Chemical fidelity of an RNA polymerase ribozyme

DEFF Research Database (Denmark)

Attwater, J.; Tagami, S.; Kimoto, M.

2013-01-01

for function. Here we have explored the chemical fidelity, i.e. substrate selectivity and specificity for both single and multiple catalytic steps of the Z RNA polymerase ribozyme-a modern day analogue of the primordial RNA replicase. Using a wide range of nucleotide analogues and ionic conditions, we observe......The emergence of catalytically active RNA enzymes (ribozymes) is widely believed to have been an important transition in the origin of life. In the context of a likely heterogeneous chemical environment, substrate specificity and selectivity of these primordial enzymes would have been critical...

Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

Directory of Open Access Journals (Sweden)

Aris Haryanto

2010-12-01

Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

Comparison of Model Reliabilities from Single-Step and Bivariate Blending Methods

DEFF Research Database (Denmark)

Taskinen, Matti; Mäntysaari, Esa; Lidauer, Martin

2013-01-01

Model based reliabilities in genetic evaluation are compared between three methods: animal model BLUP, single-step BLUP, and bivariate blending after genomic BLUP. The original bivariate blending is revised in this work to better account animal models. The study data is extracted from...... be calculated. Model reliabilities by the single-step and the bivariate blending methods were higher than by animal model due to genomic information. Compared to the single-step method, the bivariate blending method reliability estimates were, in general, lower. Computationally bivariate blending method was......, on the other hand, lighter than the single-step method....

The expanding polymerase universe.

Science.gov (United States)

Goodman, M F; Tippin, B

2000-11-01

Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

Improving Genetic Evaluation of Litter Size Using a Single-step Model

DEFF Research Database (Denmark)

Guo, Xiangyu; Christensen, Ole Fredslund; Ostersen, Tage

A recently developed single-step method allows genetic evaluation based on information from phenotypes, pedigree and markers simultaneously. This paper compared reliabilities of predicted breeding values obtained from single-step method and the traditional pedigree-based method for two litter size...... traits, total number of piglets born (TNB), and litter size at five days after birth (Ls 5) in Danish Landrace and Yorkshire pigs. The results showed that the single-step method combining phenotypic and genotypic information provided more accurate predictions than the pedigree-based method, not only...

Real-time dynamics of RNA Polymerase II clustering in live human cells

Science.gov (United States)

Cisse, Ibrahim

2014-03-01

Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.

Single-step link of the superdeformed band in 143Eu

International Nuclear Information System (INIS)

Atac, A.; Bergstroem, M.H.; Nyberg, J.; Persson, J.; Herskind, B.; Joss, D.T.; Lipoglavsek, M.; Tucek, K.

1996-01-01

A discrete γ-ray ransition with an energy of 3360.6 keV deexciting the second lowest SD state in 143 Eu has been discovered. It carries 3.2 % of the full intensity of the band and feeds into a nearly spherical state which is above the I = 35/2 (+) , E x =4947 keV level. The exact placement of the single-step link is, however, not established due to the specially complicated level scheme in the region of interest. The energy of the single-step link agrees well with the previously determined two-step links. (orig.)

Step-to-step spatiotemporal variables and ground reaction forces of intra-individual fastest sprinting in a single session.

Science.gov (United States)

Nagahara, Ryu; Mizutani, Mirai; Matsuo, Akifumi; Kanehisa, Hiroaki; Fukunaga, Tetsuo

2018-06-01

We aimed to investigate the step-to-step spatiotemporal variables and ground reaction forces during the acceleration phase for characterising intra-individual fastest sprinting within a single session. Step-to-step spatiotemporal variables and ground reaction forces produced by 15 male athletes were measured over a 50-m distance during repeated (three to five) 60-m sprints using a long force platform system. Differences in measured variables between the fastest and slowest trials were examined at each step until the 22nd step using a magnitude-based inferences approach. There were possibly-most likely higher running speed and step frequency (2nd to 22nd steps) and shorter support time (all steps) in the fastest trial than in the slowest trial. Moreover, for the fastest trial there were likely-very likely greater mean propulsive force during the initial four steps and possibly-very likely larger mean net anterior-posterior force until the 17th step. The current results demonstrate that better sprinting performance within a single session is probably achieved by 1) a high step frequency (except the initial step) with short support time at all steps, 2) exerting a greater mean propulsive force during initial acceleration, and 3) producing a greater mean net anterior-posterior force during initial and middle acceleration.

Kinetic mechanism of DNA polymerase I (Klenow)

International Nuclear Information System (INIS)

Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

1987-01-01

The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

Directory of Open Access Journals (Sweden)

Marcin Olszewski

Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

Single-step affinity purification for fungal proteomics.

Science.gov (United States)

Liu, Hui-Lin; Osmani, Aysha H; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B; De Souza, Colin P; Osmani, Stephen A

2010-05-01

A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.

Composition of single-step media used for human embryo culture.

Science.gov (United States)

Morbeck, Dean E; Baumann, Nikola A; Oglesbee, Devin

2017-04-01

To determine compositions of commercial single-step culture media and test with a murine model whether differences in composition are biologically relevant. Experimental laboratory study. University-based laboratory. Inbred female mice were superovulated and mated with outbred male mice. Amino acid, organic acid, and ions content were determined for single-step culture media: CSC, Global, G-TL, and 1-Step. To determine whether differences in composition of these media are biologically relevant, mouse one-cell embryos were cultured for 96 hours in each culture media at 5% and 20% oxygen in a time-lapse incubator. Compositions of four culture media were analyzed for concentrations of 30 amino acids, organic acids, and ions. Blastocysts at 96 hours of culture and cell cycle timings were calculated, and experiments were repeated in triplicate. Of the more than 30 analytes, concentrations of glucose, lactate, pyruvate, amino acids, phosphate, calcium, and magnesium varied in concentrations. Mouse embryos were differentially affected by oxygen in G-TL and 1-Step. Four single-step culture media have compositions that vary notably in pyruvate, lactate, and amino acids. Blastocyst development was affected by culture media and its interaction with oxygen concentration. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

The Point Zoro Symmetric Single-Step Procedure for Simultaneous Estimation of Polynomial Zeros

Directory of Open Access Journals (Sweden)

Mansor Monsi

2012-01-01

Full Text Available The point symmetric single step procedure PSS1 has R-order of convergence at least 3. This procedure is modified by adding another single-step, which is the third step in PSS1. This modified procedure is called the point zoro symmetric single-step PZSS1. It is proven that the R-order of convergence of PZSS1 is at least 4 which is higher than the R-order of convergence of PT1, PS1, and PSS1. Hence, computational time is reduced since this procedure is more efficient for bounding simple zeros simultaneously.

PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.

Science.gov (United States)

Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi

2009-07-01

Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

International Nuclear Information System (INIS)

Livneh, Z.

1986-01-01

Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC 2.7.7.6) and DNA polymerase III holoenzyme (EC 2.7.7.7) in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.

1989-01-01

We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

Genomic prediction in a nuclear population of layers using single-step models.

Science.gov (United States)

Yan, Yiyuan; Wu, Guiqin; Liu, Aiqiao; Sun, Congjiao; Han, Wenpeng; Li, Guangqi; Yang, Ning

2018-02-01

Single-step genomic prediction method has been proposed to improve the accuracy of genomic prediction by incorporating information of both genotyped and ungenotyped animals. The objective of this study is to compare the prediction performance of single-step model with a 2-step models and the pedigree-based models in a nuclear population of layers. A total of 1,344 chickens across 4 generations were genotyped by a 600 K SNP chip. Four traits were analyzed, i.e., body weight at 28 wk (BW28), egg weight at 28 wk (EW28), laying rate at 38 wk (LR38), and Haugh unit at 36 wk (HU36). In predicting offsprings, individuals from generation 1 to 3 were used as training data and females from generation 4 were used as validation set. The accuracies of predicted breeding values by pedigree BLUP (PBLUP), genomic BLUP (GBLUP), SSGBLUP and single-step blending (SSBlending) were compared for both genotyped and ungenotyped individuals. For genotyped females, GBLUP performed no better than PBLUP because of the small size of training data, while the 2 single-step models predicted more accurately than the PBLUP model. The average predictive ability of SSGBLUP and SSBlending were 16.0% and 10.8% higher than the PBLUP model across traits, respectively. Furthermore, the predictive abilities for ungenotyped individuals were also enhanced. The average improvements of prediction abilities were 5.9% and 1.5% for SSGBLUP and SSBlending model, respectively. It was concluded that single-step models, especially the SSGBLUP model, can yield more accurate prediction of genetic merits and are preferable for practical implementation of genomic selection in layers. © 2017 Poultry Science Association Inc.

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

Science.gov (United States)

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

Science.gov (United States)

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

2009-07-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

International Nuclear Information System (INIS)

Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

2009-01-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Response of single polymers to localized step strains

NARCIS (Netherlands)

Panja, D.

2009-01-01

In this paper, the response of single three-dimensional phantom and self-avoiding polymers to localized step strains are studied for two cases in the absence of hydrodynamic interactions: (i) Polymers tethered at one end with the strain created at the point of tether, and (ii) free polymers with the

The Effects of Multiple-Step and Single-Step Directions on Fourth and Fifth Grade Students' Grammar Assessment Performance

Science.gov (United States)

Mazerik, Matthew B.

2006-01-01

The mean scores of English Language Learners (ELL) and English Only (EO) students in 4th and 5th grade (N = 110), across the teacher-administered Grammar Skills Test, were examined for differences in participants' scores on assessments containing single-step directions and assessments containing multiple-step directions. The results indicated no…

Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

Science.gov (United States)

Yuan, Quan; McHenry, Charles S

2009-11-13

In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

Directory of Open Access Journals (Sweden)

Vanessa Suin

2014-01-01

Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation

DEFF Research Database (Denmark)

Christensen, Ole Fredslund

2012-01-01

Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker-based rel...

Single molecule imaging of RNA polymerase II using atomic force microscopy

International Nuclear Information System (INIS)

Rhodin, Thor; Fu Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru

2003-01-01

An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3 N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes

Two-step bacterial broad-range polymerase chain reaction analysis of heart valve tissue improves bacteriological diagnosis of infective endocarditis.

Science.gov (United States)

Boussier, Rémi; Rogez, Sylvie; François, Bruno; Denes, Eric; Ploy, Marie-Cécile; Garnier, Fabien

2013-03-01

Positive heart valve (HV) culture is a major Duke's criterion for the diagnosis of infective endocarditis but is poorly sensitive. Two broad-range 16S rDNA polymerase chain reaction (PCR) methods were applied to 31 HV samples: first, a real-time method, then conventional end-point PCR was applied to HV samples on which the first PCR was negative. Five specific real-time PCR procedures were also used in order to identify Bartonella spp., Tropheryma whipplei, Chlamydophila pneumoniae, Mycoplasma pneumonia, and Coxiella burnetii. A strategy combining the 2-step broad-range PCR methods improved the sensitivity of the molecular method from 38.7% to 58%. Specific PCR identified 1 T. whipplei, which was also identified by conventional end-point PCR. These results confirm that blood culture is the gold standard for the diagnosis of infective endocarditis, shows that molecular methods applied to HV can be useful when blood culture is negative, and that 2-step broad-range PCR approach seems to be more sensitive. Copyright © 2013 Elsevier Inc. All rights reserved.

Single-Step Affinity Purification for Fungal Proteomics ▿ †

OpenAIRE

Liu, Hui-Lin; Osmani, Aysha H.; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B.; De Souza, Colin P.; Osmani, Stephen A.

2010-01-01

A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

Science.gov (United States)

Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

2017-12-01

We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps

Directory of Open Access Journals (Sweden)

Überla Klaus

2007-06-01

Full Text Available Abstract Background Proteins of human and animal viruses are frequently expressed from RNA polymerase II dependent expression cassettes to study protein function and to develop gene-based vaccines. Initial attempts to express the G protein of vesicular stomatitis virus (VSV and the F protein of respiratory syncytial virus (RSV by eukaryotic promoters revealed restrictions at several steps of gene expression. Results Insertion of an intron flanked by exonic sequences 5'-terminal to the open reading frames (ORF of VSV-G and RSV-F led to detectable cytoplasmic mRNA levels of both genes. While the exonic sequences were sufficient to stabilise the VSV-G mRNA, cytoplasmic mRNA levels of RSV-F were dependent on the presence of a functional intron. Cytoplasmic VSV-G mRNA levels led to readily detectable levels of VSV-G protein, whereas RSV-F protein expression remained undetectable. However, RSV-F expression was observed after mutating two of four consensus sites for polyadenylation present in the RSV-F ORF. Expression levels could be further enhanced by codon optimisation. Conclusion Insufficient cytoplasmic mRNA levels and premature polyadenylation prevent expression of RSV-F by RNA polymerase II dependent expression plasmids. Since RSV replicates in the cytoplasm, the presence of premature polyadenylation sites and elements leading to nuclear instability should not interfere with RSV-F expression during virus replication. The molecular mechanisms responsible for the destabilisation of the RSV-F and VSV-G mRNAs and the different requirements for their rescue by insertion of an intron remain to be defined.

Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

KAUST Repository

Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.

2010-01-01

The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

KAUST Repository

Ghosh, Sharmistha

2010-04-06

The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

2009-10-30

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

Science.gov (United States)

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

2009-01-01

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

Global conformational dynamics of a Y-family DNA polymerase during catalysis.

Directory of Open Access Journals (Sweden)

Cuiling Xu

2009-10-01

Full Text Available Replicative DNA polymerases are stalled by damaged DNA while the newly discovered Y-family DNA polymerases are recruited to rescue these stalled replication forks, thereby enhancing cell survival. The Y-family DNA polymerases, characterized by low fidelity and processivity, are able to bypass different classes of DNA lesions. A variety of kinetic and structural studies have established a minimal reaction pathway common to all DNA polymerases, although the conformational intermediates are not well defined. Furthermore, the identification of the rate-limiting step of nucleotide incorporation catalyzed by any DNA polymerase has been a matter of long debate. By monitoring time-dependent fluorescence resonance energy transfer (FRET signal changes at multiple sites in each domain and DNA during catalysis, we present here a real-time picture of the global conformational transitions of a model Y-family enzyme: DNA polymerase IV (Dpo4 from Sulfolobus solfataricus. Our results provide evidence for a hypothetical DNA translocation event followed by a rapid protein conformational change prior to catalysis and a subsequent slow, post-chemistry protein conformational change. Surprisingly, the DNA translocation step was induced by the binding of a correct nucleotide. Moreover, we have determined the directions, rates, and activation energy barriers of the protein conformational transitions, which indicated that the four domains of Dpo4 moved in a synchronized manner. These results showed conclusively that a pre-chemistry conformational change associated with domain movements was too fast to be the rate-limiting step. Rather, the rearrangement of active site residues limited the rate of correct nucleotide incorporation. Collectively, the conformational dynamics of Dpo4 offer insights into how the inter-domain movements are related to enzymatic function and their concerted interactions with other proteins at the replication fork.

Evaluation of accuracy in implant site preparation performed in single- or multi-step drilling procedures.

Science.gov (United States)

Marheineke, Nadine; Scherer, Uta; Rücker, Martin; von See, Constantin; Rahlf, Björn; Gellrich, Nils-Claudius; Stoetzer, Marcus

2018-06-01

Dental implant failure and insufficient osseointegration are proven results of mechanical and thermal damage during the surgery process. We herein performed a comparative study of a less invasive single-step drilling preparation protocol and a conventional multiple drilling sequence. Accuracy of drilling holes was precisely analyzed and the influence of different levels of expertise of the handlers and additional use of drill template guidance was evaluated. Six experimental groups, deployed in an osseous study model, were representing template-guided and freehanded drilling actions in a stepwise drilling procedure in comparison to a single-drill protocol. Each experimental condition was studied by the drilling actions of respectively three persons without surgical knowledge as well as three highly experienced oral surgeons. Drilling actions were performed and diameters were recorded with a precision measuring instrument. Less experienced operators were able to significantly increase the drilling accuracy using a guiding template, especially when multi-step preparations are performed. Improved accuracy without template guidance was observed when experienced operators were executing single-step versus multi-step technique. Single-step drilling protocols have shown to produce more accurate results than multi-step procedures. The outcome of any protocol can be further improved by use of guiding templates. Operator experience can be a contributing factor. Single-step preparations are less invasive and are promoting osseointegration. Even highly experienced surgeons are achieving higher levels of accuracy by combining this technique with template guidance. Hereby template guidance enables a reduction of hands-on time and side effects during surgery and lead to a more predictable clinical diameter.

Computing single step operators of logic programming in radial basis function neural networks

Science.gov (United States)

Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong

2014-07-01

Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (Tp:I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks.

Computing single step operators of logic programming in radial basis function neural networks

Energy Technology Data Exchange (ETDEWEB)

Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong [School of Mathematical Sciences, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia)

2014-07-10

Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (T{sub p}:I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks.

Computing single step operators of logic programming in radial basis function neural networks

International Nuclear Information System (INIS)

Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong

2014-01-01

Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (T p :I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks

Single-step colloidal quantum dot films for infrared solar harvesting

KAUST Repository

Kiani, Amirreza; Sutherland, Brandon R.; Kim, Younghoon; Ouellette, Olivier; Levina, Larissa; Walters, Grant; Dinh, Cao Thang; Liu, Mengxia; Voznyy, Oleksandr; Lan, Xinzheng; Labelle, Andre J.; Ip, Alexander H.; Proppe, Andrew; Ahmed, Ghada H.; Mohammed, Omar F.; Hoogland, Sjoerd; Sargent, Edward H.

2016-01-01

. To date, IR CQD solar cells have been made using a wasteful and complex sequential layer-by-layer process. Here, we demonstrate ∼1 eV bandgap solar-harvesting CQD films deposited in a single step. By engineering a fast-drying solvent mixture for metal

Single-step linking transition from superdeformed to spherical states in {sup 143}Eu

Energy Technology Data Exchange (ETDEWEB)

Atac, A.; Axelsson, A.; Persson, J. [Uppsala Univ. (Sweden)] [and others

1996-12-31

A discrete {gamma}-ray transition which connects the second lowest SD state with a normally deformed one in {sup 143}Eu has been discovered. It has an energy of 3360.6 keV and carries 3.2 % of the full intensity of the SD band. It feeds into a nearly spherical state which is above the I = 35/2{sup +}, E=4947 keV level. The exact placement of the single-step link could, however, not be established due to the especially complicated level scheme in the region of interest. The angular correlation study favours a stretched dipole character for the 3360.6 keV transition. The single-step link agrees well with the previously determined two-step links, both with respect to energy and spin.

DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)

1978-03-01

Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

Nanopatterning of magnetic disks by single-step Ar+ Ion projection

NARCIS (Netherlands)

Dietzel, A.H.; Berger, R.; Loeschner, H.; Platzgummer, E.; Stengl, G.; Bruenger, W.H.; Letzkus, F.

2003-01-01

Large-area Ar+ projection has been used to generate planar magnetic nanostructures on a 1¿-format hard disk in a single step (see Figure). The recording pattern was transferred to a Co/Pt multilayer without resist processes or any other contact to the delicate media surface. It is conceivable that

Towards single step production of multi-layer inorganic hollow fibers

NARCIS (Netherlands)

de Jong, J.; Benes, Nieck Edwin; Koops, G.H.; Wessling, Matthias

2004-01-01

In this work we propose a generic synthesis route for the single step production of multi-layer inorganic hollow fibers, based on polymer wet spinning combined with a heat treatment. With this new method, membranes with a high surface area per unit volume ratio can be produced, while production time

Determining Annealing Temperatures for Polymerase Chain Reaction

Science.gov (United States)

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

DNA polymerase preference determines PCR priming efficiency.

Science.gov (United States)

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*

OpenAIRE

Yuan, Quan; McHenry, Charles S.

2009-01-01

In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

Structural comparison of anodic nanoporous-titania fabricated from single-step and three-step of anodization using two paralleled-electrodes anodizing cell

Directory of Open Access Journals (Sweden)

Mallika Thabuot

2016-02-01

Full Text Available Anodization of Ti sheet in the ethylene glycol electrolyte containing 0.38wt% NH4F with the addition of 1.79wt% H2O at room temperature was studied. Applied potential of 10-60 V and anodizing time of 1-3 h were conducted by single-step and three-step of anodization within the two paralleled-electrodes anodizing cell. Their structural and textural properties were investigated by X-ray diffraction (XRD and scanning electron microscopy (SEM. After annealing at 600°C in the air furnace for 3 h, TiO2-nanotubes was transformed to the higher proportion of anatase crystal phase. Also crystallization of anatase phase was enhanced as the duration of anodization as the final step increased. By using single-step of anodization, pore texture of oxide film was started to reveal at the applied potential of 30 V. Better orderly arrangement of the TiO2-nanotubes array with larger pore size was obtained with the increase of applied potential. The applied potential of 60 V was selected for the three-step of anodization with anodizing time of 1-3 h. Results showed that the well-smooth surface coverage with higher density of porous-TiO2 was achieved using prolonging time at the first and second step, however, discontinuity tube in length was produced instead of the long-vertical tube. Layer thickness of anodic oxide film depended on the anodizing time at the last step of anodization. More well arrangement of nanostructured-TiO2 was produced using three-step of anodization under 60 V with 3 h for each step.

Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

Science.gov (United States)

Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai

2010-01-01

Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

Directory of Open Access Journals (Sweden)

Jessica A. Brown

2010-01-01

Full Text Available Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη, a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average than the ground-state binding step (18-fold on average. Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.

Differences in Lower Extremity and Trunk Kinematics between Single Leg Squat and Step Down Tasks.

