WorldWideScience

Sample records for single step polymerase

  1. How to switch the motor on: RNA polymerase initiation steps at the single-molecule level

    Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.

    RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes

  2. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Manjula Pandey

    2014-03-01

    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  3. Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase.

    Melissis, S; Labrou, N E; Clonis, Y D

    2006-07-28

    The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

  4. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  5. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

    Sharma, Ajeet K; Chowdhury, Debashish

    2013-01-01

    A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

  7. Considering dominance in reduced single-step genomic evaluations.

    Ertl, J; Edel, C; Pimentel, E C G; Emmerling, R; Götz, K-U

    2018-06-01

    Single-step models including dominance can be an enormous computational task and can even be prohibitive for practical application. In this study, we try to answer the question whether a reduced single-step model is able to estimate breeding values of bulls and breeding values, dominance deviations and total genetic values of cows with acceptable quality. Genetic values and phenotypes were simulated (500 repetitions) for a small Fleckvieh pedigree consisting of 371 bulls (180 thereof genotyped) and 553 cows (40 thereof genotyped). This pedigree was virtually extended for 2,407 non-genotyped daughters. Genetic values were estimated with the single-step model and with different reduced single-step models. Including more relatives of genotyped cows in the reduced single-step model resulted in a better agreement of results with the single-step model. Accuracies of genetic values were largest with single-step and smallest with reduced single-step when only the cows genotyped were modelled. The results indicate that a reduced single-step model is suitable to estimate breeding values of bulls and breeding values, dominance deviations and total genetic values of cows with acceptable quality. © 2018 Blackwell Verlag GmbH.

  8. Factors affecting GEBV accuracy with single-step Bayesian models.

    Zhou, Lei; Mrode, Raphael; Zhang, Shengli; Zhang, Qin; Li, Bugao; Liu, Jian-Feng

    2018-01-01

    A single-step approach to obtain genomic prediction was first proposed in 2009. Many studies have investigated the components of GEBV accuracy in genomic selection. However, it is still unclear how the population structure and the relationships between training and validation populations influence GEBV accuracy in terms of single-step analysis. Here, we explored the components of GEBV accuracy in single-step Bayesian analysis with a simulation study. Three scenarios with various numbers of QTL (5, 50, and 500) were simulated. Three models were implemented to analyze the simulated data: single-step genomic best linear unbiased prediction (GBLUP; SSGBLUP), single-step BayesA (SS-BayesA), and single-step BayesB (SS-BayesB). According to our results, GEBV accuracy was influenced by the relationships between the training and validation populations more significantly for ungenotyped animals than for genotyped animals. SS-BayesA/BayesB showed an obvious advantage over SSGBLUP with the scenarios of 5 and 50 QTL. SS-BayesB model obtained the lowest accuracy with the 500 QTL in the simulation. SS-BayesA model was the most efficient and robust considering all QTL scenarios. Generally, both the relationships between training and validation populations and LD between markers and QTL contributed to GEBV accuracy in the single-step analysis, and the advantages of single-step Bayesian models were more apparent when the trait is controlled by fewer QTL.

  9. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  10. Comparison study on mechanical properties single step and three step artificial aging on duralium

    Tsamroh, Dewi Izzatus; Puspitasari, Poppy; Andoko, Sasongko, M. Ilman N.; Yazirin, Cepi

    2017-09-01

    Duralium is kind of non-ferro alloy that used widely in industrial. That caused its properties such as mild, high ductility, and resistance from corrosion. This study aimed to know mechanical properties of duralium on single step and three step articial aging process. Mechanical properties that discussed in this study focused on toughness value, tensile strength, and microstructure of duralium. Toughness value of single step artificial aging was 0.082 joule/mm2, and toughness value of three step artificial aging was 0,0721 joule/mm2. Duralium tensile strength of single step artificial aging was 32.36 kgf/mm^2, and duralium tensile strength of three step artificial aging was 32,70 kgf/mm^2. Based on microstructure photo of duralium of single step artificial aging showed that precipitate (θ) was not spreading evenly indicated by black spot which increasing the toughness of material. While microstructure photo of duralium that treated by three step artificial aging showed that it had more precipitate (θ) spread evenly compared with duralium that treated by single step artificial aging.

  11. Accuracy of Single-Step versus 2-Step Double-Mix Impression Technique

    Franco, Eduardo Batista; da Cunha, Leonardo Fernandes; Herrera, Francyle Simões

    2011-01-01

    Objective. To investigate the accuracy of dies obtained from single-step and 2-step double-mix impressions. Material and Methods. Impressions (n = 10) of a stainless steel die simulating a complete crown preparation were performed using a polyether (Impregum Soft Heavy and Light body) and a vinyl...

  12. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Response of single polymers to localized step strains

    Panja, D.

    2009-01-01

    In this paper, the response of single three-dimensional phantom and self-avoiding polymers to localized step strains are studied for two cases in the absence of hydrodynamic interactions: (i) Polymers tethered at one end with the strain created at the point of tether, and (ii) free polymers with the

  14. Single-step affinity purification for fungal proteomics.

    Liu, Hui-Lin; Osmani, Aysha H; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B; De Souza, Colin P; Osmani, Stephen A

    2010-05-01

    A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.

  15. Single-Step Affinity Purification for Fungal Proteomics ▿ †

    Liu, Hui-Lin; Osmani, Aysha H.; Ukil, Leena; Son, Sunghun; Markossian, Sarine; Shen, Kuo-Fang; Govindaraghavan, Meera; Varadaraj, Archana; Hashmi, Shahr B.; De Souza, Colin P.; Osmani, Stephen A.

    2010-01-01

    A single-step protein affinity purification protocol using Aspergillus nidulans is described. Detailed protocols for cell breakage, affinity purification, and depending on the application, methods for protein release from affinity beads are provided. Examples defining the utility of the approaches, which should be widely applicable, are included.

  16. Percutaneous Cystgastrostomy as a Single-Step Procedure

    Curry, L.; Sookur, P.; Low, D.; Bhattacharya, S.; Fotheringham, T.

    2009-01-01

    The purpose of this study was to evaluate the success of percutaneous transgastric cystgastrostomy as a single-step procedure. We performed a retrospective analysis of single-step percutaneous transgastric cystgastrostomy carried out in 12 patients (8 male, 4 female; mean age 44 years; range 21-70 years), between 2002 and 2007, with large symptomatic pancreatic pseudocysts for whom up to 1-year follow-up data (mean 10 months) were available. All pseudocysts were drained by single-step percutaneous cystgastrostomy with the placement of either one or two stents. The procedure was completed successfully in all 12 patients. The pseudocysts showed complete resolution on further imaging in 7 of 12 patients with either enteric passage of the stent or stent removal by endoscopy. In 2 of 12 patients, the pseudocysts showed complete resolution on imaging, with the stents still noted in situ. In 2 of 12 patients, the pseudocysts became infected after 1 month and required surgical intervention. In 1 of 12 patients, the pseudocyst showed partial resolution on imaging, but subsequently reaccumulated and later required external drainage. In our experience, percutaneous cystgastrostomy as a single-step procedure has a high success rate and good short-term outcomes over 1-year follow-up and should be considered in the treatment of large symptomatic cysts.

  17. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  18. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  19. Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps

    Überla Klaus

    2007-06-01

    Full Text Available Abstract Background Proteins of human and animal viruses are frequently expressed from RNA polymerase II dependent expression cassettes to study protein function and to develop gene-based vaccines. Initial attempts to express the G protein of vesicular stomatitis virus (VSV and the F protein of respiratory syncytial virus (RSV by eukaryotic promoters revealed restrictions at several steps of gene expression. Results Insertion of an intron flanked by exonic sequences 5'-terminal to the open reading frames (ORF of VSV-G and RSV-F led to detectable cytoplasmic mRNA levels of both genes. While the exonic sequences were sufficient to stabilise the VSV-G mRNA, cytoplasmic mRNA levels of RSV-F were dependent on the presence of a functional intron. Cytoplasmic VSV-G mRNA levels led to readily detectable levels of VSV-G protein, whereas RSV-F protein expression remained undetectable. However, RSV-F expression was observed after mutating two of four consensus sites for polyadenylation present in the RSV-F ORF. Expression levels could be further enhanced by codon optimisation. Conclusion Insufficient cytoplasmic mRNA levels and premature polyadenylation prevent expression of RSV-F by RNA polymerase II dependent expression plasmids. Since RSV replicates in the cytoplasm, the presence of premature polyadenylation sites and elements leading to nuclear instability should not interfere with RSV-F expression during virus replication. The molecular mechanisms responsible for the destabilisation of the RSV-F and VSV-G mRNAs and the different requirements for their rescue by insertion of an intron remain to be defined.

