization of the first nucleic acid molecules as the persistence of extra-cellular nucleic acids in the environment. References Bernal, J. D. (1951) The Physical Basis of Life (Routledge, London). Miller S.L. and Cleaves, H.J. (2006) Prebiotic chemistry on the primitive Earth. In

  18. Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

    Science.gov (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

    2014-09-01

    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  19. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  20. Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.

    Science.gov (United States)

    Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong

    2016-07-01

    A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.

  1. Highly stable triple helix formation by homopyrimidine (l)-acyclic threoninol nucleic acids with single stranded DNA and RNA

    DEFF Research Database (Denmark)

    Kumar, Vipin; Kesavan, Venkitasamy; Gothelf, Kurt Vesterager

    2015-01-01

    Acyclic (l)-threoninol nucleic acid (aTNA) containing thymine, cytosine and adenine nucleobases were synthesized and shown to form surprisingly stable triplexes with complementary single stranded homopurine DNA or RNA targets. The triplex structures consist of two (l)-aTNA strands and one DNA...... or RNA, and these triplexes are significantly stronger than the corresponding DNA or RNA duplexes as shown in competition experiments. As a unique property the (l)-aTNAs exclusively form triplex structures with DNA and RNA and no duplex structures are observed by gel electrophoresis. The results were...... compared to the known enantiomer (d)-aTNA, which forms much weaker triplexes depending upon temperature and time. It was demonstrated that (l)-aTNA triplexes are able to stop primer extension on a DNA template, showing the potential of (l)-aTNA for antisense applications....

  2. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  3. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

  4. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  5. Chemically Modified Oligonucleotides Modulate an Epigenetically Varied and Transient Form of Transcription Silencing of HIV-1 in Human Cells

    Directory of Open Access Journals (Sweden)

    Stuart Knowling

    2012-01-01

    Full Text Available Small noncoding RNAs (ncRNAs have been shown to guide epigenetic silencing complexes to target loci in human cells. When targeted to gene promoters, these small RNAs can lead to long-term stable epigenetic silencing of gene transcription. To date, small RNAs have been shown to modulate transcriptional gene silencing (TGS of human immunodeficiency virus type 1 (HIV-1 as well as several other disease-related genes, but it has remained unknown as to what extent particular chemistries can be used to generate single-stranded backbone-modified oligonucleotides that are amenable to this form of gene targeting and regulation. Here, we present data indicating that specific combinations of backbone modifications can be used to generate single-stranded antisense oligonucleotides that can functionally direct TGS of HIV-1 in a manner that is however, independent of epigenetic changes at the target loci. Furthermore, this functionality appears contingent on the absence of a 5′ phosphate in the oligonucleotide. These data suggest that chemically modified oligonucleotide based approaches could be implemented as a means to regulate gene transcription in an epigenetically independent manner.

  6. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  7. Bacillus subtilis single-stranded DNA-binding protein SsbA is phosphorylated at threonine 38 by the serine/threonine kinase YabT

    DEFF Research Database (Denmark)

    Derouiche, Abderahmane; Petranovic, Dina; Macek, Boris

    2016-01-01

    Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA-binding pro......Background and purpose: Single-stranded DNA-binding proteins participate in all stages of DNA metabolism that involve single-stranded DNA, from replication, recombination, repair of DNA damage, to natural competence in species such as Bacillus subtilis. B. subtilis single-stranded DNA...... assays.Results: In addition to the known tyrosine phosphorylation of SsbA on tyrosine 82, we identified a new phosphorylation site: threonine 38. The in vitro assays demonstrated that SsbA is preferentially phosphorylated by the B. subtilis Hanks-type kinase YabT, and phosphorylation of threonine 38...... leads to enhanced cooperative binding to DNA.Conclusions: Our findings contribute to the emerging picture that bacterial proteins, exemplified here by SsbA, undergo phosphorylation at multiple residues. This results in a complex regulation of cellular functions, and suggests that the complexity...

  8. Oligonucleotide N3'-->P5' phosphoramidates as antisense agents.

    Science.gov (United States)

    Gryaznov, S; Skorski, T; Cucco, C; Nieborowska-Skorska, M; Chiu, C Y; Lloyd, D; Chen, J K; Koziolkiewicz, M; Calabretta, B

    1996-01-01

    Uniformly modified oligonucleotide N3'-->P5' phosphoramidates, where every 3'-oxygen is replaced by a 3'-amino group, were synthesized. These compounds have very high affinity to single-stranded RNAs and thus have potential utility as antisense agents. As was shown in this study, the oligonucleotide phosphoramidates are resistant to digestion with snake venom phosphodiesterase, to nuclease activity in a HeLa cell nuclear extract, or to nuclease activity in 50% human plasma, where no significant hydrolysis was observed after 8 h. These compounds were used in various in vitro cellular systems as antisense compounds addressed to different targeted regions of c-myb, c-myc and bcr-abl mRNAs. C-myb antisense phosphoramidates at 5 microM caused sequence and dose-dependent inhibition of HL-60 cell proliferation and a 75% reduction in c-myb protein and RNA levels, as determined by Western blot and RT-PCR analysis. Analogous results were observed for anti-c-myc phosphoramidates, where a complete cytostatic effect for HL-60 cells was observed at 1 microM concentration for fully complementary, but not for mismatched compounds, which were indistinguishable from untreated controls. This was correlated with a 93% reduction in c-myc protein level. Moreover, colony formation by the primary CML cells was also inhibited 75-95% and up to 99% by anti-c-myc and anti-bcr-abl phosphoramidate oligonucleotides, respectively, in a sequence- and dose-dependent manner within a 0.5 nM-5 microM dose range. At these concentrations the colony-forming ability of normal bone marrow cells was not affected. The presented in vitro data indicate that oligonucleotide N3'-->P5' phosphoramidates could be used as specific and efficient antisense agents. PMID:8628685

  9. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Measurement of longitudinal sulfur isotopic variations by laser ablation MC-ICP-MS in single human hair strands.

    Science.gov (United States)

    Santamaria-Fernandez, Rebeca; Giner Martínez-Sierra, Justo; Marchante-Gayón, J M; García-Alonso, J Ignacio; Hearn, Ruth

    2009-05-01

    A new method for the measurement of longitudinal variations of sulfur isotope amount ratios in single hair strands using a laser ablation system coupled to a multicollector inductively coupled plasma mass spectrometer (LA-MC-ICP-MS) is reported here for the first time. Ablation parameters have been optimized for the measurement of sulfur isotope ratios in scalp human hair strands of 80-120-microm thickness and different washing procedures have been evaluated. The repeatability of the method has been tested and the ability to measure sulfur isotopic variations in 1,000-microm-long hair segments has been evaluated. A horse hair sample previously characterized for carbon and nitrogen isotope ratios in an interlaboratory study has been characterized by LA-MC-ICP-MS to be used as an in-house standard for the bracketing of human hair strands. (34)S/(32)S isotope amount ratios have been measured and corrected for instrumental mass bias adopting the external standardization approach using National Institute of Standards and Technology (NIST) RM8553 and full uncertainty budgets have been calculated using the Kragten approach. Results are reported as both (34)S/(32)S isotope amount ratios and deltaS(V-CDT) values (sulfur isotopic differences relative to a reference sample expressed in the Vienna Canyon Diablo Troilite (V-CDT) scale) calculated using NIST RM8553, NIST RM8554, and NIST RM8556 to anchor results to the V-CDT scale. The main advantage of the new method versus conventional gas source isotope ratio mass spectrometry measurements is that longitudinal variations in sulfur isotope amount ratios can be resolved. Proof of concept is shown with human scalp hair strands from three individuals, two UK residents and one traveler (long periods of time abroad). The method enables monitoring of longitudinal isotope ratio variations in single hair strands. Absolute ratios are reported and delta(34)S(V-CDT) values are plotted for comparison. Slight variations of 5 per thousand

  11. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  13. Development of an Interaction Assay between Single-Stranded Nucleic Acids Trapped with Silica Particles and Fluorescent Compounds

    Directory of Open Access Journals (Sweden)

    R. Maeda

    2012-09-01

    Full Text Available Biopolymers are easily denatured by heating, a change in pH or chemical substances when they are immobilized on a substrate. To prevent denaturation of biopolymers, we developed a method to trap a polynucleotide on a substrate by hydrogen bonding using silica particles with surfaces modified by aminoalkyl chains ([A-AM silane]/SiO2. [A-AM silane]/SiO2 was synthesized by silane coupling reaction of N-2-(aminoethyl-3-aminopropyltrimethoxysilane (A-AM silane with SiO2 particles with a diameter of 5 μm at 100 °C for 20 min. The surface chemical structure of [A-AM silane]/SiO2 was characterized by Fourier transform infrared spectroscopy and molecular orbital calculations. The surface of the silica particles was modified with A-AM silane and primary amine groups were formed. [A-AM silane]/SiO2 was trapped with single-stranded nucleic acids [(Poly-X; X = A (adenine, G (guanine and C (cytosine] in PBS solution at 37 °C for 1 h. The single-stranded nucleic acids were trapped on the surface of the [A-AM silane]/SiO2 by hydrogen bonding to form conjugated materials. The resulting complexes were further conjugated by derivatives of acridine orange (AO as fluorescent labels under the same conditions to form [AO:Poly-X:A-AM silane]/SiO2 complexes. Changes in the fluorescence intensity of these complexes originating from interactions between the single-stranded nucleic acid and aromatic compounds were also evaluated. The change in intensity displayed the order [AO: Poly-G: A-AM silane]/SiO2 > [AO:Poly-A:A-AM silane]/SiO2 >> [AO:Poly-C:A-AM silane]/SiO2. This suggests that the single-stranded nucleic acids conjugated with aminoalkyl chains on the surfaces of SiO2 particles and the change in fluorescence intensity reflected the molecular interaction between AO and the nucleic-acid base in a polynucleotide.

  14. String-nets, single and double-stranded quantum loop gases for non-Abelian anyons

    OpenAIRE

    Velenich, Andrea; Chamon, Claudio; Wen, Xiao-Gang

    2009-01-01

    String-net condensation can give rise to non-Abelian anyons whereas loop condensation usually gives rise to Abelian anyons. It has been proposed that generalized quantum loop gases with non-orthogonal inner products can produce non-Abelian anyons. We detail an exact mapping between the string-net and the generalized loop models and explain how the non-orthogonal products arise. We also introduce a loop model of double-stranded nets where quantum loops with an orthogonal inner product and loca...

  15. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    Science.gov (United States)

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  16. Alkyladenine DNA glycosylase (AAG) localizes to mitochondria and interacts with mitochondrial single-stranded binding protein (mtSSB).

    Science.gov (United States)

    van Loon, Barbara; Samson, Leona D

    2013-03-01

    Due to a harsh environment mitochondrial genomes accumulate high levels of DNA damage, in particular oxidation, hydrolytic deamination, and alkylation adducts. While repair of alkylated bases in nuclear DNA has been explored in detail, much less is known about the repair of DNA alkylation damage in mitochondria. Alkyladenine DNA glycosylase (AAG) recognizes and removes numerous alkylated bases, but to date AAG has only been detected in the nucleus, even though mammalian mitochondria are known to repair DNA lesions that are specific substrates of AAG. Here we use immunofluorescence to show that AAG localizes to mitochondria, and we find that native AAG is present in purified human mitochondrial extracts, as well as that exposure to alkylating agent promotes AAG accumulation in the mitochondria. We identify mitochondrial single-stranded binding protein (mtSSB) as a novel interacting partner of AAG; interaction between mtSSB and AAG is direct and increases upon methyl methanesulfonate (MMS) treatment. The consequence of this interaction is specific inhibition of AAG glycosylase activity in the context of a single-stranded DNA (ssDNA), but not a double-stranded DNA (dsDNA) substrate. By inhibiting AAG-initiated processing of damaged bases, mtSSB potentially prevents formation of DNA breaks in ssDNA, ensuring that base removal primarily occurs in dsDNA. In summary, our findings suggest the existence of AAG-initiated BER in mitochondria and further support a role for mtSSB in DNA repair. Copyright © 2012. Published by Elsevier B.V.

  17. Telomerase suppresses formation of ALT-associated single-stranded telomeric C-circles.

    Science.gov (United States)

    Plantinga, Matthew J; Pascarelli, Kara M; Merkel, Anna S; Lazar, Alexander J; von Mehren, Margaret; Lev, Dina; Broccoli, Dominique

    2013-06-01

    Telomere maintenance is an essential characteristic of cancer cells, most commonly achieved by activation of telomerase. Telomeres can also be maintained by a recombination-based mechanism, alternative lengthening of telomeres (ALT). Cells using ALT are characterized by the presence of ALT-associated promyelocytic leukemia (PML) bodies (APB), long, heterogeneously sized telomeres, extrachromosomal telomeric circular DNA, and elevated telomeric recombination. Consistent with other reports, we found that liposarcomas containing APBs, but lacking telomerase expression, always contained C-rich circles (C-circles), and these C-circles were never present in the absence of APBs, indicating a tight link between these features in ALT cells. However, a rare subgroup of tumors showing evidence of telomere maintenance by both telomerase and ALT did not contain C-circles. To test the hypothesis that telomerase expression disrupts the tight link between APBs and C-circles, we used ALT cell lines that were engineered to express telomerase. Introduction of telomerase activity in these ALT cells resulted in, on average, shorter telomeres with retention of APBs. However, at high passage, the level of C-circles was significantly reduced, which was paralleled by a switch from C-strand overhangs to G-strand overhangs. We propose that by extending critically short telomeres in these cells, telomerase is disrupting a key step in the ALT pathway necessary for production and/or maintenance of C-circles. ©2013 AACR.

  18. Characterization of a Novel Megabirnavirus from Sclerotinia sclerotiorum Reveals Horizontal Gene Transfer from Single-Stranded RNA Virus to Double-Stranded RNA Virus.

    Science.gov (United States)

    Wang, Minghong; Wang, Yong; Sun, Xiangzhong; Cheng, Jiasen; Fu, Yanping; Liu, Huiquan; Jiang, Daohong; Ghabrial, Said A; Xie, Jiatao

    2015-08-01

    Mycoviruses have been detected in all major groups of filamentous fungi, and their study represents an important branch of virology. Here, we characterized a novel double-stranded RNA (dsRNA) mycovirus, Sclerotinia sclerotiorum megabirnavirus 1 (SsMBV1), in an apparently hypovirulent strain (SX466) of Sclerotinia sclerotiorum. Two similarly sized dsRNA segments (L1- and L2-dsRNA), the genome of SsMBV1, are packaged in rigid spherical particles purified from strain SX466. The full-length cDNA sequence of L1-dsRNA/SsMBV1 comprises two large open reading frames (ORF1 and ORF2), which encode a putative coat protein and an RNA-dependent RNA polymerase (RdRp), respectively. Phylogenetic analysis of the RdRp domain clearly indicates that SsMBV1 is related to Rosellinia necatrix megabirnavirus 1 (RnMBV1). L2-dsRNA/SsMBV1 comprises two nonoverlapping ORFs (ORFA and ORFB) encoding two hypothetical proteins with unknown functions. The 5'-terminal regions of L1- and L2-dsRNA/SsMBV1 share strictly conserved sequences and form stable stem-loop structures. Although L2-dsRNA/SsMBV1 is dispensable for replication, genome packaging, and pathogenicity of SsMBV1, it enhances transcript accumulation of L1-dsRNA/SsMBV1 and stability of virus-like particles (VLPs). Interestingly, a conserved papain-like protease domain similar to a multifunctional protein (p29) of Cryphonectria hypovirus 1 was detected in the ORFA-encoded protein of L2-dsRNA/SsMBV1. Phylogenetic analysis based on the protease domain suggests that horizontal gene transfer may have occurred from a single-stranded RNA (ssRNA) virus (hypovirus) to a dsRNA virus, SsMBV1. Our results reveal that SsMBV1 has a slight impact on the fundamental biological characteristics of its host regardless of the presence or absence of L2-dsRNA/SsMBV1. Mycoviruses are widespread in all major fungal groups, and they possess diverse genomes of mostly ssRNA and dsRNA and, recently, circular ssDNA. Here, we have characterized a novel dsRNA virus

  19. A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

    Directory of Open Access Journals (Sweden)

    Birte Möhlendick

    Full Text Available Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH of single cells. The protocol is based on an established adapter-linker PCR (WGAM and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost- effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

  20. Characterization of the single-stranded DNA binding protein pV(VGJΦ) of VGJΦ phage from Vibrio cholerae.

    Science.gov (United States)

    Falero, Alina; Caballero, Andy; Trigueros, Sonia; Pérez, Celso; Campos, Javier; Marrero, Karen; Fando, Rafael

    2011-09-01

    pV(VGJΦ), a single-stranded DNA binding protein of the vibriophage VGJΦ was subject to biochemical analysis. Here, we show that this protein has a general affinity for single-stranded DNA (ssDNA) as documented by Electrophoretic Mobility Shift Assay (EMSA). The apparent molecular weight of the monomer is about 12.7kDa as measured by HPLC-SEC. Moreover, isoelectrofocusing showed an isoelectric point for pV(VGJΦ) of 6.82 pH units. Size exclusion chromatography in 150mM NaCl, 50mM sodium phosphate buffer, pH 7.0 revealed a major protein species of 27.0kDa, suggesting homodimeric protein architecture. Furthermore, pV(VGJΦ) binds ssDNA at extreme temperatures and the complex was stable after extended incubation times. Upon frozen storage at -20°C for a year the protein retained its integrity, biological activity and oligomericity. On the other hand, bioinformatics analysis predicted that pV(VGJΦ) protein has a disordered C-terminal, which might be involved in its functional activity. All the aforementioned features make pV(VGJΦ) interesting for biotechnological applications. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  2. Alkali-labile sites and post-irradiation effects in single-stranded DNA induced by H radicals

    International Nuclear Information System (INIS)

    Lafleur, M.V.M.; Heuvel, N. van; Woldhuis, J.; Loman, H.

    1978-01-01

    Single-stranded phiX174 DNA in aqueous solutions has been irradiated in the absence of oxygen, under conditions in which H radicals react with the DNA. It was shown that H radical reactions result in breaks, which contribute approximately 10 per cent inactivation. Further, two types of alkali-labile sites were formed. One was lethal and gave rise to single-strand breaks by alkali and was most probably identical with post-irradiation heat damage and contributed about 33 per cent to the inactivation mentioned above. The other consisted of non-lethal damage, partly dihydropyrimidine derivatives, and was converted to lethal damage by alkali. This followed from experiments in which the DNA was treated with osmium-tetroxide, which oxidized thymine to 5,6-dihydroxydihydrothymine. Treatment with alkali of this DNA gave the same temperature dependence as found for the non-lethal alkali-labile sites in irradiated DNA. A similar temperature dependence was found for dihydrothymine and irradiated pyrimidines with alkali. (author)

  3. Radioresistance of GGG sequences to prompt strand break formation from direct-type radiation damage.

    Science.gov (United States)

    Black, Paul J; Miller, Adam S; Hayes, Jeffrey J

    2016-11-01

    As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work, we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single-strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation.

  4. String-nets, single- and double-stranded quantum loop gases for non-Abelian anyons

    Energy Technology Data Exchange (ETDEWEB)

    Velenich, Andrea; Chamon, Claudio [Physics Department, Boston University, 590 Commonwealth Avenue, Boston, MA 02215 (United States); Wen Xiaogang, E-mail: velenich@bu.ed [Department of Physics, Massachusetts Institute of Technology, Cambridge, MA 02215 (United States)

    2010-04-30

    String-nets and quantum loop gases are two prominent microscopic lattice models to describe topological phases. String-net condensation can give rise to both Abelian and non-Abelian anyons, whereas loop condensation usually produces Abelian anyons. It has been proposed, however, that generalized quantum loop gases with non-orthogonal inner products could support non-Abelian anyons. We detail an exact mapping between the string-net and these generalized loop models and explain how the non-orthogonal products arise. We also introduce an equivalent loop model of double-stranded nets where quantum loops with an orthogonal inner product and local interactions supports non-Abelian Fibonacci anyons. Finally, we emphasize the origin of the sign problem in systems with non-Abelian excitations and its consequences on the complexity of their ground state wavefunctions. (fast track communication)

  5. Self-consistent modeling of entangled network strands and linear dangling structures in a single-strand mean-field slip-link model

    DEFF Research Database (Denmark)

    Jensen, Mette Krog; Khaliullin, Renat; Schieber, Jay D.

    2012-01-01

    knowledge about the effect of dangling ends and soluble structures. To interpret our recent experimental results, we exploit a molecular model that can predict LVE data and non-linear stress–strain data. The slip-link model has proven to be a robust tool for both LVE and non-linear stress–strain predictions...... strands in the ensemble are attached to the network in both ends. Next we add dangling strands to the network representing the stoichiometric imbalance, or imperfections during curing. By considering monodisperse network strands without dangling ends, we find that the relative low-frequency plateau, G0/GN......0G0G0N, decreases linearly with the average number of entanglements. The decrease from GN0G0N to G 0 is a result of monomer fluctuations between entanglements, which is similar to “longitudinal modes” in tube theory. It is found that the slope of G′ is dependent on the fraction of network strands...

  6. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  7. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M

    2009-06-01

    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  8. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  9. DNA unwinding assay using streptavidin-bound oligonucleotides

    Directory of Open Access Journals (Sweden)

    Kelman Zvi

    2006-11-01

    Full Text Available Abstract Background Helicases play essential roles in many cellular processes including replication, transcription and translation. Most helicases translocate along one strand of the duplex while displacing the complementary strand (of either DNA or RNA. Thus, helicases have directionality. They move along nucleic acids in either the 3'→ 5' or 5'→ 3' direction. The directionality of helicases with low activity or of those that cannot initiate duplex unwinding from a substrate that contains only one single-stranded overhang region is difficult to determine. Results An improved assay to determine helicase directionality was developed that uses a substrate containing biotinylated oligonucleotides. As a proof of concept, it was shown that the substrates substantially improve helicase activity and directionality determination for several DNA helicases in comparison to more traditional substrates. In addition, a universal substrate that can be used to determine the directionality of both 3'→ 5' and 5'→ 3' helicases was developed. Conclusion It is shown here that the use of a biotin-streptavidin complex as a helicase substrate improves helicase activity and the determination of helicase directionality. The method described is simpler that the currently available techniques.

  10. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...

  11. A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands.

    Science.gov (United States)

    Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y

    2018-06-30

    We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Accurate single nucleotide variant detection in viral populations by combining probabilistic clustering with a statistical test of strand bias

    Science.gov (United States)

    2013-01-01

    Background Deep sequencing is a powerful tool for assessing viral genetic diversity. Such experiments harness the high coverage afforded by next generation sequencing protocols by treating sequencing reads as a population sample. Distinguishing true single nucleotide variants (SNVs) from sequencing errors remains challenging, however. Current protocols are characterised by high false positive rates, with results requiring time consuming manual checking. Results By statistical modelling, we show that if multiple variant sites are considered at once, SNVs can be called reliably from high coverage viral deep sequencing data at frequencies lower than the error rate of the sequencing technology, and that SNV calling accuracy increases as true sequence diversity within a read length increases. We demonstrate these findings on two control data sets, showing that SNV detection is more reliable on a high diversity human immunodeficiency virus sample as compared to a moderate diversity sample of hepatitis C virus. Finally, we show that in situations where probabilistic clustering retains false positive SNVs (for instance due to insufficient sample diversity or systematic errors), applying a strand bias test based on a beta-binomial model of forward read distribution can improve precision, with negligible cost to true positive recall. Conclusions By combining probabilistic clustering (implemented in the program ShoRAH) with a statistical test of strand bias, SNVs may be called from deeply sequenced viral populations with high accuracy. PMID:23879730

  13. Single nucleotide-level mapping of DNA double-strand breaks in human HEK293T cells

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2017-03-01

    Full Text Available Constitutional biological processes involve the generation of DNA double-strand breaks (DSBs. The production of such breaks and their subsequent resolution are also highly relevant to neurodegenerative diseases and cancer, in which extensive DNA fragmentation has been described Stephens et al. (2011, Blondet et al. (2001. Tchurikov et al. Tchurikov et al. (2011, 2013 have reported previously that frequent sites of DSBs occur in chromosomal domains involved in the co-ordinated expression of genes. This group report that hot spots of DSBs in human HEK293T cells often coincide with H3K4me3 marks, associated with active transcription Kravatsky et al. (2015 and that frequent sites of DNA double-strand breakage are likely to be relevant to cancer genomics Tchurikov et al. (2013, 2016 . Recently, they applied a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended DSB sites and mapped these to the human genome within defined co-ordinate ‘windows’. In this paper, we re-analyse public RAFT data to derive sites of DSBs at the single-nucleotide level across the built genome for human HEK293T cells (https://figshare.com/s/35220b2b79eaaaf64ed8. This refined mapping, combined with accessory ENCODE data tracks and ribosomal DNA-related sequence annotations, will likely be of value for the design of clinically relevant targeted assays such as those for cancer susceptibility, diagnosis, treatment-matching and prognostication.

  14. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    NARCIS (Netherlands)

    Quevedo, Beatrice; Giertsen, Elin; Zijnge, Vincent; Luethi-Schaller, Helga; Guggenheim, Bernhard; Thurnheer, Thomas; Gmuer, Rudolf

    2011-01-01

    Background: The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to

  15. Genetic evidence for single-strand lesions initiating Nbs1-dependent homologous recombination in diversification of Ig v in chicken B lymphocytes.