Directory of Open Access Journals (Sweden)

Cara L Lewis

Full Text Available The single leg squat and single leg step down are two commonly used functional tasks to assess movement patterns. It is unknown how kinematics compare between these tasks. The purpose of this study was to identify kinematic differences in the lower extremity, pelvis and trunk between the single leg squat and the step down. Fourteen healthy individuals participated in this research and performed the functional tasks while kinematic data were collected for the trunk, pelvis, and lower extremities using a motion capture system. For the single leg squat task, the participant was instructed to squat as low as possible. For the step down task, the participant was instructed to stand on top of a box, slowly lower him/herself until the non-stance heel touched the ground, and return to standing. This was done from two different heights (16 cm and 24 cm. The kinematics were evaluated at peak knee flexion as well as at 60° of knee flexion. Pearson correlation coefficients (r between the angles at those two time points were also calculated to better understand the relationship between each task. The tasks resulted in kinematics differences at the knee, hip, pelvis, and trunk at both time points. The single leg squat was performed with less hip adduction (p ≤ 0.003, but more hip external rotation and knee abduction (p ≤ 0.030, than the step down tasks at 60° of knee flexion. These differences were maintained at peak knee flexion except hip external rotation was only significant in the 24 cm step down task (p ≤ 0.029. While there were multiple differences between the two step heights at peak knee flexion, the only difference at 60° of knee flexion was in trunk flexion (p < 0.001. Angles at the knee and hip had a moderate to excellent correlation (r = 0.51-0.98, but less consistently so at the pelvis and trunk (r = 0.21-0.96. The differences in movement patterns between the single leg squat and the step down should be considered when selecting a

A high-order positivity-preserving single-stage single-step method for the ideal magnetohydrodynamic equations

Science.gov (United States)

Christlieb, Andrew J.; Feng, Xiao; Seal, David C.; Tang, Qi

2016-07-01

We propose a high-order finite difference weighted ENO (WENO) method for the ideal magnetohydrodynamics (MHD) equations. The proposed method is single-stage (i.e., it has no internal stages to store), single-step (i.e., it has no time history that needs to be stored), maintains a discrete divergence-free condition on the magnetic field, and has the capacity to preserve the positivity of the density and pressure. To accomplish this, we use a Taylor discretization of the Picard integral formulation (PIF) of the finite difference WENO method proposed in Christlieb et al. (2015) [23], where the focus is on a high-order discretization of the fluxes (as opposed to the conserved variables). We use the version where fluxes are expanded to third-order accuracy in time, and for the fluid variables space is discretized using the classical fifth-order finite difference WENO discretization. We use constrained transport in order to obtain divergence-free magnetic fields, which means that we simultaneously evolve the magnetohydrodynamic (that has an evolution equation for the magnetic field) and magnetic potential equations alongside each other, and set the magnetic field to be the (discrete) curl of the magnetic potential after each time step. In this work, we compute these derivatives to fourth-order accuracy. In order to retain a single-stage, single-step method, we develop a novel Lax-Wendroff discretization for the evolution of the magnetic potential, where we start with technology used for Hamilton-Jacobi equations in order to construct a non-oscillatory magnetic field. The end result is an algorithm that is similar to our previous work Christlieb et al. (2014) [8], but this time the time stepping is replaced through a Taylor method with the addition of a positivity-preserving limiter. Finally, positivity preservation is realized by introducing a parameterized flux limiter that considers a linear combination of high and low-order numerical fluxes. The choice of the free

Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity.

Science.gov (United States)

Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J

2018-02-20

The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

Repair of Clustered Damage and DNA Polymerase Iota.

Science.gov (United States)

Belousova, E A; Lavrik, O I

2015-08-01

Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

A single-step method for rapid extraction of total lipids from green microalgae.

Directory of Open Access Journals (Sweden)

Martin Axelsson

Full Text Available Microalgae produce a wide range of lipid compounds of potential commercial interest. Total lipid extraction performed by conventional extraction methods, relying on the chloroform-methanol solvent system are too laborious and time consuming for screening large numbers of samples. In this study, three previous extraction methods devised by Folch et al. (1957, Bligh and Dyer (1959 and Selstam and Öquist (1985 were compared and a faster single-step procedure was developed for extraction of total lipids from green microalgae. In the single-step procedure, 8 ml of a 2∶1 chloroform-methanol (v/v mixture was added to fresh or frozen microalgal paste or pulverized dry algal biomass contained in a glass centrifuge tube. The biomass was manually suspended by vigorously shaking the tube for a few seconds and 2 ml of a 0.73% NaCl water solution was added. Phase separation was facilitated by 2 min of centrifugation at 350 g and the lower phase was recovered for analysis. An uncharacterized microalgal polyculture and the green microalgae Scenedesmus dimorphus, Selenastrum minutum, and Chlorella protothecoides were subjected to the different extraction methods and various techniques of biomass homogenization. The less labour intensive single-step procedure presented here allowed simultaneous recovery of total lipid extracts from multiple samples of green microalgae with quantitative yields and fatty acid profiles comparable to those of the previous methods. While the single-step procedure is highly correlated in lipid extractability (r² = 0.985 to the previous method of Folch et al. (1957, it allowed at least five times higher sample throughput.

Single step synthesis, characterization and applications of curcumin functionalized iron oxide magnetic nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Bhandari, Rohit; Gupta, Prachi; Dziubla, Thomas; Hilt, J. Zach, E-mail: zach.hilt@uky.edu

2016-10-01

Magnetic iron oxide nanoparticles have been well known for their applications in magnetic resonance imaging (MRI), hyperthermia, targeted drug delivery, etc. The surface modification of these magnetic nanoparticles has been explored extensively to achieve functionalized materials with potential application in biomedical, environmental and catalysis field. Herein, we report a novel and versatile single step methodology for developing curcumin functionalized magnetic Fe{sub 3}O{sub 4} nanoparticles without any additional linkers, using a simple coprecipitation technique. The magnetic nanoparticles (MNPs) were characterized using transmission electron microscopy, X-ray diffraction, fourier transform infrared spectroscopy and thermogravimetric analysis. The developed MNPs were employed in a cellular application for protection against an inflammatory agent, a polychlorinated biphenyl (PCB) molecule. - Graphical abstract: Novel single step curcumin coated magnetic Fe{sub 3}O{sub 4} nanoparticles without any additional linkers for medical, environmental, and other applications. Display Omitted - Highlights: • A novel and versatile single step methodology for developing curcumin functionalized magnetic Fe{sub 3}O{sub 4} nanoparticles is reported. • The magnetic nanoparticles (MNPs) were characterized using TEM, XRD, FTIR and TGA. • The developed MNPs were employed in a cellular application for protection against an inflammatory agent, a polychlorinated biphenyl (PCB).

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

Science.gov (United States)

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

The stepping behavior analysis of pedestrians from different age groups via a single-file experiment

Science.gov (United States)

Cao, Shuchao; Zhang, Jun; Song, Weiguo; Shi, Chang'an; Zhang, Ruifang

2018-03-01

The stepping behavior of pedestrians with different age compositions in single-file experiment is investigated in this paper. The relation between step length, step width and stepping time are analyzed by using the step measurement method based on the calculation of curvature of the trajectory. The relations of velocity-step width, velocity-step length and velocity-stepping time for different age groups are discussed and compared with previous studies. Finally effects of pedestrian gender and height on stepping laws and fundamental diagrams are analyzed. The study is helpful for understanding pedestrian dynamics of movement. Meanwhile, it offers experimental data to develop a microscopic model of pedestrian movement by considering stepping behavior.

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I

International Nuclear Information System (INIS)

O'Connor, D.; Stoehrer, G.

1985-01-01

Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis

An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

International Nuclear Information System (INIS)

Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

2017-01-01

Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)

Out of the picture: a study of family drawings by children from step-, single-parent, and non-step families.

Science.gov (United States)

Dunn, Judy; O'Connor, Thomas G; Levy, Irit

2002-12-01

Investigated the family drawings of 180 children ages 5 to 7 years in various family settings, including stepfather, single-parent, complex stepfamilies, and 2-parent control families. The relations of family type and biological relatedness to omission of family members and grouping of parents were examined. Children from step- and single-parent families were more likely to exclude family members than children from "control" non-step families, and exclusion was predicted from biological relatedness. Children who were biologically related to both resident parents were also more likely to group their parents together. Omission of family members was found to be associated with children's adjustment (specifically more externalizing and internalizing behavior) as reported by teachers and parents. The results indicate that biological relatedness is a salient aspect of very young children's representations of their families. The association between adjustment and exclusion of family members and grouping of parents indicates that family drawings may be useful research and clinical tools, when used in combination with other methods of assessment.

Two-step single slope/SAR ADC with error correction for CMOS image sensor.

Science.gov (United States)

Tang, Fang; Bermak, Amine; Amira, Abbes; Amor Benammar, Mohieddine; He, Debiao; Zhao, Xiaojin

2014-01-01

Conventional two-step ADC for CMOS image sensor requires full resolution noise performance in the first stage single slope ADC, leading to high power consumption and large chip area. This paper presents an 11-bit two-step single slope/successive approximation register (SAR) ADC scheme for CMOS image sensor applications. The first stage single slope ADC generates a 3-bit data and 1 redundant bit. The redundant bit is combined with the following 8-bit SAR ADC output code using a proposed error correction algorithm. Instead of requiring full resolution noise performance, the first stage single slope circuit of the proposed ADC can tolerate up to 3.125% quantization noise. With the proposed error correction mechanism, the power consumption and chip area of the single slope ADC are significantly reduced. The prototype ADC is fabricated using 0.18 μ m CMOS technology. The chip area of the proposed ADC is 7 μ m × 500 μ m. The measurement results show that the energy efficiency figure-of-merit (FOM) of the proposed ADC core is only 125 pJ/sample under 1.4 V power supply and the chip area efficiency is 84 k  μ m(2) · cycles/sample.

Two-Step Single Slope/SAR ADC with Error Correction for CMOS Image Sensor

Directory of Open Access Journals (Sweden)

Fang Tang

2014-01-01

Full Text Available Conventional two-step ADC for CMOS image sensor requires full resolution noise performance in the first stage single slope ADC, leading to high power consumption and large chip area. This paper presents an 11-bit two-step single slope/successive approximation register (SAR ADC scheme for CMOS image sensor applications. The first stage single slope ADC generates a 3-bit data and 1 redundant bit. The redundant bit is combined with the following 8-bit SAR ADC output code using a proposed error correction algorithm. Instead of requiring full resolution noise performance, the first stage single slope circuit of the proposed ADC can tolerate up to 3.125% quantization noise. With the proposed error correction mechanism, the power consumption and chip area of the single slope ADC are significantly reduced. The prototype ADC is fabricated using 0.18 μm CMOS technology. The chip area of the proposed ADC is 7 μm × 500 μm. The measurement results show that the energy efficiency figure-of-merit (FOM of the proposed ADC core is only 125 pJ/sample under 1.4 V power supply and the chip area efficiency is 84 k μm2·cycles/sample.

Modeling single-file diffusion with step fractional Brownian motion and a generalized fractional Langevin equation

International Nuclear Information System (INIS)

Lim, S C; Teo, L P

2009-01-01

Single-file diffusion behaves as normal diffusion at small time and as subdiffusion at large time. These properties can be described in terms of fractional Brownian motion with variable Hurst exponent or multifractional Brownian motion. We introduce a new stochastic process called Riemann–Liouville step fractional Brownian motion which can be regarded as a special case of multifractional Brownian motion with a step function type of Hurst exponent tailored for single-file diffusion. Such a step fractional Brownian motion can be obtained as a solution of the fractional Langevin equation with zero damping. Various kinds of fractional Langevin equations and their generalizations are then considered in order to decide whether their solutions provide the correct description of the long and short time behaviors of single-file diffusion. The cases where the dissipative memory kernel is a Dirac delta function, a power-law function and a combination of these functions are studied in detail. In addition to the case where the short time behavior of single-file diffusion behaves as normal diffusion, we also consider the possibility of a process that begins as ballistic motion

Dispersed single-phase-step Michelson interferometer for Doppler imaging using sunlight.

Science.gov (United States)

Wan, Xiaoke; Ge, Jian

2012-09-15

A Michelson interferometer is dispersed with a fiber array-fed spectrograph, providing 59 Doppler sensing channels using sunlight in the 510-570 nm wavelength region. The interferometer operates at a single-phase-step mode, which is particularly advantageous in multiplexing and data processing compared to the phase-stepping mode of other interferometer spectrometer instruments. Spectral templates are prepared using a standard solar spectrum and simulated interferometer modulations, such that the correlation function with a measured 1D spectrum determines the Doppler shift. Doppler imaging of a rotating cylinder is demonstrated. The average Doppler sensitivity is ~12 m/s, with some channels reaching ~5 m/s.

Polymerase-free measurement of microRNA-122 with single base specificity using single molecule arrays: Detection of drug-induced liver injury.

Directory of Open Access Journals (Sweden)

David M Rissin

Full Text Available We have developed a single probe method for detecting microRNA from human serum using single molecule arrays, with sequence specificity down to a single base, and without the use of amplification by polymerases. An abasic peptide nucleic acid (PNA probe-containing a reactive amine instead of a nucleotide at a specific position in the sequence-for detecting a microRNA was conjugated to superparamagnetic beads. These beads were incubated with a sample containing microRNA, a biotinylated reactive nucleobase-containing an aldehyde group-that was complementary to the missing base in the probe sequence, and a reducing agent. When a target molecule with an exact match in sequence hybridized to the capture probe, the reactive nucleobase was covalently attached to the backbone of the probe by a dynamic covalent chemical reaction. Single molecules of the biotin-labeled probe were then labeled with streptavidin-β-galactosidase (SβG, the beads were resuspended in a fluorogenic enzyme substrate, loaded into an array of femtoliter wells, and sealed with oil. The array was imaged fluorescently to determine which beads were associated with single enzymes, and the average number of enzymes per bead was determined. The assay had a limit of detection of 500 fM, approximately 500 times more sensitive than a corresponding analog bead-based assay, with target specificity down to a single base mis-match. This assay was used to measure microRNA-122 (miR-122-an established biomarker of liver toxicity-extracted from the serum of patients who had acute liver injury due to acetaminophen, and control healthy patients. All patients with liver injury had higher levels of miR-122 in their serum compared to controls, and the concentrations measured correlated well with those determined using RT-qPCR. This approach allows rapid quantification of circulating microRNA with single-based specificity and a limit of quantification suitable for clinical use.

Comparison on genomic predictions using GBLUP models and two single-step blending methods with different relationship matrices in the Nordic Holstein population

DEFF Research Database (Denmark)

Gao, Hongding; Christensen, Ole Fredslund; Madsen, Per

2012-01-01

Background A single-step blending approach allows genomic prediction using information of genotyped and non-genotyped animals simultaneously. However, the combined relationship matrix in a single-step method may need to be adjusted because marker-based and pedigree-based relationship matrices may...... not be on the same scale. The same may apply when a GBLUP model includes both genomic breeding values and residual polygenic effects. The objective of this study was to compare single-step blending methods and GBLUP methods with and without adjustment of the genomic relationship matrix for genomic prediction of 16......) a simple GBLUP method, 2) a GBLUP method with a polygenic effect, 3) an adjusted GBLUP method with a polygenic effect, 4) a single-step blending method, and 5) an adjusted single-step blending method. In the adjusted GBLUP and single-step methods, the genomic relationship matrix was adjusted...

Comparison of single-entry and double-entry two-step couple screening for cystic fibrosis carriers

NARCIS (Netherlands)

tenKate, LP; Verheij, JBGM; Wildhagen, MF; Hilderink, HBM; Kooij, L; Verzijl, JG; Habbema, JDF

1996-01-01

Both single-entry two-step (SETS) couple screening and double-entry two-step (DETS) couple screening have been recommended as methods to screen for cystic fibrosis gene carriers. In this paper we compare the expected results from both types of screening. In general, DETS results in a higher

Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

Directory of Open Access Journals (Sweden)

Fabio Lapenta

Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

Single-Stage Step up/down Driver for Permanent-Magnet Synchronous Machines

Science.gov (United States)

Chen, T. R.; Juan, Y. L.; Huang, C. Y.; Kuo, C. T.

2017-11-01

The two-stage circuit composed of a step up/down dc converter and a three-phase voltage source inverter is usually adopted as the electric vehicle’s motor driver. The conventional topology is more complicated. Additional power loss resulted from twice power conversion would also cause lower efficiency. A single-stage step up/down Permanent-Magnet Synchronous Motor driver for Brushless DC (BLDC) Motor is proposed in this study. The number components and circuit complexity are reduced. The low frequency six-step square-wave control is used to reduce the switching losses. In the proposed topology, only one active switch is gated with a high frequency PWM signal for adjusting the rotation speed. The rotor position signals are fed back to calculate the motor speed for digital close-loop control in a MCU. A 600W prototype circuit is constructed to drive a BLDC motor with rated speed 3000 rpm, and can control the speed of six sections.

α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Olivier Martínez

Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

Backtracking dynamics of RNA polymerase: pausing and error correction

International Nuclear Information System (INIS)

Sahoo, Mamata; Klumpp, Stefan

2013-01-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

Backtracking dynamics of RNA polymerase: pausing and error correction

Science.gov (United States)

Sahoo, Mamata; Klumpp, Stefan

2013-09-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Peyton’s four-step approach: differential effects of single instructional steps on procedural and memory performance – a clarification study

Directory of Open Access Journals (Sweden)

Krautter M

2015-05-01

Full Text Available Markus Krautter,1 Ronja Dittrich,2 Annette Safi,2 Justine Krautter,1 Imad Maatouk,2 Andreas Moeltner,2 Wolfgang Herzog,2 Christoph Nikendei2 1Department of Nephrology, 2Department of General Internal and Psychosomatic Medicine, University of Heidelberg Medical Hospital, Heidelberg, Germany Background: Although Peyton’s four-step approach is a widely used method for skills-lab training in undergraduate medical education and has been shown to be more effective than standard instruction, it is unclear whether its superiority can be attributed to a specific single step. Purpose: We conducted a randomized controlled trial to investigate the differential learning outcomes of the separate steps of Peyton’s four-step approach. Methods: Volunteer medical students were randomly assigned to four different groups. Step-1 group received Peyton’s Step 1, Step-2 group received Peyton’s Steps 1 and 2, Step-3 group received Peyton’s Steps 1, 2, and 3, and Step-3mod group received Peyton’s Steps 1 and 2, followed by a repetition of Step 2. Following the training, the first independent performance of a central venous catheter (CVC insertion using a manikin was video-recorded and scored by independent video assessors using binary checklists. The day after the training, memory performance during delayed recall was assessed with an incidental free recall test. Results: A total of 97 participants agreed to participate in the trial. There were no statistically significant group differences with regard to age, sex, completed education in a medical profession, completed medical clerkships, preliminary memory tests, or self-efficacy ratings. Regarding checklist ratings, Step-2 group showed a superior first independent performance of CVC placement compared to Step-1 group (P<0.001, and Step-3 group showed a superior performance to Step-2 group (P<0.009, while Step-2 group and Step-3mod group did not differ (P=0.055. The findings were similar in the incidental

Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

Science.gov (United States)

Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

2012-01-01

Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

International Nuclear Information System (INIS)

Plotch, S.J.; Palant, O.; Gluzman, Y.

1989-01-01

A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer, RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, [α- 32 P]UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro

Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

Science.gov (United States)

Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

2018-03-27

The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

A three-step vehicle detection framework for range estimation using a single camera

CSIR Research Space (South Africa)

Kanjee, R

2015-12-01

Full Text Available This paper proposes and validates a real-time onroad vehicle detection system, which uses a single camera for the purpose of intelligent driver assistance. A three-step vehicle detection framework is presented to detect and track the target vehicle...

Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

Science.gov (United States)

Zheng, Wenjun; Wang, Qingsong; Bi, Qun

2016-04-01

Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

Quickest single-step one pot mechanosynthesis and characterization of ZnTe quantum dots

Energy Technology Data Exchange (ETDEWEB)

Patra, S. [Dept of Physics, University of Burdwan, Golapbag, Burdwan, West Bengal 713104 (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Dept of Physics, University of Burdwan, Golapbag, Burdwan, West Bengal 713104 (India)

2011-05-05

Research highlights: > First time quickest mechanosynthesis of ZnTe QDs starting from Zn and Te powders. > Cubic ZnTe are formed in a single pot at RT in a single step within 1 h of milling. > The existence of stacking faults and twin faults are evident from HRTEM images. > Distinct blue shift has been observed in UV-vis absorption spectra. > First time report that ZnTe QDs with faults can also show the quantum size effect. - Abstract: ZnTe quantum dots (QDs) are synthesized at room temperature in a single step by mechanical alloying the stoichiometric equimolar mixture (1:1 mol) of Zn and Te powders under Ar within 1 h of milling. Both XRD and HRTEM characterizations reveal that these QDs having size {approx}5 nm contain stacking faults of different kinds. A distinct blue-shift in absorption spectra with decreasing particle size of QDs confirms the quantum size confinement effect (QSCE). It is observed for first time that the QDs with considerable amount of faults can also show the QSCE. Optical band gaps of these QDs increase with increasing milling time and their band gaps can be fine-tuned easily by varying milling time of QDs.

DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis

Energy Technology Data Exchange (ETDEWEB)

Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.

1987-06-01

Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.

Pressure-driven one-step solid phase-based on-chip sample preparation on a microfabricated plastic device and integration with flow-through polymerase chain reaction (PCR).

Science.gov (United States)

Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon

2013-10-01

In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.

Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

Directory of Open Access Journals (Sweden)

Claudia Huber

Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films

Science.gov (United States)

Kim, Jin Young; Adinolfi, Valerio; Sutherland, Brandon R.; Voznyy, Oleksandr; Kwon, S. Joon; Kim, Tae Wu; Kim, Jeongho; Ihee, Hyotcherl; Kemp, Kyle; Adachi, Michael; Yuan, Mingjian; Kramer, Illan; Zhitomirsky, David; Hoogland, Sjoerd; Sargent, Edward H.

2015-01-01

Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles—yet size–effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector. PMID:26165185

Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films.

KAUST Repository

Kim, Jin Young; Adinolfi, Valerio; Sutherland, Brandon R; Voznyy, Oleksandr; Kwon, S Joon; Kim, Tae Wu; Kim, Jeongho; Ihee, Hyotcherl; Kemp, Kyle; Adachi, Michael; Yuan, Mingjian; Kramer, Illan; Zhitomirsky, David; Hoogland, Sjoerd; Sargent, Edward H

2015-01-01

Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles--yet size-effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector.

Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films.

KAUST Repository

Kim, Jin Young

2015-07-13

Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles--yet size-effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector.

PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

Science.gov (United States)

Cline, J; Braman, J C; Hogrefe, H H

1996-09-15

The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

Directory of Open Access Journals (Sweden)

Gouri Chaubal

2018-02-01

Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

Science.gov (United States)

Wang, Yaqiong; Ma, Hong

2015-09-01

Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Single-Camera-Based Method for Step Length Symmetry Measurement in Unconstrained Elderly Home Monitoring.