  20. Mechanism of replication of ultraviolet-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli. Implications for SOS mutagenesis

    Livneh, Z.

    1986-01-01

    Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed

  1. Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

    Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

    2004-01-30

    A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

  2. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  3. Single step radiolytic synthesis of iridium nanoparticles onto graphene oxide

    Rojas, J.V.; Molina Higgins, M.C.; Toro Gonzalez, M.; Castano, C.E.

    2015-01-01

    Graphical abstract: - Highlights: • Ir nanoparticles were synthesized through a single step gamma irradiation process. • Homogeneously distributed Ir nanoparticles on graphene oxide are ∼2.3 nm in size. • Ir−O bonds evidenced the interaction of the nanoparticles with the support. - Abstract: In this work a new approach to synthesize iridium nanoparticles on reduced graphene oxide is presented. The nanoparticles were directly deposited and grown on the surface of the carbon-based support using a single step reduction method through gamma irradiation. In this process, an aqueous isopropanol solution containing the iridium precursor, graphene oxide, and sodium dodecyl sulfate was initially prepared and sonicated thoroughly to obtain a homogeneous dispersion. The samples were irradiated with gamma rays with energies of 1.17 and 1.33 MeV emitted from the spontaneous decay of the 60 Co irradiator. The interaction of gamma rays with water in the presence of isopropanol generates highly reducing species homogeneously distributed in the solution that can reduce the Ir precursor down to a zero valence state. An absorbed dose of 60 kGy was used, which according to the yield of reducing species is sufficient to reduce the total amount of precursor present in the solution. This novel approach leads to the formation of 2.3 ± 0.5 nm Ir nanoparticles distributed along the surface of the support. The oxygenated functionalities of graphene oxide served as nucleation sites for the formation of Ir nuclei and their subsequent growth. XPS results revealed that the interaction of Ir with the support occurs through Ir−O bonds.

  4. Step-to-step spatiotemporal variables and ground reaction forces of intra-individual fastest sprinting in a single session.

    Nagahara, Ryu; Mizutani, Mirai; Matsuo, Akifumi; Kanehisa, Hiroaki; Fukunaga, Tetsuo

    2018-06-01

    We aimed to investigate the step-to-step spatiotemporal variables and ground reaction forces during the acceleration phase for characterising intra-individual fastest sprinting within a single session. Step-to-step spatiotemporal variables and ground reaction forces produced by 15 male athletes were measured over a 50-m distance during repeated (three to five) 60-m sprints using a long force platform system. Differences in measured variables between the fastest and slowest trials were examined at each step until the 22nd step using a magnitude-based inferences approach. There were possibly-most likely higher running speed and step frequency (2nd to 22nd steps) and shorter support time (all steps) in the fastest trial than in the slowest trial. Moreover, for the fastest trial there were likely-very likely greater mean propulsive force during the initial four steps and possibly-very likely larger mean net anterior-posterior force until the 17th step. The current results demonstrate that better sprinting performance within a single session is probably achieved by 1) a high step frequency (except the initial step) with short support time at all steps, 2) exerting a greater mean propulsive force during initial acceleration, and 3) producing a greater mean net anterior-posterior force during initial and middle acceleration.

  5. Comparison of single-step and two-step purified coagulants from Moringa oleifera seed for turbidity and DOC removal.

    Sánchez-Martín, J; Ghebremichael, K; Beltrán-Heredia, J

    2010-08-01

    The coagulant proteins from Moringa oleifera purified with single-step and two-step ion-exchange processes were used for the coagulation of surface water from Meuse river in The Netherlands. The performances of the two purified coagulants and the crude extract were assessed in terms of turbidity and DOC removal. The results indicated that the optimum dosage of the single-step purified coagulant was more than two times higher compared to the two-step purified coagulant in terms of turbidity removal. And the residual DOC in the two-step purified coagulant was lower than in single-step purified coagulant or crude extract. (c) 2010 Elsevier Ltd. All rights reserved.

  6. Virtual substitution scan via single-step free energy perturbation.

    Chiang, Ying-Chih; Wang, Yi

    2016-02-05

    With the rapid expansion of our computing power, molecular dynamics (MD) simulations ranging from hundreds of nanoseconds to microseconds or even milliseconds have become increasingly common. The majority of these long trajectories are obtained from plain (vanilla) MD simulations, where no enhanced sampling or free energy calculation method is employed. To promote the 'recycling' of these trajectories, we developed the Virtual Substitution Scan (VSS) toolkit as a plugin of the open-source visualization and analysis software VMD. Based on the single-step free energy perturbation (sFEP) method, VSS enables the user to post-process a vanilla MD trajectory for a fast free energy scan of substituting aryl hydrogens by small functional groups. Dihedrals of the functional groups are sampled explicitly in VSS, which improves the performance of the calculation and is found particularly important for certain groups. As a proof-of-concept demonstration, we employ VSS to compute the solvation free energy change upon substituting the hydrogen of a benzene molecule by 12 small functional groups frequently considered in lead optimization. Additionally, VSS is used to compute the relative binding free energy of four selected ligands of the T4 lysozyme. Overall, the computational cost of VSS is only a fraction of the corresponding multi-step FEP (mFEP) calculation, while its results agree reasonably well with those of mFEP, indicating that VSS offers a promising tool for rapid free energy scan of small functional group substitutions. This article is protected by copyright. All rights reserved. © 2016 Wiley Periodicals, Inc.

  7. A Renormalisation Group Method. V. A Single Renormalisation Group Step

    Brydges, David C.; Slade, Gordon

    2015-05-01

    This paper is the fifth in a series devoted to the development of a rigorous renormalisation group method applicable to lattice field theories containing boson and/or fermion fields, and comprises the core of the method. In the renormalisation group method, increasingly large scales are studied in a progressive manner, with an interaction parametrised by a field polynomial which evolves with the scale under the renormalisation group map. In our context, the progressive analysis is performed via a finite-range covariance decomposition. Perturbative calculations are used to track the flow of the coupling constants of the evolving polynomial, but on their own perturbative calculations are insufficient to control error terms and to obtain mathematically rigorous results. In this paper, we define an additional non-perturbative coordinate, which together with the flow of coupling constants defines the complete evolution of the renormalisation group map. We specify conditions under which the non-perturbative coordinate is contractive under a single renormalisation group step. Our framework is essentially combinatorial, but its implementation relies on analytic results developed earlier in the series of papers. The results of this paper are applied elsewhere to analyse the critical behaviour of the 4-dimensional continuous-time weakly self-avoiding walk and of the 4-dimensional -component model. In particular, the existence of a logarithmic correction to mean-field scaling for the susceptibility can be proved for both models, together with other facts about critical exponents and critical behaviour.

  8. The Effects of Multiple-Step and Single-Step Directions on Fourth and Fifth Grade Students' Grammar Assessment Performance

    Mazerik, Matthew B.

    2006-01-01

    The mean scores of English Language Learners (ELL) and English Only (EO) students in 4th and 5th grade (N = 110), across the teacher-administered Grammar Skills Test, were examined for differences in participants' scores on assessments containing single-step directions and assessments containing multiple-step directions. The results indicated no…

  9. Single step synthesis of GdAlO3 powder

    Sinha, Amit; Nair, S.R.; Sinha, P.K.

    2011-01-01

    Research highlights: → First report on direct formation of GdAlO 3 powder using a novel combustion process. → Study of combustion characteristics of Gd(NO 3 ) 3 and Al(NO 3 ) 3 towards three fuels. → Preparation of highly sinterable GdAlO 3 powders through fuel-mixture approach. → Significant reduction in energy consumption for production of GdAlO 3 sintered body. - Abstract: A novel method for preparation of nano-crystalline gadolinium aluminate (GdAlO 3 ) powder, based on combustion synthesis, is reported. It was observed that aluminium nitrate and gadolinium nitrate exhibit different combustion characteristics with respect to urea, glycine and β-alanine. While urea was proven to be a suitable fuel for direct formation of crystalline α-Al 2 O 3 from its nitrate, glycine and β-alanine are suitable fuels for gadolinium nitrate for preparation of its oxide after combustion reaction. Based on the observed chemical characteristics of gadolinium and aluminium nitrates with respect to above mentioned fuels for the combustion reaction, the fuel mixture composition could be predicted that could lead to phase pure perovskite GdAlO 3 directly after the combustion reaction without any subsequent calcination step. The use of single fuel, on the other hand, leads to formation of amorphous precursor powders that call for subsequent calcination for the formation of crystalline GdAlO 3 . The powders produced directly after combustion reactions using fuel mixtures were found to be highly sinterable. The sintering of the powders at 1550 o C for 4 h resulted in GdAlO 3 with sintered density of more than 95%. T.D.