    Directory of Open Access Journals (Sweden)

    Makoto Nakahara

    2009-01-01

    Full Text Available Homologous recombination (HR is initiated by DNA double-strand breaks (DSB. However, it remains unclear whether single-strand lesions also initiate HR in genomic DNA. Chicken B lymphocytes diversify their Immunoglobulin (Ig V genes through HR (Ig gene conversion and non-templated hypermutation. Both types of Ig V diversification are initiated by AID-dependent abasic-site formation. Abasic sites stall replication, resulting in the formation of single-stranded gaps. These gaps can be filled by error-prone DNA polymerases, resulting in hypermutation. However, it is unclear whether these single-strand gaps can also initiate Ig gene conversion without being first converted to DSBs. The Mre11-Rad50-Nbs1 (MRN complex, which produces 3' single-strand overhangs, promotes the initiation of DSB-induced HR in yeast. We show that a DT40 line expressing only a truncated form of Nbs1 (Nbs1(p70 exhibits defective HR-dependent DSB repair, and a significant reduction in the rate--though not the fidelity--of Ig gene conversion. Interestingly, this defective gene conversion was restored to wild type levels by overproduction of Escherichia coli SbcB, a 3' to 5' single-strand-specific exonuclease, without affecting DSB repair. Conversely, overexpression of chicken Exo1 increased the efficiency of DSB-induced gene-targeting more than 10-fold, with no effect on Ig gene conversion. These results suggest that Ig gene conversion may be initiated by single-strand gaps rather than by DSBs, and, like SbcB, the MRN complex in DT40 may convert AID-induced lesions into single-strand gaps suitable for triggering HR. In summary, Ig gene conversion and hypermutation may share a common substrate-single-stranded gaps. Genetic analysis of the two types of Ig V diversification in DT40 provides a unique opportunity to gain insight into the molecular mechanisms underlying the filling of gaps that arise as a consequence of replication blocks at abasic sites, by HR and error

  16. Therapeutic Effect of Novel Single-Stranded RNAi Agent Targeting Periostin in Eyes with Retinal Neovascularization

    Directory of Open Access Journals (Sweden)

    Takahito Nakama

    2017-03-01

    Full Text Available Retinal neovascularization (NV due to retinal ischemia remains one of the principal causes of vision impairment in patients with ischemic retinal diseases. We recently reported that periostin (POSTN may play a role in the development of preretinal fibrovascular membranes, but its role in retinal NV has not been determined. The purpose of this study was to examine the expression of POSTN in the ischemic retinas of a mouse model of oxygen-induced retinal NV. We also studied the function of POSTN on retinal NV using Postn KO mice and human retinal endothelial cells (HRECs in culture. In addition, we used a novel RNAi agent, NK0144, which targets POSTN to determine its effect on the development of retinal NV. Our results showed that the expression of POSTN was increased in the vascular endothelial cells, pericytes, and M2 macrophages in ischemic retinas. POSTN promoted the ischemia-induced retinal NV by Akt phosphorylation through integrin αvβ3. NK0144 had a greater inhibitory effect than canonical double-stranded siRNA on preretinal pathological NV in vivo and in vitro. These findings suggest a causal relationship between POSTN and retinal NV, and indicate a potential therapeutic role of intravitreal injection of NK0144 for retinal neovascular diseases.

  17. Chemically modified oligonucleotides with efficient RNase H response

    DEFF Research Database (Denmark)

    Vester, Birte; Boel, Anne Marie; Lobedanz, Sune

    2008-01-01

    Ten different chemically modified nucleosides were incorporated into short DNA strands (chimeric oligonucleotides ON3-ON12 and ON15-ON24) and then tested for their capacity to mediate RNAse H cleavage of the complementary RNA strand. The modifications were placed at two central positions directly...... in the RNase H cleaving region. The RNA strand of duplexes with ON3, ON5 and ON12 were cleaved more efficiently than the RNA strand of the DNA:RNA control duplex. There seems to be no correlation between the thermal stability between the duplexes and RNase H cleavage....

  18. Identification and genetic characterization of a novel circular single-stranded DNA virus in a human upper respiratory tract sample.

    Science.gov (United States)

    Cui, Lunbiao; Wu, Binyao; Zhu, Xiaojuan; Guo, Xiling; Ge, Yiyue; Zhao, Kangchen; Qi, Xian; Shi, Zhiyang; Zhu, Fengcai; Sun, Lixin; Zhou, Minghao

    2017-11-01

    Metagenomic analysis through high-throughput sequencing is a tool for detecting both known and novel viruses. Using this technique, a novel circular single-stranded DNA (ssDNA) virus genome was discovered in respiratory secretions from a febrile traveler. The virus, named human respiratory-associated PSCV-5-like virus (HRAPLV), has a genome comprising 3,018 bases, with two major putative ORFs inversely encoding capsid (Cap) and replicase (Rep) protein and separated by two intergenic regions. One stem-loop structure was predicted in the larger intergenic region (LIR). The predicted amino acid sequences of the Cap and Rep proteins of HRAPLV showed highest identity to those of porcine stool-associated circular virus 5 isolate CP3 (PoSCV 5) (53.0% and 48.9%, respectively). The host tropism of the virus is unknown, and further study is warranted to determine whether this novel virus is associated with human disease.

  19. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    Energy Technology Data Exchange (ETDEWEB)

    Joshi, Vrushali S. [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India); Gokhale, Suresh P.; Patil, Kashinath R. [Physical and Material Chemistry Division, National Chemical Laboratory, Pune (India); Haram, Santosh K., E-mail: haram@chem.unipune.ernet.i [Department of Chemistry, University of Pune, Ganeshkhind, Pune 411007, Maharashtra (India)

    2010-02-15

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 +- 2 mum and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, alpha-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k{sup 0}) and electron transfer coefficient (alpha) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  20. Fabrication, characterization and electrochemical performance of single strand carbon fiber prepared by catalytic chemical vapor decomposition method

    International Nuclear Information System (INIS)

    Joshi, Vrushali S.; Gokhale, Suresh P.; Patil, Kashinath R.; Haram, Santosh K.

    2010-01-01

    Preparation, fabrication and voltammetric characterizations of a single strand of carbon fiber (SSCF) electrode and their potential applications for biosensor are presented. SSCFs of diameter ca. 10 ± 2 μm and few millimeters in length are prepared by catalytic chemical vapor decomposition (CCVD) method. Voltammetry with potassium ferricyanide, α-methylferrocene methanol and hexaammineruthenium(III) chloride on SSCF electrode are used as bench marks to validate the electrode properties. Quasi-steady state voltammograms obtained were fitted into a cylindrical diffusion model. From which, the standard rate constant (k 0 ) and electron transfer coefficient (α) are obtained. The use of SSCF electrode is demonstrated for the voltammetric detection of the micromolar quantity of dopamine in the presence of large excess (ca. 200 times) of ascorbic acid, without any fouling of electrode surface. The kinetics of electron transfer are investigated.

  1. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  2. Surface treatment on amorphous InGaZnO4 thin film for single-stranded DNA biosensing

    Science.gov (United States)

    Sun, Dali; Matsui, Hiroaki; Wu, Chun-Nan; Tabata, Hitoshi

    2015-01-01

    Amorphous InGaZnO4 (aIGZO) has been widely used as a transparent semiconductor. However, no research has been found yet applying aIGZO to biosensing. This paper examined the single strand DNA (ssDNA) immobilization on aIGZO by absorption with a comparison to ITO, which is the first step for many biosensing schemas. The DNA quantification by florescence intensity shows that the absorption capacity of aIGZO film to ssDNA is 6.7 times greater than that of ITO. XPS and contact angle analysis proved the high DNA absorption affinity on aIGZO film is related to its high effectiveness to OH- attachment. A feasible method to immobilized ssDNA on aIGZO thin film is evaluated in this paper, and consequently, enables a possible approach to apply aIGZO in biosensing.

  3. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  4. Epidermal growth factor stimulating reparation of γ-ray-induced single-strand breaks predominantly in untranscribed DNA of HeLa cells

    International Nuclear Information System (INIS)

    Igusheva, O.A.; Bil'din, V.N.; Zhestyanikov, V.D.

    1994-01-01

    Considerable evidence suggest that genomic DNA undergoes reparation unevenly because of different transcription activities of its particular sequence. It is highly probably that transcriptional factors are necessary for postion stages of excision reparation and for reparation of single-strand DNA breaks caused by ionizing radiation. There is evidence suggesting that DNA lesions inflicted by γ-radiation is preferentially initiated in transcribed rather than in untranscribed DNA species. This paper looks at the relationship between stimulatory effect of epidermal growth factor (EGF) on reparation of single-strand DNA breaks and reparation of the damage done to active and inert fragments of chromatin. The results show that EGF stimulates reparation of single-strand DNA breaks induced by γ-radiation more effectively in untranscribed than in transcribed DNA. 13 refs., 1 fig., 1 tab

  5. Investigation on accordance of DNA double-strand break of blood between in vivo and in vitro irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Liu Qiang; Jiang Enhai; Li Jin; Tang Weisheng; Wang Zhiquan; Zhao Yongcheng; Fan Feiyue

    2006-01-01

    Objective: To observe the consistency of DNA double-strand break between in vivo and in vitro irradiation, as a prophase study in radiation biodosimetry using single cell gel electrophoresis (SCGE). Methods: Detect DNA double-strand break after whole-body and in vitro radiation in mice lymphocytes using neutral single cell gel electrophoresis. The comet images were processed by CASP software and all the data were analysed by SPSS12.0. Results: There is no difference between in vivo and in vitro irradiation group in HDNA%, TDNA%, CL, TL, TM and OTM. Conclusion: The result of neutral single cell gel electrophoresis shortly after in vitro irradiation can precisely reflect the DNA double-strand break of lymphocytes in whole-body irradiation. (authors)

  6. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana.

    Science.gov (United States)

    Olszewski, Marcin; Grot, Anna; Wojciechowski, Marek; Nowak, Marta; Mickiewicz, Małgorzata; Kur, Józef

    2010-10-15

    In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. We report the characterization of single-stranded DNA binding proteins (SSBs) from the thermophilic bacteria Thermotoga maritima (TmaSSB) and Thermotoga neapolitana (TneSSB). They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively). They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold) in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC) the melting temperature (Tm) was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR).

  7. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  8. Aptamer based voltammetric determination of ampicillin using a single-stranded DNA binding protein and DNA functionalized gold nanoparticles.

    Science.gov (United States)

    Wang, Jun; Ma, Kui; Yin, Huanshun; Zhou, Yunlei; Ai, Shiyun

    2017-12-20

    An aptamer based method is described for the electrochemical determination of ampicillin. It is based on the use of DNA aptamer, DNA functionalized gold nanoparticles (DNA-AuNPs), and single-stranded DNA binding protein (ssDNA-BP). When the aptamer hybridizes with the target DNA on the AuNPs, the ssDNA-BP is captured on the electrode surface via its specific interaction with ss-DNA. This results in a decreased electrochemical signal of the redox probe Fe(CN) 6 3- which is measured best at a voltage of 0.188 mV (vs. reference electrode). In the presence of ampicillin, the formation of aptamer-ampicillin conjugate blocks the further immobilization of DNA-AuNPs and ssDNA-BP, and this leads to an increased response. The method has a linear reposne that convers the 1 pM to 5 nM ampicillin concentration range, with a 0.38 pM detection limit (at an S/N ratio of 3). The assay is selective, stable and reproducible. It was applied to the determination of ampicillin in spiked milk samples where it gave recoveries ranging from 95.5 to 105.5%. Graphical abstract Schematic of a simple and sensitive electrochemical apta-biosensor for ampicillin detection. It is based on the use of gold nanoparticles (AuNPs), DNA aptamer, DNA functionalized AuNPs (DNA-AuNPs), and single-strand DNA binding protein (SSBP).

  9. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  10. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    Dugle, D.L.

    1979-10-01

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  11. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    Science.gov (United States)

    2011-01-01

    Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of oral microbiology, as many of

  12. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    Directory of Open Access Journals (Sweden)

    Thurnheer Thomas

    2011-01-01

    Full Text Available Abstract Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of

  13. Improved Genome Editing Efficiency and Flexibility Using Modified Oligonucleotides with TALEN and CRISPR-Cas9 Nucleases

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Renaud

    2016-03-01

    Full Text Available Genome editing has now been reported in many systems using TALEN and CRISPR-Cas9 nucleases. Precise mutations can be introduced during homology-directed repair with donor DNA carrying the wanted sequence edit, but efficiency is usually lower than for gene knockout and optimal strategies have not been extensively investigated. Here, we show that using phosphorothioate-modified oligonucleotides strongly enhances genome editing efficiency of single-stranded oligonucleotide donors in cultured cells. In addition, it provides better design flexibility, allowing insertions more than 100 bp long. Despite previous reports of phosphorothioate-modified oligonucleotide toxicity, clones of edited cells are readily isolated and targeted sequence insertions are achieved in rats and mice with very high frequency, allowing for homozygous loxP site insertion at the mouse ROSA locus in particular. Finally, when detected, imprecise knockin events exhibit indels that are asymmetrically positioned, consistent with genome editing taking place by two steps of single-strand annealing.

  14. Interfacing click chemistry with automated oligonucleotide synthesis for the preparation of fluorescent DNA probes containing internal xanthene and cyanine dyes

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2013-01-01

    for the first time performed solid-phase copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) click labeling during the automated phosphoramidite oligonucleotide synthesis followed by postsynthetic click reactions in solution. We demonstrate that our novel strategy is rapid and efficient for the preparation...... Stokes shifts (40-110 nm), quenched fluorescence of single-stranded probes accompanied by up to 7.7-fold light-up effect of emission upon target DNA/RNA binding, remarkable sensitivity to single-nucleotide mismatches, generally high fluorescence brightness values (FB up to 26), and hence low limit...

  15. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  16. Slowing single-stranded DNA translocation through a solid-state nanopore by decreasing the nanopore diameter.

    Science.gov (United States)

    Akahori, Rena; Haga, Takanobu; Hatano, Toshiyuki; Yanagi, Itaru; Ohura, Takeshi; Hamamura, Hirotaka; Iwasaki, Tomio; Yokoi, Takahide; Anazawa, Takashi

    2014-07-11

    To slow the translocation of single-stranded DNA (ssDNA) through a solid-state nanopore, a nanopore was narrowed, and the effect of the narrowing on the DNA translocation speed was investigated. In order to accurately measure the speed, long (5.3 kb) ssDNA (namely, ss-poly(dA)) with uniform length (±0.4 kb) was synthesized. The diameters of nanopores fabricated by a transmission electron microscope were controlled by atomic-layer deposition. Reducing the nanopore diameter from 4.5 to 2.3 nm slowed down the translocation of ssDNA by more than 16 times (to 0.18 μs base(-1)) when 300 mV was applied across the nanopore. It is speculated that the interaction between the nanopore and the ssDNA dominates the translocation speed. Unexpectedly, the translocation speed of ssDNA through the 4.5 nm nanopore is more than two orders of magnitude higher than that of double-stranded DNA (dsDNA) through a nanopore of almost the same size. The cause of such a faster translocation of ssDNA can be explained by the weaker drag force inside the nanopore. Moreover, the measured translocation speeds of ssDNA and dsDNA agree well with those calculated by molecular-dynamics (MD) simulation. The MD simulation predicted that reducing the nanopore diameter to almost the same as that of ssDNA (i.e. 1.4 nm) decreases the translocation speed (to 1.4 μs base(-1)). Narrowing the nanopore is thus an effective approach for accomplishing nanopore DNA sequencing.

  17. The application of strand invasion phenomenon, directed by peptide nucleic acid (PNA) and single-stranded DNA binding protein (SSB) for the recognition of specific sequences of human endogenous retroviral HERV-W family.

    Science.gov (United States)

    Machnik, Grzegorz; Bułdak, Łukasz; Ruczyński, Jarosław; Gąsior, Tomasz; Huzarska, Małgorzata; Belowski, Dariusz; Alenowicz, Magdalena; Mucha, Piotr; Rekowski, Piotr; Okopień, Bogusław

    2017-05-01

    The HERV-W family of human endogenous retroviruses represents a group of numerous sequences that show close similarity in genetic composition. It has been documented that some members of HERV-W-derived expression products are supposed to play significant role in humans' pathology, such as multiple sclerosis or schizophrenia. Other members of the family are necessary to orchestrate physiological processes (eg, ERVWE1 coding syncytin-1 that is engaged in syncytiotrophoblast formation). Therefore, an assay that would allow the recognition of particular form of HERV-W members is highly desirable. A peptide nucleic acid (PNA)-mediated technique for the discrimination between multiple sclerosis-associated retrovirus and ERVWE1 sequence has been developed. The assay uses a PNA probe that, being fully complementary to the ERVWE1 but not to multiple sclerosis-associated retrovirus (MSRV) template, shows high selective potential. Single-stranded DNA binding protein facilitates the PNA-mediated, sequence-specific formation of strand invasion complex and, consequently, local DNA unwinding. The target DNA may be then excluded from further analysis in any downstream process such as single-stranded DNA-specific exonuclease action. Finally, the reaction conditions have been optimized, and several PNA probes that are targeted toward distinct loci along whole HERV-W env sequences have been evaluated. We believe that PNA/single-stranded DNA binding protein-based application has the potential to selectively discriminate particular HERV-W molecules as they are at least suspected to play pathogenic role in a broad range of medical conditions, from psycho-neurologic disorders (multiple sclerosis and schizophrenia) and cancers (breast cancer) to that of an auto-immunologic background (psoriasis and lupus erythematosus). Copyright © 2016 John Wiley & Sons, Ltd.

  18. Differentiation of Short Single-Stranded DNA Homopolymers in Solid-State Nanopores

    Science.gov (United States)

    Venta, Kimberly; Shemer, Gabriel; Puster, Matthew; Rodríguez-Manzo, Julio A.; Balan, Adrian; Rosenstein, Jacob K.; Shepard, Ken; Drndić, Marija

    2013-01-01

    In the last two decades, new techniques that monitor ionic current modulations as single molecules pass through a nanoscale pore have enabled numerous single-molecule studies. While biological nanopores have recently shown the ability to resolve single nucleotides within individual DNA molecules, similar developments with solid-state nanopores have lagged, due to challenges both in fabricating stable nanopores of similar dimensions as biological nanopores and in achieving sufficiently low-noise and high-bandwidth recordings. Here we show that small silicon nitride nanopores (0.8 to 2-nm-diameter in 5 to 8-nm-thick membranes) can resolve differences between ionic current signals produced by short (30 base) ssDNA homopolymers (poly(dA), poly(dC), poly(dT)), when combined with measurement electronics that allow a signal-to-noise ratio of better than 10 to be achieved at 1 MHz bandwidth. While identifying intramolecular DNA sequences with silicon nitride nanopores will require further improvements in nanopore sensitivity and noise levels, homopolymer differentiation represents an important milestone in the development of solid-state nanopores. PMID:23621759

  19. Short G-rich oligonucleotides as a potential therapeutic for Huntington's Disease

    Directory of Open Access Journals (Sweden)

    Parekh-Olmedo Hetal

    2006-10-01

    Full Text Available Abstract Background Huntington's Disease (HD is an inherited autosomal dominant genetic disorder in which neuronal tissue degenerates. The pathogenesis of the disease appears to center on the development of protein aggregates that arise initially from the misfolding of the mutant HD protein. Mutant huntingtin (Htt is produced by HD genes that contain an increased number of glutamine codons within the first exon and this expansion leads to the production of a protein that misfolds. Recent studies suggest that mutant Htt can nucleate protein aggregation and interfere with a multitude of normal cellular functions. Results As such, efforts to find a therapy for HD have focused on agents that disrupt or block the mutant Htt aggregation pathway. Here, we report that short guanosine monotonic oligonucleotides capable of adopting a G-quartet structure, are effective inhibitors of aggregation. By utilizing a biochemical/immunoblotting assay as an initial screen, we identified a 20-mer, all G-oligonucleotide (HDG as an active molecule. Subsequent testing in a cell-based assay revealed that HDG was an effective inhibitor of aggregation of a fusion protein, comprised of a mutant Htt fragment and green fluorescent protein (eGFP. Taken together, our results suggest that a monotonic G-oligonucleotide, capable of adopting a G-quartet conformation is an effective inhibitor of aggregation. This oligonucleotide can also enable cell survival in PC12 cells overexpressing a mutant Htt fragment fusion gene. Conclusion Single-stranded DNA oligonucleotides capable of forming stable G-quartets can inhibit aggregation of the mutant Htt fragment protein. This activity maybe an important part of the pathogenecity of Huntington's Disease. Our results reveal a new class of agents that could be developed as a therapeutic approach for Huntington's Disease.

  20. Molecular dosimetry of DNA damage caused by alkylation. I. Single-strand breaks induced by ethylating agents in cultured mammalian cells in relation to survival

    NARCIS (Netherlands)

    Abbondandolo, A.; Dogliotti, E.; Lohman, P.H.M.; Berends, F.

    1982-01-01

    Cultured Chinese hamster ovary cells were treated with ethylating agents. DNA lesions giving rise to single-strand breaks (ssb) or alkali-labile sites were measured by centrifugation in alkaline sucrose gradients after lysis in alkali. 4 agents with different tendencies to ethylate preferentially

  1. Initiation and termination of the bacteriophage phi X174 rolling circle DNA replication in vivo: packaging of plasmid single-stranded DNA into bacteriophage phi X174 coats

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; Weisbeek, P. J.

    1982-01-01

    The bacteriophage phi X174 viral (+) origin when inserted in a plasmid can interact in vivo with the A protein produced by infecting phi X174 phages. A consequence of this interaction is packaging of single-stranded plasmid DNA into preformed phage coats resulting in infective particles (1). This

  2. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57 ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  3. Identification and characterization of single-stranded DNA-binding protein from the facultative psychrophilic bacteria Pseudoalteromonas haloplanktis.

    Science.gov (United States)

    Olszewski, Marcin; Nowak, Marta; Cyranka-Czaja, Anna; Kur, Józef

    2014-01-01

    Single-stranded DNA-binding protein (SSB) plays an important role in DNA metabolism such as DNA replication, repair, and recombination, and is essential for cell survival. This study reports on the ssb-like gene cloning, gene expression and characterization of a single-stranded DNA-binding protein of Pseudoalteromonas haloplanktis (PhaSSB) and is the first report of such a protein from psychrophilic microorganism. PhaSSB possesses a high sequence similarity to Escherichia coli SSB (48% identity and 57% similarity) and has the longest amino acid sequence (244 amino acid residues) of all the known bacterial SSBs with one OB-fold per monomer. An analysis of purified PhaSSB by means of chemical cross-linking experiments, sedimentation analysis and size exclusion chromatography revealed a stable tetramer in solution. Using EMSA, we characterized the stoichiometry of PhaSSB complexed with a series of ssDNA homopolymers, and the size of the binding site was determined as being approximately 35 nucleotides long. In fluorescence titrations, the occluded site size of PhaSSB on poly(dT) is 34 nucleotides per tetramer under low-salt conditions (2mM NaCl), but increases to 54-64 nucleotides at higher-salt conditions (100-300mM NaCl). This suggests that PhaSSB undergoes a transition between ssDNA binding modes, which is observed for EcoSSB. The binding properties of PhaSSB investigated using SPR technology revealed that the affinity of PhaSSB to ssDNA is typical of SSB proteins. The only difference in the binding mode of PhaSSB to ssDNA is a faster association phase, when compared to EcoSSB, though compensated by faster dissociation rate. When analyzed by differential scanning calorimetry (DSC), the melting temperature (Tm) was determined as 63 °C, which is only a few degrees lower than for EcoSSB. Copyright © 2013 Elsevier GmbH. All rights reserved.

  4. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  5. Organization of DNA partners and strand exchange mechanisms during Flp site-specific recombination analyzed by difference topology, single molecule FRET and single molecule TPM.

    Science.gov (United States)

    Ma, Chien-Hui; Liu, Yen-Ting; Savva, Christos G; Rowley, Paul A; Cannon, Brian; Fan, Hsiu-Fang; Russell, Rick; Holzenburg, Andreas; Jayaram, Makkuni

    2014-02-20

    Flp site-specific recombination between two target sites (FRTs) harboring non-homology within the strand exchange region does not yield stable recombinant products. In negatively supercoiled plasmids containing head-to-tail sites, the reaction produces a series of knots with odd-numbered crossings. When the sites are in head-to-head orientation, the knot products contain even-numbered crossings. Both types of knots retain parental DNA configuration. By carrying out Flp recombination after first assembling the topologically well defined Tn3 resolvase synapse, it is possible to determine whether these knots arise by a processive or a dissociative mechanism. The nearly exclusive products from head-to-head and head-to-tail oriented "non-homologous" FRT partners are a 4-noded knot and a 5-noded knot, respectively. The corresponding products from a pair of native (homologous) FRT sites are a 3-noded knot and a 4-noded catenane, respectively. These results are consistent with non-homology-induced two rounds of dissociative recombination by Flp, the first to generate reciprocal recombinants containing non-complementary base pairs and the second to produce parental molecules with restored base pairing. Single molecule fluorescence resonance energy transfer (smFRET) analysis of geometrically restricted FRTs, together with single molecule tethered particle motion (smTPM) assays of unconstrained FRTs, suggests that the sites are preferentially synapsed in an anti-parallel fashion. This selectivity in synapse geometry occurs prior to the chemical steps of recombination, signifying early commitment to a productive reaction path. The cumulative topological, smFRET and smTPM results have implications for the relative orientation of DNA partners and the directionality of strand exchange during recombination mediated by tyrosine site-specific recombinases. Copyright © 2013. Published by Elsevier Ltd.

  6. Hybridization with synthetic oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Szostak, J.W.; Stiles, J.I.; Tye, B.K.; Sherman, F.; Wu, R.

    1978-01-01

    Procedures are described for the use of synthetic oligonucleotides for Southern blot experiments and gene bank screening, and the effect of various mismatches on the efficiency of hybridization is demonstrated. The following topics are discussed: sensitivity vs. specificity, hybridization of a 12-mer to the lambda endolysin gene; hybridization of oligonucleotide probes to the E. coli lac operator; hybridization of synthetic probes to the CYC1 gene of yeast; and cloning eucaryotic genes. (HLW)

  7. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  8. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  9. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-02-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  10. Functional analysis of multiple single-stranded DNA-binding proteins from Methanosarcina acetivorans and their effects on DNA synthesis by DNA polymerase BI.

    Science.gov (United States)

    Robbins, Justin B; Murphy, Mary C; White, Bryan A; Mackie, Roderick I; Ha, Taekjip; Cann, Isaac K O

    2004-02-20

    Single-stranded DNA-binding proteins and their functional homologs, replication protein A, are essential components of cellular DNA replication, repair and recombination. We describe here the isolation and characterization of multiple replication protein A homologs, RPA1, RPA2, and RPA3, from the archaeon Methanosarcina acetivorans. RPA1 comprises four single-stranded DNA-binding domains, while RPA2 and RPA3 are each composed of two such domains and a zinc finger domain. Gel filtration analysis suggested that RPA1 exists as homotetramers and homodimers in solution, while RPA2 and RPA3 form only homodimers. Unlike the multiple RPA proteins found in other Archaea and eukaryotes, each of the M. acetivorans RPAs can act as a distinct single-stranded DNA-binding protein. Fluorescence resonance energy transfer and fluorescence polarization anisotropy studies revealed that the M. acetivorans RPAs bind to as few as 10 single-stranded DNA bases. However, more stable binding is achieved with single-stranded DNA of 18-23 bases, and for such substrates the estimated Kd was 3.82 +/- 0.28 nM, 173.6 +/- 105.17 nM, and 5.92 +/- 0.23 nM, for RPA1, RPA2, and RPA3, respectively. The architectures of the M. acetivorans RPAs are different from those of hitherto reported homologs. Thus, these proteins may represent novel forms of replication protein A. Most importantly, our results show that the three RPAs and their combinations highly stimulate the primer extension capacity of M. acetivorans DNA polymerase BI. Although bacterial SSB and eukaryotic RPA have been shown to stimulate DNA synthesis by their cognate DNA polymerases, our findings provide the first in vitro biochemical evidence for the conservation of this property in an archaeon.