Science.gov (United States)

Cai, Xi; Han, Guang; Song, Xin; Wang, Jinkuan

2017-11-01

single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring. To build unconstrained monitoring environments, we propose a method to measure step length symmetry ratio (a useful gait parameter representing gait symmetry without significant relationship with age) from unconstrained straight walking using a single camera, without strict restrictions on walking directions or routes. according to projective geometry theory, we first develop a calculation formula of step length ratio for the case of unconstrained straight-line walking. Then, to adapt to general cases, we propose to modify noncollinear footprints, and accordingly provide general procedure for step length ratio extraction from unconstrained straight walking. Our method achieves a mean absolute percentage error (MAPE) of 1.9547% for 15 subjects' normal and abnormal side-view gaits, and also obtains satisfactory MAPEs for non-side-view gaits (2.4026% for 45°-view gaits and 3.9721% for 30°-view gaits). The performance is much better than a well-established monocular gait measurement system suitable only for side-view gaits with a MAPE of 3.5538%. Independently of walking directions, our method can accurately estimate step length ratios from unconstrained straight walking. This demonstrates our method is applicable for elders' daily gait monitoring to provide valuable information for elderly health care, such as abnormal gait recognition, fall risk assessment, etc. single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring

Fabrication of Polydimethylsiloxane Microlenses Utilizing Hydrogel Shrinkage and a Single Molding Step

Directory of Open Access Journals (Sweden)

Bader Aldalali

2014-05-01

Full Text Available We report on polydimethlysiloxane (PDMS microlenses and microlens arrays on flat and curved substrates fabricated via a relatively simple process combining liquid-phase photopolymerization and a single molding step. The mold for the formation of the PDMS lenses is fabricated by photopolymerizing a polyacrylamide (PAAm pre-hydrogel. The shrinkage of PAAm after its polymerization forms concave lenses. The lenses are then transferred to PDMS by a single step molding to form PDMS microlens array on a flat substrate. The PAAm concave lenses are also transferred to PDMS and another flexible polymer, Solaris, to realize artificial compound eyes. The resultant microlenses and microlens arrays possess good uniformity and optical properties. The focal length of the lenses is inversely proportional to the shrinkage time. The microlens mold can also be rehydrated to change the focal length of the ultimate PDMS microlenses. The spherical aberration is 2.85 μm and the surface roughness is on the order of 204 nm. The microlenses can resolve 10.10 line pairs per mm (lp/mm and have an f-number range between f/2.9 and f/56.5. For the compound eye, the field of view is 113°.

Single step radiolytic synthesis of iridium nanoparticles onto graphene oxide

International Nuclear Information System (INIS)

Rojas, J.V.; Molina Higgins, M.C.; Toro Gonzalez, M.; Castano, C.E.

2015-01-01

Graphical abstract: - Highlights: • Ir nanoparticles were synthesized through a single step gamma irradiation process. • Homogeneously distributed Ir nanoparticles on graphene oxide are ∼2.3 nm in size. • Ir−O bonds evidenced the interaction of the nanoparticles with the support. - Abstract: In this work a new approach to synthesize iridium nanoparticles on reduced graphene oxide is presented. The nanoparticles were directly deposited and grown on the surface of the carbon-based support using a single step reduction method through gamma irradiation. In this process, an aqueous isopropanol solution containing the iridium precursor, graphene oxide, and sodium dodecyl sulfate was initially prepared and sonicated thoroughly to obtain a homogeneous dispersion. The samples were irradiated with gamma rays with energies of 1.17 and 1.33 MeV emitted from the spontaneous decay of the 60 Co irradiator. The interaction of gamma rays with water in the presence of isopropanol generates highly reducing species homogeneously distributed in the solution that can reduce the Ir precursor down to a zero valence state. An absorbed dose of 60 kGy was used, which according to the yield of reducing species is sufficient to reduce the total amount of precursor present in the solution. This novel approach leads to the formation of 2.3 ± 0.5 nm Ir nanoparticles distributed along the surface of the support. The oxygenated functionalities of graphene oxide served as nucleation sites for the formation of Ir nuclei and their subsequent growth. XPS results revealed that the interaction of Ir with the support occurs through Ir−O bonds.

Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

Science.gov (United States)

Pierce, Kenneth E; Wangh, Lawrence J

2007-01-01

Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

Site-selective substitutional doping with atomic precision on stepped Al (111) surface by single-atom manipulation.

Science.gov (United States)

Chen, Chang; Zhang, Jinhu; Dong, Guofeng; Shao, Hezhu; Ning, Bo-Yuan; Zhao, Li; Ning, Xi-Jing; Zhuang, Jun

2014-01-01

In fabrication of nano- and quantum devices, it is sometimes critical to position individual dopants at certain sites precisely to obtain the specific or enhanced functionalities. With first-principles simulations, we propose a method for substitutional doping of individual atom at a certain position on a stepped metal surface by single-atom manipulation. A selected atom at the step of Al (111) surface could be extracted vertically with an Al trimer-apex tip, and then the dopant atom will be positioned to this site. The details of the entire process including potential energy curves are given, which suggests the reliability of the proposed single-atom doping method.

Single mode step-index polymer optical fiber for humidity insensitive high temperature fiber Bragg grating sensors

DEFF Research Database (Denmark)

Woyessa, Getinet; Fasano, Andrea; Stefani, Alessio

2016-01-01

We have fabricated the first single-mode step-index and humidity insensitive polymer optical fiber operating in the 850 nm wavelength ranges. The step-index preform is fabricated using injection molding, which is an efficient method for cost effective, flexible and fast preparation of the fiber...... preform. The fabricated single-mode step-index (SI) polymer optical fiber (POF) has a 4.8µm core made from TOPAS grade 5013S-04 with a glass transition temperature of 134°C and a 150 µm cladding made from ZEONEX grade 480R with a glass transition temperature of 138°C. The key advantages of the proposed...... SIPOF are low water absorption, high operating temperature and chemical inertness to acids and bases and many polar solvents as compared to the conventional poly-methyl-methacrylate (PMMA) and polystyrene based POFs. In addition, the fiber Bragg grating writing time is short compared to microstructured...

Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

Science.gov (United States)

Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

2011-03-01

The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

Directory of Open Access Journals (Sweden)

Parida Manmohan

2008-01-01

Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus.

Science.gov (United States)

De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M

1999-08-06

Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.

Designed optimization of a single-step extraction of fucose-containing sulfated polysaccharides from Sargassum sp

DEFF Research Database (Denmark)

Ale, Marcel Tutor; Mikkelsen, Jørn Dalgaard; Meyer, Anne S.

2012-01-01

Fucose-containing sulfated polysaccharides can be extracted from the brown seaweed, Sargassum sp. It has been reported that fucose-rich sulfated polysaccharides from brown seaweeds exert different beneficial biological activities including anti-inflammatory, anticoagulant, and anti-viral effects....... Classical extraction of fucose-containing sulfated polysaccharides from brown seaweed species typically involves extended, multiple-step, hot acid, or CaCl2 treatments, each step lasting several hours. In this work, we systematically examined the influence of acid concentration (HCl), time, and temperature...... on the yield of fucosecontaining sulfated polysaccharides (FCSPs) in statistically designed two-step and single-step multifactorial extraction experiments. All extraction factors had significant effects on the fucose-containing sulfated polysaccharides yield, with the temperature and time exerting positive...

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

Science.gov (United States)

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Voluntary stepping behavior under single- and dual-task conditions in chronic stroke survivors: A comparison between the involved and uninvolved legs.

Science.gov (United States)

Melzer, Itshak; Goldring, Melissa; Melzer, Yehudit; Green, Elad; Tzedek, Irit

2010-12-01

If balance is lost, quick step execution can prevent falls. Research has shown that speed of voluntary stepping was able to predict future falls in old adults. The aim of the study was to investigate voluntary stepping behavior, as well as to compare timing and leg push-off force-time relation parameters of involved and uninvolved legs in stroke survivors during single- and dual-task conditions. We also aimed to compare timing and leg push-off force-time relation parameters between stroke survivors and healthy individuals in both task conditions. Ten stroke survivors performed a voluntary step execution test with their involved and uninvolved legs under two conditions: while focusing only on the stepping task and while a separate attention-demanding task was performed simultaneously. Temporal parameters related to the step time were measured including the duration of the step initiation phase, the preparatory phase, the swing phase, and the total step time. In addition, force-time parameters representing the push-off power during stepping were calculated from ground reaction data and compared with 10 healthy controls. The involved legs of stroke survivors had a significantly slower stepping time than uninvolved legs due to increased swing phase duration during both single- and dual-task conditions. For dual compared to single task, the stepping time increased significantly due to a significant increase in the duration of step initiation. In general, the force time parameters were significantly different in both legs of stroke survivors as compared to healthy controls, with no significant effect of dual compared with single-task conditions in both groups. The inability of stroke survivors to swing the involved leg quickly may be the most significant factor contributing to the large number of falls to the paretic side. The results suggest that stroke survivors were unable to rapidly produce muscle force in fast actions. This may be the mechanism of delayed execution

Cellobiohydrolase 1 from Trichoderma reesei degrades cellulose in single cellobiose steps

Science.gov (United States)

Brady, Sonia K.; Sreelatha, Sarangapani; Feng, Yinnian; Chundawat, Shishir P. S.; Lang, Matthew J.

2015-12-01

Cellobiohydrolase 1 from Trichoderma reesei (TrCel7A) processively hydrolyses cellulose into cellobiose. Although enzymatic techniques have been established as promising tools in biofuel production, a clear understanding of the motor's mechanistic action has yet to be revealed. Here, we develop an optical tweezers-based single-molecule (SM) motility assay for precision tracking of TrCel7A. Direct observation of motility during degradation reveals processive runs and distinct steps on the scale of 1 nm. Our studies suggest TrCel7A is not mechanically limited, can work against 20 pN loads and speeds up when assisted. Temperature-dependent kinetic studies establish the energy requirements for the fundamental stepping cycle, which likely includes energy from glycosidic bonds and other sources. Through SM measurements of isolated TrCel7A domains, we determine that the catalytic domain alone is sufficient for processive motion, providing insight into TrCel7A's molecular motility mechanism.

DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

Science.gov (United States)

Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

2014-01-01

The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

Two-step multiplex polymerase chain reaction improves the speed and accuracy of genotyping using DNA from noninvasive and museum samples.

Science.gov (United States)

Arandjelovic, M; Guschanski, K; Schubert, G; Harris, T R; Thalmann, O; Siedel, H; Vigilant, L

2009-01-01

Many studies in molecular ecology rely upon the genotyping of large numbers of low-quantity DNA extracts derived from noninvasive or museum specimens. To overcome low amplification success rates and avoid genotyping errors such as allelic dropout and false alleles, multiple polymerase chain reaction (PCR) replicates for each sample are typically used. Recently, two-step multiplex procedures have been introduced which drastically increase the success rate and efficiency of genotyping. However, controversy still exists concerning the amount of replication needed for suitable control of error. Here we describe the use of a two-step multiplex PCR procedure that allows rapid genotyping using at least 19 different microsatellite loci. We applied this approach to quantified amounts of noninvasive DNAs from western chimpanzee, western gorilla, mountain gorilla and black and white colobus faecal samples, as well as to DNA from ~100-year-old gorilla teeth from museums. Analysis of over 45 000 PCRs revealed average success rates of > 90% using faecal DNAs and 74% using museum specimen DNAs. Average allelic dropout rates were substantially reduced compared to those obtained using conventional singleplex PCR protocols, and reliable genotyping using low (< 25 pg) amounts of template DNA was possible. However, four to five replicates of apparently homozygous results are needed to avoid allelic dropout when using the lowest concentration DNAs (< 50 pg/reaction), suggesting that use of protocols allowing routine acceptance of homozygous genotypes after as few as three replicates may lead to unanticipated errors when applied to low-concentration DNAs. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

Structure and mechanism of human DNA polymerase [eta

Energy Technology Data Exchange (ETDEWEB)

Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

2010-11-03

The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

Single-step controlled-NOT logic from any exchange interaction

Science.gov (United States)

Galiautdinov, Andrei

2007-11-01

A self-contained approach to studying the unitary evolution of coupled qubits is introduced, capable of addressing a variety of physical systems described by exchange Hamiltonians containing Rabi terms. The method automatically determines both the Weyl chamber steering trajectory and the accompanying local rotations. Particular attention is paid to the case of anisotropic exchange with tracking controls, which is solved analytically. It is shown that, if computational subspace is well isolated, any exchange interaction can always generate high fidelity, single-step controlled-NOT (CNOT) logic, provided that both qubits can be individually manipulated. The results are then applied to superconducting qubit architectures, for which several CNOT gate implementations are identified. The paper concludes with consideration of two CNOT gate designs having high efficiency and operating with no significant leakage to higher-lying noncomputational states.

Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

Science.gov (United States)

Yu, Chuanhe; Gan, Haiyun

2017-01-01

ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

Single-Step Fabrication of High-Density Microdroplet Arrays of Low-Surface-Tension Liquids.

Science.gov (United States)

Feng, Wenqian; Li, Linxian; Du, Xin; Welle, Alexander; Levkin, Pavel A

2016-04-01

A facile approach for surface patterning that enables single-step fabrication of high-density arrays of low-surface-tension organic-liquid microdroplets is described. This approach enables miniaturized and parallel high-throughput screenings in organic solvents, formation of homogeneous arrays of hydrophobic nanoparticles, polymer micropads of specific shapes, and polymer microlens arrays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Low-field multi-step magnetization of GaV4S8 single crystal

Energy Technology Data Exchange (ETDEWEB)

Nakamura, H; Kajinami, Y; Tabata, Y [Department of Materials Science and Engineering, Kyoto University, Kyoto 606-8501 (Japan); Ikeno, R; Motoyama, G; Kohara, T, E-mail: h.nakamura@ht8.ecs.kyoto-u.ac.j [Graduate School of Material Science, University of Hyogo, Kamigori, Hyogo 678-1297 (Japan)

2009-01-01

The magnetization process of single crystalline GaV4S8 including tetrahedral magnetic clusters was measured in the magnetically ordered state below T{sub C} {approx_equal} 13 K. Just below TC, steps were observed at very low fields of the order of 100 Oe, suggesting the competition of several intra- and inter-cluster interactions in a low energy range.

Diffusion welding. [heat treatment of nickel alloys following single step vacuum welding process

Science.gov (United States)

Holko, K. H. (Inventor)

1974-01-01

Dispersion-strengthened nickel alloys are sanded on one side and chemically polished. This is followed by a single-step welding process wherein the polished surfaces are forced into intimate contact at 1,400 F for one hour in a vacuum. Diffusion, recrystallization, and grain growth across the original weld interface are obtained during postheating at 2,150 F for two hours in hydrogen.

Single-step colloidal quantum dot films for infrared solar harvesting

KAUST Repository

Kiani, Amirreza

2016-11-01

Semiconductors with bandgaps in the near- to mid-infrared can harvest solar light that is otherwise wasted by conventional single-junction solar cell architectures. In particular, colloidal quantum dots (CQDs) are promising materials since they are cost-effective, processed from solution, and have a bandgap that can be tuned into the infrared (IR) via the quantum size effect. These characteristics enable them to harvest the infrared portion of the solar spectrum to which silicon is transparent. To date, IR CQD solar cells have been made using a wasteful and complex sequential layer-by-layer process. Here, we demonstrate ∼1 eV bandgap solar-harvesting CQD films deposited in a single step. By engineering a fast-drying solvent mixture for metal iodide-capped CQDs, we deposited active layers greater than 200 nm in thickness having a mean roughness less than 1 nm. We integrated these films into infrared solar cells that are stable in air and exhibit power conversion efficiencies of 3.5% under illumination by the full solar spectrum, and 0.4% through a simulated silicon solar cell filter.

Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

Science.gov (United States)

Suo, Zucai

2014-01-01

Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

Bridge flap technique as a single-step solution to mucogingival problems: A case series

Directory of Open Access Journals (Sweden)

Vivek Gupta

2011-01-01

Full Text Available Shallow vestibule, gingival recession, inadequate width of attached gingiva (AG and aberrant frenum pull are an array of mucogingival problems for which several independent and effective surgical solutions are reported in the literature. This case series reports the effectiveness of the bridge flap technique as a single-step surgical entity for increasing the depth of the vestibule, root coverage, increasing the width of the AG and solving the problem of abnormal frenum pull. Eight patients with 18 teeth altogether having Millers class I, II or III recession along with problems of shallow vestibule, inadequate width of AG and with or without frenum pull underwent this surgical procedure and were followed-up till 9 months post-operatively. The mean root coverage obtained was 55% and the mean average gain in width of the AG was 3.5 mm. The mean percentage gain in clinical attachment level was 41%. The bridge flap technique can be an effective single-step solution for the aforementioned mucogingival problems if present simultaneously in any case, and offers considerable advantages over other mucogingival surgical techniques in terms of simplicity, limited chair-time for the patient and the operator, single surgical intervention for manifold mucogingival problems and low morbidity because of the absence of palatal donor tissue.

Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

Science.gov (United States)

Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

2017-07-26

Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications.

Directory of Open Access Journals (Sweden)

Rodrigo Jácome

Full Text Available The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, "fingertips" that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection.

Characterization of cyclic deformation behaviour of tempered and quenched 42CrMoS4 at single step and variable amplitude loading

International Nuclear Information System (INIS)

Schelp, M.; Eifler, D.

2000-01-01

Cyclic single steps tests were performed on tempered and quenched specimens of the steel 42CrMoS4. Strain, temperature and electrical resistance measurements yielded an empirical prediction of fatigue life according to Coffin, Manson and Morrow. All measured values are based on physical processes and therefore show a strong interaction. A new testing procedure was developed permitting hysteresis measurements to be used for the characterization and description of fatigue behaviour under variable amplitude loading. The basic idea is to combine fatigue tests with any kind of load spectrum with single step tests. This offers the possibility to apply lifetime prediction methods normally used for single step tests for those with random or service loading. (orig.)

Multispot single-molecule FRET: High-throughput analysis of freely diffusing molecules.

Directory of Open Access Journals (Sweden)

Antonino Ingargiola

Full Text Available We describe an 8-spot confocal setup for high-throughput smFRET assays and illustrate its performance with two characteristic experiments. First, measurements on a series of freely diffusing doubly-labeled dsDNA samples allow us to demonstrate that data acquired in multiple spots in parallel can be properly corrected and result in measured sample characteristics consistent with those obtained with a standard single-spot setup. We then take advantage of the higher throughput provided by parallel acquisition to address an outstanding question about the kinetics of the initial steps of bacterial RNA transcription. Our real-time kinetic analysis of promoter escape by bacterial RNA polymerase confirms results obtained by a more indirect route, shedding additional light on the initial steps of transcription. Finally, we discuss the advantages of our multispot setup, while pointing potential limitations of the current single laser excitation design, as well as analysis challenges and their solutions.

Single-step syngas-to-distillates (S2D) process based on biomass-derived syngas--a techno-economic analysis.

Science.gov (United States)

Zhu, Yunhua; Jones, Susanne B; Biddy, Mary J; Dagle, Robert A; Palo, Daniel R

2012-08-01

This study compared biomass gasification based syngas-to-distillate (S2D) systems using techno-economic analysis (TEA). Three cases, state of technology (SOT), goal, and conventional, were compared in terms of performance and cost. The SOT case represented the best available experimental results for a process starting with syngas using a single-step dual-catalyst reactor for distillate generation. The conventional case mirrored a conventional two-step S2D process consisting of separate syngas-to-methanol and methanol-to-gasoline (MTG) processes. The goal case assumed the same performance as the conventional, but with a single-step S2D technology. TEA results revealed that the SOT was more expensive than the conventional and goal cases. The SOT case suffers from low one-pass yield and high selectivity to light hydrocarbons, both of which drive up production cost. Sensitivity analysis indicated that light hydrocarbon yield and single pass conversion efficiency were the key factors driving the high cost for the SOT case. Copyright © 2012 Elsevier Ltd. All rights reserved.

Are There Mutator Polymerases?

Directory of Open Access Journals (Sweden)

Miguel Garcia-Diaz

2003-01-01

Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

Towards Single-Step Biofabrication of Organs on a Chip via 3D Printing.

Science.gov (United States)

Knowlton, Stephanie; Yenilmez, Bekir; Tasoglu, Savas

2016-09-01

Organ-on-a-chip engineering employs microfabrication of living tissues within microscale fluid channels to create constructs that closely mimic human organs. With the advent of 3D printing, we predict that single-step fabrication of these devices will enable rapid design and cost-effective iterations in the development stage, facilitating rapid innovation in this field. Copyright © 2016 Elsevier Ltd. All rights reserved.

Single-step electrochemical method for producing very sharp Au scanning tunneling microscopy tips

International Nuclear Information System (INIS)

Gingery, David; Buehlmann, Philippe

2007-01-01

A single-step electrochemical method for making sharp gold scanning tunneling microscopy tips is described. 3.0M NaCl in 1% perchloric acid is compared to several previously reported etchants. The addition of perchloric acid to sodium chloride solutions drastically shortens etching times and is shown by transmission electron microscopy to produce very sharp tips with a mean radius of curvature of 15 nm

Single-step solution processing of small-molecule organic semiconductor field-effect transistors at high yield

NARCIS (Netherlands)

Yu, Liyang; Li, X.; Pavlica, E.; Loth, M.A.; Anthony, J.E.; Bratina, G.; Kjellander, B.K.C.; Gelinck, G.H.; Stutzmann, N.

2011-01-01

Here, we report a simple, alternative route towards high-mobility structures of the small-molecular semiconductor 5,11-bis(triethyl silylethynyl) anthradithiophene that requires one single processing step without the need for any post-deposition processing. The method relies on careful control of

Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

Science.gov (United States)

Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2015-03-01

A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

AN EFFICIENT ANALYSIS FOR ABSORPTION AND GAIN COEFFICIENTS IN 'SINGLE STEP-INDEX WAVEGUIDE'S BY USING THE ALPHA METHOD

Directory of Open Access Journals (Sweden)

Mustafa TEMİZ

2008-02-01

Full Text Available In this study, some design parameters such as normalized frequency and especially normalized propagation constant have been obtained, depending on some parameters which are functions of energy eigenvalues of the carriers such as electrons and holes confined in a single step-index waveguide laser (SSIWGL or single stepindex waveguide (SSIWG. Some optical expressions about the optical power and probability quantities for the active region and cladding layers of the SSIWG or SSIWGL have been investigated. Investigations have been undertaken in terms of these parameters and also individually the optical even and odd electric field waves with the lowest-modes were theoretically computed. Especially absorption coefficients and loss coefficients addition to some important quantities of the single step-index waveguide lasers for the even and odd electric field waves are evaluated.

Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

Energy Technology Data Exchange (ETDEWEB)

Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

1977-03-02

DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

Solving the RNA polymerase I structural puzzle

Energy Technology Data Exchange (ETDEWEB)

Moreno-Morcillo, María [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Taylor, Nicholas M. I. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Gruene, Tim [Georg-August-University, Tammannstrasse 4, 37077 Göttingen (Germany); Legrand, Pierre [SOLEIL Synchrotron, L’Orme de Merisiers, Saint Aubin, Gif-sur-Yvette (France); Rashid, Umar J. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Ruiz, Federico M. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Steuerwald, Ulrich; Müller, Christoph W. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Fernández-Tornero, Carlos, E-mail: cftornero@cib.csic.es [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany)

2014-10-01

Details of the RNA polymerase I crystal structure determination provide a framework for solution of the structures of other multi-subunit complexes. Simple crystallographic experiments are described to extract relevant biological information such as the location of the enzyme active site. Knowing the structure of multi-subunit complexes is critical to understand basic cellular functions. However, when crystals of these complexes can be obtained they rarely diffract beyond 3 Å resolution, which complicates X-ray structure determination and refinement. The crystal structure of RNA polymerase I, an essential cellular machine that synthesizes the precursor of ribosomal RNA in the nucleolus of eukaryotic cells, has recently been solved. Here, the crucial steps that were undertaken to build the atomic model of this multi-subunit enzyme are reported, emphasizing how simple crystallographic experiments can be used to extract relevant biological information. In particular, this report discusses the combination of poor molecular replacement and experimental phases, the application of multi-crystal averaging and the use of anomalous scatterers as sequence markers to guide tracing and to locate the active site. The methods outlined here will likely serve as a reference for future structural determination of large complexes at low resolution.

Single-step digital backpropagation for nonlinearity mitigation

DEFF Research Database (Denmark)

Secondini, Marco; Rommel, Simon; Meloni, Gianluca

2015-01-01

Nonlinearity mitigation based on the enhanced split-step Fourier method (ESSFM) for the implementation of low-complexity digital backpropagation (DBP) is investigated and experimentally demonstrated. After reviewing the main computational aspects of DBP and of the conventional split-step Fourier...... in the computational complexity, power consumption, and latency with respect to a simple feed-forward equalizer for bulk dispersion compensation....

Binary Factorization in Hopfield-Like Neural Networks: Single-Step Approximation and Computer Simulations

Czech Academy of Sciences Publication Activity Database

Frolov, A. A.; Sirota, A.M.; Húsek, Dušan; Muraviev, I. P.

2004-01-01

Roč. 14, č. 2 (2004), s. 139-152 ISSN 1210-0552 R&D Projects: GA ČR GA201/01/1192 Grant - others:BARRANDE(EU) 99010-2/99053; Intellectual computer Systems(EU) Grant 2.45 Institutional research plan: CEZ:AV0Z1030915 Keywords : nonlinear binary factor analysis * feature extraction * recurrent neural network * Single-Step approximation * neurodynamics simulation * attraction basins * Hebbian learning * unsupervised learning * neuroscience * brain function modeling Subject RIV: BA - General Mathematics

Blastocyst utilization rates after continuous culture in two commercial single-step media: a prospective randomized study with sibling oocytes.

Science.gov (United States)

Sfontouris, Ioannis A; Kolibianakis, Efstratios M; Lainas, George T; Venetis, Christos A; Petsas, George K; Tarlatzis, Basil C; Lainas, Tryfon G

2017-10-01

The aim of this study is to determine whether blastocyst utilization rates are different after continuous culture in two different commercial single-step media. This is a paired randomized controlled trial with sibling oocytes conducted in infertility patients, aged ≤40 years with ≥10 oocytes retrieved assigned to blastocyst culture and transfer. Retrieved oocytes were randomly allocated to continuous culture in either Sage one-step medium (Origio) or Continuous Single Culture (CSC) medium (Irvine Scientific) without medium renewal up to day 5 post oocyte retrieval. Main outcome measure was the proportion of embryos suitable for clinical use (utilization rate). A total of 502 oocytes from 33 women were randomly allocated to continuous culture in either Sage one-step medium (n = 250) or CSC medium (n = 252). Fertilization was performed by either in vitro fertilization or intracytoplasmic sperm injection, and embryo transfers were performed on day 5. Two patients had all blastocysts frozen due to the occurrence of severe ovarian hyperstimulation syndrome. Fertilization and cleavage rates, as well as embryo quality on day 3, were similar in the two media. Blastocyst utilization rates (%, 95% CI) [55.4% (46.4-64.1) vs 54.7% (44.9-64.6), p = 0.717], blastocyst formation rates [53.6% (44.6-62.5) vs 51.9 (42.2-61.6), p = 0.755], and proportion of good quality blastocysts [36.8% (28.1-45.4) vs 36.1% (27.2-45.0), p = 0.850] were similar in Sage one-step and CSC media, respectively. Continuous culture of embryos in Sage one-step and CSC media is associated with similar blastocyst development and utilization rates. Both single-step media appear to provide adequate support during in vitro preimplantation embryo development. Whether these observations are also valid for other continuous single medium protocols remains to be determined. NCT02302638.

Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

International Nuclear Information System (INIS)

Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

1988-01-01

The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

Real-time, single-step bioassay using nanoplasmonic resonator with ultra-high sensitivity

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xiang; Ellman, Jonathan A; Chen, Fanqing Frank; Su, Kai-Hang; Wei, Qi-Huo; Sun, Cheng

2014-04-01

A nanoplasmonic resonator (NPR) comprising a metallic nanodisk with alternating shielding layer(s), having a tagged biomolecule conjugated or tethered to the surface of the nanoplasmonic resonator for highly sensitive measurement of enzymatic activity. NPRs enhance Raman signals in a highly reproducible manner, enabling fast detection of protease and enzyme activity, such as Prostate Specific Antigen (paPSA), in real-time, at picomolar sensitivity levels. Experiments on extracellular fluid (ECF) from paPSA-positive cells demonstrate specific detection in a complex bio-fluid background in real-time single-step detection in very small sample volumes.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

Science.gov (United States)

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Virtual substitution scan via single-step free energy perturbation.

Science.gov (United States)

Chiang, Ying-Chih; Wang, Yi

2016-02-05

With the rapid expansion of our computing power, molecular dynamics (MD) simulations ranging from hundreds of nanoseconds to microseconds or even milliseconds have become increasingly common. The majority of these long trajectories are obtained from plain (vanilla) MD simulations, where no enhanced sampling or free energy calculation method is employed. To promote the 'recycling' of these trajectories, we developed the Virtual Substitution Scan (VSS) toolkit as a plugin of the open-source visualization and analysis software VMD. Based on the single-step free energy perturbation (sFEP) method, VSS enables the user to post-process a vanilla MD trajectory for a fast free energy scan of substituting aryl hydrogens by small functional groups. Dihedrals of the functional groups are sampled explicitly in VSS, which improves the performance of the calculation and is found particularly important for certain groups. As a proof-of-concept demonstration, we employ VSS to compute the solvation free energy change upon substituting the hydrogen of a benzene molecule by 12 small functional groups frequently considered in lead optimization. Additionally, VSS is used to compute the relative binding free energy of four selected ligands of the T4 lysozyme. Overall, the computational cost of VSS is only a fraction of the corresponding multi-step FEP (mFEP) calculation, while its results agree reasonably well with those of mFEP, indicating that VSS offers a promising tool for rapid free energy scan of small functional group substitutions. This article is protected by copyright. All rights reserved. © 2016 Wiley Periodicals, Inc.

Development of an efficient process intensification strategy for enhancing Pfu DNA polymerase production in recombinant Escherichia coli.

Science.gov (United States)

Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao

2015-04-01

An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.

The essential DNA polymerases δ and ε are involved in repair of UV-damaged DNA in the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Halas, A.; Policinska, Z.; Baranowska, H.; Jachymczyk, W.J.

1999-01-01

We have studied the ability of yeast DNA polymerases to carry out repair of lesions caused by UV irradiation in Saccharomyces cerevisiae. By the analysis of postirradiation relative molecular mass changes in cellular DNA of different DNA polymerases mutant strains, it was established that mutations in DNA polymerases δ and ε showed accumulation of single-strand breaks indicating defective repair. Mutations in other DNA polymerase genes exhibited no defects in DNA repair. Thus, the data obtained suggest that DNA polymerases δ and ε are both necessary for DNA replication and for repair of lesions caused by UV irradiation. The results are discussed in the light of current concepts concerning the specificity of DNA polymerases in DNA repair. (author)

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

Crowding-induced transcriptional bursts dictate polymerase and nucleosome density profiles along genes

NARCIS (Netherlands)

van den Berg, A.A.; Depken, S.M.

2017-01-01

During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a

Mitochondrial DNA polymerase from embryos of Drosophila melanogaster: purification, subunit structure, and partial characterization

International Nuclear Information System (INIS)

Wernette, C.M.; Kaguni, L.S.

1986-01-01

The mitochondrial DNA polymerase has been purified to near-homogeneity from early embryos of Drosophila melanogaster. Sodium dodecyl sulfate gel electrophoresis of the highly purified enzyme reveals two polypeptides with molecular masses of 125,000 and 35,000 daltons, in a ratio of 1:1. The enzyme has a sedimentation coefficient of 7.6 S and a stokes radius of 51 A. Taken together, the data suggest that the D. melanogaster DNA polymerase γ is a heterodimer. DNA polymerase activity gel analysis has allowed the assignment of the DNA polymerization function to the large subunit. The DNA polymerase exhibits a remarkable ability to utilize efficiently a variety of template-primers including gapped DNA, poly(rA).oligo(dT) and singly primed phiX174 DNA. Both the crude and the highly purified enzymes are stimulated by KCl, and inhibited by dideoxythymidine triphosphate and by N-ethylmaleimide. Thus, the catalytic properties of the near-homogeneous Drosophila enzyme are consistent with those of DNA polymerase γ as partially purified from several vertebrates

Single molecular biology: coming of age in DNA replication.

Science.gov (United States)

Liu, Xiao-Jing; Lou, Hui-Qiang

2017-09-20

DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

Electric field dependent paramagnetic defect creation in single step implanted Simox films

International Nuclear Information System (INIS)

Leray, J.L.; Margail, J.

1991-01-01

X irradiation induced oxygen-vacancy defect creation has been studied in SIMOX produced by single step implantation and annealing. It is shown that SIMOX is substantially more radiation sensitive (for these defects) than thermal or bulk oxide. Irradiation in the presence of an electric field 0.5 -1 MV cm -1 is found to enhance the rate of defect creation by ≥ 2 times. Further enhanced defect creation is observed in SIMOX samples whose substrate has been chemically thinned prior to irradiation. This enhancement is attributed to modification of the network induced by hydrogen introduced during the thinning process

Single-Step Generation of Conditional Knockout Mouse Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Matyas Flemr

2015-07-01

Full Text Available Induction of double-strand DNA breaks (DSBs by engineered nucleases, such as CRISPR/Cas9 or transcription activator-like effector nucleases (TALENs, stimulates knockin of exogenous DNA fragments via homologous recombination (HR. However, the knockin efficiencies reported so far have not allowed more complex in vitro genome modifications such as, for instance, simultaneous integration of a DNA fragment at two distinct genomic sites. We developed a reporter system to enrich for cells with engineered nuclease-assisted HR events. Using this system in mouse embryonic stem cells (mESCs, we achieve single-step biallelic and seamless integration of two loxP sites for Cre recombinase-mediated inducible gene knockout, as well as biallelic endogenous gene tagging with high efficiency. Our approach reduces the time and resources required for conditional knockout mESC generation dramatically.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

Science.gov (United States)

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Thin film complementary metal oxide semiconductor (CMOS) device using a single-step deposition of the channel layer

KAUST Repository

Nayak, Pradipta K.; Caraveo-Frescas, J. A.; Wang, Zhenwei; Hedhili, Mohamed N.; Wang, Q. X.; Alshareef, Husam N.

2014-01-01

We report, for the first time, the use of a single step deposition of semiconductor channel layer to simultaneously achieve both n-and p-type transport in transparent oxide thin film transistors (TFTs). This effect is achieved by controlling

Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

OpenAIRE

Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

1993-01-01

Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

A novel single-step, multipoint calibration method for instrumented Lab-on-Chip systems

DEFF Research Database (Denmark)

Pfreundt, Andrea; Patou, François; Zulfiqar, Azeem

2014-01-01

for instrument-based PoC blood biomarker analysis systems. Motivated by the complexity of associating high-accuracy biosensing using silicon nanowire field effect transistors with ease of use for the PoC system user, we propose a novel one-step, multipoint calibration method for LoC-based systems. Our approach...... specifically addresses the important interfaces between a novel microfluidic unit to integrate the sensor array and a mobile-device hardware accessory. A multi-point calibration curve is obtained by generating a defined set of reference concentrations from a single input. By consecutively splitting the flow...

Rapid, single-step most-probable-number method for enumerating fecal coliforms in effluents from sewage treatment plants

Science.gov (United States)

Munoz, E. F.; Silverman, M. P.

1979-01-01

A single-step most-probable-number method for determining the number of fecal coliform bacteria present in sewage treatment plant effluents is discussed. A single growth medium based on that of Reasoner et al. (1976) and consisting of 5.0 gr. proteose peptone, 3.0 gr. yeast extract, 10.0 gr. lactose, 7.5 gr. NaCl, 0.2 gr. sodium lauryl sulfate, and 0.1 gr. sodium desoxycholate per liter is used. The pH is adjusted to 6.5, and samples are incubated at 44.5 deg C. Bacterial growth is detected either by measuring the increase with time in the electrical impedance ratio between the innoculated sample vial and an uninnoculated reference vial or by visual examination for turbidity. Results obtained by the single-step method for chlorinated and unchlorinated effluent samples are in excellent agreement with those obtained by the standard method. It is suggested that in automated treatment plants impedance ratio data could be automatically matched by computer programs with the appropriate dilution factors and most probable number tables already in the computer memory, with the corresponding result displayed as fecal coliforms per 100 ml of effluent.

Excision-repair in mutants of Escherichia coli deficient in DNA polymerase I and/or its associated 5'. -->. 3' exonuclease

Energy Technology Data Exchange (ETDEWEB)

Cooper, P [Stanford Univ., Calif. (USA). Dept. of Biological Sciences

1977-01-01

The UV sensitivity of E.coli mutants deficient in the 5'..-->..3' exonuclease activity of DNA polymerase I is intermediate between that of pol/sup +/ strains and mutants which are deficient in the polymerizing activity of pol I (polA1). Like polA1 mutants, the 5'-econuclease deficient mutants exhibit increased UV-induced DNA degradation and increased repair synthesis compared to a pol/sup +/ strain, although the increase is not as great as in polA1 or in the conditionally lethal mutant BT4113ts deficient in both polymerase I activities. When dimer excision was measured at UV doses low enough to avoid interference from extensive DNA degradation, all three classes of polymerase I deficient mutants were found to remove dimers efficiently from their DNA. We conclude that enzymes alternative to polymerase I can operate in both the excision and resynthesis steps of excision repair and that substitution for either of the polymerase I functions results in longer patches of repair. A model is proposed detailing the possible events in the alternative pathways.

Functional roles of DNA polymerases β and γ

International Nuclear Information System (INIS)

Huebscher, U.; Kuenzle, C.C.; Spadari, S.

1979-01-01

The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

Mammalian RNA polymerase II core promoters: insights from genome-wide studies

DEFF Research Database (Denmark)

Sandelin, Albin; Carninci, Piero; Lenhard, Boris

2007-01-01

The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

OpenAIRE

Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

2003-01-01

Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

Single-step fabrication of electrodes with controlled nanostructured surface roughness using optically-induced electrodeposition

Science.gov (United States)

Liu, N.; Li, M.; Liu, L.; Yang, Y.; Mai, J.; Pu, H.; Sun, Y.; Li, W. J.

2018-02-01

The customized fabrication of microelectrodes from gold nanoparticles (AuNPs) has attracted much attention due to their numerous applications in chemistry and biomedical engineering, such as for surface-enhanced Raman spectroscopy (SERS) and as catalyst sites for electrochemistry. Herein, we present a novel optically-induced electrodeposition (OED) method for rapidly fabricating gold electrodes which are also surface-modified with nanoparticles in one single step. The electrodeposition mechanism, with respect to the applied AC voltage signal and the elapsed deposition time, on the resulting morphology and particle sizes was investigated. The results from SEM and AFM analysis demonstrated that 80-200 nm gold particles can be formed on the surface of the gold electrodes. Simultaneously, both the size of the nanoparticles and the roughness of the fabricated electrodes can be regulated by the deposition time. Compared to state-of-the-art methods for fabricating microelectrodes with AuNPs, such as nano-seed-mediated growth and conventional electrodeposition, this OED technique has several advantages including: (1) electrode fabrication and surface modification using nanoparticles are completed in a single step, eliminating the need for prefabricating micro electrodes; (2) the patterning of electrodes is defined using a digitally-customized, projected optical image rather than using fixed physical masks; and (3) both the fabrication and surface modification processes are rapid, and the entire fabrication process only requires less than 6 s.

Novel structure formation at the bottom surface of porous anodic alumina fabricated by single step anodization process.

Science.gov (United States)

Ali, Ghafar; Ahmad, Maqsood; Akhter, Javed Iqbal; Maqbool, Muhammad; Cho, Sung Oh

2010-08-01

A simple approach for the growth of long-range highly ordered nanoporous anodic alumina film in H(2)SO(4) electrolyte through a single step anodization without any additional pre-anodizing procedure is reported. Free-standing porous anodic alumina film of 180 microm thickness with through hole morphology was obtained. A simple and single step process was used for the detachment of alumina from aluminum substrate. The effect of anodizing conditions, such as anodizing voltage and time on the pore diameter and pore ordering is discussed. The metal/oxide and oxide/electrolyte interfaces were examined by high resolution scanning transmission electron microscope. The arrangement of pores on metal/oxide interface was well ordered with smaller diameters than that of the oxide/electrolyte interface. The inter-pore distance was larger in metal/oxide interface as compared to the oxide/electrolyte interface. The size of the ordered domain was found to depend strongly upon anodizing voltage and time. (c) 2010 Elsevier Ltd. All rights reserved.

Single step vacuum-free and hydrogen-free synthesis of graphene

Directory of Open Access Journals (Sweden)

Christian Orellana

2017-08-01

Full Text Available We report a modified method to grow graphene in a single-step process. It is based on chemical vapor deposition and considers the use of methane under extremely adverse synthesis conditions, namely in an open chamber without requiring the addition of gaseous hydrogen in any of the synthesis stages. The synthesis occurs between two parallel Cu plates, heated up via electromagnetic induction. The inductive heating yields a strong thermal gradient between the catalytic substrates and the surrounding environment, promoting the enrichment of hydrogen generated as fragments of the methane molecules within the volume confined by the Cu foils. This induced density gradient is due to thermo-diffusion, also known as the Soret effect. Hydrogen and other low mass molecular fractions produced during the process inhibit oxidative effects and simultaneously reduce the native oxide on the Cu surface. As a result, high quality graphene is obtained on the inner surfaces of the Cu sheets as confirmed by Raman spectroscopy.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

Intramolecular telomeric G-quadruplexes dramatically inhibit DNA synthesis by replicative and translesion polymerases, revealing their potential to lead to genetic change.

Directory of Open Access Journals (Sweden)

Deanna N Edwards

Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.

Higher cytoplasmic and nuclear poly(ADP-ribose) polymerase expression in familial than in sporadic breast cancer

NARCIS (Netherlands)

Klauke, M.L.; Hoogerbrugge-van der Linden, N.; Budczies, J.; Bult, P.; Prinzler, J.; Radke, C.; van Krieken, J.H.; Dietel, M.; Denkert, C.; Muller, B.M.

2012-01-01

Poly(ADP-ribose) polymerase 1 (PARP) is a key element of the single-base excision pathway for repair of DNA single-strand breaks. To compare the cytoplasmic and nuclear poly(ADP-ribose) expression between familial (BRCA1, BRCA2, or non BRCA1/2) and sporadic breast cancer, we investigated 39 sporadic

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

Directory of Open Access Journals (Sweden)

Elena K Braithwaite

2010-08-01

Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

Directory of Open Access Journals (Sweden)

V.K. Jain

2010-02-01

Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

Comparison of Stepped Care Delivery Against a Single, Empirically Validated Cognitive-Behavioral Therapy Program for Youth With Anxiety: A Randomized Clinical Trial.

Science.gov (United States)

Rapee, Ronald M; Lyneham, Heidi J; Wuthrich, Viviana; Chatterton, Mary Lou; Hudson, Jennifer L; Kangas, Maria; Mihalopoulos, Cathrine

2017-10-01

Stepped care is embraced as an ideal model of service delivery but is minimally evaluated. The aim of this study was to evaluate the efficacy of cognitive-behavioral therapy (CBT) for child anxiety delivered via a stepped-care framework compared against a single, empirically validated program. A total of 281 youth with anxiety disorders (6-17 years of age) were randomly allocated to receive either empirically validated treatment or stepped care involving the following: (1) low intensity; (2) standard CBT; and (3) individually tailored treatment. Therapist qualifications increased at each step. Interventions did not differ significantly on any outcome measures. Total therapist time per child was significantly shorter to deliver stepped care (774 minutes) compared with best practice (897 minutes). Within stepped care, the first 2 steps returned the strongest treatment gains. Stepped care and a single empirically validated program for youth with anxiety produced similar efficacy, but stepped care required slightly less therapist time. Restricting stepped care to only steps 1 and 2 would have led to considerable time saving with modest loss in efficacy. Clinical trial registration information-A Randomised Controlled Trial of Standard Care Versus Stepped Care for Children and Adolescents With Anxiety Disorders; http://anzctr.org.au/; ACTRN12612000351819. Copyright © 2017 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production

Science.gov (United States)

Slaine, Patrick D.; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M.; Hatchette, Todd

2018-01-01

Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation. PMID:29783694

A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor [version 2; referees: 1 approved, 4 approved with reservations

Directory of Open Access Journals (Sweden)

Aaron T.L. Lun

2016-10-01

Full Text Available Single-cell RNA sequencing (scRNA-seq is widely used to profile the transcriptome of individual cells. This provides biological resolution that cannot be matched by bulk RNA sequencing, at the cost of increased technical noise and data complexity. The differences between scRNA-seq and bulk RNA-seq data mean that the analysis of the former cannot be performed by recycling bioinformatics pipelines for the latter. Rather, dedicated single-cell methods are required at various steps to exploit the cellular resolution while accounting for technical noise. This article describes a computational workflow for low-level analyses of scRNA-seq data, based primarily on software packages from the open-source Bioconductor project. It covers basic steps including quality control, data exploration and normalization, as well as more complex procedures such as cell cycle phase assignment, identification of highly variable and correlated genes, clustering into subpopulations and marker gene detection. Analyses were demonstrated on gene-level count data from several publicly available datasets involving haematopoietic stem cells, brain-derived cells, T-helper cells and mouse embryonic stem cells. This will provide a range of usage scenarios from which readers can construct their own analysis pipelines.