  10. Thermodynamic approach and comparison of two-step and single step DME (dimethyl ether) syntheses with carbon dioxide utilization

    Chen, Wei-Hsin; Hsu, Chih-Liang; Wang, Xiao-Dong

    2016-01-01

    DME (Dimethyl ether) synthesis from syngas with CO_2 utilization through two-step and single step processes is analyzed thermodynamically. The influences of reaction temperature, H_2/CO molar ratio, and CO_2/CO molar ratio on CO and CO_2 conversions, DME selectivity and yield, and thermal behavior are evaluated. Particular attention is paid to the comparison of the performance of DME synthesis between the two different methods. In the two-step method, the addition of CO_2 suppresses the CO conversion during methanol synthesis. An increase in CO_2/CO ratio decreases the CO_2 conversion (negative effect), but increases the total consumption amount of CO_2 (positive effect). At a given reaction temperature with H_2/CO = 4, the maximum DME yield develops at CO_2/CO = 1. In the single step method, over 98% of CO can be converted and the DME yield can be as high as 0.52 mol (mol CO)"−"1 at CO_2/CO = 2. The comparison of the single step and two-step processes indicates that the maximum CO conversion, DME selectivity, and DME yield in the former are higher than those in the latter, whereas an opposite result in the maximum CO_2 conversion is observed. These results reveal that the single step process has lower thermodynamic limitation and is a better option for DME synthesis. From CO_2 utilization point of view, the operation with low temperature, high H_2/CO ratio, and low CO_2/CO ratio results in higher CO_2 conversion, irrespective of two-step or single step DME synthesis. - Highlights: • DME (Dimethyl ether) synthesis with CO_2 utilization is analyzed thermodynamically. • Single step and two-step DME syntheses are studied and compared with each other. • CO_2 addition suppresses CO conversion in MeOH synthesis but increases MeOH yield. • The performance of the single step DME synthesis is better than that of the two-step one. • Increase CO_2/CO ratio decreases CO_2 conversion but increases CO_2 consumption amount.

  11. Single molecule imaging of RNA polymerase II using atomic force microscopy

    Rhodin, Thor; Fu Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru

    2003-01-01

    An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3 N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes

  12. Single-step digital backpropagation for nonlinearity mitigation

    Secondini, Marco; Rommel, Simon; Meloni, Gianluca

    2015-01-01

    Nonlinearity mitigation based on the enhanced split-step Fourier method (ESSFM) for the implementation of low-complexity digital backpropagation (DBP) is investigated and experimentally demonstrated. After reviewing the main computational aspects of DBP and of the conventional split-step Fourier...... in the computational complexity, power consumption, and latency with respect to a simple feed-forward equalizer for bulk dispersion compensation....

  13. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  14. Comparative analysis of single-step and two-step biodiesel production using supercritical methanol on laboratory-scale

    Micic, Radoslav D.; Tomić, Milan D.; Kiss, Ferenc E.; Martinovic, Ferenc L.; Simikić, Mirko Ð.; Molnar, Tibor T.

    2016-01-01

    Highlights: • Single-step supercritical transesterification compared to the two-step process. • Two-step process: oil hydrolysis and subsequent supercritical methyl esterification. • Experiments were conducted in a laboratory-scale batch reactor. • Higher biodiesel yields in two-step process at milder reaction conditions. • Two-step process has potential to be cost-competitive with the single-step process. - Abstract: Single-step supercritical transesterification and two-step biodiesel production process consisting of oil hydrolysis and subsequent supercritical methyl esterification were studied and compared. For this purpose, comparative experiments were conducted in a laboratory-scale batch reactor and optimal reaction conditions (temperature, pressure, molar ratio and time) were determined. Results indicate that in comparison to a single-step transesterification, methyl esterification (second step of the two-step process) produces higher biodiesel yields (95 wt% vs. 91 wt%) at lower temperatures (270 °C vs. 350 °C), pressures (8 MPa vs. 12 MPa) and methanol to oil molar ratios (1:20 vs. 1:42). This can be explained by the fact that the reaction system consisting of free fatty acid (FFA) and methanol achieves supercritical condition at milder reaction conditions. Furthermore, the dissolved FFA increases the acidity of supercritical methanol and acts as an acid catalyst that increases the reaction rate. There is a direct correlation between FFA content of the product obtained in hydrolysis and biodiesel yields in methyl esterification. Therefore, the reaction parameters of hydrolysis were optimized to yield the highest FFA content at 12 MPa, 250 °C and 1:20 oil to water molar ratio. Results of direct material and energy costs comparison suggest that the process based on the two-step reaction has the potential to be cost-competitive with the process based on single-step supercritical transesterification. Higher biodiesel yields, similar or lower energy

  15. Comparison of Model Reliabilities from Single-Step and Bivariate Blending Methods

    Taskinen, Matti; Mäntysaari, Esa; Lidauer, Martin

    2013-01-01

    Model based reliabilities in genetic evaluation are compared between three methods: animal model BLUP, single-step BLUP, and bivariate blending after genomic BLUP. The original bivariate blending is revised in this work to better account animal models. The study data is extracted from...... be calculated. Model reliabilities by the single-step and the bivariate blending methods were higher than by animal model due to genomic information. Compared to the single-step method, the bivariate blending method reliability estimates were, in general, lower. Computationally bivariate blending method was......, on the other hand, lighter than the single-step method....

  16. The Point Zoro Symmetric Single-Step Procedure for Simultaneous Estimation of Polynomial Zeros

    Mansor Monsi

    2012-01-01

    Full Text Available The point symmetric single step procedure PSS1 has R-order of convergence at least 3. This procedure is modified by adding another single-step, which is the third step in PSS1. This modified procedure is called the point zoro symmetric single-step PZSS1. It is proven that the R-order of convergence of PZSS1 is at least 4 which is higher than the R-order of convergence of PT1, PS1, and PSS1. Hence, computational time is reduced since this procedure is more efficient for bounding simple zeros simultaneously.

  17. The stepping behavior analysis of pedestrians from different age groups via a single-file experiment

    Cao, Shuchao; Zhang, Jun; Song, Weiguo; Shi, Chang'an; Zhang, Ruifang

    2018-03-01

    The stepping behavior of pedestrians with different age compositions in single-file experiment is investigated in this paper. The relation between step length, step width and stepping time are analyzed by using the step measurement method based on the calculation of curvature of the trajectory. The relations of velocity-step width, velocity-step length and velocity-stepping time for different age groups are discussed and compared with previous studies. Finally effects of pedestrian gender and height on stepping laws and fundamental diagrams are analyzed. The study is helpful for understanding pedestrian dynamics of movement. Meanwhile, it offers experimental data to develop a microscopic model of pedestrian movement by considering stepping behavior.

  18. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  19. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  20. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  1. Single droplet drying step characterization in microsphere preparation.