  11. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins.In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity.We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  12. EFFECTOR OF TRANSCRIPTION2 is involved in xylem differentiation and includes a functional DNA single strand cutting domain.

    Science.gov (United States)

    Ivanov, Rumen; Tiedemann, Jens; Czihal, Andreas; Schallau, Anna; Diep, Le Hong; Mock, Hans-Peter; Claus, Bernhard; Tewes, Annegret; Bäumlein, Helmut

    2008-01-01

    EFFECTORS OF TRANSCRIPTION2 (ET) are plant-specific regulatory proteins characterized by the presence of two to five C-terminal DNA- and Zn-binding repeats, and a highly conserved cysteine pattern. We describe the structural characterization of the three member Arabidopsis thaliana ET gene family and reveal some allelic sequence polymorphisms. A mutation analysis showed that AtET2 affects the expression of various KNAT genes involved in the maintenance of the undifferentiated state of cambial meristem cells. It also plays a role in the regulation of GA5 (gibberellin 3-beta-dioxygenase) and the cell-cycle-related GASA4. A correlation was established between AtET2 expression and the cellular differentiation state. AtET-GFP fusion proteins shuttle between the cytoplasm and nucleus, with the AtET2 product prevented from entering the nucleus in non-differentiating cells. Within the nucleus, AtET2 probably acts via a single strand cutting domain. A more general regulatory role for ET factors is proposed, governing cell differentiation in cambial meristems, a crucial process for the development of plant vascular tissues.

  13. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  14. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, Christine; Marceau, Aimee H.; Miller, Katherine H.; Marqusee, Susan; Keck, James L. (UW-MED); (UCB)

    2015-04-22

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  15. Change of conformation and internal dynamics of supercoiled DNA upon binding of Escherichia coli single-strand binding protein

    International Nuclear Information System (INIS)

    Langowski, J.; Benight, A.S.; Fujimoto, B.S.; Schurr, J.M.; Schomburg, U.

    1985-01-01

    The influence of Escherichia coli single-strand binding (SSB) protein on the conformation and internal dynamics of pBR322 and pUC8 supercoiled DNAs has been investigated by using dynamic light scattering at 632.8 and 351.1 nm and time-resolved fluorescence polarization anisotropy of intercalated ethidium. SSB protein binds to both DNAs up to a stoichiometry that is sufficient to almost completely relax the superhelical turns. Upon saturation binding, the translational diffusion coefficients (D 0 ) of both DNAs decrease by approximately 20%. Apparent diffusion coefficients (D/sub app/) obtained from dynamic light scattering display the well-known increase with K 2 (K = scattering vector), leveling off toward a plateau value (D/sub plat/) at high K 2 . For both DNAs, the difference D/sub plat/ - D 0 increases upon relaxation of supercoils by SSB protein, which indicates a corresponding enhancement of the subunit mobilities in internal motions. Fluorescence polarization anisotropy measurements on free and complexed pBR322 DNA indicate a (predominantly) uniform torsional rigidity for the saturated DNA/SSB protein complex that is significantly reduced compared to the free DNA. These observations are all consistent with the notion that binding of SSB protein is accompanied by a gradual loss of supercoils and saturates when the superhelical twist is largely removed

  16. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110).

    Science.gov (United States)

    Cerdá, Jorge I; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C; Gómez-Rodríguez, José M; Dávila, María E

    2016-10-06

    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin-orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one.

  17. Capillary electrophoresis ribosomal RNA single-stranded conformation polymorphism: a new approach for characterization of low-diversity microbial communities.

    Science.gov (United States)

    Nai, Yi H; Zemb, Oliver; Gutierrez-Zamora, Maria-Luisa; Manefield, Mike; Powell, Shane M; Breadmore, Michael C

    2012-10-01

    Capillary electrophoresis (CE) has been the principle system for nucleic acid analysis since the early 1990s due to its inherent advantages such as fast analysis time, high resolution and efficiency, minimal sample requirement, high detection sensitivity, and automation. In the past few decades, microbial community fingerprinting methods such as terminal restriction fragment length polymorphism and single-stranded conformation polymorphism (SSCP) have migrated to CE to utilize its advantages over conventional slab gel electrophoresis. Recently, a gel-based direct rRNA fingerprint method was demonstrated. Different from other existing microbial community characterization approaches, this novel approach is polymerase chain reaction free and capable of providing information on the relative abundance of rRNA from individual phylotypes in low-diversity samples. As a gel-based method, it has a long analysis time and relatively large reagent and sample requirements. Here, we addressed these limitations by transferring the RNA fingerprint approach to the CE platform. Analysis time significantly improved from 24 h to 60 min, and the use of a fluorescently labeled hybridization probe as the detection strategy decreased the sample requirement by ten-fold. The combination of fast analysis time, low sample requirement, and sensitive fluorescence detection makes CE-RNA-SSCP an appealing new approach for characterizing low-diversity microbial communities.

  18. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  19. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  20. Assembly of presynaptic filaments. Factors affecting the assembly of RecA protein onto single-stranded DNA

    DEFF Research Database (Denmark)

    Thresher, RJ; Christiansen, Gunna; Griffith, JD

    1988-01-01

    We have previously shown that the assembly of RecA protein onto single-stranded DNA (ssDNA) facilitated by SSB protein occurs in three steps: (1) rapid binding of SSB protein to the ssDNA; (2) nucleation of RecA protein onto this template; and (3) co-operative polymerization of additional Rec......M in the presence of 12 mM-Mg2+), and relatively low concentrations of SSB protein (1 monomer per 18 nucleotides). Assembly was depressed threefold when SSB protein was added to one monomer per nine nucleotides. These effects appeared to be exerted at the nucleation step. Following nucleation, RecA protein...... assembled onto ssDNA at net rates that varied from 250 to 900 RecA protein monomers per minute, with the rate inversely related to the concentration of SSB protein. Combined sucrose sedimentation and electron microscope analysis established that SSB protein was displaced from the ssDNA during RecA protein...

  1. Unveiling the pentagonal nature of perfectly aligned single-and double-strand Si nano-ribbons on Ag(110)

    Science.gov (United States)

    Cerdá, Jorge I.; Sławińska, Jagoda; Le Lay, Guy; Marele, Antonela C.; Gómez-Rodríguez, José M.; Dávila, María E.

    2016-01-01

    Carbon and silicon pentagonal low-dimensional structures attract a great interest as they may lead to new exotic phenomena such as topologically protected phases or increased spin–orbit effects. However, no pure pentagonal phase has yet been realized for any of them. Here we unveil through extensive density functional theory calculations and scanning tunnelling microscope simulations, confronted to key experimental facts, the hidden pentagonal nature of single- and double-strand chiral Si nano-ribbons perfectly aligned on Ag(110) surfaces whose structure has remained elusive for over a decade. Our study reveals an unprecedented one-dimensional Si atomic arrangement solely comprising almost perfect alternating pentagons residing in the missing row troughs of the reconstructed surface. We additionally characterize the precursor structure of the nano-ribbons, which consists of a Si cluster (nano-dot) occupying a silver di-vacancy in a quasi-hexagonal configuration. The system thus materializes a paradigmatic shift from a silicene-like packing to a pentagonal one. PMID:27708263

  2. Oligonucleotide length dependent formation of virus-like particles.

    Science.gov (United States)

    Maassen, Stan J; de Ruiter, Mark Vincent; Lindhoud, Saskia; Cornelissen, Jeroen J L M

    2018-03-08

    Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study the Cowpea Chlorotic Mottle Virus is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short single-stranded DNA is studied at neutral pH, where the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering shows that the assembly efficiency and speed of the particles increases with increasing length of oligonucleotides. The minimal length required for assembly at the conditions used here is shown to be 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, confirming a low cooperative assembly for CCMV and allows for further expansion of current assembly theories. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

    Science.gov (United States)

    Yang, Haozhe; Seela, Frank

    2016-01-22

    A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Current sharing temperature of NbTi SULTAN samples compared to prediction using a single pinning mechanism parametrization for NbTi strand

    International Nuclear Information System (INIS)

    Pong, Ian; Vostner, Alexander; Devred, Arnaud; Bessette, Denis; Mitchell, Neil; Bordini, Bernardo; Bottura, Luca; Jewell, Matthew; Long Feng; Wu Yu

    2012-01-01

    NbTi strands to be used in four of the six ITER poloidal field (PF) coils, all the correction coils (CC) and all the superconducting feeder busbars are being produced in China. Short full-size qualification conductor (cabled and jacketed) samples have been developed at ASIPP and tested at CRPP. Single pinning mechanism parametrization for this Chinese strand (type S2) has been obtained using the Bottura scaling law. The determination of the scaling parameters using a Kramer-type regression method will be described. A comparison between the critical temperature at the operating current and field of a single strand as determined by the parametrization and the current sharing temperature (T CS ) of a few conductor samples tested at the SULTAN facility will be made. The validity and limitation of the estimation will be discussed. The estimated T CS dependence on various (superconducting critical as well as geometric and volumetric) parameters will be assessed using the modelled critical surface. Errors propagated from critical current (I c ) measurements of the strands and parameter fitting, and other uncertainties, will be quantified. (paper)

  5. Human Rad51 filaments on double- and single-stranded DNA : Correlating regular and irregular forms with recombination function

    NARCIS (Netherlands)

    Ristic, D.; Modesti, M.; Van der Heijden, T.; Van Noort, J.; Dekker, C.; Kanaar, R.; Wyman, C.

    Recombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity of

  6. Controlling with light the interaction between trans-tetrapyridyl ruthenium complexes and an oligonucleotide.

    Science.gov (United States)

    van Rixel, Vincent H S; Moolenaar, Geri F; Siegler, Maxime A; Messori, Luigi; Bonnet, Sylvestre

    2018-01-02

    Three new trans-ruthenium(ii) complexes coordinated to tetrapyridyl ligands, namely [Ru(bapbpy)(dmso)Cl]Cl ([2]Cl), [Ru(bapbpy)(Hmte) 2 ](PF 6 ) 2 ([3](PF 6 ) 2 ), and [Ru(biqbpy)(Hmte) 2 ](PF 6 ) 2 ([4](PF 6 ) 2 ), were prepared as analogues of [Ru(biqbpy)(dmso)Cl]Cl ([1]Cl), a recently described photoactivated chemotherapy agent. The new complexes were characterized, and their crystal structures showed the distorted coordination octahedron typical of this family of complexes. Their photoreactivity in solution was analyzed by spectrophotometry and mass spectrometry, which showed that the sulfur ligand was substituted upon blue light irradiation. The binding of the ruthenium complexes to a reference single-stranded oligonucleotide (s( 5' CTACGGTTTCAC 3' )) was explored both in the dark and under light irradiation by gel electrophoresis and high-resolution mass spectrometry. While adduct formation in the dark was negligible for the four complexes, light irradiation led to the formation of adducts with one or two ruthenium centers per oligonucleotide. The absence of interactions in the dark and the presence of complex-oligonucleotide adducts demonstrate that visible light controls the interaction of these ruthenium complexes with nucleic acids.

  7. Recent Advances in Nucleic Acid Targeting Probes and Supramolecular Constructs Based on Pyrene-Modified Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Olga A. Krasheninina

    2017-11-01

    Full Text Available In this review, we summarize the recent advances in the use of pyrene-modified oligonucleotides as a platform for functional nucleic acid-based constructs. Pyrene is of special interest for the development of nucleic acid-based tools due to its unique fluorescent properties (sensitivity of fluorescence to the microenvironment, ability to form excimers and exciplexes, long fluorescence lifetime, high quantum yield, ability to intercalate into the nucleic acid duplex, to act as a π-π-stacking (including anchoring moiety, and others. These properties of pyrene have been used to construct novel sensitive fluorescent probes for the sequence-specific detection of nucleic acids and the discrimination of single nucleotide polymorphisms (SNPs, aptamer-based biosensors, agents for binding of double-stranded DNAs, and building blocks for supramolecular complexes. Special attention is paid to the influence of the design of pyrene-modified oligonucleotides on their properties, i.e., the structure-function relationships. The perspectives for the applications of pyrene-modified oligonucleotides in biomolecular studies, diagnostics, and nanotechnology are discussed.

  8. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  9. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  10. UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

    Science.gov (United States)

    Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

    2017-07-01

    Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

  11. TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA.

    Science.gov (United States)

    Flynn, Rachel Litman; Centore, Richard C; O'Sullivan, Roderick J; Rai, Rekha; Tse, Alice; Songyang, Zhou; Chang, Sandy; Karlseder, Jan; Zou, Lee

    2011-03-24

    Maintenance of telomeres requires both DNA replication and telomere 'capping' by shelterin. These two processes use two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomeres 1 (POT1). Although RPA and POT1 each have a critical role at telomeres, how they function in concert is not clear. POT1 ablation leads to activation of the ataxia telangiectasia and Rad3-related (ATR) checkpoint kinase at telomeres, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. Unexpectedly, we found that purified POT1 and its functional partner TPP1 are unable to prevent RPA binding to telomeric ssDNA efficiently. In cell extracts, we identified a novel activity that specifically displaces RPA, but not POT1, from telomeric ssDNA. Using purified protein, here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) recapitulates the RPA displacing activity. The RPA displacing activity is inhibited by the telomeric repeat-containing RNA (TERRA) in early S phase, but is then unleashed in late S phase when TERRA levels decline at telomeres. Interestingly, TERRA also promotes POT1 binding to telomeric ssDNA by removing hnRNPA1, suggesting that the re-accumulation of TERRA after S phase helps to complete the RPA-to-POT1 switch on telomeric ssDNA. Together, our data suggest that hnRNPA1, TERRA and POT1 act in concert to displace RPA from telomeric ssDNA after DNA replication, and promote telomere capping to preserve genomic integrity.

  12. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Genetic effects and reparation of single-stranded DNA breaks in Arabidopsis thaliana populations growing in the vicinity of the Chernobyl Nuclear Power Station

    International Nuclear Information System (INIS)

    Abramov, V.I.; Sergeeva, S.A.; Ptitsyna, S.N.; Semov, A.B.; Shevchenko, V.A.

    1992-01-01

    The genetic effects and efficiency of repair of single-stranded DNA breaks in natural populations of Arabidopsis growing within a thirty-kilometer zone of the Chernobyl Nuclear Power Station were studied. A direct relationship was found between the level of radioactive contamination and the frequency of embryonal lethal mutations in the Arabidopsis populations studied. A decrease in the efficiency of reparation of single-stranded DNA breaks was found in Arabidopsis plants growing in the contaminated sites. The level of efficiency of DNA reparation was dependent on the duration for which the Arabidopsis population had been growing in the contaminated sites and on the degree of radioactive contamination of the sites. 9 refs., 4 tabs

  14. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  15. Intensive Linkage Mapping in a Wasp (Bracon Hebetor) and a Mosquito (Aedes Aegypti) with Single-Strand Conformation Polymorphism Analysis of Random Amplified Polymorphic DNA Markers

    OpenAIRE

    Antolin, M. F.; Bosio, C. F.; Cotton, J.; Sweeney, W.; Strand, M. R.; Black-IV, W. C.

    1996-01-01

    The use of random amplified polymorphic DNA from the polymerase chain reaction (RAPD-PCR) allows efficient construction of saturated linkage maps. However, when analyzed by agarose gel electrophoresis, most RAPD-PCR markers segregate as dominant alleles, reducing the amount of linkage information obtained. We describe the use of single strand conformation polymorphism (SSCP) analysis of RAPD markers to generate linkage maps in a haplodiploid parasitic wasp Bracon (Habrobracon) hebetor and a d...

  16. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Sharan, R.N.

    2013-01-01

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  17. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single- strand ed DNA -binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  18. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  19. The survival and repair of DNA single-strand breaks in gamma-irradiated Escherichia coli adapted to methyl methane sulfonate

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.; Savel'eva, G.E.

    1992-01-01

    The survival and repair of single-strand breaks of DNA in gamma-irradiated E.coli adapted to methyl methane sulfonate (MMS) (20 mkg/ml during 3 hours) have been investigated. It is shown that the survival of adapted bacteria of radioresistant strains B/r, H/r30, AB1157 and W3110 pol + increases with DMF (dose modification factor) ranging within 1.4-1.8 and in radiosensitive strains B s-1 , AB1157 recA13 and AB1157 lexA3 with DMF ranging within 1.3-1.4, and does not change in strains with mutation in poLA gene P3478 poLA1 and 016 res-3. The increase in radioresistance during the adaptation to MMS correlates with the acceleration of repair of gamma-ray-induced single-strand breaks in the radioresistant strains B/r and W3110 pol + and with the appearance of the ability to repair some part of DNA single-strand breaks in the mutant B s-1

  20. Synthesis and Biophysical Investigations of Oligonucleotides Containing Galactose-Modified DNA, LNA and 2'-Amino-LNA Monomers

    DEFF Research Database (Denmark)

    Ries, Annika; Kumar, Rajesh; Lou, Chenguang

    2016-01-01

    Galactose-modified thymidine, LNA-T and 2'-amino-LNA-T nucleosides were synthesized, converted into the corresponding phosphoramidite derivatives and introduced into short oligonucleotides. Compared to the unmodified control strands, the galactose-modified oligonucleotides in general, and the N2...

  1. Differentially expressed genes from RNA-Seq and functional enrichment results are affected by the choice of single-end versus paired-end reads and stranded versus non-stranded protocols.

    Science.gov (United States)

    Corley, Susan M; MacKenzie, Karen L; Beverdam, Annemiek; Roddam, Louise F; Wilkins, Marc R

    2017-05-23

    RNA-Seq is now widely used as a research tool. Choices must be made whether to use paired-end (PE) or single-end (SE) sequencing, and whether to use strand-specific or non-specific (NS) library preparation kits. To date there has been no analysis of the effect of these choices on identifying differentially expressed genes (DEGs) between controls and treated samples and on downstream functional analysis. We undertook four mammalian transcriptomics experiments to compare the effect of SE and PE protocols on read mapping, feature counting, identification of DEGs and functional analysis. For three of these experiments we also compared a non-stranded (NS) and a strand-specific approach to mapping the paired-end data. SE mapping resulted in a reduced number of reads mapped to features, in all four experiments, and lower read count per gene. Up to 4.3% of genes in the SE data and up to 12.3% of genes in the NS data had read counts which were significantly different compared to the PE data. Comparison of DEGs showed the presence of false positives (average 5%, using voom) and false negatives (average 5%, using voom) using the SE reads. These increased further, by one or two percentage points, with the NS data. Gene ontology functional enrichment (GO) of the DEGs arising from SE or NS approaches, revealed striking differences in the top 20 GO terms, with as little as 40% concordance with PE results. Caution is therefore advised in the interpretation of such results. By comparison, there was overall consistency in gene set enrichment analysis results. A strand-specific protocol should be used in library preparation to generate the most reliable and accurate profile of expression. Ideally PE reads are also recommended particularly for transcriptome assembly. Whilst SE reads produce a DEG list with around 5% of false positives and false negatives, this method can substantially reduce sequencing cost and this saving could be used to increase the number of biological replicates

  2. Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function.

    NARCIS (Netherlands)

    D. Ristic (Dejan); M. Modesti (Mauro); T. van der Heijden (Thijn); J. Noort (John); C. Dekker (Cees); R. Kanaar (Roland); C. Wyman (Claire)

    2005-01-01

    textabstractRecombinase proteins assembled into helical filaments on DNA are believed to be the catalytic core of homologous recombination. The assembly, disassembly and dynamic rearrangements of this structure must drive the DNA strand exchange reactions of homologous recombination. The sensitivity

  3. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  4. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    Science.gov (United States)

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by

  5. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  6. Synthesis and Excellent Duplex Stability of Oligonucleotides Containing 2'-Amino-LNA Functionalized with Galactose Units.

    Science.gov (United States)

    Kumar, Rajesh; Ries, Annika; Wengel, Jesper

    2017-05-21

    A convenient method for the preparation of oligonucleotides containing internally-attached galactose and triantennary galactose units has been developed based on click chemistry between 2'- N -alkyne 2'-amino-LNA nucleosides and azido-functionalized galactosyl building blocks. The synthesized oligonucleotides show excellent binding affinity and selectivity towards complementary DNA/RNA strands with an increase in the melting temperature of up to +23.5 °C for triply-modified variants.

  7. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  8. Intramolecular binding mode of the C-terminus of Escherichia coli single-stranded DNA binding protein determined by nuclear magnetic resonance spectroscopy

    OpenAIRE

    Shishmarev, Dmitry; Wang, Yao; Mason, Claire E.; Su, Xun-Cheng; Oakley, Aaron J.; Graham, Bim; Huber, Thomas; Dixon, Nicholas E.; Otting, Gottfried

    2013-01-01

    Single-stranded DNA (ssDNA) binding protein (SSB) is an essential protein to protect ssDNA and recruit specific ssDNA-processing proteins. Escherichia coli SSB forms a tetramer at neutral pH, comprising a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain) of ∼64 amino acid residues. The C-terminal eight-residue segment of SSB (C-peptide) has been shown to interact with the OB-domain, but crystal structures failed to reveal any electron den...

  9. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  10. Oligonucleotide-mediated gene modification and its promise for animal agriculture.

    Science.gov (United States)

    Laible, Götz; Wagner, Stefan; Alderson, Jon

    2006-01-17

    One of the great aspirations in modern biology is the ability to utilise the expanding knowledge of the genetic basis of phenotypic diversity through the purposeful tailoring of the mammalian genome. A number of technologies are emerging which have the capacity to modify genes in their chromosomal context. Not surprisingly, the major thrust in this area has come from the evaluation of gene therapy applications to correct mutations implicated in human genetic diseases. The recent development of somatic cell nuclear transfer (SCNT) provides access to these technologies for the purposeful modification of livestock animals. The enormous phenotypic variety existent in contemporary livestock animals has in many cases been linked to quantitative trait loci (QTL) and their underlying point mutations, often referred to as single-nucleotide polymorphisms (SNPs). Thus, the ability for the targeted genetic modification of livestock animals constitutes an attractive opportunity for future agricultural applications. In this review, we will summarize attempts and approaches for oligonucleotide-mediated gene modification (OGM) strategies for the site-specific modification of the genome, with an emphasis on chimeric RNA-DNA oligonucleotides (RDOs) and single-stranded oligonucletides (ssODNs). The potential of this approach for the directed genetic improvement of livestock animals is illustrated through examples, outlining the effects of point mutations on important traits, including meat and milk production, reproductive performance, disease resistance and superior models of human diseases. Current technological hurdles and potential strategies that might remove these barriers in the future are discussed.

  11. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  12. Site-specific binding of viral plus single-stranded RNA to replicase-containing open virus-like particles of yeast.

    OpenAIRE

    Esteban, R; Fujimura, T; Wickner, R B

    1988-01-01

    X double-stranded RNA is a deletion mutant of L-A double-stranded RNA and is encapsidated in viral particles by the L-A-encoded major coat protein. X double-stranded RNA has all the cis sites necessary to be transcribed, encapsidated, and replicated. We have cloned X double-stranded RNA and sequenced it. The complete X double-stranded RNA sequence deduced indicates that the first 25 bases of the X plus-strand 5' end originated from the 5' end of the L-A plus strand and that most, if not all, ...

  13. Localization of specific sequences and DNA single-strand breaks in individual UV-A-irradiated human lymphocytes by COMET FISH

    Science.gov (United States)

    Bock, Claudia; Rapp, Alexander; Dittmar, Heike; Monajembashi, Shamci; Greulich, Karl-Otto

    1999-01-01

    The COMET assay, a single cell electrophoresis technique which allows to separate electrophoretically fractionated DNA according to size has been combined with fluorescence in situ hybridization (FISH) which allows to localize specific genes or gene regions. This combination (COMET FISH) allows the detection of DNA single strand breaks in specific regions of the genome of human lymphocytes at the single cell level. Various types of DNA probes, e.g. centromere-, (alpha) - satellite-, telomere-, whole chromosome-, single copy- and region specific DNA probes have been used to investigate whether the UV-A induced DNA single strand breaks are distributed randomly all over the human genome or induced at specific sites ('hot spots'). In the investigated human peripheral blood lymphocytes all but one centromere reveal low sensitivity for UV-A irradiation (500 kJ/m2), while telomeres are randomly distributed over COMET heads and tails. The human chromosome 1 is fractionated by irradiation, but remains in the COMET head, indicating an only moderate degree of fractionation. Among three tested single copy probes, c- myc, p53 and p58, the p53 gene located on chromosome 17p13.1 and the p58 gene (1p36) appear to be located in UV-A stable regions of the human genome in 95% of 65 investigated lymphocytes. In contrast, the c-myc proto-oncogene (8q24) is found in the COMET tail in 90% of the 27 investigated lymphocytes and thus appears to be more sensitive to UV-A irradiation.

  14. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    Science.gov (United States)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.