Antibacterial and cytocompatible nanotextured Ti surface incorporating silver via single step hydrothermal processing

Energy Technology Data Exchange (ETDEWEB)

Mohandas, Anu; Krishnan, Amit G.; Biswas, Raja; Menon, Deepthy, E-mail: deepthymenon@aims.amrita.edu; Nair, Manitha B., E-mail: manithanair@aims.amrita.edu

2017-06-01

Nanosurface modification of Titanium (Ti) implants and prosthesis is proved to enhance osseointegration at the tissue–implant interface. However, many of these products lack adequate antibacterial capability, which leads to implant loosening. As a curative strategy, in this study, nanotextured Ti substrates embedded with silver nanoparticles were developed through a single step hydrothermal processing in an alkaline medium containing silver nitrate at different concentrations (15, 30 and 75 μM). Scanning electron micrographs revealed a non-periodically oriented nanoleafy structure on Ti (TNL) decorated with Ag nanoparticles (nanoAg), which was verified by XPS, XRD and EDS analysis. This TNLAg substrate proved to be mechanically stable upon nanoindentation and nanoscratch tests. Silver ions at detectable levels were released for a period of ~ 28 days only from substrates incorporating higher nanoAg content. The samples demonstrated antibacterial activity towards both Escherichia coli and Staphylococcus aureus, with a more favorable response to the former. Simultaneously, Ti substrates incorporating nanoAg at all concentrations supported the viability, proliferation and osteogenic differentiation of mesenchymal stem cells. Overall, nanoAg incorporation into surface modified Ti via a simple one-step thermochemical method is a favorable strategy for producing implants with dual characteristics of antibacterial activity and cell compatibility. - Highlights: • Nanosilver was incorporated within Ti nanoleafy topography by simple one-step thermochemical method • The nanosurface demonstrated antibacterial activity against gram positive and gram negative bacteria • The nanosurface promoted the viability, proliferation and osteogenic differentiation of mesenchymal stem cells.

Single step synthesis and organization of gold colloids assisted by copolymer templates

Science.gov (United States)

Sarrazin, Aurélien; Gontier, Arthur; Plaud, Alexandre; Béal, Jérémie; Yockell-Lelièvre, Hélène; Bijeon, Jean-Louis; Plain, Jérôme; Adam, Pierre-Michel; Maurer, Thomas

2014-06-01

We report here an original single-step process for the synthesis and self-organization of gold colloids by simply incorporating gold salts into a solution prepared using polystyrene (PS)-polymethylmethacrylate copolymer and thiolated PS with propylene glycol methyl ether acetate as a solvent. The spin-coating and annealing of this solution then allows the formation of PS domains. Depending on the polymer concentration of the as-prepared solution, there can be either one or several gold nanoparticles (Au NPs) per PS domain. For high concentrations of Au NPs in PS domains, the coupling between plasmonic NPs leads to the observation of a second peak in the optical extinction spectrum. Such a collective effect could be relevant for the development of optical strain sensors in the near future.

Separation of Be and Al for AMS using single-step column chromatography

Energy Technology Data Exchange (ETDEWEB)

Binnie, Steven A., E-mail: sbinnie@uni-koeln.de [Institute for Geology und Mineralogy, University of Cologne, 4-6 Greinstrasse, Cologne D-50939 (Germany); Dunai, Tibor J.; Voronina, Elena; Goral, Tomasz [Institute for Geology und Mineralogy, University of Cologne, 4-6 Greinstrasse, Cologne D-50939 (Germany); Heinze, Stefan; Dewald, Alfred [University of Cologne, Institut für Kernphysik, Zülpicher Str. 77, Cologne D-50937 (Germany)

2015-10-15

With the aim of simplifying AMS target preparation procedures for TCN measurements we tested a new extraction chromatography approach which couples an anion exchange resin (WBEC) to a chelating resin (Beryllium resin) to separate Be and Al from dissolved quartz samples. Results show that WBEC–Beryllium resin stacks can be used to provide high purity Be and Al separations using a combination of hydrochloric/oxalic and nitric acid elutions. {sup 10}Be and {sup 26}Al concentrations from quartz samples prepared using more standard procedures are compared with results from replicate samples prepared using the coupled WBEC–Beryllium resin approach and show good agreement. The new column procedure is performed in a single step, reducing sample preparation times relative to more traditional methods of TCN target production.

Separation of Be and Al for AMS using single-step column chromatography

Science.gov (United States)

Binnie, Steven A.; Dunai, Tibor J.; Voronina, Elena; Goral, Tomasz; Heinze, Stefan; Dewald, Alfred

2015-10-01

With the aim of simplifying AMS target preparation procedures for TCN measurements we tested a new extraction chromatography approach which couples an anion exchange resin (WBEC) to a chelating resin (Beryllium resin) to separate Be and Al from dissolved quartz samples. Results show that WBEC-Beryllium resin stacks can be used to provide high purity Be and Al separations using a combination of hydrochloric/oxalic and nitric acid elutions. 10Be and 26Al concentrations from quartz samples prepared using more standard procedures are compared with results from replicate samples prepared using the coupled WBEC-Beryllium resin approach and show good agreement. The new column procedure is performed in a single step, reducing sample preparation times relative to more traditional methods of TCN target production.

Single-Step Transepithelial PRK vs Alcohol-Assisted PRK in Myopia and Compound Myopic Astigmatism Correction

OpenAIRE

Kaluzny, Bartlomiej J.; Cieslinska, Iwona; Mosquera, Samuel A.; Verma, Shwetabh

2016-01-01

Abstract Transepithelial photorefractive keratectomy (tPRK), where both the epithelium and stroma are removed in a single-step, is a relatively new procedure of laser refractive error correction. This study compares the 3-month results of myopia and compound myopic astigmatism correction by tPRK or conventional alcohol-assisted PRK (aaPRK). This prospective, nonrandomized, case?control study recruited 148 consecutive patients; 93 underwent tPRK (173 eyes) and 55 aaPRK (103 eyes). Refractive r...

DNA damage mediated transcription arrest: Step back to go forward.

Science.gov (United States)

Mullenders, Leon

2015-12-01

The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

Biochemical and genetic analysis of the role of the viral polymerase in enterovirus recombination.

Science.gov (United States)

Woodman, Andrew; Arnold, Jamie J; Cameron, Craig E; Evans, David J

2016-08-19

Genetic recombination in single-strand, positive-sense RNA viruses is a poorly understand mechanism responsible for generating extensive genetic change and novel phenotypes. By moving a critical cis-acting replication element (CRE) from the polyprotein coding region to the 3' non-coding region we have further developed a cell-based assay (the 3'CRE-REP assay) to yield recombinants throughout the non-structural coding region of poliovirus from dually transfected cells. We have additionally developed a defined biochemical assay in which the only protein present is the poliovirus RNA dependent RNA polymerase (RdRp), which recapitulates the strand transfer events of the recombination process. We have used both assays to investigate the role of the polymerase fidelity and nucleotide turnover rates in recombination. Our results, of both poliovirus intertypic and intratypic recombination in the CRE-REP assay and using a range of polymerase variants in the biochemical assay, demonstrate that RdRp fidelity is a fundamental determinant of recombination frequency. High fidelity polymerases exhibit reduced recombination and low fidelity polymerases exhibit increased recombination in both assays. These studies provide the basis for the analysis of poliovirus recombination throughout the non-structural region of the virus genome and provide a defined biochemical assay to further dissect this important evolutionary process. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Colloidal Quantum Dot Inks for Single-Step-Fabricated Field-Effect Transistors: The Importance of Postdeposition Ligand Removal.

Science.gov (United States)

Balazs, Daniel M; Rizkia, Nisrina; Fang, Hong-Hua; Dirin, Dmitry N; Momand, Jamo; Kooi, Bart J; Kovalenko, Maksym V; Loi, Maria Antonietta

2018-02-14

Colloidal quantum dots are a class of solution-processed semiconductors with good prospects for photovoltaic and optoelectronic applications. Removal of the surfactant, so-called ligand exchange, is a crucial step in making the solid films conductive, but performing it in solid state introduces surface defects and cracks in the films. Hence, the formation of thick, device-grade films have only been possible through layer-by-layer processing, limiting the technological interest for quantum dot solids. Solution-phase ligand exchange before the deposition allows for the direct deposition of thick, homogeneous films suitable for device applications. In this work, fabrication of field-effect transistors in a single step is reported using blade-coating, an upscalable, industrially relevant technique. Most importantly, a postdeposition washing step results in device properties comparable to the best layer-by-layer processed devices, opening the way for large-scale fabrication and further interest from the research community.

Novel Polymerase Gene Mutations for Human Adaptation in Clinical Isolates of Avian H5N1 Influenza Viruses.

Directory of Open Access Journals (Sweden)

Yasuha Arai

2016-04-01

Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.

An efficient single-step scheme for manipulating quantum information of two trapped ions beyond the Lamb-Dicke limit

International Nuclear Information System (INIS)

Wei, L.F.; Nori, Franco

2003-01-01

Based on the exact conditional quantum dynamics for a two-ion system, we propose an efficient single-step scheme for coherently manipulating quantum information of two trapped cold ions by using a pair of synchronous laser pulses. Neither the auxiliary atomic level nor the Lamb-Dicke approximation are needed

Balanced Photodetection in One-Step Liquid-Phase-Synthesized CsPbBr3 Micro-/Nanoflake Single Crystals.

Science.gov (United States)

Zheng, Wei; Xiong, Xufan; Lin, Richeng; Zhang, Zhaojun; Xu, Cunhua; Huang, Feng

2018-01-17

Here, we reported a low-cost and high-compatibility one-step liquid-phase synthesis method for synthesizing high-purity CsPbBr 3 micro-/nanoflake single crystals. On the basis of the high-purity CsPbBr 3 , we further prepared a low-dimensional photodetector capable of balanced photodetection, involving both high external quantum efficiency and rapid temporal response, which is barely realized in previously reported low-dimensional photodetectors.

Determination of beam intensity in a single step for IMRT inverse planning

International Nuclear Information System (INIS)

Chuang, Keh-Shih; Chen, Tzong-Jer; Kuo, Shan-Chi; Jan, Meei-Ling; Hwang, Ing-Ming; Chen, Sharon; Lin, Ying-Chuan; Wu, Jay

2003-01-01

In intensity modulated radiotherapy (IMRT), targets are treated by multiple beams at different orientations each with spatially-modulated beam intensities. This approach spreads the normal tissue dose to a greater volume and produces a higher dose conformation to the target. In general, inverse planning is used for IMRT treatment planning. The inverse planning requires iterative calculation of dose distribution in order to optimize the intensity profile for each beam and is very computation intensive. In this paper, we propose a single-step method utilizing a figure of merit (FoM) to estimate the beam intensities for IMRT treatment planning. The FoM of a ray is defined as the ratio between the delivered tumour dose and normal tissue dose and is a good index for the dose efficacy of the ray. To maximize the beam utility, it is natural to irradiate the tumour with intensity of each ray proportional to the value of the FoM. The nonuniform beam intensity profiles are then fixed and the weights of the beam are determined iteratively in order to yield a uniform tumour dose. In this study, beams are employed at equispaced angles around the patient. Each beam with its field size that just covers the tumour is divided into a fixed number of beamlets. The FoM is calculated for each beamlet and this value is assigned to be the beam intensity. Various weighting factors are incorporated in the FoM computation to accommodate different clinical considerations. Two clinical datasets are used to test the feasibility of the algorithm. The resultant dose-volume histograms of this method are presented and compared to that of conformal therapy. Preliminary results indicate that this method reduces the critical organ doses at a small expense of uniformity in tumour dose distribution. This method estimates the beam intensity in one single step and the computation time is extremely fast and can be finished in less than one minute using a regular PC

The effects of strength and power training on single-step balance recovery in older adults: a preliminary study.

Science.gov (United States)

Pamukoff, Derek N; Haakonssen, Eric C; Zaccaria, Joseph A; Madigan, Michael L; Miller, Michael E; Marsh, Anthony P

2014-01-01

Improving muscle strength and power may mitigate the effects of sarcopenia, but it is unknown if this improves an older adult's ability to recover from a large postural perturbation. Forward tripping is prevalent in older adults and lateral falls are important due to risk of hip fracture. We used a forward and a lateral single-step balance recovery task to examine the effects of strength training (ST) or power (PT) training on single-step balance recovery in older adults. Twenty older adults (70.8±4.4 years, eleven male) were randomly assigned to either a 6-week (three times/week) lower extremity ST or PT intervention. Maximum forward (FLean(max)) and lateral (LLean(max)) lean angle and strength and power in knee extension and leg press were assessed at baseline and follow-up. Fifteen participants completed the study (ST =7, PT =8). Least squares means (95% CI) for ΔFLean(max) (ST: +4.1° [0.7, 7.5]; PT: +0.6° [-2.5, 3.8]) and ΔLLean(max) (ST: +2.2° [0.4, 4.1]; PT: +2.6° [0.9, 4.4]) indicated no differences between groups following training. In exploratory post hoc analyses collapsed by group, ΔFLean(max) was +2.4° (0.1, 4.7) and ΔLLean(max) was +2.4° (1.2, 3.6). These improvements on the balance recovery tasks ranged from ~15%-30%. The results of this preliminary study suggest that resistance training may improve balance recovery performance, and that, in this small sample, PT did not lead to larger improvements in single-step balance recovery compared to ST.

Stability of cell-free DNA from maternal plasma isolated following a single centrifugation step.

Science.gov (United States)

Barrett, Angela N; Thadani, Henna A; Laureano-Asibal, Cecille; Ponnusamy, Sukumar; Choolani, Mahesh

2014-12-01

Cell-free fetal DNA can be used for prenatal testing with no procedure-related risk to the fetus. However, yield of fetal DNA is low compared with maternal cell-free DNA fragments, resulting in technical challenges for some downstream applications. To maximize the fetal fraction, careful blood processing procedures are essential. We demonstrate that fetal fraction can be preserved using a single centrifugation step followed by postage of plasma to the laboratory for further processing. Digital PCR was used to quantify copies of total, maternal, and fetal DNA present in single-spun plasma at time points over a two-week period, compared with immediately processed double-spun plasma, with storage at room temperature, 4°C, and -80°C representing different postage scenarios. There was no significant change in total, maternal, or fetal DNA copy numbers when single-spun plasma samples were stored for up to 1 week at room temperature and 2 weeks at -80°C compared with plasma processed within 4 h. Following storage at 4°C no change in composition of cell-free DNA was observed. Single-spun plasma can be transported at room temperature if the journey is expected to take one week or less; shipping on dry ice is preferable for longer journeys. © 2014 John Wiley & Sons, Ltd.

Step size of the rotary proton motor in single FoF1-ATP synthase from a thermoalkaliphilic bacterium by DCO-ALEX FRET

Science.gov (United States)

Hammann, Eva; Zappe, Andrea; Keis, Stefanie; Ernst, Stefan; Matthies, Doreen; Meier, Thomas; Cook, Gregory M.; Börsch, Michael

2012-02-01

Thermophilic enzymes operate at high temperatures but show reduced activities at room temperature. They are in general more stable during preparation and, accordingly, are considered to be more rigid in structure. Crystallization is often easier compared to proteins from bacteria growing at ambient temperatures, especially for membrane proteins. The ATP-producing enzyme FoF1-ATP synthase from thermoalkaliphilic Caldalkalibacillus thermarum strain TA2.A1 is driven by a Fo motor consisting of a ring of 13 c-subunits. We applied a single-molecule Förster resonance energy transfer (FRET) approach using duty cycle-optimized alternating laser excitation (DCO-ALEX) to monitor the expected 13-stepped rotary Fo motor at work. New FRET transition histograms were developed to identify the smaller step sizes compared to the 10-stepped Fo motor of the Escherichia coli enzyme. Dwell time analysis revealed the temperature and the LDAO dependence of the Fo motor activity on the single molecule level. Back-and-forth stepping of the Fo motor occurs fast indicating a high flexibility in the membrane part of this thermophilic enzyme.

Single step synthesis and organization of gold colloids assisted by copolymer templates

International Nuclear Information System (INIS)

Sarrazin, Aurélien; Gontier, Arthur; Plaud, Alexandre; Béal, Jérémie; Yockell-Lelièvre, Hélène; Bijeon, Jean-Louis; Plain, Jérôme; Adam, Pierre-Michel; Maurer, Thomas

2014-01-01

We report here an original single-step process for the synthesis and self-organization of gold colloids by simply incorporating gold salts into a solution prepared using polystyrene (PS)-polymethylmethacrylate copolymer and thiolated PS with propylene glycol methyl ether acetate as a solvent. The spin-coating and annealing of this solution then allows the formation of PS domains. Depending on the polymer concentration of the as-prepared solution, there can be either one or several gold nanoparticles (Au NPs) per PS domain. For high concentrations of Au NPs in PS domains, the coupling between plasmonic NPs leads to the observation of a second peak in the optical extinction spectrum. Such a collective effect could be relevant for the development of optical strain sensors in the near future. (papers)

Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

International Nuclear Information System (INIS)

Shwartz, H.; Shavitt, O.; Livneh, Z.

1988-01-01

The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

Advancing Polymerase Ribozymes Towards Self-Replication

Science.gov (United States)

Tjhung, K. F.; Joyce, G. F.

2017-07-01

Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)

1977-09-01

Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.

Single-step generation of metal-plasma polymer multicore@shell nanoparticles from the gas phase.

Science.gov (United States)

Solař, Pavel; Polonskyi, Oleksandr; Olbricht, Ansgar; Hinz, Alexander; Shelemin, Artem; Kylián, Ondřej; Choukourov, Andrei; Faupel, Franz; Biederman, Hynek

2017-08-17

Nanoparticles composed of multiple silver cores and a plasma polymer shell (multicore@shell) were prepared in a single step with a gas aggregation cluster source operating with Ar/hexamethyldisiloxane mixtures and optionally oxygen. The size distribution of the metal inclusions as well as the chemical composition and the thickness of the shells were found to be controlled by the composition of the working gas mixture. Shell matrices ranging from organosilicon plasma polymer to nearly stoichiometric SiO 2 were obtained. The method allows facile fabrication of multicore@shell nanoparticles with tailored functional properties, as demonstrated here with the optical response.

Single-step generation of fluorophore-encapsulated gold nanoparticle core-shell materials

International Nuclear Information System (INIS)

Sardar, R; Shem, P M; Pecchia-Bekkum, C; Bjorge, N S; Shumaker-Parry, J S

2010-01-01

We report a simple route to produce fluorophore-encapsulated gold nanoparticles (AuNPs) in a single step under aqueous conditions using the fluorophore 1-pyrenemethylamine (PMA). Different amounts of PMA were used and the resulting core-shell gold nanoparticles were analyzed using UV-visible absorption spectroscopy, fluorescence spectroscopy, and transmission and scanning electron microscopy. Electron microscopy analysis shows nanoparticles consisting of a gold nanoparticle core which is encapsulated with a lower contrast shell. In the UV-visible spectra, we observed a significant red shift (37 nm) of the localized surface plasmon resonance (LSPR) absorption maximum (λ max ) compared to citrate-stabilized AuNPs of a similar size. We attribute the prominent LSPR wavelength shift for PMA-AuNP conjugates to the increase in the local dielectric environment near the gold nanoparticles due to the shell formation. This simple, aqueous-based synthesis is a new approach to the production of fluorophore-encapsulated AuNPs that could be applicable in biological sensing systems and photonic device fabrication.

A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

International Nuclear Information System (INIS)

Yap, Thai Leong; Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G.; Lescar, Julien

2007-01-01

Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration

A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

Energy Technology Data Exchange (ETDEWEB)

Yap, Thai Leong [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G. [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); Lescar, Julien, E-mail: julien@ntu.edu.sg [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore)

2007-02-01

Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.

"Silicon millefeuille": From a silicon wafer to multiple thin crystalline films in a single step

Science.gov (United States)

Hernández, David; Trifonov, Trifon; Garín, Moisés; Alcubilla, Ramon

2013-04-01

During the last years, many techniques have been developed to obtain thin crystalline films from commercial silicon ingots. Large market applications are foreseen in the photovoltaic field, where important cost reductions are predicted, and also in advanced microelectronics technologies as three-dimensional integration, system on foil, or silicon interposers [Dross et al., Prog. Photovoltaics 20, 770-784 (2012); R. Brendel, Thin Film Crystalline Silicon Solar Cells (Wiley-VCH, Weinheim, Germany 2003); J. N. Burghartz, Ultra-Thin Chip Technology and Applications (Springer Science + Business Media, NY, USA, 2010)]. Existing methods produce "one at a time" silicon layers, once one thin film is obtained, the complete process is repeated to obtain the next layer. Here, we describe a technology that, from a single crystalline silicon wafer, produces a large number of crystalline films with controlled thickness in a single technological step.

Affinity isolation and I-DIRT mass spectrometric analysis of the Escherichia coli O157:H7 Sakai RNA polymerase complex.

Science.gov (United States)

Lee, David J; Busby, Stephen J W; Westblade, Lars F; Chait, Brian T

2008-02-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the "core" E. coli genome.

Single step sequential polydimethylsiloxane wet etching to fabricate a microfluidic channel with various cross-sectional geometries

Science.gov (United States)

Wang, C.-K.; Liao, W.-H.; Wu, H.-M.; Lo, Y.-H.; Lin, T.-R.; Tung, Y.-C.

2017-11-01

Polydimethylsiloxane (PDMS) has become a widely used material to construct microfluidic devices for various biomedical and chemical applications due to its desirable material properties and manufacturability. PDMS microfluidic devices are usually fabricated using soft lithography replica molding methods with master molds made of photolithogrpahy patterned photoresist layers on silicon wafers. The fabricated microfluidic channels often have rectangular cross-sectional geometries with single or multiple heights. In this paper, we develop a single step sequential PDMS wet etching process that can be used to fabricate microfluidic channels with various cross-sectional geometries from single-layer PDMS microfluidic channels. The cross-sections of the fabricated channel can be non-rectangular, and varied along the flow direction. Furthermore, the fabricated cross-sectional geometries can be numerically simulated beforehand. In the experiments, we fabricate microfluidic channels with various cross-sectional geometries using the developed technique. In addition, we fabricate a microfluidic mixer with alternative mirrored cross-sectional geometries along the flow direction to demonstrate the practical usage of the developed technique.

DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

Science.gov (United States)

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-07-14

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

Science.gov (United States)

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-01-01

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

Cp2 TiX Complexes for Sustainable Catalysis in Single-Electron Steps.