    Al Zaitone, Belal; Lamprecht, Alf

    2013-05-01

    Spray drying processes are difficult to characterize since process parameters are not directly accessible. Acoustic levitation was used to investigate microencapsulation by spray drying on one single droplet facilitating the analyses of droplet behavior upon drying. Process parameters were simulated on a poly(lactide-co-glycolide)/ethyl acetate combination for microencapsulation. The results allowed quantifying the influence of process parameters such as temperature (0-40°C), polymer concentration (5-400 mg/ml), and droplet size (0.5-1.37 μl) on the drying time and drying kinetics as well as the particle morphology. The drying of polymer solutions at temperature of 21°C and concentration of 5 mg/ml, shows that the dimensionless particle diameter (Dp/D0) approaches 0.25 and the particle needs 350 s to dry. At 400 mg/ml, Dp/D0=0.8 and the drying time increases to one order of magnitude and a hollow particle is formed. The study demonstrates the benefit of using the acoustic levitator as a lab scale method to characterize and study the microparticle formation. This method can be considered as a helpful tool to mimic the full scale spray drying process by providing identical operational parameters such as air velocity, temperature, and variable droplet sizes. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  3. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  4. Improving Genetic Evaluation of Litter Size Using a Single-step Model

    Guo, Xiangyu; Christensen, Ole Fredslund; Ostersen, Tage

    A recently developed single-step method allows genetic evaluation based on information from phenotypes, pedigree and markers simultaneously. This paper compared reliabilities of predicted breeding values obtained from single-step method and the traditional pedigree-based method for two litter size...... traits, total number of piglets born (TNB), and litter size at five days after birth (Ls 5) in Danish Landrace and Yorkshire pigs. The results showed that the single-step method combining phenotypic and genotypic information provided more accurate predictions than the pedigree-based method, not only...

  5. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

    Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

    2017-01-01

    Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  6. Two-step bacterial broad-range polymerase chain reaction analysis of heart valve tissue improves bacteriological diagnosis of infective endocarditis.

    Boussier, Rémi; Rogez, Sylvie; François, Bruno; Denes, Eric; Ploy, Marie-Cécile; Garnier, Fabien

    2013-03-01

    Positive heart valve (HV) culture is a major Duke's criterion for the diagnosis of infective endocarditis but is poorly sensitive. Two broad-range 16S rDNA polymerase chain reaction (PCR) methods were applied to 31 HV samples: first, a real-time method, then conventional end-point PCR was applied to HV samples on which the first PCR was negative. Five specific real-time PCR procedures were also used in order to identify Bartonella spp., Tropheryma whipplei, Chlamydophila pneumoniae, Mycoplasma pneumonia, and Coxiella burnetii. A strategy combining the 2-step broad-range PCR methods improved the sensitivity of the molecular method from 38.7% to 58%. Specific PCR identified 1 T. whipplei, which was also identified by conventional end-point PCR. These results confirm that blood culture is the gold standard for the diagnosis of infective endocarditis, shows that molecular methods applied to HV can be useful when blood culture is negative, and that 2-step broad-range PCR approach seems to be more sensitive. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Single-step link of the superdeformed band in 143Eu

    Atac, A.; Bergstroem, M.H.; Nyberg, J.; Persson, J.; Herskind, B.; Joss, D.T.; Lipoglavsek, M.; Tucek, K.

    1996-01-01

    A discrete γ-ray ransition with an energy of 3360.6 keV deexciting the second lowest SD state in 143 Eu has been discovered. It carries 3.2 % of the full intensity of the band and feeds into a nearly spherical state which is above the I = 35/2 (+) , E x =4947 keV level. The exact placement of the single-step link is, however, not established due to the specially complicated level scheme in the region of interest. The energy of the single-step link agrees well with the previously determined two-step links. (orig.)

  8. Strand Displacement by DNA Polymerase III Occurs through a τ-ψ-χ Link to Single-stranded DNA-binding Protein Coating the Lagging Strand Template*

    Yuan, Quan; McHenry, Charles S.

    2009-01-01

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...

  9. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  10. Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

    Wang, Yaqiong; Ma, Hong

    2015-09-01

    Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  11. Two-step multiplex polymerase chain reaction improves the speed and accuracy of genotyping using DNA from noninvasive and museum samples.

    Arandjelovic, M; Guschanski, K; Schubert, G; Harris, T R; Thalmann, O; Siedel, H; Vigilant, L

    2009-01-01

    Many studies in molecular ecology rely upon the genotyping of large numbers of low-quantity DNA extracts derived from noninvasive or museum specimens. To overcome low amplification success rates and avoid genotyping errors such as allelic dropout and false alleles, multiple polymerase chain reaction (PCR) replicates for each sample are typically used. Recently, two-step multiplex procedures have been introduced which drastically increase the success rate and efficiency of genotyping. However, controversy still exists concerning the amount of replication needed for suitable control of error. Here we describe the use of a two-step multiplex PCR procedure that allows rapid genotyping using at least 19 different microsatellite loci. We applied this approach to quantified amounts of noninvasive DNAs from western chimpanzee, western gorilla, mountain gorilla and black and white colobus faecal samples, as well as to DNA from ~100-year-old gorilla teeth from museums. Analysis of over 45 000 PCRs revealed average success rates of > 90% using faecal DNAs and 74% using museum specimen DNAs. Average allelic dropout rates were substantially reduced compared to those obtained using conventional singleplex PCR protocols, and reliable genotyping using low (< 25 pg) amounts of template DNA was possible. However, four to five replicates of apparently homozygous results are needed to avoid allelic dropout when using the lowest concentration DNAs (< 50 pg/reaction), suggesting that use of protocols allowing routine acceptance of homozygous genotypes after as few as three replicates may lead to unanticipated errors when applied to low-concentration DNAs. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

  12. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  13. Evaluation of accuracy in implant site preparation performed in single- or multi-step drilling procedures.

    Marheineke, Nadine; Scherer, Uta; Rücker, Martin; von See, Constantin; Rahlf, Björn; Gellrich, Nils-Claudius; Stoetzer, Marcus

    2018-06-01

    Dental implant failure and insufficient osseointegration are proven results of mechanical and thermal damage during the surgery process. We herein performed a comparative study of a less invasive single-step drilling preparation protocol and a conventional multiple drilling sequence. Accuracy of drilling holes was precisely analyzed and the influence of different levels of expertise of the handlers and additional use of drill template guidance was evaluated. Six experimental groups, deployed in an osseous study model, were representing template-guided and freehanded drilling actions in a stepwise drilling procedure in comparison to a single-drill protocol. Each experimental condition was studied by the drilling actions of respectively three persons without surgical knowledge as well as three highly experienced oral surgeons. Drilling actions were performed and diameters were recorded with a precision measuring instrument. Less experienced operators were able to significantly increase the drilling accuracy using a guiding template, especially when multi-step preparations are performed. Improved accuracy without template guidance was observed when experienced operators were executing single-step versus multi-step technique. Single-step drilling protocols have shown to produce more accurate results than multi-step procedures. The outcome of any protocol can be further improved by use of guiding templates. Operator experience can be a contributing factor. Single-step preparations are less invasive and are promoting osseointegration. Even highly experienced surgeons are achieving higher levels of accuracy by combining this technique with template guidance. Hereby template guidance enables a reduction of hands-on time and side effects during surgery and lead to a more predictable clinical diameter.

  14. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.

    2010-01-01

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Genomic prediction in a nuclear population of layers using single-step models.

    Yan, Yiyuan; Wu, Guiqin; Liu, Aiqiao; Sun, Congjiao; Han, Wenpeng; Li, Guangqi; Yang, Ning

    2018-02-01

    Single-step genomic prediction method has been proposed to improve the accuracy of genomic prediction by incorporating information of both genotyped and ungenotyped animals. The objective of this study is to compare the prediction performance of single-step model with a 2-step models and the pedigree-based models in a nuclear population of layers. A total of 1,344 chickens across 4 generations were genotyped by a 600 K SNP chip. Four traits were analyzed, i.e., body weight at 28 wk (BW28), egg weight at 28 wk (EW28), laying rate at 38 wk (LR38), and Haugh unit at 36 wk (HU36). In predicting offsprings, individuals from generation 1 to 3 were used as training data and females from generation 4 were used as validation set. The accuracies of predicted breeding values by pedigree BLUP (PBLUP), genomic BLUP (GBLUP), SSGBLUP and single-step blending (SSBlending) were compared for both genotyped and ungenotyped individuals. For genotyped females, GBLUP performed no better than PBLUP because of the small size of training data, while the 2 single-step models predicted more accurately than the PBLUP model. The average predictive ability of SSGBLUP and SSBlending were 16.0% and 10.8% higher than the PBLUP model across traits, respectively. Furthermore, the predictive abilities for ungenotyped individuals were also enhanced. The average improvements of prediction abilities were 5.9% and 1.5% for SSGBLUP and SSBlending model, respectively. It was concluded that single-step models, especially the SSGBLUP model, can yield more accurate prediction of genetic merits and are preferable for practical implementation of genomic selection in layers. © 2017 Poultry Science Association Inc.