    2015-02-01

    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  15. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  16. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  18. On-site detection of Phytophthora spp.—single-stranded target DNA as the limiting factor to improve on-chip hybridization

    International Nuclear Information System (INIS)

    Schwenkbier, Lydia; Pollok, Sibyll; Popp, Jürgen; Weber, Karina; König, Stephan; Wagner, Stefan; Werres, Sabine; Weber, Jörg; Hentschel, Martin

    2014-01-01

    We report on a lab-on-a-chip approach for on-site detection of Phytophthora species that allows visual signal readout. The results demonstrate the significance of single-stranded DNA (ssDNA) generation in terms of improving the intensity of the hybridization signal and to improve the reliability of the method. Conventional PCR with subsequent heat denaturation, sodium hydroxide-based denaturation, lambda exonuclease digestion and two asymmetric PCR methods were investigated for the species P. fragariae, P. kernoviae, and P. ramorum. The positioning of the capture probe within the amplified yeast GTP-binding protein (YPT1) target DNA was also of interest because it significantly influences the intensity of the signal. Statistical tests were used to validate the impact of the ssDNA generation methods and the capture-target probe position. The single-stranded target DNA generated by Linear-After-The-Exponential PCR (LATE-PCR) was found to produce signal intensities comparable to post-PCR exonuclease treatment. The LATE-PCR is the best method for the on-site detection of Phytophthora because the enzymatic digestion after PCR is more laborious and time-consuming. (author)

  19. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  20. FAST TRACK COMMUNICATION: String-nets, single- and double-stranded quantum loop gases for non-Abelian anyons

    Science.gov (United States)

    Velenich, Andrea; Chamon, Claudio; Wen, Xiao-Gang

    2010-04-01

    String-nets and quantum loop gases are two prominent microscopic lattice models to describe topological phases. String-net condensation can give rise to both Abelian and non-Abelian anyons, whereas loop condensation usually produces Abelian anyons. It has been proposed, however, that generalized quantum loop gases with non-orthogonal inner products could support non-Abelian anyons. We detail an exact mapping between the string-net and these generalized loop models and explain how the non-orthogonal products arise. We also introduce an equivalent loop model of double-stranded nets where quantum loops with an orthogonal inner product and local interactions supports non-Abelian Fibonacci anyons. Finally, we emphasize the origin of the sign problem in systems with non-Abelian excitations and its consequences on the complexity of their ground state wavefunctions.

  1. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  2. To Nick or Not to Nick: Comparison of I-SceI Single- and Double-Strand Break-Induced Recombination in Yeast and Human Cells

    Science.gov (United States)

    Katz, Samantha S.; Gimble, Frederick S.; Storici, Francesca

    2014-01-01

    Genetic modification of a chromosomal locus to replace an existing dysfunctional allele with a corrected sequence can be accomplished through targeted gene correction using the cell's homologous recombination (HR) machinery. Gene targeting is stimulated by generation of a DNA double-strand break (DSB) at or near the site of correction, but repair of the break via non-homologous end-joining without using the homologous template can lead to deleterious genomic changes such as in/del mutations, or chromosomal rearrangements. By contrast, generation of a DNA single-strand break (SSB), or nick, can stimulate gene correction without the problems of DSB repair because the uncut DNA strand acts as a template to permit healing without alteration of genetic material. Here, we examine the ability of a nicking variant of the I-SceI endonuclease (K223I I-SceI) to stimulate gene targeting in yeast Saccharomyces cerevisiae and in human embryonic kidney (HEK-293) cells. K223I I-SceI is proficient in both yeast and human cells and promotes gene correction up to 12-fold. We show that K223I I-SceI-driven recombination follows a different mechanism than wild-type I-SceI-driven recombination, thus indicating that the initial DNA break that stimulates recombination is not a low-level DSB but a nick. We also demonstrate that K223I I-SceI efficiently elevates gene targeting at loci distant from the break site in yeast cells. These findings establish the capability of the I-SceI nickase to enhance recombination in yeast and human cells, strengthening the notion that nicking enzymes could be effective tools in gene correction strategies for applications in molecular biology, biotechnology, and gene therapy. PMID:24558436

  3. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Improved Performance of Anti-miRNA Oligonucleotides Using a Novel Non-Nucleotide Modifier

    Directory of Open Access Journals (Sweden)

    Kim A Lennox

    2013-01-01

    Full Text Available Anti-microRNA oligonucleotides (AMOs are steric blocking antisense reagents that inhibit microRNA (miRNA function by hybridizing and repressing the activity of a mature miRNA. First generation AMOs employed 2′-O-Methyl RNA nucleotides (2′OMe with phosphorothioate (PS internucleotide linkages positioned at both ends to block exonuclease attack. Second generation AMOs improved potency through the use of chemical modifications that increase binding affinity to the target, such as locked nucleic acid (LNA residues. However, this strategy can reduce specificity as high binding affinity compounds can bind to and suppress function of related sequences even if one or more mismatches are present. Further, unnatural modified nucleic acid residues can have toxic side effects. In the present study, a variety of non-nucleotide modifiers were screened for utility in steric blocking antisense applications. A novel compound, N,N-diethyl-4-(4-nitronaphthalen-1-ylazo-phenylamine (“ZEN”, was discovered that increased binding affinity and blocked exonuclease degradation when placed at or near each end of a single-stranded oligonucleotide. This new modification was combined with the 2′OMe RNA backbone to make ZEN-AMOs. The new ZEN-AMOs have high potency and can effectively inhibit miRNA function in vitro at low nanomolar concentrations, show high specificity, and have low toxicity in cell culture.

  5. Short Oligonucleotides Aligned in Stretched Humid Matrix: Secondary DNA Structure in Poly(vinyl alcohol) Environment

    KAUST Repository

    Hanczyc, Piotr

    2012-04-24

    We report that short, synthetic, double- as well as single-stranded DNA can be aligned in stretched humid poly(vinyl alcohol) (PVA) matrix, and the secondary structure (nucleobase orientation) can be characterized with linear dichroism (LD) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong dependence of helical structure of DNA on PVA hydration level, results of relevance for nanotechnical studies of DNA-based supramolecular systems. Also, the PVA gel could provide possibilities to test models for nucleic acid interactions and distribution in cell contexts, including structural stability of genetic material in the cell and PVA-packaging for gene delivery. A method by which duplex oligonucleotides, with sequences designed to provide specific binding sites, become amenable to polarized-light spectroscopy opens up new possibilities for studying structure in DNA complexes with small adduct molecules as well as proteins. © 2012 American Chemical Society.

  6. Targeted inhibition of transcription elongation in cells mediated by triplex-forming oligonucleotides

    Science.gov (United States)

    Faria, M.; Wood, C. D.; Perrouault, L.; Nelson, J. S.; Winter, A.; White, M. R. H.; Hélène, C.; Giovannangeli, C.

    2000-01-01

    Triple-helix-forming oligonucleotides (TFOs) bind in the major groove of double-stranded DNA at oligopyrimidine⋅oligopurine sequences and therefore are candidate molecules for artificial gene regulation, in vitro and in vivo. We recently have described oligonucleotide analogues containing N3′-P5′ phosphoramidate (np) linkages that exhibited efficient inhibition of transcription elongation in vitro. In the present work we provide conclusive evidence that np-modified TFOs targeted to the HIV-1 polypurine tract (PPT) sequence can inhibit transcriptional elongation in cells, either in transient or stable expression systems. The same constructs were used in transient expression assays (target sequence on transfected plasmid) and in the generation of stable cell lines (target sequence integrated into cellular chromosomes). In both cases the only distinguishable feature between the cellular systems is the presence of an insert containing the wild-type PPT/HIV-1 sequence, a mutated version with two mismatches, or the absence of the insert altogether. The inhibitory action induced by np-TFOs was restricted to the cellular systems containing the complementary wild-type PPT/HIV-1 target, and consequently can be attributed only to a triple-helix-mediated mechanism. As a part of this study we also have applied an imaging technique to quantitatively investigate the dynamics of TFO-mediated specific gene silencing in single cells. PMID:10760257

  7. DNA single- and double-strand breaks by alkaline- and immuno-comet assay in lymphocytes of workers exposed to styrene.

    Science.gov (United States)

    Fracasso, Maria Enrica; Doria, Denise; Carrieri, Mariella; Bartolucci, Giovanni Battista; Quintavalle, Sonia; De Rosa, Edoardo

    2009-02-25

    Occupational exposure to styrene was studied in 34 workers employed in the production of fiberglass-reinforced plastic sheets and compared to 29 unexposed healthy controls. We evaluated genotoxic effects induced by occupational styrene exposure in lymphocytes by alkaline version of the comet assay to detect single-strand breaks (SSBs), DNA oxidation products (formamido pyrimidine glycosilase (Fpg)- and endonuclease (Endo III)-sensitive sites) and DNA repair kinetics studies, as well as the neutral version of comet assay for DNA double-strand breaks (DSBs). An innovative aspect of this study was the use of immuno-comet assay, a new technique that recognizes DSBs with specific antibody by DAPI/FITC method. The battery of parameters included markers of external and internal exposure. Exposed workers showed significant high levels of SSBs (p<0.0001) and DSBs (p<0.0001) in neutral- and immuno-comet assay. A drastic decrease in DNA repair activity as compared to controls was observed (180 min vs. 35 min). Styrene workplace concentration significantly correlated with alkaline comet parameters (TM, p=0.013; TI, p=0.008), in negative with TL (p=0.022), and with DNA-base oxidation (TM Endo III, p=0.048 and TI Endo III, p=0.028). There was a significant negative correlation between urinary metabolites (MA+PGA) and TM Endo III (p=0.032) and TI Endo III (p=0.017).

  8. Cells deficient in PARP-1 show an accelerated accumulation of DNA single strand breaks, but not AP sites, over the PARP-1-proficient cells exposed to MMS.

    Science.gov (United States)

    Pachkowski, Brian F; Tano, Keizo; Afonin, Valeriy; Elder, Rhoderick H; Takeda, Shunichi; Watanabe, Masami; Swenberg, James A; Nakamura, Jun

    2009-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) is a base excision repair (BER) protein that binds to DNA single strand breaks (SSBs) and subsequently synthesizes and transfers poly(ADP-ribose) polymers to various nuclear proteins. Numerous biochemical studies have implicated PARP-1 as a modulator of BER; however, the role of PARP-1 in BER in living cells remains unclear partly due to lack of accurate quantitation of BER intermediates existing in cells. Since DT40 cells, chicken B lymphocytes, naturally lack PARP-2, DT40 cells allow for the investigation of the PARP-1 null phenotype without confounding by PARP-2. To test the hypothesis that PARP-1 is necessary for efficient BER during methylmethane sulfonate (MMS) exposure in vertebrate cells, intact DT40 cells and their isogenic PARP-1 null counterparts were challenged with different exposure scenarios for phenotypic characterization. With chronic exposure, PARP-1 null cells exhibited sensitivity to MMS but with an acute exposure did not accumulate base lesions or AP sites to a greater extent than wild-type cells. However, an increase in SSB content in PARP-1 null cell DNA, as indicated by glyoxal gel electrophoresis under neutral conditions, suggested the presence of BER intermediates. These data suggest that during exposure, PARP-1 impacts the stage of BER after excision of the deoxyribosephosphate moiety from the 5' end of DNA strand breaks by polymerase beta.

  9. Integrative modelling coupled with ion mobility mass spectrometry reveals structural features of the clamp loader in complex with single-stranded DNA binding protein.

    Science.gov (United States)

    Politis, Argyris; Park, Ah Young; Hall, Zoe; Ruotolo, Brandon T; Robinson, Carol V

    2013-11-29

    DNA polymerase III, a decameric 420-kDa assembly, simultaneously replicates both strands of the chromosome in Escherichia coli. A subassembly of this holoenzyme, the seven-subunit clamp loader complex, is responsible for loading the sliding clamp (β2) onto DNA. Here, we use structural information derived from ion mobility mass spectrometry (IM-MS) to build three-dimensional models of one form of the full clamp loader complex, γ3δδ'ψχ (254 kDa). By probing the interaction between the clamp loader and a single-stranded DNA (ssDNA) binding protein (SSB4) and by identifying two distinct conformational states, with and without ssDNA, we assemble models of ψχ-SSB4 (108 kDa) and the clamp loader-SSB4 (340 kDa) consistent with IM data. A significant increase in measured collision cross-section (~10%) of the clamp loader-SSB4 complex upon DNA binding suggests large conformational rearrangements. This DNA bound conformation represents the active state and, along with the presence of ψχ, stabilises the clamp loader-SSB4 complex. Overall, this study of a large heteromeric complex analysed by IM-MS, coupled with integrative modelling, highlights the potential of such an approach to reveal structural features of previously unknown complexes of high biological importance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Ultrasensitive electrochemical biosensor based on the oligonucleotide self-assembled monolayer-mediated immunosensing interface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Dengyou; Luo, Qimei [Science College of Hunan Agricultural University, Changsha 410128 (China); Deng, Fawen [The Fourth Hospital of Chansha, Changsha 410006 (China); Li, Zhen [Science College of Hunan Agricultural University, Changsha 410128 (China); Li, Benxiang, E-mail: 172170960@qq.com [Science College of Hunan Agricultural University, Changsha 410128 (China); Shen, Zhifa, E-mail: shenzhifa@wmu.edu.cn [Key Laboratory of Laboratory Medicine, Ministry of Education, Zhejiang Provincial Key Laboratory of Medical Genetics, College of Laboratory Medicine and Life Sciences, Wenzhou Medical University, Wenzhou 325035 (China)

    2017-06-08

    Highly sensitive and selective quantitation of a variety of proteins over a wide concentration range is highly desirable for increased accuracy of biomarker detection or for multidisease diagnostics. In the present contribution, using human immunoglobulin G (HIgG) as the model target protein, an electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer-mediated (OSAM) sensing interface. For this immunosensor, the “signal-on” signaling mechanism and enzymatic signal amplification effect were integrated into one sensing architecture. Moreover, the thiolated flexible single-stranded DNAs immobilized onto gold electrode surface not only performs the wobbling motion to facilitate the electron transfer between the electrode surface and biosensing layer but also fundamentally prohibiting the direct interaction of proteins with gold substrate. Thus, the electrochemical signal could be efficiently enhanced and the unspecific adsorption or cross-reaction might be eliminated. As a result, utilizing the newly-proposed immunosensor, the HIgG can be detected down to 0.5 ng/mL, and the high detection specificity is offered. The successful design of OSAM and the highly desirable detection capability of new immunosensor are expected to provide a perspective for fabricating new robust immunosensing platform and for promising potential of oligonucleotide probe in biological research and biomedical diagnosis. - Highlights: • An electrochemical ultrasensitive immunosensing platform was developed based on the oligonucleotide self-assembled monolayer (OASM). • OASM severs as a flexible monolayer to promote electron transfer and prohibits the direct interaction of proteins with gold substrate. • The electrochemical signal is efficiently enhanced and the unspecific adsorption or cross-reaction is eliminated. • Target protein can be detected down to 0.5 ng/mL, and the high detection specificity can be obtained.

  11. Pyrene–nucleobase conjugates: synthesis, oligonucleotide binding and confocal bioimaging studies

    Directory of Open Access Journals (Sweden)

    Artur Jabłoński

    2017-11-01

    Full Text Available Fluorescent pyrene–linker–nucleobase (nucleobase = thymine, adenine conjugates with carbonyl and hydroxy functionalities in the linker were synthesized and characterized. X-ray single-crystal structure analysis performed for the pyrene–C(OCH2CH2–thymine (2 conjugate reveals dimers of molecules 2 stabilized by hydrogen bonds between the thymine moieties. The photochemical characterization showed structure-dependent fluorescence properties of the investigated compounds. The conjugates bearing a carbonyl function represent weak emitters as compared to compounds with a hydroxy function in the linker. The self-assembly properties of pyrene nucleobases were investigated in respect to their binding to single and double strand oligonucleotides in water and in buffer solution. In respect to the complementary oligothymidine T10 template in water, compounds 3 and 5 both show a self-assembling behavior according to canonical base–base pairing. However, in buffer solution, derivative 5 was much more effective than 3 in binding to the T10 template. Furthermore the adenine derivative 5 binds to the double-stranded (dA10–T10 template with a self-assembly ratio of 112%. Such a high value of a self-assembly ratio can be rationalized by a triple-helix-like binding, intercalation, or a mixture of both. Remarkably, compound 5 also shows dual staining pattern in living HeLa cells. Confocal microscopy confirmed that 5 predominantly stains mitochondria but it also accumulates in the nucleoli of the cells.

  12. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  13. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  14. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  15. UV light-induced DNA synthesis arrest in HeLa cells is associated with changes in phosphorylation of human single-stranded DNA-binding protein

    International Nuclear Information System (INIS)

    Carty, M.P.; Zernik-Kobak, M.; McGrath, S.; Dixon, K.

    1994-01-01

    We show that DNA replication activity in extracts of human HeLa cells decreases following UV irradiation. Alterations in replication activity in vitro parallel the UV-induced block in cell cycle progression of these cells in culture. UV irradiation also induces specific changes in the pattern of phosphorylation of the 34 kDa subunit of a DNA replication protein, human single-stranded DNA-binding protein (hSSB). The appearance of a hyperphosphorylated form of hSSB correlates with reduced in vitro DNA replication activity in extracts of UV-irradiated cells. Replication activity can be restored to these extracts in vitro by addition of purified hSSB. These results suggest that UV-induced DNA synthesis arrest may be mediated in part through phosphorylation-related alterations in the activity of hSSB, an essential component of the DNA replication apparatus. (Author)

  16. Influence of the single-strand linker composition on the structural/dynamical properties of a truncated octahedral DNA nano-cage family.

    Science.gov (United States)

    Iacovelli, Federico; Alves, Cassio; Falconi, Mattia; Oteri, Francesco; de Oliveira, Cristiano L P; Desideri, Alessandro

    2014-10-01

    The structural/dynamical properties of three truncated octahedral DNA nano-cages composed by identical double helices but single strand linkers with different composition, namely 7 thymidines, 7 adenines, and 7 alternated thymidines and adenines, have been investigated through classical molecular dynamics simulations. Trajectories have been analyzed to investigate the role of the linkers in defining nano-cages stability and flexibility, including possible influence on the internal cages motions. The data indicate that the cages behavior is almost identical and that the structural/dynamical parameters measured along the trajectories are not particularly affected by the presence of different bases. These results demonstrate that the constraints imposed by the nano-structure geometry are the main factor in modulating these properties

  17. Functional roles of the N- and C-terminal regions of the human mitochondrial single-stranded DNA-binding protein.

    Directory of Open Access Journals (Sweden)

    Marcos T Oliveira

    2010-10-01

    Full Text Available Biochemical studies of the mitochondrial DNA (mtDNA replisome demonstrate that the mtDNA polymerase and the mtDNA helicase are stimulated by the mitochondrial single-stranded DNA-binding protein (mtSSB. Unlike Escherichia coli SSB, bacteriophage T7 gp2.5 and bacteriophage T4 gp32, mtSSBs lack a long, negatively charged C-terminal tail. Furthermore, additional residues at the N-terminus (notwithstanding the mitochondrial presequence are present in the sequence of species across the animal kingdom. We sought to analyze the functional importance of the N- and C-terminal regions of the human mtSSB in the context of mtDNA replication. We produced the mature wild-type human mtSSB and three terminal deletion variants, and examined their physical and biochemical properties. We demonstrate that the recombinant proteins adopt a tetrameric form, and bind single-stranded DNA with similar affinities. They also stimulate similarly the DNA unwinding activity of the human mtDNA helicase (up to 8-fold. Notably, we find that unlike the high level of stimulation that we observed previously in the Drosophila system, stimulation of DNA synthesis catalyzed by human mtDNA polymerase is only moderate, and occurs over a narrow range of salt concentrations. Interestingly, each of the deletion variants of human mtSSB stimulates DNA synthesis at a higher level than the wild-type protein, indicating that the termini modulate negatively functional interactions with the mitochondrial replicase. We discuss our findings in the context of species-specific components of the mtDNA replisome, and in comparison with various prokaryotic DNA replication machineries.

  18. Fully automated parallel oligonucleotide synthesizer

    Czech Academy of Sciences Publication Activity Database

    Lebl, M.; Burger, Ch.; Ellman, B.; Heiner, D.; Ibrahim, G.; Jones, A.; Nibbe, M.; Thompson, J.; Mudra, Petr; Pokorný, Vít; Poncar, Pavel; Ženíšek, Karel

    2001-01-01

    Roč. 66, č. 8 (2001), s. 1299-1314 ISSN 0010-0765 Institutional research plan: CEZ:AV0Z4055905 Keywords : automated oligonucleotide synthesizer Subject RIV: CC - Organic Chemistry Impact factor: 0.778, year: 2001

  19. Mapping of HIV-1 integrase preferences for target site selection with various oligonucleotides

    Czech Academy of Sciences Publication Activity Database

    Snášel, Jan; Rosenberg, Ivan; Pačes, Ondřej; Pichová, Iva

    2009-01-01

    Roč. 488, č. 2 (2009), s. 153-162 ISSN 0003-9861 R&D Projects: GA MŠk 1M0508; GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z40550506 Keywords : HIV integrase * strand transfer reaction * oligonucleotide substrates Subject RIV: CE - Biochemistry Impact factor: 3.046, year: 2009

  20. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Kinetics of DNA strand breaks and protection by antioxidants in UVA- or UVB-irradiated HaCaT keratinocytes using the single cell gel electrophoresis assay.

    Science.gov (United States)

    Lehmann, J; Pollet, D; Peker, S; Steinkraus, V; Hoppe, U

    1998-03-01

    The aim of this study was to characterize the genotoxic action of UVA and UVB in human keratinocytes by application of the single cell gel electrophoresis assay (SCGE assay). Dose dependence of DNA damage, the time course of its repair, and the influence of cellular antioxidant status were assessed. Irradiation with UVA or UVB both resulted in a dose-dependent increase in the level of DNA damage. A time course study to evaluate the repair kinetics in keratinocytes irradiated with 5 J/cm2 UVA revealed an immediate occurrence of DNA effects which subsequently disappeared within about 1 h, indicating removal of DNA lesions. This rapid repair of DNA damage is consistent with the observation that 5 J/cm2 UVA did not impair cellular viability. In contrast, exposure to 15 mJ/cm2 UVB resulted in a prolonged repair of DNA damage which lasted about 25 h. Thus, the repair kinetics of UVA- and UVB-induced DNA damage clearly differed from each other, implicating the induction of different types of DNA lesions by UVA and UVB. Neither a pretreatment with Mg-ascorbyl phosphate or D,L-alpha-tocopherol, nor depletion of endogenous glutathione altered cellular sensitivity to UVB. In contrast, the DNA damaging effects of UVA could be counteracted by a pretreatment with these antioxidants. These observations confirm that the UVA-induced effects on DNA are related to radical mediated strand breaks and DNA lesions forming alkali-labile sites. The UVB-induced effects mainly occur as a consequence of excision repair-related strand breaks. The observed repair kinetics of DNA lesions and the influence of cellular antioxidant status may help to elucidate protective mechanisms against the carcinogenic effects of UV radiation present in sunlight.

  2. Polymerase-endonuclease amplification reaction (PEAR for large-scale enzymatic production of antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Xiaolong Wang

    Full Text Available Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR, for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs.

  3. Technetium-99m labeled antisense oligonucleotide-noninvasive tumor imaging in mice

    International Nuclear Information System (INIS)

    Qin, G.M.; Zhang, Y.X.; An, R.; Gao, Z.R.; Cao, W.; Cao, G.X.; Hnatowich, D.J.

    2002-01-01

    Single-stranded RNA and DNA oligonucleotides may be useful as radiopharmaceuticals for antisense and other in vivo applications if convenient methods for stably attaching radionuclides such as 99m Tc can be developed. The c-myc oncogene works in cooperation with other oncogenes in a variety of malignant tumors. The concentration of c-myc messenger RNA increases rapidly 30 to 50 fold during DNA synthesis, thus making it a suitable target for following the progression of malignancy by noninvasive imaging with radiolabeled antisense oligonucleotide probes. Methods: 1 Oligonucleotide Conjugation: A solution of single stranded amine-derivatized DNA (100-1000μg) was prepared at a concentration of 2 mg/ml in 0.25M sodium bicarbonate, 1 M sodium chloride, 1mM EDTA, pH8.5. 2 Oligonucleotide Labeling: A fresh 50mg/ml solution of sodium tartrate was prepared in sterile 0.5 M ammonium The ability of the labeled DNA to hybridize to its complement was analyzed by Sep-Pak column chromatography before and after the addition of the complementary DNA. 3 Biodistribution and Tumor Imaging Studies: A colony of KM mice (15-20g) were inoculated with 1x10 6 Ehrlich carcinoma tumor cells in the right thigh, and the tumors were allowed to grow for 6-7 days to a size of 1.0-1.5 cm in diameter. Biodistribution studies were performed in 32 KM mice after 50 μCi per mouse of 99m Tc-labeled oncogene probes were injected intravenously. A total of 8 mice were injected intravenously in the tail vein with 1-2 mCi of 99m Tc-labeled sense or antisense probes, immobilized with ketamine hydrochloride and imaged periodically from 0.5hr to 24hr with a gamma camera. Results: Essentially complete conjugation was achieved by reverse-phase Sep-Pak C18 chromatography analysis. The labeled antisense DNA still remained the ability to hybridize with its complementary DNA. The highest accumulation of label was in the liver first, with the kidney and small bowel next. The injected activity localized in the lesion

  4. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.

    1975-01-01

    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  5. Clonal origin of multiple lung cancers: K-ras and p53 mutations determined by nonradioisotopic single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Lau, D H; Yang, B; Hu, R; Benfield, J R

    1997-08-01

    Disease stage is the most important factor in determining prognosis and treatment of lung cancer. Staging of lung cancer is complicated by presentation of multiple pulmonary malignant lesions with a similar histology. It is a dilemma to decide if these lesions are synchronous primaries arising from different malignant clones or metastases from a single clone. Lung cancer is associated with multiple genetic abnormalities including mutations of K-ras and p53, which are believed to occur prior to onset of metastasis. To determine the clonal origin of multiple pulmonary malginant nodules, we analyzed point-mutations of K-ras and p53 by microdissection, polymerase chain reactions (PCR), nonradioisotopic single-strand conformation polymorphism (SSCP) analysis, and DNA sequencing. Each pulmonary lesion was microdissected from paraffin slides. Genomic DNA was amplified by two sequential PCRs followed by electrophoresis in a minigel and silver staining. Deoxyribonucleic acid sequencing was performed if necessary to confirm a mutation found upon SSCP analysis. Applying this molecular approach, we were able to differentiate the clonal origins of multiple malignant nodules of the lung as exemplified by the two cases presented.

  6. Development of a gold nanoparticle-based universal oligonucleotide microarray for multiplex and low-cost detection of foodborne pathogens.