Science.gov (United States)

Richrath, Ruben B; Olyschläger, Theresa; Hildebrandt, Sven; Enny, Daniel G; Fianu, Godfred D; Flowers, Robert A; Gansäuer, Andreas

2018-04-25

We present a combined electrochemical, kinetic, and synthetic study with a novel and easily accessible class of titanocene catalysts for catalysis in single-electron steps. The tailoring of the electronic properties of our Cp 2 TiX-catalysts that are prepared in situ from readily available Cp 2 TiX 2 is achieved by varying the anionic ligand X. Of the complexes investigated, Cp 2 TiOMs proved to be either equal or substantially superior to the best catalysts developed earlier. The kinetic and thermodynamic properties pertinent to catalysis have been determined. They allow a mechanistic understanding of the subtle interplay of properties required for an efficient oxidative addition and reduction. Therefore, our study highlights that efficient catalysts do not require the elaborate covalent modification of the cyclopentadienyl ligands. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

Directory of Open Access Journals (Sweden)

Hui Dong

2016-09-01

Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

RNA binding and replication by the poliovirus RNA polymerase

International Nuclear Information System (INIS)

Oberste, M.S.

1988-01-01

RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

Properties of nano-structured Ni/YSZ anodes fabricated from plasma sprayable NiO/YSZ powder prepared by single step solution combustion method

Energy Technology Data Exchange (ETDEWEB)

Prakash, B. Shri; Balaji, N.; Kumar, S. Senthil; Aruna, S.T., E-mail: staruna194@gmail.com

2016-12-15

Highlights: • Preparation of plasma grade NiO/YSZ powder in single step. • Fabrication of nano-structured Ni/YSZ coating. • Conductivity of 600 S/cm at 800 °C. - Abstract: NiO/YSZ anode coatings are fabricated by atmospheric plasma spraying at different plasma powers from plasma grade NiO/YSZ powders that are prepared in a single step by solution combustion method. The process adopted is devoid of multi-steps that are generally involved in conventional spray drying or fusing and crushing methods. Density of the coating increased and porosity decreased with increase in the plasma power of deposition. An ideal nano-structured Ni/YSZ anode encompassing nano YSZ particles, nano Ni particles and nano pores is achieved on reducing the coating deposited at lower plasma powers. The coating exhibit porosities in the range of 27%, sufficient for anode functional layers. Electronic conductivity of the coatings is in the range of 600 S/cm at 800 °C.

Evolving a polymerase for hydrophobic base analogues.

Science.gov (United States)

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

Dynamics of termination during in vitro replication of ultraviolet-irradiated DNA with DNA polymerase III holoenzyme of Escherichia coli

International Nuclear Information System (INIS)

Shwartz, H.; Livneh, Z.

1987-01-01

During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini

Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

Directory of Open Access Journals (Sweden)

Rudolph Spangler

Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

Polymerase chain reaction methods (PCR in agrobiotechnology

Directory of Open Access Journals (Sweden)

Taški-Ajduković Ksenija

2006-01-01

Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Replication slippage of the thermophilic DNA polymerases B and D from the Euryarchaeota Pyrococcus abyssi

Directory of Open Access Journals (Sweden)

Melissa G. eCastillo-Lizardo

2014-08-01

Full Text Available Replication slippage or slipped-strand mispairing involves the misalignment of DNA strands during the replication of repeated DNA sequences, and can lead to genetic rearrangements such as microsatellite instability. Here, we show that PolB and PolD replicative DNA polymerases from the archaeal model Pyrococcus abyssi (Pab slip in vitro during replication of a single-stranded DNA template carrying a hairpin structure and short direct repeats. We find that this occurs in both their wild-type (exo+ and exonuclease deficient (exo- forms. The slippage behavior of PabPolB and PabPolD, probably due to limited strand displacement activity, resembles that observed for the high fidelity Pyrococcus furiosus (Pfu DNA polymerase. The presence of PabPCNA inhibited PabPolB and PabPolD slippage. We propose a model whereby PabPCNA stimulates strand displacement activity and polymerase progression through the hairpin, thus permitting the error-free replication of repetitive sequences.

The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli

International Nuclear Information System (INIS)

Tang, M.-S.; Patrick, M.H.

1977-01-01

Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)

DNA polymerase η mutational signatures are found in a variety of different types of cancer.

Science.gov (United States)

Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I

2018-01-01

DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

Affinity Isolation and I-DIRT Mass Spectrometric Analysis of the Escherichia coli O157:H7 Sakai RNA Polymerase Complex▿

Science.gov (United States)

Lee, David J.; Busby, Stephen J. W.; Westblade, Lars F.; Chait, Brian T.

2008-01-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the “core” E. coli genome. PMID:18083804

Polymerase study: Improved detection of Salmonella and Campylobacter through the optimized use of DNA polymerases in diagnostic real-time PCR

DEFF Research Database (Denmark)

Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer

DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...

A uv-sensitive Chinese hamster lung fibroblast cell line (V79/UC) with a possible defect in DNA polymerase activity is deficient in DNA repair

International Nuclear Information System (INIS)

Creissen, D.M.; Hill, C.K.

1991-01-01

Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present

DNA repair synthesis in human fibroblasts requires DNA polymerase delta

International Nuclear Information System (INIS)

Nishida, C.; Reinhard, P.; Linn, S.

1988-01-01

When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

Single step production of Cas9 mRNA for zygote injection.

Science.gov (United States)

Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

2018-03-01

Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

Structural Studies of Silver Nanoparticles Obtained Through Single-Step Green Synthesis

Science.gov (United States)

Prasad Peddi, Siva; Abdallah Sadeh, Bilal

2015-10-01

Green synthesis of silver Nanoparticles (AGNP's) has been the most prominent among the metallic nanoparticles for research for over a decade and half now due to both the simplicity of preparation and the applicability of biological species with extensive applications in medicine and biotechnology to reduce and trap the particles. The current article uses Eclipta Prostrata leaf extract as the biological species to cap the AGNP's through a single step process. The characterization data obtained was used for the analysis of the sample structure. The article emphasizes the disquisition of their shape and size of the lattice parameters and proposes a general scheme and a mathematical model for the analysis of their dependence. The data of the synthesized AGNP's has been used to advantage through the introduction of a structural shape factor for the crystalline nanoparticles. The properties of the structure of the AGNP's proposed and evaluated through a theoretical model was undeviating with the experimental consequences. This modus operandi gives scope for the structural studies of ultrafine particles prepared using biological methods.

Effect of increased exposure times on amount of residual monomer released from single-step self-etch adhesives.

Science.gov (United States)

Altunsoy, Mustafa; Botsali, Murat Selim; Tosun, Gonca; Yasar, Ahmet

2015-10-16

The aim of this study was to evaluate the effect of increased exposure times on the amount of residual Bis-GMA, TEGDMA, HEMA and UDMA released from single-step self-etch adhesive systems. Two adhesive systems were used. The adhesives were applied to bovine dentin surface according to the manufacturer's instructions and were polymerized using an LED curing unit for 10, 20 and 40 seconds (n = 5). After polymerization, the specimens were stored in 75% ethanol-water solution (6 mL). Residual monomers (Bis-GMA, TEGDMA, UDMA and HEMA) that were eluted from the adhesives (after 10 minutes, 1 hour, 1 day, 7 days and 30 days) were analyzed by high-performance liquid chromatography (HPLC). The data were analyzed using 1-way analysis of variance and Tukey HSD tests. Among the time periods, the highest amount of released residual monomers from adhesives was observed in the 10th minute. There were statistically significant differences regarding released Bis-GMA, UDMA, HEMA and TEGDMA between the adhesive systems (p<0.05). There were no significant differences among the 10, 20 and 40 second polymerization times according to their effect on residual monomer release from adhesives (p>0.05). Increasing the polymerization time did not have an effect on residual monomer release from single-step self-etch adhesives.

Sci-Thur PM - Colourful Interactions: Highlights 08: ARC TBI using Single-Step Optimized VMAT Fields

International Nuclear Information System (INIS)

Hudson, Alana; Gordon, Deborah; Moore, Roseanne; Balogh, Alex; Pierce, Greg

2016-01-01

Purpose: This work outlines a new TBI delivery technique to replace a lateral POP full bolus technique. The new technique is done with VMAT arc delivery, without bolus, treating the patient prone and supine. The benefits of the arc technique include: increased patient experience and safety, better dose conformity, better organ at risk sparing, decreased therapist time and reduction of therapist injuries. Methods: In this work we build on a technique developed by Jahnke et al. We use standard arc fields with gantry speeds corrected for varying distance to the patient followed by a single step VMAT optimization on a patient CT to increase dose inhomogeneity and to reduce dose to the lungs (vs. blocks). To compare the arc TBI technique to our full bolus technique, we produced plans on patient CTs for both techniques and evaluated several dosimetric parameters using an ANOVA test. Results and Conclusions: The arc technique is able reduce both the hot areas to the body (D2% reduced from 122.2% to 111.8% p<0.01) and the lungs (mean lung dose reduced from 107.5% to 99.1%, p<0.01), both statistically significant, while maintaining coverage (D98% = 97.8% vs. 94.6%, p=0.313, not statistically significant). We developed a more patient and therapist-friendly TBI treatment technique that utilizes single-step optimized VMAT plans. It was found that this technique was dosimetrically equivalent to our previous lateral technique in terms of coverage and statistically superior in terms of reduced lung dose.

Sci-Thur PM - Colourful Interactions: Highlights 08: ARC TBI using Single-Step Optimized VMAT Fields

Energy Technology Data Exchange (ETDEWEB)

Hudson, Alana; Gordon, Deborah; Moore, Roseanne; Balogh, Alex; Pierce, Greg [Tom Baker Cancer Centre (Canada)

2016-08-15

Purpose: This work outlines a new TBI delivery technique to replace a lateral POP full bolus technique. The new technique is done with VMAT arc delivery, without bolus, treating the patient prone and supine. The benefits of the arc technique include: increased patient experience and safety, better dose conformity, better organ at risk sparing, decreased therapist time and reduction of therapist injuries. Methods: In this work we build on a technique developed by Jahnke et al. We use standard arc fields with gantry speeds corrected for varying distance to the patient followed by a single step VMAT optimization on a patient CT to increase dose inhomogeneity and to reduce dose to the lungs (vs. blocks). To compare the arc TBI technique to our full bolus technique, we produced plans on patient CTs for both techniques and evaluated several dosimetric parameters using an ANOVA test. Results and Conclusions: The arc technique is able reduce both the hot areas to the body (D2% reduced from 122.2% to 111.8% p<0.01) and the lungs (mean lung dose reduced from 107.5% to 99.1%, p<0.01), both statistically significant, while maintaining coverage (D98% = 97.8% vs. 94.6%, p=0.313, not statistically significant). We developed a more patient and therapist-friendly TBI treatment technique that utilizes single-step optimized VMAT plans. It was found that this technique was dosimetrically equivalent to our previous lateral technique in terms of coverage and statistically superior in terms of reduced lung dose.

Structure and function of DNA polymerase μ

International Nuclear Information System (INIS)

Matsumoto, Takuro; Maezawa, So

2013-01-01

DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

High-Resolution Phenotypic Landscape of the RNA Polymerase II Trigger Loop.

Directory of Open Access Journals (Sweden)

Chenxi Qiu

2016-11-01

Full Text Available The active sites of multisubunit RNA polymerases have a "trigger loop" (TL that multitasks in substrate selection, catalysis, and translocation. To dissect the Saccharomyces cerevisiae RNA polymerase II TL at individual-residue resolution, we quantitatively phenotyped nearly all TL single variants en masse. Three mutant classes, revealed by phenotypes linked to transcription defects or various stresses, have distinct distributions among TL residues. We find that mutations disrupting an intra-TL hydrophobic pocket, proposed to provide a mechanism for substrate-triggered TL folding through destabilization of a catalytically inactive TL state, confer phenotypes consistent with pocket disruption and increased catalysis. Furthermore, allele-specific genetic interactions among TL and TL-proximal domain residues support the contribution of the funnel and bridge helices (BH to TL dynamics. Our structural genetics approach incorporates structural and phenotypic data for high-resolution dissection of transcription mechanisms and their evolution, and is readily applicable to other essential yeast proteins.

COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

Directory of Open Access Journals (Sweden)

Masashi Miura

2013-12-01

Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Aesthetic rehabilitation of a patient with an anterior maxillectomy defect, using an innovative single-step, single unit, plastic-based hollow obturator

Directory of Open Access Journals (Sweden)

Vishwas Bhatia

2015-06-01

Full Text Available What could be better than improving the comfort and quality of life of a patient with a life-threatening disease? Maxillectomy, the partial or total removal of the maxilla in patients suffering from benign or malignant neoplasms, creates a challenging defect for the maxillofacial prosthodontist when attempting to provide an effective obturator. Although previous methods have been described for rehabilitation of such patients, our goal should be to devise one stage techniques that will allow the patient an improved quality of life as soon as possible. The present report describes the aesthetic rehabilitation of a maxillectomy patient by use of a hollow obturator. The obturator is fabricated through a processing technique which is a variation of other well-known techniques, consisting of the use of a single-step flasking procedure to fabricate a single-unit hollow obturator using the lost salt technique. As our aim is to aesthetically and functionally rehabilitate the patient as soon as possible, the present method of restoring the maxillectomy defect is cost-effective, time-saving and beneficial for the patient.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Polymerase Gamma Disease through the Ages

Science.gov (United States)

Saneto, Russell P.; Naviaux, Robert K.

2010-01-01

The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

Fast Synthesis of High Quality Biodiesel from ‘Waste Fish Oil’ by Single Step Transesterification

Directory of Open Access Journals (Sweden)

Yogesh C. Sharma

2014-09-01

Full Text Available A large volume of fish wastes is produced on a daily basis in the Indian sub-continent. This abundant waste source could serve as an economic feedstock for bioenergy generation. In the present study, oil extracted from discarded fish parts was used for high quality biodiesel production. More specifically, a single step transesterification of ‘waste fishoil’ with methanol using sodium methoxide (CH3ONa as homogeneous catalyst under moderate operational conditions resulted in highly pure biodiesel of > 98% of fatty acid methyl ester (FAME content. Characterization was performed by Fourier Transform-Nuclear Magnetic Resonance (FT-NMR.

Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

Science.gov (United States)

Glais, Laurent; Jacquot, Emmanuel

2015-01-01

Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

Two Family B DNA Polymerases From Aeropyrum pernix, Based on Revised Translational Frames

Directory of Open Access Journals (Sweden)

Katsuya Daimon

2018-04-01

Full Text Available Living organisms are divided into three domains, Bacteria, Eukarya, and Archaea. Comparative studies in the three domains have provided useful information to understand the evolution of the DNA replication machinery. DNA polymerase is the central enzyme of DNA replication. The presence of multiple family B DNA polymerases is unique in Crenarchaeota, as compared with other archaeal phyla, which have a single enzyme each for family B (PolB and family D (PolD. We analyzed PolB1 and PolB3 in the hyperthermophilic crenarchaeon, Aeropyrum pernix, and found that they are larger proteins than those predicted from the coding regions in our previous study and from public database annotations. The recombinant larger PolBs exhibited the same DNA polymerase activities as previously reported. However, the larger PolB3 showed remarkably higher thermostability, which made this enzyme applicable to PCR. In addition, the high tolerance to salt and heparin suggests that PolB3 will be useful for amplification from the samples with contaminants, and therefore it has a great potential for diagnostic use in the medical and environmental field.

Chromosomal location of the human gene for DNA polymerase β

International Nuclear Information System (INIS)

McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

1987-01-01

Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique

Science.gov (United States)

Fanzio, Paola; Chang, Chi-Tung; Skolimowski, Maciej; Tanzi, Simone; Sasso, Luigi

2017-01-01

We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT), and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline). The patterning of the fluidic (microfluidic channels) and conductive (wiring and electrodes) functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH. PMID:28531106

Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique

Directory of Open Access Journals (Sweden)

Paola Fanzio

2017-05-01

Full Text Available We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT, and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline. The patterning of the fluidic (microfluidic channels and conductive (wiring and electrodes functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH.

Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique.

Science.gov (United States)

Fanzio, Paola; Chang, Chi-Tung; Skolimowski, Maciej; Tanzi, Simone; Sasso, Luigi

2017-05-20

We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT), and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline). The patterning of the fluidic (microfluidic channels) and conductive (wiring and electrodes) functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH.

A novel single-step procedure for the calibration of the mounting parameters of a multi-camera terrestrial mobile mapping system

Science.gov (United States)

Habib, A.; Kersting, P.; Bang, K.; Rau, J.

2011-12-01

Mobile Mapping Systems (MMS) can be defined as moving platforms which integrates a set of imaging sensors and a position and orientation system (POS) for the collection of geo-spatial information. In order to fully explore the potential accuracy of such systems and guarantee accurate multi-sensor integration, a careful system calibration must be carried out. System calibration involves individual sensor calibration as well as the estimation of the inter-sensor geometric relationship. This paper tackles a specific component of the system calibration process of a multi-camera MMS - the estimation of the relative orientation parameters among the cameras, i.e., the inter-camera geometric relationship (lever-arm offsets and boresight angles among the cameras). For that purpose, a novel single step procedure, which is easy to implement and not computationally intensive, will be introduced. The proposed method is implemented in such a way that it can also be used for the estimation of the mounting parameters among the cameras and the IMU body frame, in case of directly georeferenced systems. The performance of the proposed method is evaluated through experimental results using simulated data. A comparative analysis between the proposed single-step and the two-step, which makes use of the traditional bundle adjustment procedure, is demonstrated.

Analytic observations for the d=1+ 1 bridge site (or single-step) deposition model

International Nuclear Information System (INIS)

Evans, J.W.; Kang, H.C.

1991-01-01

Some exact results for a reversible version of the d=1+1 bridge site (or single-step) deposition model are presented. Exact steady-state properties are determined directly for finite systems with various mean slopes. These show explicitly how the asymptotic growth velocity and fluctuations are quenched as the slope approaches its maximum allowed value. Next, exact hierarchial equations for the dynamics are presented. For the special case of ''equilibrium growth,'' these are analyzed exactly at the pair-correlation level directly for an infinite system. This provided further insight into asymptotic scaling behavior. Finally, the above hierarchy is compared with one generated from a discrete form of the Kardar--Parisi--Zhang equations. Some differences are described

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

Science.gov (United States)

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Using the Hepatitis C Virus RNA-Dependent RNA Polymerase as a Model to Understand Viral Polymerase Structure, Function and Dynamics

Directory of Open Access Journals (Sweden)

Ester Sesmero

2015-07-01

Full Text Available Viral polymerases replicate and transcribe the genomes of several viruses of global health concern such as Hepatitis C virus (HCV, human immunodeficiency virus (HIV and Ebola virus. For this reason they are key targets for therapies to treat viral infections. Although there is little sequence similarity across the different types of viral polymerases, all of them present a right-hand shape and certain structural motifs that are highly conserved. These features allow their functional properties to be compared, with the goal of broadly applying the knowledge acquired from studying specific viral polymerases to other viral polymerases about which less is known. Here we review the structural and functional properties of the HCV RNA-dependent RNA polymerase (NS5B in order to understand the fundamental processes underlying the replication of viral genomes. We discuss recent insights into the process by which RNA replication occurs in NS5B as well as the role that conformational changes play in this process.

Molecular diagnosis of eosinophilic meningitis due to Angiostrongylus cantonensis (Nematoda: Metastrongyloidea by polymerase chain reaction-DNA sequencing of cerebrospinal fluids of patients

Directory of Open Access Journals (Sweden)

Praphathip Eamsobhana

2013-02-01

Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.

Attenuation of Foot-and-Mouth Disease Virus by Engineered Viral Polymerase Fidelity.

Science.gov (United States)

Rai, Devendra K; Diaz-San Segundo, Fayna; Campagnola, Grace; Keith, Anna; Schafer, Elizabeth A; Kloc, Anna; de Los Santos, Teresa; Peersen, Olve; Rieder, Elizabeth

2017-08-01

Foot-and-mouth disease virus (FMDV) RNA-dependent RNA polymerase (RdRp) (3D pol ) catalyzes viral RNA synthesis. Its characteristic low fidelity and absence of proofreading activity allow FMDV to rapidly mutate and adapt to dynamic environments. In this study, we used the structure of FMDV 3D pol in combination with previously reported results from similar picornaviral polymerases to design point mutations that would alter replication fidelity. In particular, we targeted Trp237 within conserved polymerase motif A because of the low reversion potential inherent in the single UGG codon. Using biochemical and genetic tools, we show that the replacement of tryptophan 237 with phenylalanine imparts higher fidelity, but replacements with isoleucine and leucine resulted in lower-fidelity phenotypes. Viruses containing these W237 substitutions show in vitro growth kinetics and plaque morphologies similar to those of the wild-type (WT) A 24 Cruzeiro strain in BHK cells, and both high- and low-fidelity variants retained fitness during coinfection with the wild-type virus. The higher-fidelity W237F (W237F HF ) mutant virus was more resistant to the mutagenic nucleoside analogs ribavirin and 5-fluorouracil than the WT virus, whereas the lower-fidelity W237I (W237I LF ) and W237L LF mutant viruses exhibited lower ribavirin resistance. Interestingly, the variant viruses showed heterogeneous and slightly delayed growth kinetics in primary porcine kidney cells, and they were significantly attenuated in mouse infection experiments. These data demonstrate, for a single virus, that either increased or decreased RdRp fidelity attenuates virus growth in animals, which is a desirable feature for the development of safer and genetically more stable vaccine candidates. IMPORTANCE Foot-and-mouth disease (FMD) is the most devastating disease affecting livestock worldwide. Here, using structural and biochemical analyses, we have identified FMDV 3D pol mutations that affect polymerase

Reduction of postreplication DNA repair in two Escherichia coli mutants with temperature-sensitive polymerase III activity: implications for the postreplication repair pathway

International Nuclear Information System (INIS)

Johnson, R.C.

1978-01-01

Daughter strand gaps are secondary lesions caused by interrupted DNA synthesis in the proximity of uv-induced pyrimidine dimers. The relative roles of DNA recombination and de novo DNA synthesis in filling such gaps have not been clarified, although both are required for complete closure. In this study, the Escherichia coli E486 and E511 dnaE(Ts) mutants, in which DNA polymerase I but not DNA polymerase III is active at 43 0 C, were examined. Both mutants demonstrated reduced gap closure in comparison with the progenitor strain at the nonpermissive temperature. These results and those of previous studies support the hypothesis that both DNA polymerase I and DNA polymerase III contribute to gap closure, suggesting a cooperative effort in the repair of each gap. Benzoylated, naphthoylated diethylaminoethyl-cellulose chromatography analysis for persistence of single-strand DNA in the absence of DNA polymerase III activity suggested that de novo DNA synthesis initiates the filling of daughter strand gaps

Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

Science.gov (United States)

Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

2017-02-07

Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

Science.gov (United States)

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

General methods for analysis of sequential "n-step" kinetic mechanisms: application to single turnover kinetics of helicase-catalyzed DNA unwinding.