  17. Composition of single-step media used for human embryo culture.

    Morbeck, Dean E; Baumann, Nikola A; Oglesbee, Devin

    2017-04-01

    To determine compositions of commercial single-step culture media and test with a murine model whether differences in composition are biologically relevant. Experimental laboratory study. University-based laboratory. Inbred female mice were superovulated and mated with outbred male mice. Amino acid, organic acid, and ions content were determined for single-step culture media: CSC, Global, G-TL, and 1-Step. To determine whether differences in composition of these media are biologically relevant, mouse one-cell embryos were cultured for 96 hours in each culture media at 5% and 20% oxygen in a time-lapse incubator. Compositions of four culture media were analyzed for concentrations of 30 amino acids, organic acids, and ions. Blastocysts at 96 hours of culture and cell cycle timings were calculated, and experiments were repeated in triplicate. Of the more than 30 analytes, concentrations of glucose, lactate, pyruvate, amino acids, phosphate, calcium, and magnesium varied in concentrations. Mouse embryos were differentially affected by oxygen in G-TL and 1-Step. Four single-step culture media have compositions that vary notably in pyruvate, lactate, and amino acids. Blastocyst development was affected by culture media and its interaction with oxygen concentration. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  18. Polymerase-free measurement of microRNA-122 with single base specificity using single molecule arrays: Detection of drug-induced liver injury.

    David M Rissin

    Full Text Available We have developed a single probe method for detecting microRNA from human serum using single molecule arrays, with sequence specificity down to a single base, and without the use of amplification by polymerases. An abasic peptide nucleic acid (PNA probe-containing a reactive amine instead of a nucleotide at a specific position in the sequence-for detecting a microRNA was conjugated to superparamagnetic beads. These beads were incubated with a sample containing microRNA, a biotinylated reactive nucleobase-containing an aldehyde group-that was complementary to the missing base in the probe sequence, and a reducing agent. When a target molecule with an exact match in sequence hybridized to the capture probe, the reactive nucleobase was covalently attached to the backbone of the probe by a dynamic covalent chemical reaction. Single molecules of the biotin-labeled probe were then labeled with streptavidin-β-galactosidase (SβG, the beads were resuspended in a fluorogenic enzyme substrate, loaded into an array of femtoliter wells, and sealed with oil. The array was imaged fluorescently to determine which beads were associated with single enzymes, and the average number of enzymes per bead was determined. The assay had a limit of detection of 500 fM, approximately 500 times more sensitive than a corresponding analog bead-based assay, with target specificity down to a single base mis-match. This assay was used to measure microRNA-122 (miR-122-an established biomarker of liver toxicity-extracted from the serum of patients who had acute liver injury due to acetaminophen, and control healthy patients. All patients with liver injury had higher levels of miR-122 in their serum compared to controls, and the concentrations measured correlated well with those determined using RT-qPCR. This approach allows rapid quantification of circulating microRNA with single-based specificity and a limit of quantification suitable for clinical use.

  19. Single-step colloidal quantum dot films for infrared solar harvesting

    Kiani, Amirreza; Sutherland, Brandon R.; Kim, Younghoon; Ouellette, Olivier; Levina, Larissa; Walters, Grant; Dinh, Cao Thang; Liu, Mengxia; Voznyy, Oleksandr; Lan, Xinzheng; Labelle, Andre J.; Ip, Alexander H.; Proppe, Andrew; Ahmed, Ghada H.; Mohammed, Omar F.; Hoogland, Sjoerd; Sargent, Edward H.

    2016-01-01

    . To date, IR CQD solar cells have been made using a wasteful and complex sequential layer-by-layer process. Here, we demonstrate ∼1 eV bandgap solar-harvesting CQD films deposited in a single step. By engineering a fast-drying solvent mixture for metal

  20. A three-step vehicle detection framework for range estimation using a single camera

    Kanjee, R

    2015-12-01

    Full Text Available This paper proposes and validates a real-time onroad vehicle detection system, which uses a single camera for the purpose of intelligent driver assistance. A three-step vehicle detection framework is presented to detect and track the target vehicle...

  1. Towards single step production of multi-layer inorganic hollow fibers

    de Jong, J.; Benes, Nieck Edwin; Koops, G.H.; Wessling, Matthias

    2004-01-01

    In this work we propose a generic synthesis route for the single step production of multi-layer inorganic hollow fibers, based on polymer wet spinning combined with a heat treatment. With this new method, membranes with a high surface area per unit volume ratio can be produced, while production time

  2. Nanopatterning of magnetic disks by single-step Ar+ Ion projection

    Dietzel, A.H.; Berger, R.; Loeschner, H.; Platzgummer, E.; Stengl, G.; Bruenger, W.H.; Letzkus, F.

    2003-01-01

    Large-area Ar+ projection has been used to generate planar magnetic nanostructures on a 1¿-format hard disk in a single step (see Figure). The recording pattern was transferred to a Co/Pt multilayer without resist processes or any other contact to the delicate media surface. It is conceivable that

  3. Single-step linking transition from superdeformed to spherical states in {sup 143}Eu

    Atac, A.; Axelsson, A.; Persson, J. [Uppsala Univ. (Sweden)] [and others

    1996-12-31

    A discrete {gamma}-ray transition which connects the second lowest SD state with a normally deformed one in {sup 143}Eu has been discovered. It has an energy of 3360.6 keV and carries 3.2 % of the full intensity of the SD band. It feeds into a nearly spherical state which is above the I = 35/2{sup +}, E=4947 keV level. The exact placement of the single-step link could, however, not be established due to the especially complicated level scheme in the region of interest. The angular correlation study favours a stretched dipole character for the 3360.6 keV transition. The single-step link agrees well with the previously determined two-step links, both with respect to energy and spin.

  4. Differences in Lower Extremity and Trunk Kinematics between Single Leg Squat and Step Down Tasks.

    Cara L Lewis

    Full Text Available The single leg squat and single leg step down are two commonly used functional tasks to assess movement patterns. It is unknown how kinematics compare between these tasks. The purpose of this study was to identify kinematic differences in the lower extremity, pelvis and trunk between the single leg squat and the step down. Fourteen healthy individuals participated in this research and performed the functional tasks while kinematic data were collected for the trunk, pelvis, and lower extremities using a motion capture system. For the single leg squat task, the participant was instructed to squat as low as possible. For the step down task, the participant was instructed to stand on top of a box, slowly lower him/herself until the non-stance heel touched the ground, and return to standing. This was done from two different heights (16 cm and 24 cm. The kinematics were evaluated at peak knee flexion as well as at 60° of knee flexion. Pearson correlation coefficients (r between the angles at those two time points were also calculated to better understand the relationship between each task. The tasks resulted in kinematics differences at the knee, hip, pelvis, and trunk at both time points. The single leg squat was performed with less hip adduction (p ≤ 0.003, but more hip external rotation and knee abduction (p ≤ 0.030, than the step down tasks at 60° of knee flexion. These differences were maintained at peak knee flexion except hip external rotation was only significant in the 24 cm step down task (p ≤ 0.029. While there were multiple differences between the two step heights at peak knee flexion, the only difference at 60° of knee flexion was in trunk flexion (p < 0.001. Angles at the knee and hip had a moderate to excellent correlation (r = 0.51-0.98, but less consistently so at the pelvis and trunk (r = 0.21-0.96. The differences in movement patterns between the single leg squat and the step down should be considered when selecting a

  5. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  6. The expanding polymerase universe.

    Goodman, M F; Tippin, B

    2000-11-01

    Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

  7. Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

    Yuan, Quan; McHenry, Charles S

    2009-11-13

    In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

  8. Dispersed single-phase-step Michelson interferometer for Doppler imaging using sunlight.

    Wan, Xiaoke; Ge, Jian

    2012-09-15

    A Michelson interferometer is dispersed with a fiber array-fed spectrograph, providing 59 Doppler sensing channels using sunlight in the 510-570 nm wavelength region. The interferometer operates at a single-phase-step mode, which is particularly advantageous in multiplexing and data processing compared to the phase-stepping mode of other interferometer spectrometer instruments. Spectral templates are prepared using a standard solar spectrum and simulated interferometer modulations, such that the correlation function with a measured 1D spectrum determines the Doppler shift. Doppler imaging of a rotating cylinder is demonstrated. The average Doppler sensitivity is ~12 m/s, with some channels reaching ~5 m/s.