    Science.gov (United States)

    Wang, Xiaoqiang; Ying, Sisi; Wei, Xiaoguang; Yuan, Jun

    2017-07-17

    Bacterial foodborne diseases remain major threats to food safety and public health, especially in developing countries. In this study a novel assay, combining gold nanoparticle (GNP)-based multiplex oligonucleotide ligation-PCR and universal oligonucleotide microarray technology, was developed for inexpensive, specific, sensitive, and multiplex detection of eight common foodborne pathogens, including Shigella spp., Campylobacter jejuni, Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, Staphylococcus aureus, and Vibrio parahaemolyticus. The target fragments of the eight pathogens were enriched by multiplex PCR and subjected to multiplex ligase detection reaction. Ligation products were enriched and labeled with GNPs by universal asymmetric PCR, using excess GNP-conjugated primers. The labeled single-stranded amplicons containing complementary tag sequences were captured by the corresponding tag sequences immobilized on microarrays, followed by silver staining for signal enhancement. Black images of microarray spots were visualized by naked eyes or scanned on a simple flatbed scanner, and quantified. The results indicated that this assay could unambiguously discriminate all eight pathogens in single and multiple infections, with detection sensitivity of 3.3-85CFU/mL for pure cultures. Microarray results of ninety-five artificially contaminated and retail food samples were consistent with traditional culture, biochemical and real-time PCR findings. Therefore, the novel assay has the potential to be used for routine detection due to rapidity, low cost, and high specificity and sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Long-range order of organized oligonucleotide monolayers on Au(111) electrodes

    DEFF Research Database (Denmark)

    Wackerbarth, Hainer; Grubb, Mikala; Zhang, Jingdong

    2004-01-01

    , substantiating that domain formation rests on adsorption of thiol-modified oligonucleotide adsorption in an upright or tilted orientation. The comprehensive, high-resolution information reported may hold prospects for single-molecule electronic conduction and molecular-scale mapping of oligonucleotide...

  8. Potent and selective antisense oligonucleotides targeting single-nucleotide polymorphisms in the Huntington disease gene / allele-specific silencing of mutant huntingtin

    DEFF Research Database (Denmark)

    Carroll, Jeffrey B; Warby, Simon C; Southwell, Amber L

    2011-01-01

    Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG-expansion in the huntingtin gene (HTT) that results in a toxic gain of function in the mutant huntingtin protein (mHTT). Reducing the expression of mHTT is therefore an attractive therapy for HD. However, wild......-type HTT protein is essential for development and has critical roles in maintaining neuronal health. Therapies for HD that reduce wild-type HTT may therefore generate unintended negative consequences. We have identified single-nucleotide polymorphism (SNP) targets in the human HD population for the disease...

  9. Conversion of a beta-strand to an alpha-helix induced by a single-site mutation observed in the crystal structure of Fis mutant Pro26Ala.

    OpenAIRE

    Yang, W. Z.; Ko, T. P.; Corselli, L.; Johnson, R. C.; Yuan, H. S.

    1998-01-01

    The conversion from an alpha-helix to a beta-strand has received extensive attention since this structural change may induce many amyloidogenic proteins to self-assemble into fibrils and cause fatal diseases. Here we report the conversion of a peptide segment from a beta-strand to an alpha-helix by a single-site mutation as observed in the crystal structure of Fis mutant Pro26Ala determined at 2.0 A resolution. Pro26 in Fis occurs at the point where a flexible extended beta-hairpin arm leaves...

  10. Comparison of the effect of radiation exposure from dual-energy CT versus single-energy CT on double-strand breaks at CT pulmonary angiography.

    Science.gov (United States)

    Tao, Shu Min; Li, Xie; Schoepf, U Joseph; Nance, John W; Jacobs, Brian E; Zhou, Chang Sheng; Gu, Hai Feng; Lu, Meng Jie; Lu, Guang Ming; Zhang, Long Jiang

    2018-04-01

    To compare the effect of dual-source dual-energy CT versus single-energy CT on DNA double-strand breaks (DSBs) in blood lymphocytes at CT pulmonary angiography (CTPA). Sixty-two patients underwent either dual-energy CTPA (Group 1: n = 21, 80/Sn140 kVp, 89/38 mAs; Group 2: n = 20, 100/Sn140 kVp, 89/76 mAs) or single-energy CTPA (Group 3: n = 21, 120 kVp, 110 mAs). Blood samples were obtained before and 5 min after CTPA. DSBs were assessed with fluorescence microscopy and Kruskal-Walls tests were used to compare DSBs levels among groups. Volume CT dose index (CTDIvol), dose length product (DLP) and organ radiation dose were compared using ANOVA. There were increased excess DSB foci per lymphocyte 5 min after CTPA examinations in three groups (Group 1: P = .001; Group 2: P = .001; Group 3: P = .006). There were no differences among groups regarding excess DSB foci/cell and percentage of excess DSBs (Group 1, 23%; Group 2, 24%; Group 3, 20%; P = .932). CTDIvol, DLP and organ radiation dose in Group 1 were the lowest among the groups (all P dual-source and single-source CTPA, while dual-source dual-energy CT protocols do not increase the estimated radiation dose and also do not result in a higher incidence of DNA DSBs in patients undergoing CTPA. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Structure of the complex of [Ru(tpm)(dppz)py](2+) with a B-DNA oligonucleotide - a single-substituent binding switch for a metallo-intercalator.

    Science.gov (United States)

    Waywell, Philip; Gonzalez, Veronica; Gill, Martin R; Adams, Harry; Meijer, Anthony J H M; Williamson, Mike P; Thomas, James A

    2010-02-22

    We report the synthesis of three new complexes related to the achiral [Ru(tpm)(dppz)py](2+) cation (tpm=tripyridazole methane, dppz=dipyrido[3,2-a:2',3'-c]phenazine, py=pyridine) that contain an additional single functional group on the monodentate ancillary pyridyl ligand. Computational calculations indicate that the coordinated pyridyl rings are in a fixed orientation parallel to the dppz axis, and that the electrostatic properties of the complexes are very similar. DNA binding studies on the new complexes reveal that the nature and positioning of the functional group has a profound effect on the binding mode and affinity of these complexes. To explore the molecular and structural basis of these effects, circular dichroism and NMR studies on [Ru(tpm)(dppz)py]Cl(2) with the octanucleotides d(AGAGCTCT)(2) and d(CGAGCTCG)(2), were carried out. These studies demonstrate that the dppz ligand intercalates into the G(2)-A(3) step, with {Ru(tpm)py} in the minor groove. They also reveal that the complex intercalates into the binding site in two possible orientations with the pyridyl ligand of the major conformer making close contact with terminal base pairs. We conclude that substitution at the 2- or 3-position of the pyridine ring has little effect on binding, but that substitution at the 4-position drastically disrupts intercalative binding, particularly with a 4-amino substituent, because of steric and electronic interactions with the DNA. These results indicate that complexes derived from these systems have the potential to function as sequence-specific light-switch systems.

  12. Thermodynamics of complex structures formed between single-stranded DNA oligomers and the KH domains of the far upstream element binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Sinha, Sudipta Kumar; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2016-05-28

    The noncovalent interaction between protein and DNA is responsible for regulating the genetic activities in living organisms. The most critical issue in this problem is to understand the underlying driving force for the formation and stability of the complex. To address this issue, we have performed atomistic molecular dynamics simulations of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein (FBP) complexed with two single-stranded DNA (ss-DNA) oligomers in aqueous media. Attempts have been made to calculate the individual components of the net entropy change for the complexation process by adopting suitable statistical mechanical approaches. Our calculations reveal that translational, rotational, and configurational entropy changes of the protein and the DNA components have unfavourable contributions for this protein-DNA association process and such entropy lost is compensated by the entropy gained due to the release of hydration layer water molecules. The free energy change corresponding to the association process has also been calculated using the Free Energy Perturbation (FEP) method. The free energy gain associated with the KH4–DNA complex formation has been found to be noticeably higher than that involving the formation of the KH3–DNA complex.

  13. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  14. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray.

    Science.gov (United States)

    Kennedy, Laura; Vass, J Keith; Haggart, D Ross; Moore, Steve; Burczynski, Michael E; Crowther, Dan; Miele, Gino

    2008-08-25

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene() RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2() enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene() blood samples also advocate a short, fixed room temperature storage time for all PAXgene() blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  15. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Science.gov (United States)

    Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

    2008-01-01

    Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

  16. A biomarker model of sublethal genotoxicity (DNA single-strand breaks and adducts) using the sentinel organism Aporrectodea longa in spiked soil

    International Nuclear Information System (INIS)

    Martin, Francis L.; Piearce, Trevor G.; Hewer, Alan; Phillips, David H.; Semple, Kirk T.

    2005-01-01

    There is a need to develop risk biomarkers during the remediation of contaminated land. We employed the earthworm, Aporrectodea longa (Ude), to determine whether genotoxicity measures could be applied to this organism's intestinal tissues. Earthworms were added, for 24 h or 7 days, to soil samples spiked with benzo[a]pyrene (B[a]P) and/or lindane. After exposure, intestinal tissues (crop/gizzard or intestine) were removed prior to the measurement in disaggregated cells of DNA single-strand breaks (SSBs) by the alkaline comet assay. Damage was quantified by comet tail length (CTL, μm). B[a]P 24-h exposure induced dose-related increases (P 32 P-postlabelling, showed a two-adduct-spot pattern. This preliminary investigation suggests that earthworm tissues may be incorporated into genotoxicity assays to facilitate hazard identification within terrestrial ecosystems. - Sublethal genotoxicity in the sentinel organism A. longa can be used to monitor the effects of contaminants in soil

  17. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  18. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against the Pesticide Fipronil and Sensitive Detection in River Water

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2017-12-01

    Full Text Available Fipronil is a commonly used insecticide that has been shown to have environmental and human health risks. The current standard methods of detection for fipronil and its metabolites, such as GC-MS, are time consuming and labor intensive. In this study, a variant of systematic evolution of ligands by exponential enrichment (SELEX, was utilized to identify the first single-stranded DNA (ssDNA molecular recognition element (MRE that binds to fipronil with high affinity (Kd = 48 ± 8 nM. The selected MRE displayed low cross binding activity on various environmentally relevant, structurally unrelated herbicides and pesticides, in addition to broad-spectrum binding activity on major metabolites of fipronil and a structurally similar pesticide in prepared river samples. Additionally, a proof-of-principle fluorescent detection assay was developed by using the selected ssDNA MRE as a signal-reporting element, with a limit of detection of 105 nM in a prepared river water sample.

  19. Simultaneous identification of seven foodborne pathogens and Escherichia coli (pathogenic and nonpathogenic) using capillary electrophoresis-based single-strand conformation polymorphism coupled with multiplex PCR.

    Science.gov (United States)

    Oh, Mi-Hwa; Paek, Se-Hee; Shin, Gi Won; Kim, Hae-Yeong; Jung, Gyoo Yeol; Oh, Sangsuk

    2009-06-01

    The objective of this study was to develop a novel technique for parallel analysis of eight important foodborne microbes using capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) coupled with multiplex PCR. Specific primers for multiplex PCR amplification of the 16S rRNA gene were designed, corresponding to eight species of bacteria, including Escherichia coli, Clostridium perfringens, Campylobacter jejuni, Salmonella enterica, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Bacillus cereus, for the species-specific identification and optimal separation of their PCR products in subsequent analysis by CE-SSCP. Multiplex PCR conditions including annealing temperature, extension time, the number of PCR cycles, and primer concentrations were then optimized for simultaneous detection of all target foodborne bacteria. The diagnostic system using CE-SSCP combined with multiplex PCR developed here can be used for rapid investigation of causative agents of foodborne illness. The simplicity and high sensitivity of the method may lead to improved management of safety and illness related to food.

  20. Selection and Characterization of Single-Stranded DNA Aptamers Binding Human B-Cell Surface Protein CD20 by Cell-SELEX

    Directory of Open Access Journals (Sweden)

    Mansoureh Haghighi

    2018-03-01

    Full Text Available The B-lymphocyte antigen (CD20 is a suitable target for single-stranded (ss nucleic acid oligomer (aptamers. The aim of study was selection and characterization of a ssDNA aptamer against CD20 using Cell-Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX. The cDNA clone of CD20 (pcDNA-CD20 was transfected to human embryonic kidney (HEK293T cells. Ten rounds of Cell-SELEX was performed on recombinant HEK-CD20 cells. The final eluted ssDNA pool was amplified and ligated in T/A vector for cloning. The plasmids of positive clones were extracted, sequenced and the secondary structures of the aptamers predicted using DNAMAN® software. The sequencing results revealed 10 different types; three of them had the highest thermodynamic stability, named AP-1, AP-2 and AP-3. The AP-1 aptamer was the most thermodynamically stable one (ΔGAP-1 = −10.87 kcal/mol with the highest binding affinity to CD20 (96.91 ± 4.5 nM. Since, the CD20 is a suitable target for recognition of B-Cell. The selected aptamers could be comparable to antibodies with many advantages. The AP-1, AP-2 and AP-3 could be candidate instead of antibodies for diagnostic and therapeutic applications in immune deficiency, autoimmune diseases, leukemia and lymphoma.

  1. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.

    Science.gov (United States)

    Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus

    2011-04-06

    Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.

  3. Electronic Structures of LNA Phosphorothioate Oligonucleotides

    DEFF Research Database (Denmark)

    Bohr, Henrik G.; Shim, Irene; Stein, Cy

    2017-01-01

    Important oligonucleotides in anti-sense research have been investigated in silico and experimentally. This involves quantum mechanical (QM) calculations and chromatography experiments on locked nucleic acid (LNA) phosphorothioate (PS) oligonucleotides. iso-potential electrostatic surfaces are es...

  4. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  5. Single and repeated moderate consumption of native or dealcoholized red wine show different effects on antioxidant parameters in blood and DNA strand breaks in peripheral leukocytes in healthy volunteers: a randomized controlled trial [ISRCTN68505294

    Directory of Open Access Journals (Sweden)

    Spengler Ulrich

    2005-11-01

    Full Text Available Abstract Background Red wine (RW is rich in antioxidant polyphenols that might protect from oxidative stress related diseases, such as cardiovascular disease and cancer. Antioxidant effects after single ingestion of RW or dealcoholized RW (DRW have been observed in several studies, but results after regular consumption are contradictory. Thus, we examined if single or repeated consumption of moderate amounts of RW or DRW exert antioxidant activity in vivo. Methods Total phenolic content and concentration of other antioxidants in plasma/serum, total antioxidant capacity (TEAC in plasma as well as DNA strand breaks in peripheral leukocytes were measured in healthy non-smokers A before, 90 and 360 min after ingestion of one glass of RW, DRW or water; B before and after consumption of one glass of RW or DRW daily for 6 weeks. DNA strand breaks (SB were determined by single cell gel electrophoresis (Comet Assay in untreated cells and after induction of oxidative stress ex vivo with H2O2 (300 μM, 20 min. Results Both RW and DRW transiently increased total phenolic content in plasma after single consumption, but only RW lead to a sustained increase if consumed regularly. Plasma antioxidant capacity was not affected by single or regular consumption of RW or DRW. Effects of RW and DRW on DNA SB were conflicting. DNA strand breaks in untreated cells increased after a single dose of RW and DRW, whereas H2O2 induced SB were reduced after DRW. In contrast, regular RW consumption reduced SB in untreated cells but did not affect H2O2 induced SB. Conclusion The results suggest that consumption of both RW and DRW leads to an accumulation of phenolic compounds in plasma without increasing plasma antioxidant capacity. Red wine and DRW seem to affect the occurrence of DNA strand breaks, but this cannot be referred to antioxidant effects.

  6. porphyrin with single strand DNAs

    Indian Academy of Sciences (India)

    for organization of porphyrin molecules into extended assemblies, providing opportunities for construction of supramolecular structures.6–8 Among the porphyrin .... and consequently the mono- and bi-exponential nature of the decays were judged by the reduced chi-square. (χ2) values and distribution of the weighted ...

  7. EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

    Science.gov (United States)

    Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

    2017-10-01

    Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

  8. Effect of vanillin on methylene blue plus light-induced single-strand breaks in plasmid pBR322 DNA.

    Science.gov (United States)

    Kumar, S S; Ghosh, A; Devasagayam, T P; Chauhan, P S

    2000-09-20

    The ability of vanillin (4-hydroxy-3-methoxybenzaldehyde), a naturally occurring food flavouring agent, in inhibiting photosensitization-induced single-strand breaks (ssbs) in plasmid pBR322 DNA has been examined in an in vitro system, independent of DNA repair/replication processes. Photosensitization of DNA with methylene blue, visible light and oxygen, induced ssbs resulting in the production of open circular form (OC form) in a concentration-dependent manner. The yield of OC form induced by photosensitization was increased several-fold by deuteration of the buffer and was found to be inhibited by sodium azide, a scavenger of singlet oxygen (1O(2)). Vanillin, per se, did not induce but inhibited photosensitization-induced ssbs in plasmid DNA, at millimolar concentrations. The inhibitory effect of vanillin was both concentration- and time-dependent. On a molar basis, vanillin was, however, less effective than trolox, a water-soluble analogue of alpha-tocopherol. Photosensitization by methylene blue system generates singlet oxygen, as one of the major components of ROS. Therefore, interaction of singlet oxygen with vanillin was investigated. The rate constant of vanillin with 1O(2) was estimated to be 5.93x10(7)M(-1)s(-1) and that of sodium azide as 2. 7x10(8)M(-1)s(-1). The present investigations show that vanillin can protect against photosensitization-induced ssbs in the plasmid pBR322 DNA, and this effect may partly be due to its ability to scavenge 1O(2).

  9. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  10. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis.

    Science.gov (United States)

    Bosari, S; Marchetti, A; Buttitta, F; Graziani, D; Borsani, G; Loda, M; Bevilacqua, G; Coggi, G

    1995-12-01

    p53 mutations are the most common genetic abnormality in humans tumors, but their clinical significance remains to be precisely elucidated. Conventional single-strand conformation polymorphism (SSCP) analysis, a well-established technique for detecting p53 mutations, uses radioactively labeled polymerase chain reaction (PCR) products, which migrate abnormally in the presence of mutations. We performed radioactive PCR-SSCP analysis in a series of 30 formalin-fixed, paraffin-embedded ovarian carcinomas and two cell lines (SW480 and Caov4) harboring known homozygous p53 mutations and compared the results with nonradioactive silver-stained SSCP. The purpose was to assess whether nonradioactive SSCP is suitable for detecting p53 mutations in a rapid, sensitive, cost-effective fashion, without the need of radioactive isotopes. We accomplished PCR amplification of p53 exons 5 through 8 in 26 carcinomas, and radioactive SSCP detected p53 mutations in 13 tumors; three mutations were localized in exon 5, six in exon 6, two in exon 7, and two in exon 8. All mutations were correctly identified with nonradioactive SSCP, except for one exon 8 mutation. To establish the sensitivity of nonradioactive SSCP, DNA samples of SW480 and Caov4 were mixed with increasing amounts (0-90%) of normal DNA and subjected to PCR-SSCP analysis. Mutations were detected until the concentration of SW480 and Caov4 was 15% and 10%, respectively, of the total sample. The results of our investigation demonstrate that nonradioactive silver-stained SSCP is a sensitive, rapid, and simple technique to detect p53 mutations, even in formalin-fixed tissues, and could be easily used to investigate large series of patients to assess the clinical significance of p53 mutations in human tumors.

  11. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.

    Science.gov (United States)

    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter

    2005-04-01

    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year.

  12. Single-stranded DNA aptamer targeting and neutralization of anti-D alloantibody: a potential therapeutic strategy for haemolytic diseases caused by Rhesus alloantibody.

    Science.gov (United States)

    Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua

    2018-02-01

    Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.

  13. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  14. Gauging the Nanotoxicity of h2D-C2N toward Single-Stranded DNA: An in Silico Molecular Simulation Approach.

    Science.gov (United States)

    Mukhopadhyay, Titas Kumar; Bhattacharyya, Kalishankar; Datta, Ayan

    2018-04-12

    Recent toxicological assessments of graphene, graphene oxides, and some other two-dimensional (2D) materials have shown them to be substantially toxic at the nanoscale, where they inhibit and eventually disrupt biological processes. These shortfalls of graphene and analogs have resulted in a quest for novel biocompatible 2D materials with minimum cytotoxicity. In this article, we demonstrate C 2 N (h2D-C 2 N), a newly synthesized 2D porous graphene analog, to be non-nanotoxic toward genetic materials from an "in-silico" point of view through sequence-dependent binding of different polynucleotide single-stranded DNA (ssDNA) onto it. The calculated binding energy of nucleobases and the free energy of binding of polynucleotides follow the common trait, cytosine > guanine > adenine > thymine, and are well within the limits of physisorption. Ab-initio simulations completely exclude the possibility of any chemical reaction, demonstrating purely noncovalent binding of nucleobases with C 2 N through a crucial interplay between hydrogen bonding and π-stacking interactions with the surface. Further, we show that the extent of distortion inflicted upon ssDNA by C 2 N is negligible. Analysis of the density of states of the nucleobase-C 2 N hybrids confirms minimum electronic perturbation of the bases after adsorption. Most importantly, we demonstrate the potency of C 2 N in nucleic acid transportation via reversible binding of ssDNA. The plausible use of C 2 N as a template for DNA repair is illustrated through an example of C 2 N-assisted complementary ssDNA winding.

  15. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Fair Exchange in Strand Spaces

    Directory of Open Access Journals (Sweden)

    Joshua D. Guttman

    2009-10-01

    Full Text Available Many cryptographic protocols are intended to coordinate state changes among principals. Exchange protocols coordinate delivery of new values to the participants, e.g. additions to the set of values they possess. An exchange protocol is fair if it ensures that delivery of new values is balanced: If one participant obtains a new possession via the protocol, then all other participants will, too. Fair exchange requires progress assumptions, unlike some other protocol properties. The strand space model is a framework for design and verification of cryptographic protocols. A strand is a local behavior of a single principal in a single session of a protocol. A bundle is a partially ordered global execution built from protocol strands and adversary activities. The strand space model needs two additions for fair exchange protocols. First, we regard the state as a multiset of facts, and we allow strands to cause changes in this state via multiset rewriting. Second, progress assumptions stipulate that some channels are resilient-and guaranteed to deliver messages-and some principals are assumed not to stop at certain critical steps. This method leads to proofs of correctness that cleanly separate protocol properties, such as authentication and confidentiality, from invariants governing state evolution. G. Wang's recent fair exchange protocol illustrates the approach.

  17. Oligonucleotide-directed mutagenesis for precision gene editing.

    Science.gov (United States)

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  19. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  20. Oligonucleotides containing a piperazino-modified 2'-amino-LNA monomer exhibit very high duplex stability and remarkable nuclease resistance

    DEFF Research Database (Denmark)

    Lou, Chenguang; Vester, Birte; Wengel, Jesper

    2015-01-01

    Incorporation of a piperazino-modified 2'-amino-LNA monomer (PipLNA-T) into oligonucleotides conferred very high affinity and base-pairing selectivity towards complementary DNA and RNA strands. Furthermore, one PipLNA-T modification provided a robust nuclease resistance that safeguarded three...

  1. Synthesis and studies of modified oligonucleotides-directed triple helix formation at the purine-pyrimidine interrupted site.

    Science.gov (United States)

    Jazouli, Mohamed; Guianvarc'h, Dominique; Bougrin, Khalid; Soufiaoui, Mohamed; Vierling, Pierre; Benhida, Rachid

    2003-01-01

    Triple helix formation is still restricted to oligopurine-oligopyrimidine double stranded DNA target. Herein we focus on our progress achieved in nucleobase and oligonucleotide modifications area to address the chemical challenge to circumvent the recognition of a purine-pyrimidine base pair interruption in an oligopyrimidine-oligopurine DNA sequence.

  2. Crystal structure of four-stranded Oxytricha telomeric DNA

    Science.gov (United States)

    Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A.

    1992-01-01

    The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.

  3. Contribution of single-strand breaks and alkali-labile bonds to the loss of infectivity of γ-irradiated phiX174 RF-DNA in E. coli cells mutant in various repair functions

    International Nuclear Information System (INIS)

    McKee, R.H.

    1975-01-01

    Twenty-one radiation sensitive mutants have been examined for their capacity to support gamma-irradiated phiX174 RF-DNA. The survival of phiX174 RF-DNA was reduced in essentially all of the sensitive mutants. The irradiated phiX174 RF-DNA was then separated into populations containing either single-strand breaks or alkali-labile bonds to examine the capacity of the mutants to repair each of the classes of lesions. It was found that all E. coli strains are unable to repair 22 percent of the single-strand breaks and all sensitive mutants are unable to repair an additional 10 percent of the breaks. All the repair functions examined are involved in single-strand break repair and none are more or less necessary than any of the others. PhiX174 RF-DNA is also inactivated by alkali-labile bonds. In the normal strains the inactivation efficiency is 0.16 lethal events per lesion with a threshold dose of 15 to 20 krads. The mutants are divided into two classes by their sensitivity to alkali-labile bonds. Both classes of mutants are also inactivated by alkali-labile bonds with efficiencies of about 0.17 and 0.29 lethal events per lesion, respectively. It is proposed that the differences seen in survival curves of phiX174 measured in the sensitive mutants is due to this difference. Although in normal cells the efficiency of inactivation of phiX174 by single-strand breaks is 50 percent greater than by alkali-labile bonds, alkali-labile bonds are produced at approximately twice the rate of single-strand breaks so alkali-labile bonds account for about 61 percent of the overall inactivation. In the mutants of least sensitivity alkali-labile bonds account for about 54 percent of the inactivating events and in the most sensitive about 67 percent

  4. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  5. Nanoparticle delivery of antisense oligonucleotides and their application in the exon skipping strategy for Duchenne muscular dystrophy.

    Science.gov (United States)

    Falzarano, Maria Sofia; Passarelli, Chiara; Ferlini, Alessandra

    2014-02-01

    Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy.

  6. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  7. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    International Nuclear Information System (INIS)

    Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  9. The Medicinal Chemistry of Therapeutic Oligonucleotides.

    Science.gov (United States)

    Wan, W Brad; Seth, Punit P

    2016-11-10

    Oligonucleotide-based therapeutics have made rapid progress in the clinic for treatment of a variety of disease indications. Unmodified oligonucleotides are polyanionic macromolecules with poor drug-like properties. Over the past two decades, medicinal chemists have identified a number of chemical modification and conjugation strategies which can improve the nuclease stability, RNA-binding affinity, and pharmacokinetic properties of oligonucleotides for therapeutic applications. In this perspective, we present a summary of the most commonly used nucleobase, sugar and backbone modification, and conjugation strategies used in oligonucleotide medicinal chemistry.