Science.gov (United States)

Lucius, Aaron L; Maluf, Nasib K; Fischer, Christopher J; Lohman, Timothy M

2003-10-01

Helicase-catalyzed DNA unwinding is often studied using "all or none" assays that detect only the final product of fully unwound DNA. Even using these assays, quantitative analysis of DNA unwinding time courses for DNA duplexes of different lengths, L, using "n-step" sequential mechanisms, can reveal information about the number of intermediates in the unwinding reaction and the "kinetic step size", m, defined as the average number of basepairs unwound between two successive rate limiting steps in the unwinding cycle. Simultaneous nonlinear least-squares analysis using "n-step" sequential mechanisms has previously been limited by an inability to float the number of "unwinding steps", n, and m, in the fitting algorithm. Here we discuss the behavior of single turnover DNA unwinding time courses and describe novel methods for nonlinear least-squares analysis that overcome these problems. Analytic expressions for the time courses, f(ss)(t), when obtainable, can be written using gamma and incomplete gamma functions. When analytic expressions are not obtainable, the numerical solution of the inverse Laplace transform can be used to obtain f(ss)(t). Both methods allow n and m to be continuous fitting parameters. These approaches are generally applicable to enzymes that translocate along a lattice or require repetition of a series of steps before product formation.

Repair of X-ray-induced single-strand breaks by a cell-free system

International Nuclear Information System (INIS)

Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi

1990-01-01

Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

Science.gov (United States)

Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

2018-01-11

The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

Directory of Open Access Journals (Sweden)

Trina Ekawati Tallei

2015-10-01

Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

Structural relationships among the multiple forms of DNA-dependent RNA polymerase II from cultured parsley cells

International Nuclear Information System (INIS)

Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.

1978-01-01

DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

OpenAIRE

Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

2014-01-01

Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

DEFF Research Database (Denmark)

Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

2005-01-01

Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

Home-based step training using videogame technology in people with Parkinson's disease: a single-blinded randomised controlled trial.

Science.gov (United States)

Song, Jooeun; Paul, Serene S; Caetano, Maria Joana D; Smith, Stuart; Dibble, Leland E; Love, Rachelle; Schoene, Daniel; Menant, Jasmine C; Sherrington, Cathie; Lord, Stephen R; Canning, Colleen G; Allen, Natalie E

2018-03-01

To determine whether 12-week home-based exergame step training can improve stepping performance, gait and complementary physical and neuropsychological measures associated with falls in Parkinson's disease. A single-blinded randomised controlled trial. Community (experimental intervention), university laboratory (outcome measures). Sixty community-dwelling people with Parkinson's disease. Home-based step training using videogame technology. The primary outcomes were the choice stepping reaction time test and Functional Gait Assessment. Secondary outcomes included physical and neuropsychological measures associated with falls in Parkinson's disease, number of falls over six months and self-reported mobility and balance. Post intervention, there were no differences between the intervention ( n = 28) and control ( n = 25) groups in the primary or secondary outcomes except for the Timed Up and Go test, where there was a significant difference in favour of the control group ( P = 0.02). Intervention participants reported mobility improvement, whereas control participants reported mobility deterioration-between-group difference on an 11-point scale = 0.9 (95% confidence interval: -1.8 to -0.1, P = 0.03). Interaction effects between intervention and disease severity on physical function measures were observed ( P = 0.01 to P = 0.08) with seemingly positive effects for the low-severity group and potentially negative effects for the high-severity group. Overall, home-based exergame step training was not effective in improving the outcomes assessed. However, the improved physical function in the lower disease severity intervention participants as well as the self-reported improved mobility in the intervention group suggest home-based exergame step training may have benefits for some people with Parkinson's disease.

RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications

Science.gov (United States)

Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong

2016-01-01

Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

Science.gov (United States)

Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

2011-08-01

DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

Identification of constrained peptides that bind to and preferentially inhibit the activity of the hepatitis C viral RNA-dependent RNA polymerase

International Nuclear Information System (INIS)

Amin, Anthony; Zaccardi, Joe; Mullen, Stanley; Olland, Stephane; Orlowski, Mark; Feld, Boris; Labonte, Patrick; Mak, Paul

2003-01-01

A class of disulfide constrained peptides containing a core motif FPWG was identified from a screen of phage displayed library using the HCV RNA-dependent RNA polymerase (NS5B) as a bait. Surface plasmon resonance studies showed that three highly purified synthetic constrained peptides bound to immobilized NS5B with estimated K d values ranging from 30 to 60 μM. In addition, these peptides inhibited the NS5B activity in vitro with IC 50 ranging from 6 to 48 μM, whereas in contrast they had no inhibitory effect on the enzymatic activities of calf thymus polymerase α, human polymerase β, RSV polymerase, and HIV reverse transcriptase in vitro. Two peptides demonstrated conformation-dependent inhibition since their synthetic linear versions were not inhibitory in the NS5B assay. A constrained peptide with the minimum core motif FPWG retained selective inhibition of NS5B activity with an IC 50 of 50 μM. Alanine scan analyses of a representative constrained peptide, FPWGNTW, indicated that residues F1 and W7 were critical for the inhibitory effect of this peptide, although residues P2 and N5 had some measurable inhibitory effect as well. Further analyses of the mechanism of inhibition indicated that these peptides inhibited the formation of preelongation complexes required for the elongation reaction. However, once the preelongation complex was formed, its activity was refractory to peptide inhibition. Furthermore, the constrained peptide FPWGNTW inhibited de novo initiated RNA synthesis by NS5B from a poly(rC) template. These data indicate that the peptides confer selective inhibition of NS5B activity by binding to the enzyme and perturbing an early step preceding the processive elongation step of RNA synthesis

Complex single step skull reconstruction in Gorham's disease - a technical report and review of the literature.

Science.gov (United States)

Ohla, Victoria; Bayoumi, Ahmed B; Hefty, Markus; Anderson, Matthew; Kasper, Ekkehard M

2015-03-11

Gorham's disease is a rare osteolytic disorder characterized by progressive resorption of bone and replacement of osseous matrix by a proliferative non-neoplastic vascular or lymphatic tissue. A standardized treatment protocol has not yet been defined due to the unpredictable natural history of the disease and variable clinical presentations. No single treatment has proven to be superior in arresting the course of the disease. Trials have included surgery, radiation and medical therapies using drugs such as calcium salts, vitamin D supplements and hormones. We report on our advantageous experience in the management of this osteolyic disorder in a case when it affected only the skull vault. A brief review of pertinent literature about Gorham's disease with skull involvement is provided. A 25-year-old Caucasian male presented with a skull depression over the left fronto-temporal region. He noticed progressive enlargement of the skull defect associated with local pain and mild headache. Physical examination revealed a tender palpable depression of the fronto-temporal convexity. Conventional X-ray of the skull showed widespread loss of bone substance. Subsequent CT scans showed features of patchy erosions indicative of an underlying osteolysis. MRI also revealed marginal enhancement at the site of the defect. The patient was in need of a pathological diagnosis as well as complex reconstruction of the afflicted area. A density graded CT scan was done to determine the variable degrees of osteolysis and a custom made allograft was designed for cranioplasty preoperatively to allow for a single step excisional craniectomy with synchronous skull repair. Gorham's disease was diagnosed based on histopathological examination. No neurological deficit or wound complications were reported postoperatively. Over a two-year follow up period, the patient had no evidence of local recurrence or other systemic involvement. A single step excisional craniectomy and cranioplasty can be an

Single-Step Transepithelial PRK vs Alcohol-Assisted PRK in Myopia and Compound Myopic Astigmatism Correction.

Science.gov (United States)

Kaluzny, Bartlomiej J; Cieslinska, Iwona; Mosquera, Samuel A; Verma, Shwetabh

2016-02-01

Transepithelial photorefractive keratectomy (tPRK), where both the epithelium and stroma are removed in a single-step, is a relatively new procedure of laser refractive error correction. This study compares the 3-month results of myopia and compound myopic astigmatism correction by tPRK or conventional alcohol-assisted PRK (aaPRK).This prospective, nonrandomized, case-control study recruited 148 consecutive patients; 93 underwent tPRK (173 eyes) and 55 aaPRK (103 eyes). Refractive results, predictability, safety, and efficacy were evaluated during the 3-month follow-up. The main outcome measures were uncorrected distance visual acuity (UDVA), corrected distance visual acuity (CDVA), and mean refractive spherical equivalent (MRSE).Mean preoperative MRSE was -4.30 ± 1.72 D and -4.33 ± 1.96 D, respectively (P = 0.87). The 3-month follow-up rate was 82.1% in the tPRK group (n = 145) and 86.4% in aaPRK group (n = 90), P = 0.81. Postoperative UDVA was 20/20 or better in 97% and 94% of eyes, respectively (P = 0.45). In the tPRK and aaPRK groups, respectively, 13% and 21% of eyes lost 1 line of CDVA, and 30% and 31% gained 1 or 2 lines (P = 0.48). Mean postoperative MRSE was -0.14 ± 0.26 D in the tPRK group and -0.12 ± 0.20 D in the aaPRK group (P = 0.9). The correlation between attempted versus achieved MRSE was equally high in both groups.Single-step transepithelial PRK and conventional PRK provide very similar results 3 months postoperatively. These procedures are predictable, effective, and safe for correction of myopia and compound myopic astigmatism.

Well-Defined Silica Supported Aluminum Hydride: Another Step Towards the Utopian Single Site Dream?

KAUST Repository

Werghi, Baraa; Bendjeriou-Sedjerari, Anissa; Sofack-Kreutzer, Julien; Jedidi, Abdesslem; Abou-Hamad, Edy; Cavallo, Luigi; Basset, Jean-Marie

2015-01-01

Reaction of triisobutylaluminum with SBA15700 at room temperature occurs by two parallel pathways involving either silanol or siloxane bridges. It leads to the formation of a well-defined bipodal [(≡SiO)2Al-CH2CH(CH3)2] 1a, silicon isobutyl [≡Si-CH2CH(CH3)2] 1b and a silicon hydride [≡Si-H] 1c. Their structural identity was characterized by FT-IR and advance solid-state NMR spectroscopies (1H, 13C, 29Si, 27Al and 2D multiple quantum), elemental and gas phase analysis, and DFT calculations. The reaction involves the formation of a highly reactive monopodal intermediate: [≡SiO-Al-[CH2CH(CH3)2]2], with evolution of isobutane. This intermediate undergoes two parallel routes: Transfer of either one isobutyl fragment or of one hydride to an adjacent silicon atom. Both processes occur by opening of a strained siloxane bridge, ≡Si-O-Si≡ but with two different mechanisms, showing that the reality of “single site” catalyst may be an utopia: DFT calculations indicate that isobutyl transfer occurs via a simple metathesis between the Al-isobutyl and O-Si bonds, while hydride transfer occurs via a two steps mechanism, the first one is a ß-H elimination to Al with elimination of isobutene, whereas the second is a metathesis step between the formed Al-H bond and a O-Si bond. Thermal treatment of 1a (at 250 °C) under high vacuum (10-5 mbar) generates Al-H through a ß-H elimination of isobutyl fragment. These supported well-defined Al-H which are highly stable with time, are tetra, penta and octa coordinated as demonstrated by IR and 27Al–1H J-HMQC NMR spectroscopy. All these observations indicate that surfaces atoms around the site of grafting play a considerable role in the reactivity of a single site system.

Well-Defined Silica Supported Aluminum Hydride: Another Step Towards the Utopian Single Site Dream?

KAUST Repository

Werghi, Baraa

2015-07-17

Reaction of triisobutylaluminum with SBA15700 at room temperature occurs by two parallel pathways involving either silanol or siloxane bridges. It leads to the formation of a well-defined bipodal [(≡SiO)2Al-CH2CH(CH3)2] 1a, silicon isobutyl [≡Si-CH2CH(CH3)2] 1b and a silicon hydride [≡Si-H] 1c. Their structural identity was characterized by FT-IR and advance solid-state NMR spectroscopies (1H, 13C, 29Si, 27Al and 2D multiple quantum), elemental and gas phase analysis, and DFT calculations. The reaction involves the formation of a highly reactive monopodal intermediate: [≡SiO-Al-[CH2CH(CH3)2]2], with evolution of isobutane. This intermediate undergoes two parallel routes: Transfer of either one isobutyl fragment or of one hydride to an adjacent silicon atom. Both processes occur by opening of a strained siloxane bridge, ≡Si-O-Si≡ but with two different mechanisms, showing that the reality of “single site” catalyst may be an utopia: DFT calculations indicate that isobutyl transfer occurs via a simple metathesis between the Al-isobutyl and O-Si bonds, while hydride transfer occurs via a two steps mechanism, the first one is a ß-H elimination to Al with elimination of isobutene, whereas the second is a metathesis step between the formed Al-H bond and a O-Si bond. Thermal treatment of 1a (at 250 °C) under high vacuum (10-5 mbar) generates Al-H through a ß-H elimination of isobutyl fragment. These supported well-defined Al-H which are highly stable with time, are tetra, penta and octa coordinated as demonstrated by IR and 27Al–1H J-HMQC NMR spectroscopy. All these observations indicate that surfaces atoms around the site of grafting play a considerable role in the reactivity of a single site system.

Single step synthesis of GdAlO3 powder

International Nuclear Information System (INIS)

Sinha, Amit; Nair, S.R.; Sinha, P.K.

2011-01-01

Research highlights: → First report on direct formation of GdAlO 3 powder using a novel combustion process. → Study of combustion characteristics of Gd(NO 3 ) 3 and Al(NO 3 ) 3 towards three fuels. → Preparation of highly sinterable GdAlO 3 powders through fuel-mixture approach. → Significant reduction in energy consumption for production of GdAlO 3 sintered body. - Abstract: A novel method for preparation of nano-crystalline gadolinium aluminate (GdAlO 3 ) powder, based on combustion synthesis, is reported. It was observed that aluminium nitrate and gadolinium nitrate exhibit different combustion characteristics with respect to urea, glycine and β-alanine. While urea was proven to be a suitable fuel for direct formation of crystalline α-Al 2 O 3 from its nitrate, glycine and β-alanine are suitable fuels for gadolinium nitrate for preparation of its oxide after combustion reaction. Based on the observed chemical characteristics of gadolinium and aluminium nitrates with respect to above mentioned fuels for the combustion reaction, the fuel mixture composition could be predicted that could lead to phase pure perovskite GdAlO 3 directly after the combustion reaction without any subsequent calcination step. The use of single fuel, on the other hand, leads to formation of amorphous precursor powders that call for subsequent calcination for the formation of crystalline GdAlO 3 . The powders produced directly after combustion reactions using fuel mixtures were found to be highly sinterable. The sintering of the powders at 1550 o C for 4 h resulted in GdAlO 3 with sintered density of more than 95%. T.D.

Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

NARCIS (Netherlands)

Vens, C.; Hofland, I.; Begg, A.C.

2007-01-01

Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

Enhancement of DNA polymerase activity in potato tuber slices

International Nuclear Information System (INIS)

Watanabe, Akira; Imaseki, Hidemasa

1977-01-01

DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)

A Renormalisation Group Method. V. A Single Renormalisation Group Step

Science.gov (United States)

Brydges, David C.; Slade, Gordon

2015-05-01

This paper is the fifth in a series devoted to the development of a rigorous renormalisation group method applicable to lattice field theories containing boson and/or fermion fields, and comprises the core of the method. In the renormalisation group method, increasingly large scales are studied in a progressive manner, with an interaction parametrised by a field polynomial which evolves with the scale under the renormalisation group map. In our context, the progressive analysis is performed via a finite-range covariance decomposition. Perturbative calculations are used to track the flow of the coupling constants of the evolving polynomial, but on their own perturbative calculations are insufficient to control error terms and to obtain mathematically rigorous results. In this paper, we define an additional non-perturbative coordinate, which together with the flow of coupling constants defines the complete evolution of the renormalisation group map. We specify conditions under which the non-perturbative coordinate is contractive under a single renormalisation group step. Our framework is essentially combinatorial, but its implementation relies on analytic results developed earlier in the series of papers. The results of this paper are applied elsewhere to analyse the critical behaviour of the 4-dimensional continuous-time weakly self-avoiding walk and of the 4-dimensional -component model. In particular, the existence of a logarithmic correction to mean-field scaling for the susceptibility can be proved for both models, together with other facts about critical exponents and critical behaviour.

Evaluating tamsulosin hydrochloride-released microparticles prepared using single-step matrix coating.

Science.gov (United States)

Maeda, Atsushi; Shinoda, Tatsuki; Ito, Naoki; Baba, Keizo; Oku, Naoto; Mizumoto, Takao

2011-04-15

The objective of the present study was to determine the optimum composition for sustained-release of tamsulosin hydrochloride from microparticles intended for orally disintegrating tablets. Microparticles were prepared from an aqueous ethylcellulose dispersion (Aquacoa®), and an aqueous copolymer based on ethyl acrylate and methyl methacrylate dispersion (Eudragit®) NE30D), with microcrystalline cellulose as core particles with a fluidized bed coating process. Prepared microparticles were about 200 μm diameter and spherical. The microparticles were evaluated for in vitro drug release and in vivo absorption to assess bioequivalence in a commercial product, Harnal® pellets. The optimum ratio of Aquacoat® and Eudragit® NE30D in the matrix was 9:1. We observed similar drug release profiles in microparticles and Harnal® pellets. Higuchi model analysis of the in vitro drug release from microparticles was linear up to 80% release, typical of Fickian diffusion sustained-release profile. The in vivo absorption properties from microparticles were comparable to Harnal® pellets, and there was a linear relationship between in vitro drug release and in vivo drug release. In conclusion, this development produces microparticles in single-step coating, that provided a sustained-release of tamsulosin hydrochloride comparable to Harnal® pellets. Copyright © 2011 Elsevier B.V. All rights reserved.

The effect of a cognitive-motor intervention on voluntary step execution under single and dual task conditions in older adults: a randomized controlled pilot study

Directory of Open Access Journals (Sweden)

Pichierri G

2012-07-01

Full Text Available Giuseppe Pichierri,1 Amos Coppe,1 Silvio Lorenzetti,2 Kurt Murer,1 Eling D de Bruin11Institute of Human Movement Sciences and Sport, Department of Health Sciences and Technology, ETH Zurich, Switzerland; 2Institute for Biomechanics, Department of Health Sciences and Technology, ETH Zurich, SwitzerlandBackground: This randomized controlled pilot study aimed to explore whether a cognitive-motor exercise program that combines traditional physical exercise with dance video gaming can improve the voluntary stepping responses of older adults under attention demanding dual task conditions.Methods: Elderly subjects received twice weekly cognitive-motor exercise that included progressive strength and balance training supplemented by dance video gaming for 12 weeks (intervention group. The control group received no specific intervention. Voluntary step execution under single and dual task conditions was recorded at baseline and post intervention (Week 12.Results: After intervention between-group comparison revealed significant differences for initiation time of forward steps under dual task conditions (U = 9, P = 0.034, r = 0.55 and backward steps under dual task conditions (U = 10, P = 0.045, r = 0.52 in favor of the intervention group, showing altered stepping levels in the intervention group compared to the control group.Conclusion: A cognitive-motor intervention based on strength and balance exercises with additional dance video gaming is able to improve voluntary step execution under both single and dual task conditions in older adults.Keywords: fall prevention, exercise, dance, video game

DNA Polymerase Fidelity: Beyond Right and Wrong.

Science.gov (United States)

Washington, M Todd

2016-11-01

Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

Science.gov (United States)

Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

2018-02-15

Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

Competition between replicative and translesion polymerases during homologous recombination repair in Drosophila.

Directory of Open Access Journals (Sweden)

Daniel P Kane

Full Text Available In metazoans, the mechanism by which DNA is synthesized during homologous recombination repair of double-strand breaks is poorly understood. Specifically, the identities of the polymerase(s that carry out repair synthesis and how they are recruited to repair sites are unclear. Here, we have investigated the roles of several different polymerases during homologous recombination repair in Drosophila melanogaster. Using a gap repair assay, we found that homologous recombination is impaired in Drosophila lacking DNA polymerase zeta and, to a lesser extent, polymerase eta. In addition, the Pol32 protein, part of the polymerase delta complex, is needed for repair requiring extensive synthesis. Loss of Rev1, which interacts with multiple translesion polymerases, results in increased synthesis during gap repair. Together, our findings support a model in which translesion polymerases and the polymerase delta complex compete during homologous recombination repair. In addition, they establish Rev1 as a crucial factor that regulates the extent of repair synthesis.

The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.

Science.gov (United States)

Jeronimo, Célia; Robert, François

2017-10-01

Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.

Bioconversion of starch to ethanol in a single-step process by coculture of amylolytic yeasts and Saccharomyces cerevisiae 21

Energy Technology Data Exchange (ETDEWEB)

Verma, G.; Singh, D.; Chaudhary, K. [CCS Haryana Agricultural Univ., Hisar (India). Dept. of Biotechnology and Molecular Biology; Nigam, P. [Ulster Univ., Coleraine, Northern Ireland (United Kingdom). School of Applied Biological and Chemical Sciences

2000-05-01

Ethanol production by a coculture of Saccharomyces diastaticus and Saccharomyces cerevisiae 21 was 24.8 g/l using raw unhydrolysed starch in a single-step fermentation. This was 48% higher than the yield obtained with the monoculture of S. diastaticus (16.8 g/l). The maximum ethanol fermentation efficiency was achieved (93% of the theoretical value) using 60 g/l starch concentration. In another coculture fermentation with E. capsularis and S. cerevisiae 21, maximum ethanol yield was 16.0 g/l, higher than the yield with the monoculture of Endomycopsis capsularis. In batch fermentations using cocultures maximum ethanol production occurred in 48 h of fermentation at 30{sup o}C using 60 g/l starch. Fermentation efficiency was found lower in a two-step process using {alpha}-amylase and glucoamylase-treated starch. (Author)

Single banking supervision and the single supervisory mechanism

Directory of Open Access Journals (Sweden)

Gheorghe, C. A.

2013-06-01

Full Text Available A resolution seems to have been found for the banking crisis. The first steps have been made towards the construction of the Economic and Monetary Union, steps involving the single supervision of banks, in order to avoid the discount of a new financial crisis on the expense of the EU state members. The Single Supervisory Mechanism – SSM is to become effective as of March 1, 2014, at the earliest.