  9. Modeling single-file diffusion with step fractional Brownian motion and a generalized fractional Langevin equation

    Lim, S C; Teo, L P

    2009-01-01

    Single-file diffusion behaves as normal diffusion at small time and as subdiffusion at large time. These properties can be described in terms of fractional Brownian motion with variable Hurst exponent or multifractional Brownian motion. We introduce a new stochastic process called Riemann–Liouville step fractional Brownian motion which can be regarded as a special case of multifractional Brownian motion with a step function type of Hurst exponent tailored for single-file diffusion. Such a step fractional Brownian motion can be obtained as a solution of the fractional Langevin equation with zero damping. Various kinds of fractional Langevin equations and their generalizations are then considered in order to decide whether their solutions provide the correct description of the long and short time behaviors of single-file diffusion. The cases where the dissipative memory kernel is a Dirac delta function, a power-law function and a combination of these functions are studied in detail. In addition to the case where the short time behavior of single-file diffusion behaves as normal diffusion, we also consider the possibility of a process that begins as ballistic motion

  10. Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films.

    Kim, Jin Young; Adinolfi, Valerio; Sutherland, Brandon R; Voznyy, Oleksandr; Kwon, S Joon; Kim, Tae Wu; Kim, Jeongho; Ihee, Hyotcherl; Kemp, Kyle; Adachi, Michael; Yuan, Mingjian; Kramer, Illan; Zhitomirsky, David; Hoogland, Sjoerd; Sargent, Edward H

    2015-01-01

    Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles--yet size-effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector.

  11. Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films

    Kim, Jin Young; Adinolfi, Valerio; Sutherland, Brandon R.; Voznyy, Oleksandr; Kwon, S. Joon; Kim, Tae Wu; Kim, Jeongho; Ihee, Hyotcherl; Kemp, Kyle; Adachi, Michael; Yuan, Mingjian; Kramer, Illan; Zhitomirsky, David; Hoogland, Sjoerd; Sargent, Edward H.

    2015-01-01

    Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles—yet size–effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector. PMID:26165185

  12. Single-step fabrication of quantum funnels via centrifugal colloidal casting of nanoparticle films.

    Kim, Jin Young

    2015-07-13

    Centrifugal casting of composites and ceramics has been widely employed to improve the mechanical and thermal properties of functional materials. This powerful method has yet to be deployed in the context of nanoparticles--yet size-effect tuning of quantum dots is among their most distinctive and application-relevant features. Here we report the first gradient nanoparticle films to be constructed in a single step. By creating a stable colloid of nanoparticles that are capped with electronic-conduction-compatible ligands we were able to leverage centrifugal casting for thin-films devices. This new method, termed centrifugal colloidal casting, is demonstrated to form films in a bandgap-ordered manner with efficient carrier funnelling towards the lowest energy layer. We constructed the first quantum-gradient photodiode to be formed in a single deposition step and, as a result of the gradient-enhanced electric field, experimentally measured the highest normalized detectivity of any colloidal quantum dot photodetector.

  13. Two-Step Single Slope/SAR ADC with Error Correction for CMOS Image Sensor

    Fang Tang

    2014-01-01

    Full Text Available Conventional two-step ADC for CMOS image sensor requires full resolution noise performance in the first stage single slope ADC, leading to high power consumption and large chip area. This paper presents an 11-bit two-step single slope/successive approximation register (SAR ADC scheme for CMOS image sensor applications. The first stage single slope ADC generates a 3-bit data and 1 redundant bit. The redundant bit is combined with the following 8-bit SAR ADC output code using a proposed error correction algorithm. Instead of requiring full resolution noise performance, the first stage single slope circuit of the proposed ADC can tolerate up to 3.125% quantization noise. With the proposed error correction mechanism, the power consumption and chip area of the single slope ADC are significantly reduced. The prototype ADC is fabricated using 0.18 μm CMOS technology. The chip area of the proposed ADC is 7 μm × 500 μm. The measurement results show that the energy efficiency figure-of-merit (FOM of the proposed ADC core is only 125 pJ/sample under 1.4 V power supply and the chip area efficiency is 84 k μm2·cycles/sample.

  14. Two-step single slope/SAR ADC with error correction for CMOS image sensor.

    Tang, Fang; Bermak, Amine; Amira, Abbes; Amor Benammar, Mohieddine; He, Debiao; Zhao, Xiaojin

    2014-01-01

    Conventional two-step ADC for CMOS image sensor requires full resolution noise performance in the first stage single slope ADC, leading to high power consumption and large chip area. This paper presents an 11-bit two-step single slope/successive approximation register (SAR) ADC scheme for CMOS image sensor applications. The first stage single slope ADC generates a 3-bit data and 1 redundant bit. The redundant bit is combined with the following 8-bit SAR ADC output code using a proposed error correction algorithm. Instead of requiring full resolution noise performance, the first stage single slope circuit of the proposed ADC can tolerate up to 3.125% quantization noise. With the proposed error correction mechanism, the power consumption and chip area of the single slope ADC are significantly reduced. The prototype ADC is fabricated using 0.18 μ m CMOS technology. The chip area of the proposed ADC is 7 μ m × 500 μ m. The measurement results show that the energy efficiency figure-of-merit (FOM) of the proposed ADC core is only 125 pJ/sample under 1.4 V power supply and the chip area efficiency is 84 k  μ m(2) · cycles/sample.

  15. Peyton’s four-step approach: differential effects of single instructional steps on procedural and memory performance – a clarification study

    Krautter M

    2015-05-01

    Full Text Available Markus Krautter,1 Ronja Dittrich,2 Annette Safi,2 Justine Krautter,1 Imad Maatouk,2 Andreas Moeltner,2 Wolfgang Herzog,2 Christoph Nikendei2 1Department of Nephrology, 2Department of General Internal and Psychosomatic Medicine, University of Heidelberg Medical Hospital, Heidelberg, Germany Background: Although Peyton’s four-step approach is a widely used method for skills-lab training in undergraduate medical education and has been shown to be more effective than standard instruction, it is unclear whether its superiority can be attributed to a specific single step. Purpose: We conducted a randomized controlled trial to investigate the differential learning outcomes of the separate steps of Peyton’s four-step approach. Methods: Volunteer medical students were randomly assigned to four different groups. Step-1 group received Peyton’s Step 1, Step-2 group received Peyton’s Steps 1 and 2, Step-3 group received Peyton’s Steps 1, 2, and 3, and Step-3mod group received Peyton’s Steps 1 and 2, followed by a repetition of Step 2. Following the training, the first independent performance of a central venous catheter (CVC insertion using a manikin was video-recorded and scored by independent video assessors using binary checklists. The day after the training, memory performance during delayed recall was assessed with an incidental free recall test. Results: A total of 97 participants agreed to participate in the trial. There were no statistically significant group differences with regard to age, sex, completed education in a medical profession, completed medical clerkships, preliminary memory tests, or self-efficacy ratings. Regarding checklist ratings, Step-2 group showed a superior first independent performance of CVC placement compared to Step-1 group (P<0.001, and Step-3 group showed a superior performance to Step-2 group (P<0.009, while Step-2 group and Step-3mod group did not differ (P=0.055. The findings were similar in the incidental

  16. A single-step method for rapid extraction of total lipids from green microalgae.

    Martin Axelsson

    Full Text Available Microalgae produce a wide range of lipid compounds of potential commercial interest. Total lipid extraction performed by conventional extraction methods, relying on the chloroform-methanol solvent system are too laborious and time consuming for screening large numbers of samples. In this study, three previous extraction methods devised by Folch et al. (1957, Bligh and Dyer (1959 and Selstam and Öquist (1985 were compared and a faster single-step procedure was developed for extraction of total lipids from green microalgae. In the single-step procedure, 8 ml of a 2∶1 chloroform-methanol (v/v mixture was added to fresh or frozen microalgal paste or pulverized dry algal biomass contained in a glass centrifuge tube. The biomass was manually suspended by vigorously shaking the tube for a few seconds and 2 ml of a 0.73% NaCl water solution was added. Phase separation was facilitated by 2 min of centrifugation at 350 g and the lower phase was recovered for analysis. An uncharacterized microalgal polyculture and the green microalgae Scenedesmus dimorphus, Selenastrum minutum, and Chlorella protothecoides were subjected to the different extraction methods and various techniques of biomass homogenization. The less labour intensive single-step procedure presented here allowed simultaneous recovery of total lipid extracts from multiple samples of green microalgae with quantitative yields and fatty acid profiles comparable to those of the previous methods. While the single-step procedure is highly correlated in lipid extractability (r² = 0.985 to the previous method of Folch et al. (1957, it allowed at least five times higher sample throughput.