  10. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have ...

  11. Replication of the plasmid pBR322 under the control of a cloned replication origin from the single-stranded DNA phage M13.

    OpenAIRE

    Cleary, J M; Ray, D S

    1980-01-01

    The replication origins of viral and complementary strands of bacteriophage M13 DNA are contained within a 507-nucleotide intergenic region of the viral genome. Chimeric plasmids have been constructed by inserting restriction endonuclease fragments of the M13 intergenic region into the plasmid pBR322. Replication of these hybrid plasmids, under conditions not permissive for the plasmid replicon, depends on specific segments of the M13 origin region and on the presence of M13 helper virus. Thu...

  12. Controlling lipid micelle stability using oligonucleotide headgroups.

    Science.gov (United States)

    Wilner, Samantha E; Sparks, Samuel E; Cowburn, David; Girvin, Mark E; Levy, Matthew

    2015-02-18

    Lipid-based micelles provide an attractive option for therapeutic and diagnostic applications because of their small size (24 h. Using antisense oligonucleotides we demonstrated that disruption of the quadruplex leads to micelle destabilization and cargo release. The ability to use oligonucleotide interactions to control lipid particle stability represents a new approach in the design of programmed nanoscale devices.

  13. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  14. Increased type I collagen content and DNA binding activity of a single-stranded, cytosine-rich sequence in the high-salt buffer protein extract of the copper-deficient rat heart.

    Science.gov (United States)

    Zeng, Huawei; Saari, Jack T

    2004-11-01

    Dietary copper (Cu) deficiency not only causes a hypertrophic cardiomyopathy but also increases cancer risk in rodent models. However, a possible alteration in gene expression has not been fully examined. The present study was undertaken to determine the effect of Cu deficiency on protein profiles in rat heart tissue. Male Sprague-Dawley rats were fed diets that were either a Cu-adequate diet (6.0 microg Cu/g diet, n = 6) or a Cu-deficient diet (0.3 microg Cu/g diet, n = 6) for 5 weeks. The high-salt buffer (HSB) protein extract from heart tissue of Cu-deficient, but not Cu-adequate rats showed a 132 kDa protein band by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. This protein band stained pink with Coomassie Blue, suggesting the presence of collagens or other proline-rich proteins. Dot immunoblotting demonstrated that total type I collagen was increased by 110% in HSB protein extract from Cu-deficient, relative to Cu-adequate, rats. Liquid chromatography with mass spectrometry analysis indicated that the 132 kDa protein band contained a collagen alpha (I) chain precursor as well as a leucine-rich protein 130 (LRP130) in HSB protein extract from Cu-deficient but not Cu-adequate rats. A gel shift assay showed that HSB protein extract from Cu-deficient rats bound to a single-stranded cytosine-rich DNA with higher affinity than the extract of Cu-adequate rats, similar to reports of an increase in LRP130 single-stranded DNA binding activity in several types of tumor cells. Collectively, these results not only suggest an additional feature of altered collagen metabolism with Cu deficiency but also demonstrate for the first time an increase in single-stranded cytosine-rich DNA binding in Cu-deficient rat heart.

  15. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  16. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry.

    Science.gov (United States)

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Isolation and characterization of Nylanderia fulva virus 1, a positive-sense, single-stranded RNA virus infecting the tawny crazy ant, Nylanderia fulva

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Steven M., E-mail: steven.valles@ars.usda.gov [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Oi, David H.; Becnel, James J. [Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, 1600 SW 23rd Drive, Gainesville, FL 32608 (United States); Wetterer, James K. [Wilkes Honors College, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458 (United States); LaPolla, John S. [Department of Biological Sciences, Towson University, 8000 York Road, Towson, MD 21252 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom)

    2016-09-15

    We report the discovery of Nylanderia fulva virus 1 (NfV-1), the first virus identified and characterized from the ant, Nylanderia fulva. The NfV-1 genome (GenBank accession KX024775) is 10,881 nucleotides in length, encoding one large open reading frame (ORF). Helicase, protease, RNA-dependent RNA polymerase, and jelly-roll capsid protein domains were recognized within the polyprotein. Phylogenetic analysis placed NfV-1 in an unclassified clade of viruses. Electron microscopic examination of negatively stained samples revealed particles with icosahedral symmetry with a diameter of 28.7±1.1 nm. The virus was detected by RT-PCR in larval, pupal, worker and queen developmental stages. However, the replicative strand of NfV-1 was only detected in larvae. Vertical transmission did not appear to occur, but horizontal transmission was facile. The inter-colonial field prevalence of NfV-1 was 52±35% with some local infections reaching 100%. NfV-1 was not detected in limited samples of other Nylanderia species or closely related ant species. - Highlights: • A new positive-strand RNA virus was discovered in the ant, Nylanderia fulva. • The Nylanderia fulva virus 1 genome was comprised of 10,881 nucleotides. • NfV-1 was detected in larval, pupal, queen and worker ants, but not eggs. • Replication of NfV-1 appeared to be limited to the larval stage.

  18. Detection of transgenes in soybean via a polymerase chain reaction and a simple bioluminometric assay based on a universal aequorin-labeled oligonucleotide probe.

    Science.gov (United States)

    Glynou, Kyriaki; Ioannou, Penelope C; Christopoulos, Theodore K

    2004-04-01

    The recombinant photoprotein aequorin was used as a reporter in highly sensitive and automatable hybridization assays for the analysis of transgenic sequences in genetically modified organisms (GMO). The terminator of the nopaline synthase gene (NOS) from Agrobacterium tumefaciens and the 35S promoter sequence were detected in genetically modified soybean. The endogenous, soybean-specific, lectin gene was also detected for confirmation of the integrity of extracted DNA. A universal detection reagent was produced through conjugation of aequorin to the oligonucleotide (dA)(30). Biotinylated (through PCR) products for the three target sequences were captured onto streptavidin-coated wells, and one strand was removed by NaOH treatment. The immobilized single-stranded DNAs were then hybridized with oligonucleotide probes consisting of a target-specific segment and a poly(dT) tail. This allowed the subsequent determination of all hybrids through the use of the (dA)(30)-aequorin conjugate as a universal reagent. The bound aequorin was measured by adding Ca(2+) and integrating the light emission for 3 s. As low as 2 pM (100 amol per well) of amplified DNA was detectable for all three targets, with a signal-to-background ratio of about 2. The analytical range extended up to 2000 pM. As low as 0.05% GMO content in soybean can be detected with a signal-to-background ratio of 8.2. The overall repeatability of the proposed assay, including DNA extraction, PCR, and hybridization assay, ranged from 7.5-19.8%. The use of a (dA)(30)-aequorin conjugate renders the assay configuration general for any target DNA, provided that the specific probe carries a poly(dT) tail.

  19. Oligonucleotide microarrays: immobilization of phosphorylated oligonucleotides on epoxylated surface.

    Science.gov (United States)

    Mahajan, S; Kumar, P; Gupta, K C

    2006-01-01

    A facile and efficient method for direct immobilization of phosphorylated oligonucleotides on an epoxy-activated glass surface is described. The new immobilization strategy has been analyzed for its performance in DNA microarray under both microwave and thermal conditions. It reflects high immobilization efficiency ( approximately 23%), and signal-to-noise ratio ( approximately 98) and resulted in high hybridization efficiency ( approximately 36%) in comparison to those obtained with standard methods, viz., NTMTA ( approximately 9.76%) and epoxide-amine ( approximately 9.82%). The probes immobilized through the new strategy were found to be heat-stable, since the performance of microarray decreased by only approximately 7% after subjecting it to 20 PCR-like heat cycles, suggesting that the chemistry could be used in integrated PCR/microarray devices. The immobilization of probes following the proposed chemistry resulted in spots of superior quality in terms of spot morphology, spot homogeneity, and signal reproducibility. The constructed microarrays have been successfully used for the discrimination of nucleotide mismatches. In conclusion, these features make the new immobilization strategy ideal for facile, efficient, and cost-effective manufacturing of DNA microarrays.

  20. Injection site reactions after subcutaneous oligonucleotide therapy

    NARCIS (Netherlands)

    van Meer, L. (Leonie); M. Moerland (Matthijs); Gallagher, J. (Jolie); M.B.A. van Doorn (Martijn); E.P. Prens (Errol); A.F. Cohen; Rissmann, R. (Robert); J. Burggraaf (Jacobus)

    2016-01-01

    textabstractOligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including

  1. Antisense oligonucleotides: the state of the art.

    Science.gov (United States)

    Aboul-Fadl, T

    2005-01-01

    The use of antisense oligonucleotides as therapeutic agents has generated considerable enthusiasm in the research and medical community. Antisense oligonucleotides as therapeutic agents were proposed as far back as in the 1970s when the antisense strategy was initially developed. Nonetheless, it has taken almost a quarter of a century for this potential to be realized. The principle of antisense technology is the sequence-specific binding of an antisense oligonucleotide to target mRNA, resulting in the prevention of gene translation. The specificity of hybridization by Watson-Crick base pairing make antisense oligonucleotides attractive as tools for targeted validation and functionalization, and as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of diseases. The last few years have seen a rapid increase in the number of antisense molecules progressing past Phase I, II and III clinical trials. This review outlines the basic concept of the antisense technology, its development and recent potential therapeutic applications.

  2. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    Science.gov (United States)

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity.

  3. Direct oligonucleotide synthesis onto super-paramagnetic beads

    Science.gov (United States)

    Jensen, Michael A; Akhras, Michael S.; Fukushima, Marilyn; Pourmand, Nader; Davis, Ron W.

    2013-01-01

    Super-paramagnetic beads (SPMB)s used for a variety of molecular diagnostic assays are prepared by attaching pre-synthesized oligonucleotides to the surface via a cumbersome and low efficient method of carbodiimide-mediated amide bond formation. To mainstream the process, we describe a novel procedure of direct oligonucleotide synthesis onto the surface of SPMBs (e.g. MyOne Dynabeads). With the many challenges surrounding containment of paramagnetic beads (≤ 1 μm) during automated oligonucleotide synthesis, we show that by applying a magnetic force directly to the SPMBs we prevent their loss caused by high-pressure drain steps during synthesis. To date we have synthesized 40mers using a Spacer 9 phosphoramidite (triethylene glycol) coupled to the surface of hydroxylated SPMBs. HPLC analysis shows successful product generation with an average yield of 200 pmoles per sample. Furthermore, because of the versatility of this powerful research tool, we envision its use in any laboratory working with conventional synthesis automation, as employed for single columns and for multi-well titer plates. In addition to direct synthesis of oligodeoxynucleotides (DNA) onto SPMBs, this platform also has the potential for RNA and peptide nucleic acid synthesis. PMID:23942380

  4. Development of plasmid and oligonucleotide nanometric particles.

    Science.gov (United States)

    Dauty, E; Behr, J-P; Remy, J-S

    2002-06-01

    Nucleic acids delivery vectors have shown promising therapeutic potential in model systems. However, comparable clinical success is delayed essentially because of their poor biodistribution and of their ineffective intracellular trafficking. The size of condensed DNA particles is a key determinant for in vivo diffusion, as well as for gene delivery to the cell nucleus. Towards this goal, we have developed cationic thiol-detergents that individually compact plasmid DNA molecules into anionic particles. These particles are then 'stabilized' by air-induced dimerization of the detergent into a disulfide lipid on the template DNA. The particles all measure approximately 30 nm, which corresponds to the volume of a single molecule of plasmid DNA. The gel electrophoretic mobility of the anionic particles was found to be higher than that of the plasmid DNA itself. Similarly, particles formed with a 31-mer oligonucleotide measured 19 nm. Improved in vivo diffusion, as well as improved intracellular trafficking may be inferred from the faster migration of the complexes. Moreover, the size of the particles remains compatible with nuclear pore crossing. Finally, in an attempt to improve the biodistribution of these particles, we have coated the monomolecular particles with a poly(ethylene glycol) corona.

  5. Structure of the replicative form of bacteriophage φX174 : VI. Studies on alkali-denatured double-stranded φX DNA

    NARCIS (Netherlands)

    Pouwels, P.H.; Knijnenburg, C.M.; Rotterdam, J. van; Cohen, J.A.; Jansz, H.S.

    1968-01-01

    Double-stranded φX DNA which accumulates after infection with bacteriophage φX174 in the presence of chloramphenicol consists mainly of twisted circular double-stranded DNA with no single-strand breaks (component I) and of circular double-stranded DNA, in which single-strand breaks are present

  6. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  7. Development of a graphene oxide-based assay for the sequence-specific detection of double-stranded DNA molecules.

    Directory of Open Access Journals (Sweden)

    Anna Maria Giuliodori

    Full Text Available Graphene oxide (GO is a promising material for the development of cost-effective detection systems. In this work, we have devised a simple and rapid GO-based method for the sequence-specific identification of DNA molecules generated by PCR amplification. The csp genes of Escherichia coli, which share a high degree of sequence identity, were selected as paradigm DNA templates. All tested csp genes were amplified with unlabelled primers, which can be rapidly removed at the end of the PCR taking advantage of the preferential binding to GO of single-stranded versus duplex DNA molecules. The amplified DNAs (targets were heat-denatured and hybridized to a fluorescently-labelled single strand oligonucleotide (probe, which recognizes a region of the target DNAs displaying sequence variability. This interaction is extremely specific, taking place with high efficiency only when target and probe show perfect or near perfect matching. Upon GO addition, the unbound fraction of the probe was captured and its fluorescence quenched by the GO's molecular properties. On the other hand, the probe-target complexes remained in solution and emitted a fluorescent signal whose intensity was related to their degree of complementarity.

  8. Elimination of double strand nuclease activity from S1 nuclease prepared from crude alpha amylase.

    Science.gov (United States)

    Hahn, W E; Van Ness, J

    1976-01-01

    Single strand-specific s1 nuclease prepared as previously described from crude alpha amylase by DEAE-cellulose chromatography also contains nuclease which degrades double strand nucleic acid. The double strand activity can be removed by repeating the DEAE-cellulose chromatography procedure at least two additional times. S1 nuclease prepared by this procedure does not degrade double strand sheared DNA as measured by Sephadex chromatography. Under the same conditions single strand DNA is completely degraded. Thus, S1 nuclease prepared by this procedure is suitable for use in removing single strand regions in DNA/DNA duplexes and DNA/RNA hybrids. PMID:940774

  9. NMR studies concerning base-base interactions in oligonucleotides

    International Nuclear Information System (INIS)

    Hoogen, Y.T. van den.

    1988-01-01

    Two main subjects are treated in the present thesis. The firsst part principally deals with the base-base interactions in single-stranded oligoribonucleotides. The second part presents NMR and model-building studies of DNA and RNA duplexes containing an unpaired base. (author). 242 refs.; 26 figs.; 24 tabs

  10. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redox...... marked single- and double-strand OGNs has reached the single-molecule level based i.a. on electrochemical in situ scanning tunnelling microscopy (STM) and break-junction (B-J) STM. There are much fewer such reports on “non-canonical” OGN structures such as G-quadruplexes. We discuss first single......-molecule electrochemical conductivity of pure and redox marked duplex OGNs, and address next electrochemistry and electrochemical conductivity in the few reported monolayer and single-molecule G-quadruplex studies. Facile electrochemical electron transfer of iron protoporphyrin IX stacked onto three-quartet 12-guanine...

  11. Purine- and pyrimidine-triple-helix-forming oligonucleotides recognize qualitatively different target sites at the ribosomal DNA locus.

    Science.gov (United States)

    Maldonado, Rodrigo; Filarsky, Michael; Grummt, Ingrid; Längst, Gernot

    2018-03-01

    Triplexes are noncanonical DNA structures, which are functionally associated with regulation of gene expression through ncRNA targeting to chromatin. Based on the rules of Hoogsteen base-pairing, polypurine sequences of a duplex can potentially form triplex structures with single-stranded oligonucleotides. Prediction of triplex-forming sequences by bioinformatics analyses have revealed enrichment of potential triplex targeting sites (TTS) at regulatory elements, mainly in promoters and enhancers, suggesting a potential function of RNA-DNA triplexes in transcriptional regulation. Here, we have quantitatively evaluated the potential of different sequences of human and mouse ribosomal RNA genes ( rDNA ) to form triplexes at different salt and pH conditions. We show by biochemical and biophysical approaches that some of these predicted sequences form triplexes with high affinity, following the canonical rules for triplex formation. We further show that RNA triplex-forming oligos (TFOs) are more stable than their DNA counterpart, and point mutations strongly affect triplex formation. We further show differential sequence requirements of pyrimidine and purine TFO sequences for efficient binding, depending on the G-C content of the TTS. The unexpected sequence specificity, revealing distinct sequence requirements for purine and pyrimidine TFOs, shows that in addition to the Hoogsteen pairing rules, a sequence code and mutations have to be taken into account to predict genomic TTS. © 2018 Maldonado et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    Energy Technology Data Exchange (ETDEWEB)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook; Karim, Nurul Huda Abd [School of Chemical Sciences and Food Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor Darul Ehsan (Malaysia); Ahmad, Haslina; Harun, Siti Norain [Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, Serdang, Selangor (Malaysia)

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.

  13. Enzymatic synthesis of DNA strands containing α-L-LNA (α-L-configured locked nucleic acid) thymine nucleotides

    DEFF Research Database (Denmark)

    Højland, Torben; Veedu, Rakesh N; Vester, Birte

    2012-01-01

    We describe the first enzymatic incorporation of an α-L-LNA nucleotide into an oligonucleotide. It was found that the 5'-triphosphate of α-L-LNA is a substrate for the DNA polymerases KOD, 9°N(m), Phusion and HIV RT. Three dispersed α-L-LNA thymine nucleotides can be incorporated into DNA strands...

  14. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  15. Oligonucleotides conjugated to short lysine chains.

    Science.gov (United States)

    Winkler, Johannes; Urban, Ernst; Noe, Christian R

    2005-01-01

    A new method for synthesizing oligonucleotide peptide conjugates by an in-line approach is presented. A phosphorothioate oligonucleotide with the sequence of bcl-2 targeted Oblimersen by employing a modified 2'-amino-2'-desoxy-uridine nucleotide bearing a succinyl linker at the 2' position was prepared. The carboxyl group was protected for solid-phase synthesis as the benzyl ester. Ester cleavage was afforded by a phase transfer reaction using palladium nanoparticles as catalyst and cyclohexadiene as hydrogen donor. Short tails of up to three lysyl residues were conjugated to the oligonucleotide by an inverse stepwise peptide synthesis. The conjugates were characterized by HPLC, mass spectrometry, and circular dichroism. Influence of lysyl tails on CD spectra were minimal. Melting profiles revealed only minimal destabilizing effects on duplexes by conjugation of peptides.

  16. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  17. Oligonucleotide-mediated gene editing is underestimated in cells expressing mutated green fluorescent protein and is positively associated with target protein expression.

    Science.gov (United States)

    Disterer, Petra; Papaioannou, Ioannis; Evans, Vanessa C; Simons, J Paul; Owen, James S

    2012-02-01

    Single-stranded DNA oligonucleotides (ssODNs) can introduce small, specific sequence alterations into genomes. Potential applications include creating disease-associated mutations in cell lines or animals, functional studies of single nucleotide polymorphisms and, ultimately, clinical therapy by correcting genetic point mutations. Here, we report feasibility studies into realizing this potential by targeting a reporter gene, mutated enhanced green fluorescent protein (mEGFP). Three mammalian cell lines, CHO, HEK293T and HepG2, expressing multiple copies of mEGFP were transfected with a 27-mer ssODN capable of restoring fluorescence. Successful cell correction was quantified by flow cytometry. Gene editing in each isogenic cell line, as measured by percentage of green cells, correlated tightly with target protein levels, and thus gene expression. In the total population, 2.5% of CHO-mEGFP cells were successfully edited, although, remarkably, in the highest decile producing mEGFP protein, over 20% of the cells had restored green fluorescence. Gene-edited clones initially selected for green fluorescence lost EGFP expression during cell passaging, which partly reflected G2-phase cycle arrest and perhaps eventual cell death. The major cause, however, was epigenetic down-regulation; incubation with sodium butyrate or 5-aza-2'-deoxycytidine reactivated fluorescent EGFP expression and hence established that the repaired genotype was stable. Our data establish that ssODN-mediated gene editing is underestimated in cultured mammalian cells expressing nonfluorescent mutated EGFP, because of variable expression of this mEGFP target gene in the cell population. This conclusion was endorsed by studies in HEK293T-mEGFP and HepG2-mEGFP cells. We infer that oligonucleotide-directed editing of endogenous genes is feasible, particularly for those that are transcriptionally active. Copyright © 2012 John Wiley & Sons, Ltd.

  18. Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame

    Science.gov (United States)

    Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi

    2013-01-01

    Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846

  19. Simultaneous Detection of Escherichia coli, Salmonella enterica, Listeria monocytegenes and Bacillus cereus by Oligonucleotide Microarray

    Directory of Open Access Journals (Sweden)

    Meysam Sarshar

    2015-11-01

    Full Text Available Background: Traditional laboratory methods to detect pathogenic bacteria are time consuming and laborious. Therefore, it is essential to use powerful and reliable molecular methods for quick and simultaneous detection of microbial pathogens. Objectives: The current study aimed to evaluate the capability and efficiency of 23S rDNA sequence for rapid and simultaneous detection of four important food-borne pathogens by an oligonucleotide microarray technique. Materials and Methods: The 23S rDNA sequences of Escherichia coli, Salmonella enterica, Listeria monocytogenes and Bacillus cereus were obtained from GenBank databases and used to design the oligonucleotide probes and primers by Vector NTI software. Oligonucleotide probes were placed on a nylon membrane and hybridization was performed between probes and 23S rDNA digoxigenin-labeled polymerase chain reaction (PCR products. Hybridization signals were visualized by NBT/BCIP color development. Results: Positive hybridization color was produced for Escherichia coli, Salmonella enterica, Listeria monocytogenes and Bacillus cereus. The oligonucleotide microarray detected all bacterial strains in a single reaction in less than five hours. The sensitivity of the performed microarray assay was 103 cfu/mL for each species of pathogen. No cross reaction was found between the tested bacterial species. Conclusions: The obtained results indicated that amplification of 23S rDNA gene followed by oligonucleotide microarray hybridization is a rapid and reliable method to identify and discriminate foodborne pathogens tested under the study.

  20. Radio-marking and in vivo imagery of oligonucleotides

    International Nuclear Information System (INIS)

    Kuehnast, Bertrand

    2000-01-01

    This research thesis is part of activities aimed at the development of new molecules like oligonucleotides. Its first objective was the development and validation of a marking method with fluorine-18 of oligonucleotides for their in-vivo pharmacological assessment with positron emission tomography (PET). Further investigations addressed the use of iodine-125 for oligonucleotide marking purpose. This radio-marking, and in vivo and ex vivo imagery techniques are described, and their potential is highlighted for the pharmacological assessment of different oligonucleotides

  1. LHC superconducting strand

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    This cross-section through a strand of superconducting matieral as used in the LHC shows the 8000 Niobium-Titanium filaments embedded like a honeycomb in copper. When cooled to 1.9 degrees above absolute zero in the LHC accelerator, these filaments will have zero resistance and so will carry a high electric current with no energy loss.

  2. Strand SPA & Konverentsikeskus

    Index Scriptorium Estoniae

    2008-01-01

    Strand SPA & Konverentsikeskus on Pärnu suurim äri- ja konverentsiklientidele suunatud hotell, mis klientide seas on hinnatud just selle kompleksuse tõttu, kuna kõik, mida külaline vajab ja soovib, on olemas ühe katuse all

  3. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    Energy Technology Data Exchange (ETDEWEB)

    Sebastiani, F.; Comez, L.; Sacchetti, F. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); CNR, Istituto Officina dei Materiali, Unità di Perugia, c/o Dipartimento di Fisica e Geologia, Università di Perugia, 06123 Perugia (Italy); Longo, M. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); Elettra—Sincrotrone Trieste, 34149 Basovizza, Trieste (Italy); Orecchini, A.; Petrillo, C.; Paciaroni, A., E-mail: alessandro.paciaroni@fisica.unipg.it [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); De Francesco, A. [CNR-IOM OGG c/o Institut Laue-Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France); Muthmann, M. [Jülich Centre for Neutron Science, Forschungszentrum Jülich GmbH, Outstation at Heinz Maier-Leibnitz Zentrum, Lichtenbergstrasse 1, 85747 Garching (Germany); Teixeira, S. C. M. [EPSAM, Keele University, Staffordshire ST5 5BG (United Kingdom); Institut Laue–Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France)

    2015-07-07

    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  4. New oligonucleotide microarray for rapid diagnosis of avian viral diseases.

    Science.gov (United States)

    Sultankulova, Kulyaisan T; Kozhabergenov, Nurlan S; Strochkov, Vitaliy M; Burashev, Yerbol D; Shorayeva, Kamshat A; Chervyakova, Olga V; Rametov, Nurkuisa M; Sandybayev, Nurlan T; Sansyzbay, Abylay R; Orynbayev, Mukhit B

    2017-04-05

    We developed a new oligonucleotide microarray comprising 16 identical subarrays for simultaneous rapid detection of avian viruses: avian influenza virus (AIV), Newcastle disease virus (NDV), infection bronchitis virus (IBV), and infectious bursal disease virus (IBDV) in single- and mixed-virus infections. The objective of the study was to develop an oligonucleotide microarray for rapid diagnosis of avian diseases that would be used in the course of mass analysis for routine epidemiological surveillance owing to its ability to test one specimen for several infections. The paper describes the technique for rapid and simultaneous diagnosis of avian diseases such as avian influenza, Newcastle disease, infectious bronchitis and infectious bursal disease with use of oligonucleotide microarray, conditions for hybridization of fluorescent-labelled viral cDNA on the microarray and its specificity tested with use of AIV, NDV, IBV, IBDV strains as well as biomaterials from poultry. Sensitivity and specificity of the developed microarray was evaluated with use of 122 specimens of biological material: 44 cloacal swabs from sick birds and 78 tissue specimens from dead wild and domestic birds, as well as with use of 15 AIV, NDV, IBV and IBDV strains, different in their origin, epidemiological and biological characteristics (RIBSP Microbial Collection). This microarray demonstrates high diagnostic sensitivity (99.16% within 95% CI limits 97.36-100%) and specificity (100%). Specificity of the developed technique was confirmed by direct sequencing of NP and M (AIV), VP2 (IBDV), S1 (IBV), NP (NDV) gene fragments. Diagnostic effectiveness of the developed DNA microarray is 99.18% and therefore it can be used in mass survey for specific detection of AIV, NDV, IBV and IBDV circulating in the region in the course of epidemiological surveillance. Rather simple method for rapid diagnosis of avian viral diseases that several times shortens duration of assay versus classical diagnostic

  5. A comparative analysis of existing oligonucleotides selection ...

    African Journals Online (AJOL)

    technology at the front and back ends, respectively, are the selection of optimal DNA oligonucleotides (henceforth oligos) and computational analysis of the genes expression data. A computational comparative analysis of the methods used to select oligos is important since the design and quality of the microarray probes ...