A direct, single-step plasma arc-vitreous ceramic process for stabilizing spent nuclear fuels, sludges, and associated wastes

International Nuclear Information System (INIS)

Feng, X.; Einziger, R.E.; Eschenbach, R.C.

1997-01-01

A single-step plasma arc-vitreous ceramic (PAVC) process is described for converting spent nuclear fuel (SNF), SNF sludges, and associated wastes into a vitreous ceramic waste form. This proposed technology is built on extensive experience of nuclear waste form development and nuclear waste treatment using the commercially available plasma arc centrifugal (PAC) system. SNF elements will be loaded directly into a PAC furnace with minimum additives and converted into vitreous ceramics with up to 90 wt% waste loading. The vitreous ceramic waste form should meet the functional requirements for borosilicate glasses for permanent disposal in a geologic repository and for interim storage. Criticality safety would be ensured through the use of batch modes, and controlling the amount of fuel processed in one batch. The minimum requirements on SNF characterization and pretreatment, the one-step process, and minimum secondary waste generation may reduce treatment duration, radiation exposure, and treatment cost

The Effect of Phosphoric Acid Pre-etching Times on Bonding Performance and Surface Free Energy with Single-step Self-etch Adhesives.

Science.gov (United States)

Tsujimoto, A; Barkmeier, W W; Takamizawa, T; Latta, M A; Miyazaki, M

2016-01-01

The purpose of this study was to evaluate the effect of phosphoric acid pre-etching times on shear bond strength (SBS) and surface free energy (SFE) with single-step self-etch adhesives. The three single-step self-etch adhesives used were: 1) Scotchbond Universal Adhesive (3M ESPE), 2) Clearfil tri-S Bond (Kuraray Noritake Dental), and 3) G-Bond Plus (GC). Two no pre-etching groups, 1) untreated enamel and 2) enamel surfaces after ultrasonic cleaning with distilled water for 30 seconds to remove the smear layer, were prepared. There were four pre-etching groups: 1) enamel surfaces were pre-etched with phosphoric acid (Etchant, 3M ESPE) for 3 seconds, 2) enamel surfaces were pre-etched for 5 seconds, 3) enamel surfaces were pre-etched for 10 seconds, and 4) enamel surfaces were pre-etched for 15 seconds. Resin composite was bonded to the treated enamel surface to determine SBS. The SFEs of treated enamel surfaces were determined by measuring the contact angles of three test liquids. Scanning electron microscopy was used to examine the enamel surfaces and enamel-adhesive interface. The specimens with phosphoric acid pre-etching showed significantly higher SBS and SFEs than the specimens without phosphoric acid pre-etching regardless of the adhesive system used. SBS and SFEs did not increase for phosphoric acid pre-etching times over 3 seconds. There were no significant differences in SBS and SFEs between the specimens with and without a smear layer. The data suggest that phosphoric acid pre-etching of ground enamel improves the bonding performance of single-step self-etch adhesives, but these bonding properties do not increase for phosphoric acid pre-etching times over 3 seconds.

Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Xia, Shuangluo; Beckman, Jeff; Wang, Jimin; Konigsberg, William H. (Yale)

2012-10-10

Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystal structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.

Effect of γ-irradiated DNA on the activity of DNA polymerase

International Nuclear Information System (INIS)

Leadon, S.A.; Ward, J.F.

1981-01-01

A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

Directory of Open Access Journals (Sweden)

Hirokazu Takahashi

Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae

Energy Technology Data Exchange (ETDEWEB)

Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)

2013-02-08

Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.

Single-molecule spectroscopy of amino acids and peptides by recognition tunnelling

Science.gov (United States)

Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, Jongone; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart

2014-06-01

The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single-molecule protein sequencing is a critical step in the search for protein biomarkers. Here, we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules, then measuring the electron tunnelling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic `fingerprints' associated with each binding motif. With this recognition tunnelling technique, we are able to identify D and L enantiomers, a methylated amino acid, isobaric isomers and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore.

A rapid, ratiometric, enzyme-free, and sensitive single-step miRNA detection using three-way junction based FRET probes

Science.gov (United States)

Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen

2018-03-01

MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.

A high-yield, one-step synthesis of surfactant-free gold nanostars and numerical study for single-molecule SERS application

Energy Technology Data Exchange (ETDEWEB)

Chatterjee, S.; Ringane, A. B.; Arya, A.; Das, G. M.; Dantham, V. R., E-mail: dantham@iitp.ac.in; Laha, R. [Indian Institute of Technology Patna, Department of Physics (India); Hussian, S. [Indian Institute of Technology Patna, Department of Chemistry (India)

2016-08-15

We report a high-yield synthesis of star-shaped gold nanostructures in one step, using a new surfactant-free wet chemistry method. Compared to the existing reports, these nanostars were found to have longer and sharper spikes anchored uniformly on the surface of the spherical core, allowing at least a few hot spots irrespective of the incident light polarization. The average experimental values of core radius and spike length were found to be 88.5 and 72 nm, respectively. Using these values in numerical simulations, the local electric field enhancement (η) and localized surface plasmon resonance (LSPR) spectrum were obtained. Moreover, the single-molecule surface-enhanced Raman scattering (SERS) enhancement factor was found to vary from 10{sup 10} to 10{sup 13} depending on the excitation wavelengths. Our theoretical calculations suggest that these nanostructures can be used to fabricate efficient SERS-based biosensors for the detection of single molecules in real time and for predicting structural information of single molecules.

Thin film complementary metal oxide semiconductor (CMOS) device using a single-step deposition of the channel layer

KAUST Repository

Nayak, Pradipta K.

2014-04-14

We report, for the first time, the use of a single step deposition of semiconductor channel layer to simultaneously achieve both n-and p-type transport in transparent oxide thin film transistors (TFTs). This effect is achieved by controlling the concentration of hydroxyl groups (OH-groups) in the underlying gate dielectrics. The semiconducting tin oxide layer was deposited at room temperature, and the maximum device fabrication temperature was 350C. Both n and p-type TFTs showed fairly comparable performance. A functional CMOS inverter was fabricated using this novel scheme, indicating the potential use of our approach for various practical applications.

Single step biotransformation of corn oil phytosterols to boldenone by a newly isolated Pseudomonas aeruginosa

Directory of Open Access Journals (Sweden)

Mohamed Eisa

2016-09-01

Full Text Available A new potent Pseudomonas aeruginosa isolate capable for biotransformation of corn oil phytosterol (PS to 4-androstene-3, 17-dione (AD, testosterone (T and boldenone (BOL was identified by phenotypic analysis and 16S rRNA gene sequencing. Sequential statistical strategy was used to optimize the biotransformation process mainly concerning BOL using Factorial design and response surface methodology (RSM. The production of BOL in single step microbial biotransformation from corn oil phytosterols by P. aeruginosa was not previously reported. Results showed that the pH concentration of the medium, (NH42SO4 and KH2PO4 were the most significant factors affecting BOL production. By analyzing the statistical model of three-dimensional surface plot, BOL production increased from 36.8% to 42.4% after the first step of optimization, and the overall biotransformation increased to 51.9%. After applying the second step of the sequential statistical strategy BOL production increased to 53.6%, and the overall biotransformation increased to 91.9% using the following optimized medium composition (g/l distilled water (NH42SO4, 2; KH2PO4, 4; Na2HPO4. 1; MgSO4·7H2O, 0.3; NaCl, 0.1; CaCl2·2H2O, 0.1; FeSO4·7H2O, 0.001; ammonium acetate 0.001; Tween 80, 0.05%; corn oil 0.5%; 8-hydroxyquinoline 0.016; pH 8; 200 rpm agitation speed and incubation time 36 h at 30 °C. Validation experiments proved the adequacy and accuracy of model, and the results showed the predicted value agreed well with the experimental values.

Changes in step-width during dual-task walking predicts falls.

Science.gov (United States)

Nordin, E; Moe-Nilssen, R; Ramnemark, A; Lundin-Olsson, L

2010-05-01

The aim was to evaluate whether gait pattern changes between single- and dual-task conditions were associated with risk of falling in older people. Dual-task cost (DTC) of 230 community living, physically independent people, 75 years or older, was determined with an electronic walkway. Participants were followed up each month for 1 year to record falls. Mean and variability measures of gait characteristics for 5 dual-task conditions were compared to single-task walking for each participant. Almost half (48%) of the participants fell at least once during follow-up. Risk of falling increased in individuals where DTC for performing a subtraction task demonstrated change in mean step-width compared to single-task walking. Risk of falling decreased in individuals where DTC for carrying a cup and saucer demonstrated change compared to single-task walking in mean step-width, mean step-time, and step-length variability. Degree of change in gait characteristics related to a change in risk of falling differed between measures. Prognostic guidance for fall risk was found for the above DTCs in mean step-width with a negative likelihood ratio of 0.5 and a positive likelihood ratio of 2.3, respectively. Findings suggest that changes in step-width, step-time, and step-length with dual tasking may be related to future risk of falling. Depending on the nature of the second task, DTC may indicate either an increased risk of falling, or a protective strategy to avoid falling. Copyright 2010. Published by Elsevier B.V.

Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

Science.gov (United States)

Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N

2004-07-16

A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.

Science.gov (United States)

Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun

2018-02-19

DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.

Promotion of the oxidation of carbon monoxide at stepped platinum single-crystal electrodes in alkaline media by lithium and beryllium cations.

Science.gov (United States)

Stoffelsma, Chantal; Rodriguez, Paramaconi; Garcia, Gonzalo; Garcia-Araez, Nuria; Strmcnik, Dusan; Marković, Nenad M; Koper, Marc T M

2010-11-17

The role of alkali cations (Li(+), Na(+), K(+), Cs(+), and Be(2+)) on the blank voltammetric response and the oxidative stripping of carbon monoxide from stepped Pt single-crystal electrodes in alkaline media has been investigated by cyclic voltammetry. A strong influence of the nature of the cation on both the blank voltammetric profile and the CO oxidation is observed and related to the influence of the cation on the specific adsorption of OH on the platinum surface. Especially Li(+) and Be(2+) cations markedly affect the adsorption of OH and thereby have a significant promoting effect on CO(ads) oxidation. The voltammetric experiments suggest that, on Pt(111), the influence of Li(+) (and Be(2+)) is primarily through a weakening of the repulsive interactions between the OH in the OH adlayer, whereas in the presence of steps also, the onset of OH adsorption is at a lower potential, both on steps and on terraces.

CDK9-dependent RNA polymerase II pausing controls transcription initiation.

Science.gov (United States)

Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

2017-10-10

Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

A simple method for encapsulating single cells in alginate microspheres allows for direct PCR and whole genome amplification.

Directory of Open Access Journals (Sweden)

Saharnaz Bigdeli

Full Text Available Microdroplets are an effective platform for segregating individual cells and amplifying DNA. However, a key challenge is to recover the contents of individual droplets for downstream analysis. This paper offers a method for embedding cells in alginate microspheres and performing multiple serial operations on the isolated cells. Rhodobacter sphaeroides cells were diluted in alginate polymer and sprayed into microdroplets using a fingertip aerosol sprayer. The encapsulated cells were lysed and subjected either to conventional PCR, or whole genome amplification using either multiple displacement amplification (MDA or a two-step PCR protocol. Microscopic examination after PCR showed that the lumen of the occupied microspheres contained fluorescently stained DNA product, but multiple displacement amplification with phi29 produced only a small number of polymerase colonies. The 2-step WGA protocol was successful in generating fluorescent material, and quantitative PCR from DNA extracted from aliquots of microspheres suggested that the copy number inside the microspheres was amplified up to 3 orders of magnitude. Microspheres containing fluorescent material were sorted by a dilution series and screened with a fluorescent plate reader to identify single microspheres. The DNA was extracted from individual isolates, re-amplified with full-length sequencing adapters, and then a single isolate was sequenced using the Illumina MiSeq platform. After filtering the reads, the only sequences that collectively matched a genome in the NCBI nucleotide database belonged to R. sphaeroides. This demonstrated that sequencing-ready DNA could be generated from the contents of a single microsphere without culturing. However, the 2-step WGA strategy showed limitations in terms of low genome coverage and an uneven frequency distribution of reads across the genome. This paper offers a simple method for embedding cells in alginate microspheres and performing PCR on isolated

Kinematic Differences During Single-Leg Step-Down Between Individuals With Femoroacetabular Impingement Syndrome and Individuals Without Hip Pain.

Science.gov (United States)

Lewis, Cara L; Loverro, Kari L; Khuu, Anne

2018-04-01

Study Design Controlled laboratory study, case-control design. Background Despite recognition that femoroacetabular impingement syndrome (FAIS) is a movement-related disorder, few studies have examined dynamic unilateral tasks in individuals with FAIS. Objectives To determine whether movements of the pelvis and lower extremities in individuals with FAIS differ from those in individuals without hip pain during a single-leg step-down, and to analyze kinematic differences between male and female participants within groups. Methods Individuals with FAIS and individuals without hip pain performed a single-leg step-down while kinematic data were collected. Kinematics were evaluated at 60° of knee flexion. A linear regression analysis assessed the main effects of group, sex, and side, and the interaction of sex by group. Results Twenty individuals with FAIS and 40 individuals without hip pain participated. Individuals with FAIS performed the step-down with greater hip flexion (4.9°; 95% confidence interval [CI]: 0.5°, 9.2°) and anterior pelvic tilt (4.1°; 95% CI: 0.9°, 7.3°) than individuals without hip pain. Across groups, female participants performed the task with more hip flexion (6.1°; 95% CI: 1.7°, 10.4°), hip adduction (4.8°; 95% CI: 2.2°, 7.4°), anterior pelvic tilt (5.8°; 95% CI: 2.6°, 9.0°), pelvic drop (1.4°; 95% CI: 0.3°, 2.5°), and thigh adduction (2.7°; 95% CI: 1.3°, 4.2°) than male participants. Conclusion The results of this study suggest that individuals with FAIS have alterations in pelvic motion during a dynamic unilateral task. The noted altered movement patterns in the FAIS group may contribute to the development of hip pain and may be due to impairments that are modifiable through rehabilitation. J Orthop Sports Phys Ther 2018;48(4):270-279. Epub 6 Mar 2018. doi:10.2519/jospt.2018.7794.

File list: Pol.Dig.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.10.RNA_polymerase_II.AllCell.bed ...

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

File list: Pol.Neu.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Neu.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Neural ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Muscle SR.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Oth.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.ALL.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II All cell ...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Brs.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Breast ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Embryo ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Emb.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Emb.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Epd.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Epidermis... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Epd.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Spl.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Spl.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Spleen ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Oth.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Brs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Oth.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Oth.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Emb.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Neu.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Neu.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Neural... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Bld.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Bld.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Blood h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.CDV.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Adp.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Adipocy...te http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Gon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.CDV.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Unc.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Bld.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bld.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.50.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Emb.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.50.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Embryo h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.CDV.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Bon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Gon.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Gon.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Pancrea...s http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Pan.10.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Bon.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Bone ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bon.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Adp.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Adp.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adp.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Prs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.CDV.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Myo.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Bon.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Myo.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Myo.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Bon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.CDV.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Prs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lng.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.05.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Pup.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pup.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Brs.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Brs.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Breast SR...078990 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Pup.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pup.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Kid.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Kid.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Dig.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Liv.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Liv.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Pan.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Kid.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Pan.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Pan.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Kid.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Kid.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Emb.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043869 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Epd.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.PSC.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.50.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.PSC.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Epd.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Unclassif...ied SRX110774 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.PSC.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Bon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043866 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.PSC.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Bon.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Bon.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.YSt.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.YSt.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Yeast... strain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Epd.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

A Double Polymerase Chain Reaction Method for Detecting African ...

African Journals Online (AJOL)

Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

Single step thermal decomposition approach to prepare supported γ-Fe2O3 nanoparticles

International Nuclear Information System (INIS)

Sharma, Geetu; Jeevanandam, P.

2012-01-01

γ-Fe 2 O 3 nanoparticles supported on MgO (macro-crystalline and nanocrystalline) were prepared by an easy single step thermal decomposition method. Thermal decomposition of iron acetylacetonate in diphenyl ether, in the presence of the supports followed by calcination, leads to iron oxide nanoparticles supported on MgO. The X-ray diffraction results indicate the stability of γ-Fe 2 O 3 phase on MgO (macro-crystalline and nanocrystalline) up to 1150 °C. The scanning electron microscopy images show that the supported iron oxide nanoparticles are agglomerated while the energy dispersive X-ray analysis indicates the presence of iron, magnesium and oxygen in the samples. Transmission electron microscopy images indicate the presence of smaller γ-Fe 2 O 3 nanoparticles on nanocrystalline MgO. The magnetic properties of the supported magnetic nanoparticles at various calcination temperatures (350-1150 °C) were studied using a superconducting quantum interference device which indicates superparamagnetic behavior.

Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

Science.gov (United States)

Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

2014-07-15

In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

Error-prone bypass of O6-methylguanine by DNA polymerase of Pseudomonas aeruginosa phage PaP1.

Science.gov (United States)

Gu, Shiling; Xiong, Jingyuan; Shi, Ying; You, Jia; Zou, Zhenyu; Liu, Xiaoying; Zhang, Huidong

2017-09-01

O 6 -Methylguanine (O 6 -MeG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, generally leads to G:C to A:T mutagenesis. To study DNA replication encountering O 6 -MeG by the DNA polymerase (gp90) of P. aeruginosa phage PaP1, we analyzed steady-state and pre-steady-state kinetics of nucleotide incorporation opposite O 6 -MeG by gp90 exo - . O 6 -MeG partially inhibited full-length extension by gp90 exo - . O 6 -MeG greatly reduces dNTP incorporation efficiency, resulting in 67-fold preferential error-prone incorporation of dTTP than dCTP. Gp90 exo - extends beyond T:O 6 -MeG 2-fold more efficiently than C:O 6 -MeG. Incorporation of dCTP opposite G and incorporation of dCTP or dTTP opposite O 6 -MeG show fast burst phases. The pre-steady-state incorporation efficiency (k pol /K d,dNTP ) is decreased in the order of dCTP:G>dTTP:O 6 -MeG>dCTP:O 6 -MeG. The presence of O 6 -MeG at template does not affect the binding affinity of polymerase to DNA but it weakened their binding in the presence of dCTP and Mg 2+ . Misincorporation of dTTP opposite O 6 -MeG further weakens the binding affinity of polymerase to DNA. The priority of dTTP incorporation opposite O 6 -MeG is originated from the fact that dTTP can induce a faster conformational change step and a faster chemical step than dCTP. This study reveals that gp90 bypasses O 6 -MeG in an error-prone manner and provides further understanding in DNA replication encountering mutagenic alkylation DNA damage for P. aeruginosa phage PaP1. Copyright © 2017 Elsevier B.V. All rights reserved.

File list: Pol.Epd.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...247,SRX080162,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Utr.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Utr.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX018606,SRX017002,SRX017001 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Neu.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Neu.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Neural SR...,SRX685285,SRX217736 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.ALL.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.ALL.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.50.RNA_Polymerase_III.AllCell.bed ...

File list: Pol.Adl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adl.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Adult SR...SRX1388757,SRX1388756 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Epd.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...246,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Dig.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Dig.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Digestive... tract SRX112957,SRX143802 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.20.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Epd.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...248,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Utr.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Utr.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Prs.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...932,SRX020922,SRX022582 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.PSC.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...670820,SRX702057,SRX702061 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Prs.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...866,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Prs.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...363,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Epd.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Epd.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...245,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.PSC.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.PSC.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...833412,SRX149642,SRX702059 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Prs.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Prs.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...557,SRX173197,SRX173198 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.20.RNA_polymerase_II.AllCell.bed ...

File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Utr.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Utr.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Adl.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adl.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX331268,SRX331270,SRX395531 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

Electron diffraction of CBr{sub 4} in superfluid helium droplets: A step towards single molecule diffraction

Energy Technology Data Exchange (ETDEWEB)

He, Yunteng; Zhang, Jie; Kong, Wei, E-mail: wei.kong@oregonstate.edu [Department of Chemistry, Oregon State University, Corvallis, Oregon 97331-4003 (United States)

2016-07-21

We demonstrate the practicality of electron diffraction of single molecules inside superfluid helium droplets using CBr{sub 4} as a testing case. By reducing the background from pure undoped droplets via multiple doping, with small corrections for dimers and trimers, clearly resolved diffraction rings of CBr{sub 4} similar to those of gas phase molecules can be observed. The experimental data from CBr{sub 4} doped droplets are in agreement with both theoretical calculations and with experimental results of gaseous species. The abundance of monomers and clusters in the droplet beam also qualitatively agrees with the Poisson statistics. Possible extensions of this approach to macromolecular ions will also be discussed. This result marks the first step in building a molecular goniometer using superfluid helium droplet cooling and field induced orientation. The superior cooling effect of helium droplets is ideal for field induced orientation, but the diffraction background from helium is a concern. This work addresses this background issue and identifies a possible solution. Accumulation of diffraction images only becomes meaningful when all images are produced from molecules oriented in the same direction, and hence a molecular goniometer is a crucial technology for serial diffraction of single molecules.

Comparison of step-by-step kinematics of resisted, assisted and unloaded 20-m sprint runs.

Science.gov (United States)

van den Tillaar, Roland; Gamble, Paul

2018-03-26

This investigation examined step-by-step kinematics of sprint running acceleration. Using a randomised counterbalanced approach, 37 female team handball players (age 17.8 ± 1.6 years, body mass 69.6 ± 9.1 kg, height 1.74 ± 0.06 m) performed resisted, assisted and unloaded 20-m sprints within a single session. 20-m sprint times and step velocity, as well as step length, step frequency, contact and flight times of each step were evaluated for each condition with a laser gun and an infrared mat. Almost all measured parameters were altered for each step under the resisted and assisted sprint conditions (η 2  ≥ 0.28). The exception was step frequency, which did not differ between assisted and normal sprints. Contact time, flight time and step frequency at almost each step were different between 'fast' vs. 'slow' sub-groups (η 2  ≥ 0.22). Nevertheless overall both groups responded similarly to the respective sprint conditions. No significant differences in step length were observed between groups for the respective condition. It is possible that continued exposure to assisted sprinting might allow the female team-sports players studied to adapt their coordination to the 'over-speed' condition and increase step frequency. It is notable that step-by-step kinematics in these sprints were easy to obtain using relatively inexpensive equipment with possibilities of direct feedback.

File list: Pol.CDV.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.CDV.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX080152,SRX080153,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Lng.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lng.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX1...43816,SRX062976,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.10.RNA_Polymerase_II.AllCell.bed ...

File list: Pol.Adl.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Adl.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Spl.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)