  17. Towards Single-Step Biofabrication of Organs on a Chip via 3D Printing.

    Knowlton, Stephanie; Yenilmez, Bekir; Tasoglu, Savas

    2016-09-01

    Organ-on-a-chip engineering employs microfabrication of living tissues within microscale fluid channels to create constructs that closely mimic human organs. With the advent of 3D printing, we predict that single-step fabrication of these devices will enable rapid design and cost-effective iterations in the development stage, facilitating rapid innovation in this field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Single-Step Fabrication of High-Density Microdroplet Arrays of Low-Surface-Tension Liquids.

    Feng, Wenqian; Li, Linxian; Du, Xin; Welle, Alexander; Levkin, Pavel A

    2016-04-01

    A facile approach for surface patterning that enables single-step fabrication of high-density arrays of low-surface-tension organic-liquid microdroplets is described. This approach enables miniaturized and parallel high-throughput screenings in organic solvents, formation of homogeneous arrays of hydrophobic nanoparticles, polymer micropads of specific shapes, and polymer microlens arrays. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Low-field multi-step magnetization of GaV4S8 single crystal

    Nakamura, H; Kajinami, Y; Tabata, Y [Department of Materials Science and Engineering, Kyoto University, Kyoto 606-8501 (Japan); Ikeno, R; Motoyama, G; Kohara, T, E-mail: h.nakamura@ht8.ecs.kyoto-u.ac.j [Graduate School of Material Science, University of Hyogo, Kamigori, Hyogo 678-1297 (Japan)

    2009-01-01

    The magnetization process of single crystalline GaV4S8 including tetrahedral magnetic clusters was measured in the magnetically ordered state below T{sub C} {approx_equal} 13 K. Just below TC, steps were observed at very low fields of the order of 100 Oe, suggesting the competition of several intra- and inter-cluster interactions in a low energy range.

  20. Diffusion welding. [heat treatment of nickel alloys following single step vacuum welding process

    Holko, K. H. (Inventor)

    1974-01-01

    Dispersion-strengthened nickel alloys are sanded on one side and chemically polished. This is followed by a single-step welding process wherein the polished surfaces are forced into intimate contact at 1,400 F for one hour in a vacuum. Diffusion, recrystallization, and grain growth across the original weld interface are obtained during postheating at 2,150 F for two hours in hydrogen.

  1. Single-step electrochemical method for producing very sharp Au scanning tunneling microscopy tips

    Gingery, David; Buehlmann, Philippe

    2007-01-01

    A single-step electrochemical method for making sharp gold scanning tunneling microscopy tips is described. 3.0M NaCl in 1% perchloric acid is compared to several previously reported etchants. The addition of perchloric acid to sodium chloride solutions drastically shortens etching times and is shown by transmission electron microscopy to produce very sharp tips with a mean radius of curvature of 15 nm

  2. Single step synthesis, characterization and applications of curcumin functionalized iron oxide magnetic nanoparticles

    Bhandari, Rohit; Gupta, Prachi; Dziubla, Thomas; Hilt, J. Zach, E-mail: zach.hilt@uky.edu

    2016-10-01

    Magnetic iron oxide nanoparticles have been well known for their applications in magnetic resonance imaging (MRI), hyperthermia, targeted drug delivery, etc. The surface modification of these magnetic nanoparticles has been explored extensively to achieve functionalized materials with potential application in biomedical, environmental and catalysis field. Herein, we report a novel and versatile single step methodology for developing curcumin functionalized magnetic Fe{sub 3}O{sub 4} nanoparticles without any additional linkers, using a simple coprecipitation technique. The magnetic nanoparticles (MNPs) were characterized using transmission electron microscopy, X-ray diffraction, fourier transform infrared spectroscopy and thermogravimetric analysis. The developed MNPs were employed in a cellular application for protection against an inflammatory agent, a polychlorinated biphenyl (PCB) molecule. - Graphical abstract: Novel single step curcumin coated magnetic Fe{sub 3}O{sub 4} nanoparticles without any additional linkers for medical, environmental, and other applications. Display Omitted - Highlights: • A novel and versatile single step methodology for developing curcumin functionalized magnetic Fe{sub 3}O{sub 4} nanoparticles is reported. • The magnetic nanoparticles (MNPs) were characterized using TEM, XRD, FTIR and TGA. • The developed MNPs were employed in a cellular application for protection against an inflammatory agent, a polychlorinated biphenyl (PCB).

  3. Computing single step operators of logic programming in radial basis function neural networks

    Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong [School of Mathematical Sciences, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia)

    2014-07-10

    Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (T{sub p}:I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks.

  4. Computing single step operators of logic programming in radial basis function neural networks

    Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong

    2014-07-01

    Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (Tp:I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks.

  5. Computing single step operators of logic programming in radial basis function neural networks

    Hamadneh, Nawaf; Sathasivam, Saratha; Choon, Ong Hong

    2014-01-01

    Logic programming is the process that leads from an original formulation of a computing problem to executable programs. A normal logic program consists of a finite set of clauses. A valuation I of logic programming is a mapping from ground atoms to false or true. The single step operator of any logic programming is defined as a function (T p :I→I). Logic programming is well-suited to building the artificial intelligence systems. In this study, we established a new technique to compute the single step operators of logic programming in the radial basis function neural networks. To do that, we proposed a new technique to generate the training data sets of single step operators. The training data sets are used to build the neural networks. We used the recurrent radial basis function neural networks to get to the steady state (the fixed point of the operators). To improve the performance of the neural networks, we used the particle swarm optimization algorithm to train the networks

  6. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  7. Replication of UV-irradiated single-stranded DNA by DNA polymerase III holoenzyme of Escherichia coli: evidence for bypass of pyrimidine photodimers

    Livneh, Z.

    1986-01-01

    Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC 2.7.7.6) and DNA polymerase III holoenzyme (EC 2.7.7.7) in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins

  8. Compatibility of pedigree-based and marker-based relationship matrices for single-step genetic evaluation

    Christensen, Ole Fredslund

    2012-01-01

    Single-step methods for genomic prediction have recently become popular because they are conceptually simple and in practice such a method can completely replace a pedigree-based method for routine genetic evaluation. An issue with single-step methods is compatibility between the marker-based rel...

  9. Bridge flap technique as a single-step solution to mucogingival problems: A case series

    Vivek Gupta

    2011-01-01

    Full Text Available Shallow vestibule, gingival recession, inadequate width of attached gingiva (AG and aberrant frenum pull are an array of mucogingival problems for which several independent and effective surgical solutions are reported in the literature. This case series reports the effectiveness of the bridge flap technique as a single-step surgical entity for increasing the depth of the vestibule, root coverage, increasing the width of the AG and solving the problem of abnormal frenum pull. Eight patients with 18 teeth altogether having Millers class I, II or III recession along with problems of shallow vestibule, inadequate width of AG and with or without frenum pull underwent this surgical procedure and were followed-up till 9 months post-operatively. The mean root coverage obtained was 55% and the mean average gain in width of the AG was 3.5 mm. The mean percentage gain in clinical attachment level was 41%. The bridge flap technique can be an effective single-step solution for the aforementioned mucogingival problems if present simultaneously in any case, and offers considerable advantages over other mucogingival surgical techniques in terms of simplicity, limited chair-time for the patient and the operator, single surgical intervention for manifold mucogingival problems and low morbidity because of the absence of palatal donor tissue.

  10. Quickest single-step one pot mechanosynthesis and characterization of ZnTe quantum dots

    Patra, S. [Dept of Physics, University of Burdwan, Golapbag, Burdwan, West Bengal 713104 (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Dept of Physics, University of Burdwan, Golapbag, Burdwan, West Bengal 713104 (India)

    2011-05-05

    Research highlights: > First time quickest mechanosynthesis of ZnTe QDs starting from Zn and Te powders. > Cubic ZnTe are formed in a single pot at RT in a single step within 1 h of milling. > The existence of stacking faults and twin faults are evident from HRTEM images. > Distinct blue shift has been observed in UV-vis absorption spectra. > First time report that ZnTe QDs with faults can also show the quantum size effect. - Abstract: ZnTe quantum dots (QDs) are synthesized at room temperature in a single step by mechanical alloying the stoichiometric equimolar mixture (1:1 mol) of Zn and Te powders under Ar within 1 h of milling. Both XRD and HRTEM characterizations reveal that these QDs having size {approx}5 nm contain stacking faults of different kinds. A distinct blue-shift in absorption spectra with decreasing particle size of QDs confirms the quantum size confinement effect (QSCE). It is observed for first time that the QDs with considerable amount of faults can also show the QSCE. Optical band gaps of these QDs increase with increasing milling time and their band gaps can be fine-tuned easily by varying milling time of QDs.