  6. Associating Oligonucleotides with Positively Charged Liposomes

    Czech Academy of Sciences Publication Activity Database

    Jurkiewicz, P.; Okruszek, A.; Hof, Martin; Langner, M.

    2003-01-01

    Roč. 8, č. 1 (2003), s. 77-84 ISSN 1425-8153 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : oligonucleotides * fluorescence correlation spectroscopy * DOTAP Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.455, year: 2003

  7. Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

    Science.gov (United States)

    Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

    2009-07-17

    Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

  8. Liver as a target for oligonucleotide therapeutics.

    Science.gov (United States)

    Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

    2013-12-01

    Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to

  9. Sequence-Dependent Mechanism of DNA Oligonucleotide Dehybridization Resolved through Infrared Spectroscopy.

    Science.gov (United States)

    Sanstead, Paul J; Stevenson, Paul; Tokmakoff, Andrei

    2016-09-14

    Despite its important role in biology and nanotechnology, many questions remain regarding the molecular mechanism and dynamics by which oligonucleotides recognize and hybridize to their complementary sequence. The thermodynamics and kinetics of DNA oligonucleotide hybridization and dehybridization are often assumed to involve an all-or-nothing two-state dissociation pathway, but deviations from this behavior can be considerable even for short sequences. We introduce a new strategy to characterize the base-pair-specific thermal dissociation mechanism of DNA oligonucleotides through steady-state and time-resolved infrared spectroscopy. Experiments are interpreted with a lattice model to provide a structure-specific interpretation. This method is applied to a model set of self-complementary 10-base-pair sequences in which the placement of GC base pairs is varied in an otherwise AT strand. Through a combination of Fourier transform infrared and two-dimensional infrared spectroscopy, experiments reveal varying degrees of deviation from simple two-state behavior. As the temperature is increased, duplexes dissociate through a path in which the terminal bases fray, without any significant contribution from loop configurations. Transient temperature jump experiments reveal time scales of 70-100 ns for fraying and 10-30 μs for complete dissociation near the melting temperature. Whether or not frayed states are metastable intermediates or short-lived configurations during the full dissociation of the duplex is dictated by the nucleobase sequence.

  10. Sea Turtle Stranding Network Reports

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Sea Turtle Stranding and Salvage Network (STSSN) was formally established in 1980 to collect information on and document the stranding of marine turtles along...

  11. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  12. DNA strand breaks, repair, and survival in x-irradiated mammalian cells

    International Nuclear Information System (INIS)

    Dugle, D.L.; Gillespie, C.J.; Chapman, J.D.

    1976-01-01

    The yields of unrepairable single- and double-strand breaks in the DNA of x-irradiated Chinese hamster cells were measured by low-speed neutral and alkaline sucrose density gradient sedimentation in order to investigate the relation between these lesions and reproductive death. After maximal single-strand rejoining, at all doses, the number of residual single-strand breaks was twice the number of residual double-strand breaks. Both double-strand and unrepairable single-strand breaks were proportional to the square of absorbed dose, in the range 10-50 krad. No rejoining of double-strand breaks was observed. These observations suggest that, in mammalian cells, most double-strand breaks are not repairable, while all single-strand breaks are repaired except those that are sufficiently close on complementary strands to constitute double-strand breaks. Comparison with cell survival measurements at much lower doses suggests that loss of reproductive capacity corresponds to induction of approximately one double-strand break

  13. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    Science.gov (United States)

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

    2017-11-16

    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry

    Energy Technology Data Exchange (ETDEWEB)

    Jafari, Safiye [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush, E-mail: faridbodf@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Norouzi, Parviz [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ajloo, Davood [School of Chemistry, Damghan University, Damghan (Iran, Islamic Republic of); Mohammadipanah, Fatemeh [Department of Microbial Biotechnology, School of Biology and Center of Excellence in Phylogeny of Living Organisms, College of Science, University of Tehran, 14155-6455 Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO{sub 2}NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy){sub 3}]{sup 2+/3+} redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy){sub 3}]{sup 2+/3+} FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10{sup −15} to 1 × 10{sup −8} mol L{sup −1}. The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL{sup −1} with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy){sub 3}]{sup 2+/3+} interaction with ssDNA before and after hybridization. - Highlights: • New DNA biosensor is designed for sub-femtomolar detection of Aeromonas hydrophila DNA sequence. • Reduced graphene oxide decorated Ceria nanoparticles was used as a new immobilization platform. • Biosensor was successfully used to detect A. hydrophila DNA sequence in fish pond water.

  15. Oligonucleotide gas-phase hydrogen/deuterium exchange with D2S in the collision cell of a quadrupole-Fourier transform ion cyclotron resonance mass spectrometer.

    Science.gov (United States)

    Mo, Jingjie; Håkansson, Kristina

    2007-10-15

    We have implemented gas-phase hydrogen/deuterium exchange (HDX) experiments in the external collision cell of a hybrid quadrupole-Fourier transform ion cyclotron resonance mass spectrometer. In this configuration, multiply charged oligonucleotide anions undergo significant exchange with D(2)S at reaction intervals ranging from 0.11 to 60.1 s. For DNA homohexamers, relative exchange rates were dC(6) approximately dA(6) > dG(6) > dT(6), correlating with the gas-phase acidities of nucleobases (C > A > T > G), except for guanine. Our results are consistent with a relay mechanism in which D(2)S interacts with both a backbone phosphate group and a neutral nucleobase through hydrogen bonding. We propose that the faster exchange of polyguanosine compared to polythymidine is due to the larger size of guanine and the orientation of its labile hydrogens, which may result in gas-phase conformations more favorable for forming complexes with D(2)S. Similar trends were observed for RNA homohexamers, although their HDX rates were faster than for DNA, suggesting they can also exchange via another relay process involving the 2'-hydroxyl group. HDX of DNA duplexes further supports the involvement of nucleobase hydrogens because duplexes exchanged slower than their corresponding single strands, presumably due to the intermolecular hydrogen bonds between nucleobases. This work constitutes the first investigation of the mechanisms of oligonucleotide gas-phase HDX. Our results on duplexes show promise for application of this strategy to the characterization of structured nucleic acids.

  16. Cable degration of SSC strand

    International Nuclear Information System (INIS)

    Warnes, W.H.; Dai, W.; Seuntjens, J.; Capone, D.W. II

    1992-01-01

    Cable degradation of a SSC 40mm cable was studied by comparing the virgin strand and extracted strand measurements of critical current for all thirty strands. Typical degradation values of a few percent are observed in these materials. Image analysis performed on the strand cross sections found the filament deformation to be commensurate with the measured degradation in critical current. A simple model for current sharing in cables with edge damage reduction of Ic was developed and described below. Suggestions for measurements of cable critical current using extracted strands are also presented

  17. The Rev1 interacting region (RIR) motif in the scaffold protein XRCC1 mediates a low-affinity interaction with polynucleotide kinase/phosphatase (PNKP) during DNA single-strand break repair.

    Science.gov (United States)

    Breslin, Claire; Mani, Rajam S; Fanta, Mesfin; Hoch, Nicolas; Weinfeld, Michael; Caldecott, Keith W

    2017-09-29

    The scaffold protein X-ray repair cross-complementing 1 (XRCC1) interacts with multiple enzymes involved in DNA base excision repair and single-strand break repair (SSBR) and is important for genetic integrity and normal neurological function. One of the most important interactions of XRCC1 is that with polynucleotide kinase/phosphatase (PNKP), a dual-function DNA kinase/phosphatase that processes damaged DNA termini and that, if mutated, results in ataxia with oculomotor apraxia 4 (AOA4) and microcephaly with early-onset seizures and developmental delay (MCSZ). XRCC1 and PNKP interact via a high-affinity phosphorylation-dependent interaction site in XRCC1 and a forkhead-associated domain in PNKP. Here, we identified using biochemical and biophysical approaches a second PNKP interaction site in XRCC1 that binds PNKP with lower affinity and independently of XRCC1 phosphorylation. However, this interaction nevertheless stimulated PNKP activity and promoted SSBR and cell survival. The low-affinity interaction site required the highly conserved Rev1-interacting region (RIR) motif in XRCC1 and included three critical and evolutionarily invariant phenylalanine residues. We propose a bipartite interaction model in which the previously identified high-affinity interaction acts as a molecular tether, holding XRCC1 and PNKP together and thereby promoting the low-affinity interaction identified here, which then stimulates PNKP directly. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  19. Direct and Auger Electron-Induced, Single- and Double-Strand Breaks on Plasmid DNA Caused by 99mTc-Labeled Pyrene Derivatives and the Effect of Bonding Distance.

    Directory of Open Access Journals (Sweden)

    Falco Reissig

    Full Text Available It is evident that 99mTc causes radical-mediated DNA damage due to Auger electrons, which were emitted simultaneously with the known γ-emission of 99mTc. We have synthesized a series of new 99mTc-labeled pyrene derivatives with varied distances between the pyrene moiety and the radionuclide. The pyrene motif is a common DNA intercalator and allowed us to test the influence of the radionuclide distance on damages of the DNA helix. In general, pUC 19 plasmid DNA enables the investigation of the unprotected interactions between the radiotracers and DNA that results in single-strand breaks (SSB or double-strand breaks (DSB. The resulting DNA fragments were separated by gel electrophoresis and quantified by fluorescent staining. Direct DNA damage and radical-induced indirect DNA damage by radiolysis products of water were evaluated in the presence or absence of the radical scavenger DMSO. We demonstrated that Auger electrons directly induced both SSB and DSB in high efficiency when 99mTc was tightly bound to the plasmid DNA and this damage could not be completely prevented by DMSO, a free radical scavenger. For the first time, we were able to minimize this effect by increasing the carbon chain lengths between the pyrene moiety and the 99mTc nuclide. However, a critical distance between the 99mTc atom and the DNA helix could not be determined due to the significantly lowered DSB generation resulting from the interaction which is dependent on the type of the 99mTc binding motif. The effect of variable DNA damage caused by the different chain length between the pyrene residue and the Tc-core as well as the possible conformations of the applied Tc-complexes was supplemented with molecular dynamics (MD calculations. The effectiveness of the DNA-binding 99mTc-labeled pyrene derivatives was demonstrated by comparison to non-DNA-binding 99mTcO4-, since nearly all DNA damage caused by 99mTcO4- was prevented by incubating with DMSO.

  20. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II; FINAL

    International Nuclear Information System (INIS)

    None

    2000-01-01

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank(reg s ign) finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  1. Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

    Science.gov (United States)

    Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

  2. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients. © 2014 AlphaMed Press.

  3. Hybridization properties of 4'-branched oligonucleotides

    Czech Academy of Sciences Publication Activity Database

    Liboska, Radek; Buděšínský, Miloš; Kavenová, Ivana; Páv, Ondřej; Rosenberg, Ivan

    2002-01-01

    Roč. 96, č. 11 (2002), s. 933 ISSN 0009-2770. [Konference Pokroky v organické, bioorganické a farmaceutické chemii /37./. 22.11.2002-24.11.2002, Liblice] R&D Projects: GA AV ČR IAA4055101; GA ČR GA203/01/1166 Institutional research plan: CEZ:AV0Z4055905 Keywords : oligonucleotides Subject RIV: CC - Organic Chemistry

  4. Hybridization properties of 4'-branched oligonucleotides

    Czech Academy of Sciences Publication Activity Database

    Liboska, Radek; Buděšínský, Miloš; Kavenová, Ivana; Páv, Ondřej; Rosenberg, Ivan

    2003-01-01

    Roč. 22, 5/8 (2003), s. 1057-1060 ISSN 1525-7770. [International Roundtable Nucleosides, Nucleotides and Nucleic Acids /15./. Leuven, 10.09.2002-14.09.2002] R&D Projects: GA ČR GA203/01/1166; GA AV ČR IAA4055101 Institutional research plan: CEZ:AV0Z4055905 Keywords : 4'-branched oligonucleotides * hybridization * triplexes Subject RIV: CC - Organic Chemistry Impact factor: 0.813, year: 2003

  5. Stranded costs and exit fees

    International Nuclear Information System (INIS)

    2002-01-01

    The New Brunswick Market Design Committee has been directed to examine the issue of stranded costs since it is a major component of restructuring within the electricity sector. When regulated monopolies are faced with competition, they could find that some of their embedded costs cannot be recovered. These costs are referred to as stranded costs. Common sources include large capital investments in uneconomic plants or expensive power purchase contracts or fuel supply contracts. In general, stranded costs do not include gains or losses associated with normal business risks experienced by regulated utilities. This report presents recommendations for mitigation of stranded costs, valuation methodologies and cost-recovery mechanisms. It also presents a summary of experience with stranded costs in other jurisdictions such as California, Rhode Island, Pennsylvania and Ontario. Stranded costs are often recovered through an obligatory charge on all customers, particularly in jurisdictions where retail competition exists. In the New Brunswick market, however, the only customers who can create stranded costs are those eligible to choose their own suppliers. It is argued that since most customers will not have a choice of electricity suppliers, they cannot generate stranded costs and therefore, should not have to pay costs stranded by others. A method to quantify stranded costs is presented, along with a review of transmission-related stranded costs in New Brunswick. Expansion of self-generation in New Brunswick could strand transmission assets. Currently, self-generators only contribute a small amount to fixed charges of the transmission system. However, under new recommended tariffs, the amount could increase. It is likely that the net amount of stranded transmission costs will not be large. 2 refs., 1 fig

  6. Oligonucleotides with 1,4-dioxane-based nucleotide monomers

    DEFF Research Database (Denmark)

    Madsen, Andreas S; Wengel, Jesper

    2012-01-01

    An epimeric mixture of H-phosphonates 5R and 5S has been synthesized in three steps from known secouridine 1. Separation of the epimers has been accomplished by RP-HPLC, allowing full characterization and incorporation of monomers X and Y into 9-mer oligonucleotides using H-phosphonates building...... blocks 5R and 5S, respectively. A single incorporation of either monomer X or monomer Y in the central position of a DNA 9-mer results in decreased thermal affinity toward both DNA and RNA complements (ΔT(m) = -3.5 °C/-3.5 °C for monomer X and ΔT(m) = -11.0 °C/-6.5 °C for monomer Y). CD measurements do...

  7. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

    Science.gov (United States)

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

    2010-01-01

    Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts

  8. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  9. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  10. A G-C-rich palindromic structural motif and a stretch of single-stranded purines are required for optimal packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA.

    Science.gov (United States)

    Jaballah, Soumeya Ali; Aktar, Suriya J; Ali, Jahabar; Phillip, Pretty Susan; Al Dhaheri, Noura Salem; Jabeen, Aayesha; Rizvi, Tahir A

    2010-09-03

    During retroviral RNA packaging, two copies of genomic RNA are preferentially packaged into the budding virus particles whereas the spliced viral RNAs and the cellular RNAs are excluded during this process. Specificity towards retroviral RNA packaging is dependent upon sequences at the 5' end of the viral genome, which at times extend into Gag sequences. It has earlier been suggested that the Mason-Pfizer monkey virus (MPMV) contains packaging sequences within the 5' untranslated region (UTR) and Gag. These studies have also suggested that the packaging determinants of MPMV that lie in the UTR are bipartite and are divided into two regions both upstream and downstream of the major splice donor. However, the precise boundaries of these discontinuous regions within the UTR and the role of the intervening sequences between these dipartite sequences towards MPMV packaging have not been investigated. Employing a combination of genetic and structural prediction analyses, we have shown that region "A", immediately downstream of the primer binding site, is composed of 50 nt, whereas region "B" is composed of the last 23 nt of UTR, and the intervening 55 nt between these two discontinuous regions do not contribute towards MPMV RNA packaging. In addition, we have identified a 14-nt G-C-rich palindromic sequence (with 100% autocomplementarity) within region A that has been predicted to fold into a structural motif and is essential for optimal MPMV RNA packaging. Furthermore, we have also identified a stretch of single-stranded purines (ssPurines) within the UTR and 8 nt of these ssPurines are duplicated in region B. The native ssPurines or its repeat in region B when predicted to refold as ssPurines has been shown to be essential for RNA packaging, possibly functioning as a potential nucleocapsid binding site. Findings from this study should enhance our understanding of the steps involved in MPMV replication including RNA encapsidation process. Copyright (c) 2010 Elsevier Ltd

  11. A single-stranded conformational polymorphism (SSCP)-derived quantitative variable to monitor the virulence of a Barley yellow dwarf virus-PAV (BYDV-PAV) isolate during adaptation to the TC14 resistant wheat line.

    Science.gov (United States)

    Delaunay, Agnes; Lacroix, Christelle; Morliere, Stephanie; Riault, Gerard; Chain, Florian; Trottet, Maxime; Jacquot, Emmanuel

    2010-09-01

    A standardized single-stranded conformational polymorphism (SSCP) procedure is proposed as an alternative to the time-consuming biological characterization of Barley yellow dwarf virus-PAV (BYDV-PAV) isolates. Using this procedure, six of 21 overlapping regions used to scan the viral genome gave patterns specific to '4E' (avirulent) or '4T' ('4E'-derived virulent) isolates. The calibration of samples and integration of SSCP patterns corresponding to the nucleotide region 1482-2023 allowed the estimation of P(T) values that reflect the proportions of a '4T'-specific band. Analysis of the biological (area under the pathogen progress curve) and molecular (P(T)) data suggested a positive linear relation between these variables. Moreover, sequence analysis of the nucleotide region 1482-2023 highlighted the presence of a nucleotide polymorphism (C/A(1835)) which can be considered as a candidate for virus-host interactions linked to the monitored virulence. According to these parameters, P(T) values associated with '4E'- and '4T'-derived populations show that: (i) long-term infection of a BYDV-PAV isolate on the 'TC14' resistant host leads to the fixation of virulent individuals in viral populations; and (ii) the introduction of susceptible hosts in successive 'TC14' infections results in the maintenance of low virulence of the populations. Thus, the presented study demonstrates that SSCP is a useful tool for monitoring viral populations during the host adaptation process. The described impact of host alternation provides new opportunities for the use of the 'TC14' resistance source in BYDV-resistant breeding programmes. This study is part of the global effort made by the scientific community to propose sustainable alternatives to the chemical control of this viral disease.

  12. Labeling of phosphorothioate antisense oligonucleotides with yttrium-90

    International Nuclear Information System (INIS)

    Watanabe, Naoyuki; Sawai, Hiroaki; Endo, Keigo; Shinozuka, Kazuo; Ozaki, Hiroaki; Tanada, Shuji; Murata, Hajime; Sasaki, Yasuhito

    1999-01-01

    Novel yttrium-90 ( 90 Y)-labeled phosphorothioate antisense oligonucleotides were designed as a potential targeted radionuclide method for the purification of IQNP for use imer phosphorothioate antisense oligonucleotide, which was complementary to the translation start region of the N-myc oncogene mRNA, was conjugated with isothiocyanobenzyl ethylenediamine tetraacetic acid (SCN-Bn-EDTA), via a C-5-substituted deoxyuridine that had replaced a thymine in the oligonucleotide, and was then labeled with 90 Y-acetate. Following purification, the radiochemical purity of the 90 Y-Bn-EDTA-phosphorothioate antisense oligonucleotides was estimated by 2.0% agarose gel electrophoresis, and the specific hybridization of 90 Y-Bn-EDTA-phosphorothioate antisense oligonucleotide to a phosphorodiester sense oligonucleotide was investigated by 20% polyacrylamide gel electrophoresis in a cell-free system. Radiochemical purity was 98.7±0.4% at 72 h after labeling and 90.3±0.9% after 72-h incubation with human normal serum. The 90 Y-Bn-EDTA-phosphorothioate antisense oligonucleotide hybridized specifically to a complementary phosphorodiester sense oligonucleotide. In conclusion, phosphorothioate antisense oligonucleotides can be labeled stably with 90 Y using SCN-Bn-EDTA without loss of hybridization properties

  13. Recognition of double-stranded DNA using energetically activated duplexes with interstrand zippers of 1-, 2- or 4-pyrenyl-functionalized O2'-alkylated RNA monomers.

    Science.gov (United States)

    Karmakar, Saswata; Madsen, Andreas S; Guenther, Dale C; Gibbons, Bradley C; Hrdlicka, Patrick J

    2014-10-21

    Despite advances with triplex-forming oligonucleotides, peptide nucleic acids, polyamides and--more recently--engineered proteins, there remains an urgent need for synthetic ligands that enable specific recognition of double-stranded (ds) DNA to accelerate studies aiming at detecting, regulating and modifying genes. Invaders, i.e., energetically activated DNA duplexes with interstrand zipper arrangements of intercalator-functionalized nucleotides, are emerging as an attractive approach toward this goal. Here, we characterize and compare Invaders based on 1-, 2- and 4-pyrenyl-functionalized O2'-alkylated uridine monomers X-Z by means of thermal denaturation experiments, optical spectroscopy, force-field simulations and recognition experiments using DNA hairpins as model targets. We demonstrate that Invaders with +1 interstrand zippers of X or Y monomers efficiently recognize mixed-sequence DNA hairpins with single nucleotide fidelity. Intercalator-mediated unwinding and activation of the double-stranded probe, coupled with extraordinary stabilization of probe-target duplexes (ΔT(m)/modification up to +14.0 °C), provides the driving force for dsDNA recognition. In contrast, Z-modified Invaders show much lower dsDNA recognition efficiency. Thus, even very conservative changes in the chemical makeup of the intercalator-functionalized nucleotides used to activate Invader duplexes, affects dsDNA-recognition efficiency of the probes, which highlights the importance of systematic structure-property studies. The insight from this study will guide future design of Invaders for applications in molecular biology and nucleic acid diagnostics.

  14. Engineering of Functional Replication Protein A Homologs Based on Insights into the Evolution of Oligonucleotide/ Oligosaccharide-Binding Folds▿ †

    Science.gov (United States)

    Lin, Yuyen; Lin, Li-Jung; Sriratana, Palita; Coleman, Kelli; Ha, Taekjip; Spies, Maria; Cann, Isaac K. O.

    2008-01-01

    The bacterial single-stranded DNA-binding protein (SSB) and the archaeal/eukaryotic functional homolog, replication protein A (RPA), are essential for most aspects of DNA metabolism. Structural analyses of the architecture of SSB and RPA suggest that they are composed of different combinations of a module called the oligonucleotide/oligosaccharide-binding (OB) fold. Members of the domains Bacteria and Eukarya, in general, contain one type of SSB or RPA. In contrast, organisms in the archaeal domain have different RPAs made up of different organizations of OB folds. Interestingly, the euryarchaeon Methanosarcina acetivorans harbors multiple functional RPAs named MacRPA1 (for M. acetivorans RPA 1), MacRPA2, and MacRPA3. Comparison of MacRPA1 with related proteins in the publicly available databases suggested that intramolecular homologous recombination might play an important role in generating some of the diversity of OB folds in archaeal cells. On the basis of this information, from a four-OB-fold-containing RPA, we engineered chimeric modules to create three-OB-fold-containing RPAs to mimic a novel form of RPA found in Methanococcoides burtonii and Methanosaeta thermophila. We further created two RPAs that mimicked the RPAs in Methanocaldococcus jannaschii and Methanothermobacter thermautotrophicus through fusions of modules from MacRPA1 and M. thermautotrophicus RPA. Functional studies of these engineered proteins suggested that fusion and shuffling of OB folds can lead to well-folded polypeptides with most of the known properties of SSB and RPAs. On the basis of these results, different models that attempt to explain how intramolecular and intermolecular homologous recombination can generate novel forms of SSB or RPAs are proposed. PMID:18586938

  15. Engineering of functional replication protein a homologs based on insights into the evolution of oligonucleotide/oligosaccharide-binding folds.

    Science.gov (United States)

    Lin, Yuyen; Lin, Li-Jung; Sriratana, Palita; Coleman, Kelli; Ha, Taekjip; Spies, Maria; Cann, Isaac K O

    2008-09-01

    The bacterial single-stranded DNA-binding protein (SSB) and the archaeal/eukaryotic functional homolog, replication protein A (RPA), are essential for most aspects of DNA metabolism. Structural analyses of the architecture of SSB and RPA suggest that they are composed of different combinations of a module called the oligonucleotide/oligosaccharide-binding (OB) fold. Members of the domains Bacteria and Eukarya, in general, contain one type of SSB or RPA. In contrast, organisms in the archaeal domain have different RPAs made up of different organizations of OB folds. Interestingly, the euryarchaeon Methanosarcina acetivorans harbors multiple functional RPAs named MacRPA1 (for M. acetivorans RPA 1), MacRPA2, and MacRPA3. Comparison of MacRPA1 with related proteins in the publicly available databases suggested that intramolecular homologous recombination might play an important role in generating some of the diversity of OB folds in archaeal cells. On the basis of this information, from a four-OB-fold-containing RPA, we engineered chimeric modules to create three-OB-fold-containing RPAs to mimic a novel form of RPA found in Methanococcoides burtonii and Methanosaeta thermophila. We further created two RPAs that mimicked the RPAs in Methanocaldococcus jannaschii and Methanothermobacter thermautotrophicus through fusions of modules from MacRPA1 and M. thermautotrophicus RPA. Functional studies of these engineered proteins suggested that fusion and shuffling of OB folds can lead to well-folded polypeptides with most of the known properties of SSB and RPAs. On the basis of these results, different models that attempt to explain how intramolecular and intermolecular homologous recombination can generate novel forms of SSB or RPAs are proposed.

  16. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    Energy Technology Data Exchange (ETDEWEB)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.; Mitra, S.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNA when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.

  17. Investigations of radiation-induced strand breaks of poly(U) in aqueous solutions

    International Nuclear Information System (INIS)

    Lemaire, D.G.E.

    1984-01-01

    DNA strand breaks induced by γ irradiation were studied in polyuridylic acid (Poly(U)), a single-strand model substance with a single base. Poly(U) in diluted, aqueous solution was irradiated in a Co-γ source, and the 100 eV yields of strand breaks (Cr values) were determined on the basis of the loss of molecular weight. The molecular weight was determined by small-angle laser light scattering. (orig./PW) [de

  18. Mutagenesis of the Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.

    Science.gov (United States)

    Zhou, X R; Christie, P J

    1999-07-01

    The VirE2 single-stranded DNA-binding protein (SSB) of Agrobacterium tumefaciens is required for delivery of T-DNA to the nuclei of susceptible plant cells. By yeast two-hybrid and immunoprecipitation analyses, VirE2 was shown to self-associate and to interact with VirE1. VirE2 mutants with small deletions or insertions of a 31-residue oligopeptide (i31) at the N or C terminus or with an i31 peptide insertion at Leu236 retained the capacity to form homomultimers. By contrast, VirE2 mutants with modifications outside a central region located between residues 320 and 390 retained the capacity to interact with VirE1. These findings suggest the tertiary structure of VirE2 is important for homomultimer formation whereas a central domain mediates formation of a complex with VirE1. The capacity of VirE2 mutants to interact with full-length VirE2 in the yeast Saccharomyces cerevisiae correlated with the abundance of the mutant proteins in A. tumefaciens, suggesting that VirE2 is stabilized by homomultimerization in the bacterium. We further characterized the promoter and N- and C-terminal sequence requirements for synthesis of functional VirE2. A PvirB::virE2 construct yielded functional VirE2 protein as defined by complementation of a virE2 null mutation. By contrast, PvirE or Plac promoter constructs yielded functional VirE2 only if virE1 was coexpressed with virE2. Deletion of 10 or 9 residues from the N or C terminus of VirE2, respectively, or addition of heterologous peptides or proteins to either terminus resulted in a loss of protein function. However, an i31 peptide insertion at Tyr39 had no effect on protein function as defined by the capacity of the mutant protein to (i) interact with native VirE2, (ii) interact with VirE1, (iii) accumulate at abundant levels in A. tumefaciens, and (iv) restore wild-type virulence to a virE2 null mutant. We propose that Tyr39 of VirE2 corresponds to a permissive site for insertion of heterologous peptides or proteins of interest

  19. Targeting several CAG expansion diseases by a single antisense oligonucleotide.

    NARCIS (Netherlands)

    Evers, M.M.; Pepers, B.A.; Deutekom, J.C.T. van; Mulders, S.A.M.; Dunnen, J.T. den; Aartsma-Rus, A.; Ommen, G.J.B. van; Roon-Mom, W.M. van

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion

  20. Correlation of Free Radical Yields with Strand Break Yields Produced in Plasmid DNA by the Direct Effect of Ionizing Radiation

    OpenAIRE

    Purkayastha, Shubhadeep; Milligan, Jamie R.; Bernhard, William A.

    2005-01-01

    The purpose of this study was to determine how free radical formation (fr) correlates with single strand break (ssb) and double strand break (dsb) formation in DNA exposed to the direct effects of ionizing radiation. Chemical yields have been determined of (i) total radicals trapped on DNA at 4 K, G(∑fr), (ii) radicals trapped on the DNA sugar, Gsugar(fr), (iii) prompt single strand breaks, Gprompt(ssb), (iv) total single strand breaks, Gtotal(ssb), and (v) double strand breaks, G(dsb). These...

  1. Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

    Science.gov (United States)

    Khrapko, Konstantin R.; Khorlin, Alexandr A.; Ivanov, Igor B.; Ershov, Gennady M.; Lysov, Jury P.; Florentiev, Vladimir L.; Mirzabekov, Andrei D.

    1996-09-03

    A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

  2. Genetic and environmental influence on DNA strand break repair

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single-strand...... breaks), and some of the most hazardous lesions (DNA double-strand breaks). DNA damage signaling response (Gamma-H2AX signaling), relative amount of endogenous damage, and DNA-strand break repair capacities were studied in peripheral blood mononuclear cells from 198 twins (94 monozygotic and 104...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study. Environ. Mol. Mutagen., 2013. © 2013 Wiley Periodicals, Inc....

  3. Design and analysis of mismatch probes for long oligonucleotide microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  4. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Poeschla, Eric, E-mail: poeschla.eric@mayo.edu

    2013-06-20

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.

  5. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    International Nuclear Information System (INIS)

    Poeschla, Eric

    2013-01-01

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import

  6. Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    2013-09-01

    Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  7. Viable deletions of the M13 complementary strand origin

    OpenAIRE

    Kim, Myoung Hee; Hines, Jane C.; Ray, Dan S.

    1981-01-01

    The single-stranded DNA of bacteriophage M13 is converted to a duplex replicative form by a mechanism involving RNA-primed initiation at a single unique site on the viral DNA. The DNA sequence that specifies the RNA primer is contained largely within one of two adjacent hairpin structures protected from DNase degradation by RNA polymerase. We have used in vitro techniques to construct a series of M13 mutants having deletions in the region of the complementary strand origin. Deletions of the d...

  8. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Science.gov (United States)

    Grant, Rachel A.; Savirina, Anna

    2018-01-01

    Simple Summary Marine mammals stranding on coastal beaches is not unusual. However, there appears to be no single cause for this, with several causes being probable, such as starvation, contact with humans (for example boat strike or entanglement with fishing gear), disease, and parasitism. We evaluated marine mammal stranding off the Washington and Oregon coasts and looked at offshore earthquakes as a possible contributing factor. Our analysis showed that offshore earthquakes did not make marine mammals more likely to strand. We also analysed a subset of data from the north of Washington State and found that non-adult animals made up a large proportion of stranded animals, and for dead animals the commonest cause of death was disease, traumatic injury, or starvation. Abstract The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or

  9. The Effect of Basepair Mismatch on DNA Strand Displacement.

    Science.gov (United States)

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  10. Identification of mycotoxigenic fungi using an oligonucleotide microarray

    CSIR Research Space (South Africa)

    Barros, E

    2013-01-01

    Full Text Available the development of an oligonucleotide microarray specific for eleven mycotoxigenic fungi isolated from different food commodities in South Africa. This array is suitable for the detection and identification of cultures of potential mycotoxigenic fungi in both...

  11. Sequence-dependent theory of oligonucleotide hybridization kinetics

    International Nuclear Information System (INIS)

    Marimuthu, Karthikeyan; Chakrabarti, Raj

    2014-01-01

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions

  12. Oligonucleotide-based theranostic nanoparticles in cancer therapy

    Science.gov (United States)

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-01-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  13. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  14. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  15. The N-terminal strand modulates immunoglobulin light chain fibrillogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Pozo-Yauner, Luis del, E-mail: ldelpozo@inmegen.gob.mx [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Wall, Jonathan S. [Departments of Radiology and Medicine, The University of Tennessee Medical Center, 1924 Alcoa Highway, Knoxville, TN (United States); González Andrade, Martín [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Sánchez-López, Rosana [Instituto de Biotecnología, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa Cuernavaca, Morelos C.P. 62210 (Mexico); Rodríguez-Ambriz, Sandra L. [Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional, Calle CEPROBI No. 8, Col. San Isidro, Yautepec, Morelos C.P. 62731 (Mexico); Pérez Carreón, Julio I. [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); and others

    2014-01-10

    Highlights: •We evaluated the impact of mutations in the N-terminal strand of 6aJL2 protein. •Mutations destabilized the protein in a position-dependent manner. •Destabilizing mutations accelerated the fibrillogenesis by shortening the lag time. •The effect on the kinetic of fibril elongation by seeding was of different nature. •The N-terminal strand is buried in the fibrillar state of 6aJL2 protein. -- Abstract: It has been suggested that the N-terminal strand of the light chain variable domain (V{sub L}) protects the molecule from aggregation by hindering spurious intermolecular contacts. We evaluated the impact of mutations in the N-terminal strand on the thermodynamic stability and kinetic of fibrillogenesis of the V{sub L} protein 6aJL2. Mutations in this strand destabilized the protein in a position-dependent manner, accelerating the fibrillogenesis by shortening the lag time; an effect that correlated with the extent of destabilization. In contrast, the effect on the kinetics of fibril elongation, as assessed in seeding experiments was of different nature, as it was not directly dependant on the degree of destabilization. This finding suggests different factors drive the nucleation-dependent and elongation phases of light chain fibrillogenesis. Finally, taking advantage of the dependence of the Trp fluorescence upon environment, four single Trp substitutions were made in the N-terminal strand, and changes in solvent exposure during aggregation were evaluated by acrylamide-quenching. The results suggest that the N-terminal strand is buried in the fibrillar state of 6aJL2 protein. This finding suggest a possible explanation for the modulating effect exerted by the mutations in this strand on the aggregation behavior of 6aJL2 protein.

  16. Spotted cotton oligonucleotide microarrays for gene expression analysis

    Directory of Open Access Journals (Sweden)

    Nettleton Dan

    2007-03-01

    Full Text Available Abstract Background Microarrays offer a powerful tool for diverse applications plant biology and crop improvement. Recently, two comprehensive assemblies of cotton ESTs were constructed based on three Gossypium species. Using these assemblies as templates, we describe the design and creation and of a publicly available oligonucleotide array for cotton, useful for all four of the cultivated species. Results Synthetic oligonucleotide probes were generated from exemplar sequences of a global assembly of 211,397 cotton ESTs derived from >50 different cDNA libraries representing many different tissue types and tissue treatments. A total of 22,787 oligonucleotide probes are included on the arrays, optimized to target the diversity of the transcriptome and previously studied cotton genes, transcription factors, and genes with homology to Arabidopsis. A small portion of the oligonucleotides target unidentified protein coding sequences, thereby providing an element of gene discovery. Because many oligonucleotides were based on ESTs from fiber-specific cDNA libraries, the microarray has direct application for analysis of the fiber transcriptome. To illustrate the utility of the microarray, we hybridized labeled bud and leaf cDNAs from G. hirsutum and demonstrate technical consistency of results. Conclusion The cotton oligonucleotide microarray provides a reproducible platform for transcription profiling in cotton, and is made publicly available through http://cottonevolution.info.

  17. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    Science.gov (United States)

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.

    2002-01-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  18. Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.

    Science.gov (United States)

    Tang, Weizhong; Zhou, Huafu; Li, Wei

    2015-01-01

    To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA), (dC), (dG) and (dT) to silver staining could be ranged as (dA) > (dG) > (dC) > (dT) from high to low. It was unexpected that oligo (dT) was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt). The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.

  19. Global features of sequences of bacterial chromosomes, plasmids and phages revealed by analysis of oligonucleotide usage patterns

    Directory of Open Access Journals (Sweden)

    Tümmler Burkhard

    2004-07-01

    Full Text Available Abstract Background Oligonucleotide frequencies were shown to be conserved signatures for bacterial genomes, however, the underlying constraints have yet not been resolved in detail. In this paper we analyzed oligonucleotide usage (OU biases in a comprehensive collection of 155 completely sequenced bacterial chromosomes, 316 plasmids and 104 phages. Results Two global features were analyzed: pattern skew (PS and variance of OU deviations normalized by mononucleotide content of the sequence (OUV. OUV reflects the strength of OU biases and taxonomic signals. PS denotes asymmetry of OU in direct and reverse DNA strands. A trend towards minimal PS was observed for almost all complete sequences of bacterial chromosomes and plasmids, however, PS was substantially higher in separate genomic loci and several types of plasmids and phages characterized by long stretches of non-coding DNA and/or asymmetric gene distribution on the two DNA strands. Five of the 155 bacterial chromosomes have anomalously high PS, of which the chromosomes of Xylella fastidiosa 9a5c and Prochlorococcus marinus MIT9313 exhibit extreme PS values suggesting an intermediate unstable state of these two genomes. Conclusions Strand symmetry as indicated by minimal PS is a universally conserved feature of complete bacterial genomes that results from the matching mutual compensation of local OU biases on both replichors while OUV is more a taxon specific feature. Local events such as inversions or the incorporation of genome islands are balanced by global changes in genome organization to minimize PS that may represent one of the leading evolutionary forces driving bacterial genome diversification.

  20. Short Communication A near mass stranding of cetaceans in St ...

    African Journals Online (AJOL)

    A group of 70 false killer whales Pseudorca crassidens and 124 bottlenose dolphins Tursiops sp., and a separate group of 13 Risso's dolphins Grampus griseus, assembled close inshore off a known mass-stranding site in St Helena Bay, South Africa, in October 2003. However, only a single Risso's dolphin attempted to ...

  1. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    DNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Raman spectroscopy. Keywords. Graphene oxide; DNA; hydrogels; liquid crystals; self-assembly. 1. Introduction.

  2. Nick-initiated homologous recombination: Protecting the genome, one strand at a time

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Krawczyk, Przemek M.

    2017-01-01

    Homologous recombination (HR) is an essential, widely conserved mechanism that utilizes a template for accurate repair of DNA breaks. Some early HR models, developed over five decades ago, anticipated single-strand breaks (nicks) as initiating lesions. Subsequent studies favored a more double-strand

  3. Interactions between Cytochrome c and DNA Strands Self-Assembled at Gold Electrode

    Science.gov (United States)

    Lao, Ruojun; Wang, Lihua; Wan, Ying; Zhang, Jiong; Song, Shiping; Zhang, Zhizhou; Fan, Chunhai; He, Lin

    2007-01-01

    In this work, we reported the investigation on the interaction between DNA strands self-assembled at gold electrodes and an electron transfer protein, cytochrome c. We observed that cytochrome c exhibited well-defined electrochemistry in both double-stranded and single-stranded DNA films. This suggested that the electron transfer reaction of cytochrome c arose possibly due to the electron hopping along DNA strands rather than wiring along the double helix. We also compared the heterogeneous electron transfer rate of cytochrome c with that of a ruthenium complex, which further confirmed this mechanism.

  4. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    as genotyping by melting curve analysis is possible by the use of hybridisation probes. These hybridisation probes are sequence-specific oligonucleotide probes, labelled by fluorescence dyes. For the detection of a SNP two hy- bridisation probes are required, one that binds to the. DNA strand in a way that the polymorphic ...

  5. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    Science.gov (United States)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  6. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts.

    Science.gov (United States)

    Grant, Rachel A; Savirina, Anna; Hoppitt, Will

    2018-01-26

    The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  7. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    Science.gov (United States)

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis.

  8. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Directory of Open Access Journals (Sweden)

    Rachel A. Grant

    2018-01-01

    Full Text Available The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  9. Genetic transformation of Neisseria gonorrhoeae shows a strand preference

    OpenAIRE

    Duffin, Paul M.; Seifert, H. Steven

    2012-01-01

    Natural transformation is the main means of horizontal genetic exchange in the obligate human pathogen Neisseria gonorrhoeae. Neisseria spp. have been shown to preferentially take up and transform their own DNA by recognizing a non-palindromic 10 or 12 nucleotide DNA uptake sequence (DUS10 or DUS12). We investigated the ability of the DUS12 to enhance single-stranded DNA (ssDNA) transformation. Given the non-palindromic nature of the DUS12, we tested whether both strands of the DUS equally en...

  10. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    DEFF Research Database (Denmark)

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong

    2011-01-01

    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...... DNA while Au-NPs modified with oligonucleotide detection sequences played a role in recognition and signal production. Due to the much lower stability of mismatched DNA strands caused by unstable duplex structures in solutions of relatively low salt concentration, hybridization efficiency...... in the presence of different buffers was well investigated, and thus, the optimized salt concentration allowed for discrimination of single-mismatched DNA (MMT) from perfectly matched DNA (PMT). Therefore, quantitative information concerning the target analyte was translated into a colorimetric signal, which...

  11. Triple helices containing arabinonucleotides in the third (Hoogsteen) strand: effects of inverted stereochemistry at the 2'-position of the sugar moiety.

    Science.gov (United States)

    Noronha, A; Damha, M J

    1998-06-01

    Arabinonucleic acid, the 2'-stereoisomer of RNA, was tested for its ability to recognize double-helical DNA, double-helical RNA and RNA-DNA hybrids. A pyrimidine oligoarabinonucleotide (ANA) was shown to form triple-helical complexes only with duplex DNA and hybrid DNA (Pu):RNA (Py) with an affinity that was slightly lower relative to the corresponding pyrimidine oligodeoxynucleotide (DNA) third strand. Neither the ANA nor DNA third strands were able to bind to duplex RNA or hybrid RNA (Pu):DNA (Py). In contrast, an RNA third strand recognized all four possible duplexes (DD, DR, RD and RR), as previously demonstrated. Such an understanding can be applied to the design of sequence-selective oligonucleotides which interact with double-stranded nucleic acids and emphasizes the role of the 2'-OH group as a general recognition and binding determinant of RNA.

  12. An albumin-oligonucleotide assembly for potential combinatorial drug delivery and half-life extension applications

    DEFF Research Database (Denmark)

    Kuhlmann, Matthias; Hamming, Jonas Bohn Refslund; Voldum, Anders

    2017-01-01

    The long blood circulatory property of human serum albumin, due to engagement with the cellular recycling neonatal Fc receptor (FcRn), is an attractive drug half-life extension enabling technology. This work describes a novel site-specific albumin double-stranded (ds) DNA assembly approach......, in which the 3' or 5' end maleimide-derivatized oligodeoxynucleotides are conjugated to albumin cysteine at position 34 (cys34) and annealed with complementary strands to allow single site-specific protein modification with functionalized ds oligodeoxynucleotides. Electrophoretic gel shift assays...

  13. DNA turnover and strand breaks in Escherichia coli

    International Nuclear Information System (INIS)

    Hanawalt, P.; Grivell, A.; Nakayama, H.

    1975-01-01

    The extent of DNA turnover has been measured in a dnaB mutant of Escherichia coli, temperature sensitive for semiconservative DNA replication. At the nonpermissive temperature about 0.02 percent of the deoxynucleotides in DNA are exchanged per generation period. This turnover rate is markedly depressed in the presence of rifampicin. During thymine starvation strand breaks accumulate in the DNA of E. coli strains that are susceptible to thymineless death. Rifampicin suppresses the appearance of these breaks, consistent with our hypothesis that transcription may be accompanied by repairable single-strand breaks in DNA. DNA turnover is enhanced severalfold in strands containing 5-bromodeoxyuridine in place of thymidine, possibly because the analog (or the deoxyuridine, following debromination) is sometimes recognized and excised

  14. Development of specific oligonucleotide probes for the identification and in situ detection of hydrocarbon-degrading Alcanivorax strains.

    Science.gov (United States)

    Syutsubo, K; Kishira, H; Harayama, S

    2001-06-01

    The genus Alcanivorax comprises diverse hydrocarbon-degrading marine bacteria. Novel 16S rRNA-targeted oligonucleotide DNA probes (ALV735 and ALV735-b) were developed to quantify two subgroups of the Alcanivorax/Fundibacter group by fluorescence in situ hybridization (FISH), and the conditions for the single-mismatch discrimination of the probes were optimized. The specificity of the probes was improved further using a singly mismatched oligonucleotide as a competitor. The growth of Alcanivorax cells in crude oil-contaminated sea water under the biostimulation condition was investigated by FISH with the probe ALV735, which targeted the main cluster of the Alcanivorax/Fundibacter group. The size of the Alcanivorax population increased with increasing incubation time and accounted for 91% of the 4',6-diamidino-2-phenylindole (DAPI) count after incubation for 2 weeks. The probes developed in this study are useful for detecting Alcanivorax populations in petroleum hydrocarbon-degrading microbial consortia.

  15. A Single Electrochemical Probe Used for Analysis of Multiple Nucleic Acid Sequences

    Science.gov (United States)

    Mills, Dawn M.; Calvo-Marzal, Percy; Pinzon, Jeffer M.; Armas, Stephanie; Kolpashchikov, Dmitry M.; Chumbimuni-Torres, Karin Y.

    2017-01-01

    Electrochemical hybridization sensors have been explored extensively for analysis of specific nucleic acids. However, commercialization of the platform is hindered by the need for attachment of separate oligonucleotide probes complementary to a RNA or DNA target to an electrode’s surface. Here we demonstrate that a single probe can be used to analyze several nucleic acid targets with high selectivity and low cost. The universal electrochemical four-way junction (4J)-forming (UE4J) sensor consists of a universal DNA stem-loop (USL) probe attached to the electrode’s surface and two adaptor strands (m and f) which hybridize to the USL probe and the analyte to form a 4J associate. The m adaptor strand was conjugated with a methylene blue redox marker for signal ON sensing and monitored using square wave voltammetry. We demonstrated that a single sensor can be used for detection of several different DNA/RNA sequences and can be regenerated in 30 seconds by a simple water rinse. The UE4J sensor enables a high selectivity by recognition of a single base substitution, even at room temperature. The UE4J sensor opens a venue for a re-useable universal platform that can be adopted at low cost for the analysis of DNA or RNA targets. PMID:29371782

  16. Gene editing by co-transformation of TALEN and chimeric RNA/DNA oligonucleotides on the rice OsEPSPS gene and the inheritance of mutations.

    Directory of Open Access Journals (Sweden)

    Mugui Wang

    Full Text Available Although several site-specific nucleases (SSNs, such as zinc-finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs, and the clustered regularly interspaced short palindromic repeat (CRISPR/Cas, have emerged as powerful tools for targeted gene editing in many organisms, to date, gene targeting (GT in plants remains a formidable challenge. In the present study, we attempted to substitute a single base in situ on the rice OsEPSPS gene by co-transformation of TALEN with chimeric RNA/DNA oligonucleotides (COs, including different strand composition such as RNA/DNA (C1 or DNA/RNA (C2 but contained the same target base to be substituted. In contrast to zero GT event obtained by the co-transformation of TALEN with homologous recombination plasmid (HRP, we obtained one mutant showing target base substitution although accompanied by undesired deletion of 12 bases downstream the target site from the co-transformation of TALEN and C1. In addition to this typical event, we also obtained 16 mutants with different length of base deletions around the target site among 105 calli lines derived from transformation of TALEN alone (4/19 as well as co-transformation of TELAN with either HRP (5/30 or C1 (2/25 or C2 (5/31. Further analysis demonstrated that the homozygous gene-edited mutants without foreign gene insertion could be obtained in one generation. The induced mutations in transgenic generation were also capable to pass to the next generation stably. However, the genotypes of mutants did not segregate normally in T1 population, probably due to lethal mutations. Phenotypic assessments in T1 generation showed that the heterozygous plants with either one or three bases deletion on target sequence, called d1 and d3, were more sensitive to glyphosate and the heterozygous d1 plants had significantly lower seed-setting rate than wild-type.

  17. Comparison of the electrophoretic method with the sedimentation method for the analysis of DNA strand breaks

    International Nuclear Information System (INIS)

    Yamamoto, Osamu; Ogawa, Masaaki; Hoshi, Masaharu

    1982-01-01

    Application of electrophoresis to the analysis of DNA strand breaks was studied comparing with the sedimentation analysis. A BRL gel electrophoresis system (Type V16) was used for this study. Calf thymus DNA (1 mg/ml) irradiated with 60 Co gamma-rays in SSC solution was applied to both the electrophoretic analysis and the sedimentation analysis. Lamda phage DNA and its fragments were employed as the standard size molecules. In a range from 1 k base pairs to 6 k base pairs in length for double stranded DNA or from 2 k bases to 12 k bases for single stranded DNA, the calculated average molecular weight from the electrophoresis coincided with that from the sedimentation. Number of single strand breaks and double strand breaks were 1.34 x 10 11 breaks/mg/rad (G = 0.215) and 0.48 x 10 5 breaks/mg/rad 2 , respectively. (author)

  18. Investigations of oligonucleotide usage variance within and between prokaryotes

    DEFF Research Database (Denmark)

    Bohlin, J.; Skjerve, E.; Ussery, David

    2008-01-01

    Oligonucleotide usage in archaeal and bacterial genomes can be linked to a number of properties, including codon usage (trinucleotides), DNA base-stacking energy (dinucleotides), and DNA structural conformation (di-to tetranucleotides). We wanted to assess the statistical information potential...... was that prokaryotic chromosomes can be described by hexanucleotide frequencies, suggesting that prokaryotic DNA is predominantly short range correlated, i. e., information in prokaryotic genomes is encoded in short oligonucleotides. Oligonucleotide usage varied more within AT-rich and host-associated genomes than...... in GC-rich and free-living genomes, and this variation was mainly located in non-coding regions. Bias (selectional pressure) in tetranucleotide usage correlated with GC content, and coding regions were more biased than non-coding regions. Non-coding regions were also found to be approximately 5.5% more...

  19. Delivery of RNAi-Based Oligonucleotides by Electropermeabilization

    Directory of Open Access Journals (Sweden)

    Muriel Golzio

    2013-04-01

    Full Text Available For more than a decade, understanding of RNA interference (RNAi has been a growing field of interest. The potent gene silencing ability that small oligonucleotides have offers new perspectives for cancer therapeutics. One of the present limits is that many biological barriers exist for their efficient delivery into target cells or tissues. Electropermeabilization (EP is one of the physical methods successfully used to transfer small oligonucleotides into cells or tissues. EP consists in the direct application of calibrated electric pulses to cells or tissues that transiently permeabilize the plasma membranes, allowing efficient in vitro and in vivo. cytoplasmic delivery of exogenous molecules. The present review reports on the type of therapeutic RNAi-based oligonucleotides that can be electrotransferred, the mechanism(s of their electrotransfer and the technical settings for pre-clinical purposes.

  20. Challenges to oligonucleotides-based therapeutics for Duchenne muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Goyenvalle Aurélie

    2011-02-01

    Full Text Available Abstract Antisense oligonucleotides are short nucleic acids designed to bind to specific messenger RNAs in order to modulate splicing patterns or inhibit protein translation. As such, they represent promising therapeutic tools for many disorders and have been actively developed for more than 20 years as a form of molecular medicine. Although significant progress has been made in developing these agents as drugs, they are yet not recognized as effective therapeutics and several hurdles remain to be overcome. Within the last few years, however, the prospect of successful oligonucleotides-based therapies has moved a step closer, in particular for Duchenne muscular dystrophy. Clinical trials have recently been conducted for this myopathy, where exon skipping is being used to achieve therapeutic outcomes. In this review, the recent developments and clinical trials using antisense oligonucleotides for Duchenne muscular dystrophy are discussed, with emphasis on the challenges ahead for this type of therapy, especially with regards to delivery and regulatory issues.