  11. Single-Camera-Based Method for Step Length Symmetry Measurement in Unconstrained Elderly Home Monitoring.

    Cai, Xi; Han, Guang; Song, Xin; Wang, Jinkuan

    2017-11-01

    single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring. To build unconstrained monitoring environments, we propose a method to measure step length symmetry ratio (a useful gait parameter representing gait symmetry without significant relationship with age) from unconstrained straight walking using a single camera, without strict restrictions on walking directions or routes. according to projective geometry theory, we first develop a calculation formula of step length ratio for the case of unconstrained straight-line walking. Then, to adapt to general cases, we propose to modify noncollinear footprints, and accordingly provide general procedure for step length ratio extraction from unconstrained straight walking. Our method achieves a mean absolute percentage error (MAPE) of 1.9547% for 15 subjects' normal and abnormal side-view gaits, and also obtains satisfactory MAPEs for non-side-view gaits (2.4026% for 45°-view gaits and 3.9721% for 30°-view gaits). The performance is much better than a well-established monocular gait measurement system suitable only for side-view gaits with a MAPE of 3.5538%. Independently of walking directions, our method can accurately estimate step length ratios from unconstrained straight walking. This demonstrates our method is applicable for elders' daily gait monitoring to provide valuable information for elderly health care, such as abnormal gait recognition, fall risk assessment, etc. single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring

  12. A novel single-step, multipoint calibration method for instrumented Lab-on-Chip systems

    Pfreundt, Andrea; Patou, François; Zulfiqar, Azeem

    2014-01-01

    for instrument-based PoC blood biomarker analysis systems. Motivated by the complexity of associating high-accuracy biosensing using silicon nanowire field effect transistors with ease of use for the PoC system user, we propose a novel one-step, multipoint calibration method for LoC-based systems. Our approach...... specifically addresses the important interfaces between a novel microfluidic unit to integrate the sensor array and a mobile-device hardware accessory. A multi-point calibration curve is obtained by generating a defined set of reference concentrations from a single input. By consecutively splitting the flow...

  13. Fast Synthesis of High Quality Biodiesel from ‘Waste Fish Oil’ by Single Step Transesterification

    Yogesh C. Sharma

    2014-09-01

    Full Text Available A large volume of fish wastes is produced on a daily basis in the Indian sub-continent. This abundant waste source could serve as an economic feedstock for bioenergy generation. In the present study, oil extracted from discarded fish parts was used for high quality biodiesel production. More specifically, a single step transesterification of ‘waste fishoil’ with methanol using sodium methoxide (CH3ONa as homogeneous catalyst under moderate operational conditions resulted in highly pure biodiesel of > 98% of fatty acid methyl ester (FAME content. Characterization was performed by Fourier Transform-Nuclear Magnetic Resonance (FT-NMR.

  14. Binary Factorization in Hopfield-Like Neural Networks: Single-Step Approximation and Computer Simulations

    Frolov, A. A.; Sirota, A.M.; Húsek, Dušan; Muraviev, I. P.

    2004-01-01

    Roč. 14, č. 2 (2004), s. 139-152 ISSN 1210-0552 R&D Projects: GA ČR GA201/01/1192 Grant - others:BARRANDE(EU) 99010-2/99053; Intellectual computer Systems(EU) Grant 2.45 Institutional research plan: CEZ:AV0Z1030915 Keywords : nonlinear binary factor analysis * feature extraction * recurrent neural network * Single-Step approximation * neurodynamics simulation * attraction basins * Hebbian learning * unsupervised learning * neuroscience * brain function modeling Subject RIV: BA - General Mathematics

  15. Real-time, single-step bioassay using nanoplasmonic resonator with ultra-high sensitivity

    Zhang, Xiang; Ellman, Jonathan A; Chen, Fanqing Frank; Su, Kai-Hang; Wei, Qi-Huo; Sun, Cheng

    2014-04-01

    A nanoplasmonic resonator (NPR) comprising a metallic nanodisk with alternating shielding layer(s), having a tagged biomolecule conjugated or tethered to the surface of the nanoplasmonic resonator for highly sensitive measurement of enzymatic activity. NPRs enhance Raman signals in a highly reproducible manner, enabling fast detection of protease and enzyme activity, such as Prostate Specific Antigen (paPSA), in real-time, at picomolar sensitivity levels. Experiments on extracellular fluid (ECF) from paPSA-positive cells demonstrate specific detection in a complex bio-fluid background in real-time single-step detection in very small sample volumes.

  16. Electric field dependent paramagnetic defect creation in single step implanted Simox films

    Leray, J.L.; Margail, J.

    1991-01-01

    X irradiation induced oxygen-vacancy defect creation has been studied in SIMOX produced by single step implantation and annealing. It is shown that SIMOX is substantially more radiation sensitive (for these defects) than thermal or bulk oxide. Irradiation in the presence of an electric field 0.5 -1 MV cm -1 is found to enhance the rate of defect creation by ≥ 2 times. Further enhanced defect creation is observed in SIMOX samples whose substrate has been chemically thinned prior to irradiation. This enhancement is attributed to modification of the network induced by hydrogen introduced during the thinning process

  17. "Silicon millefeuille": From a silicon wafer to multiple thin crystalline films in a single step

    Hernández, David; Trifonov, Trifon; Garín, Moisés; Alcubilla, Ramon

    2013-04-01

    During the last years, many techniques have been developed to obtain thin crystalline films from commercial silicon ingots. Large market applications are foreseen in the photovoltaic field, where important cost reductions are predicted, and also in advanced microelectronics technologies as three-dimensional integration, system on foil, or silicon interposers [Dross et al., Prog. Photovoltaics 20, 770-784 (2012); R. Brendel, Thin Film Crystalline Silicon Solar Cells (Wiley-VCH, Weinheim, Germany 2003); J. N. Burghartz, Ultra-Thin Chip Technology and Applications (Springer Science + Business Media, NY, USA, 2010)]. Existing methods produce "one at a time" silicon layers, once one thin film is obtained, the complete process is repeated to obtain the next layer. Here, we describe a technology that, from a single crystalline silicon wafer, produces a large number of crystalline films with controlled thickness in a single technological step.

  18. A high-order positivity-preserving single-stage single-step method for the ideal magnetohydrodynamic equations

    Christlieb, Andrew J.; Feng, Xiao; Seal, David C.; Tang, Qi

    2016-07-01

    We propose a high-order finite difference weighted ENO (WENO) method for the ideal magnetohydrodynamics (MHD) equations. The proposed method is single-stage (i.e., it has no internal stages to store), single-step (i.e., it has no time history that needs to be stored), maintains a discrete divergence-free condition on the magnetic field, and has the capacity to preserve the positivity of the density and pressure. To accomplish this, we use a Taylor discretization of the Picard integral formulation (PIF) of the finite difference WENO method proposed in Christlieb et al. (2015) [23], where the focus is on a high-order discretization of the fluxes (as opposed to the conserved variables). We use the version where fluxes are expanded to third-order accuracy in time, and for the fluid variables space is discretized using the classical fifth-order finite difference WENO discretization. We use constrained transport in order to obtain divergence-free magnetic fields, which means that we simultaneously evolve the magnetohydrodynamic (that has an evolution equation for the magnetic field) and magnetic potential equations alongside each other, and set the magnetic field to be the (discrete) curl of the magnetic potential after each time step. In this work, we compute these derivatives to fourth-order accuracy. In order to retain a single-stage, single-step method, we develop a novel Lax-Wendroff discretization for the evolution of the magnetic potential, where we start with technology used for Hamilton-Jacobi equations in order to construct a non-oscillatory magnetic field. The end result is an algorithm that is similar to our previous work Christlieb et al. (2014) [8], but this time the time stepping is replaced through a Taylor method with the addition of a positivity-preserving limiter. Finally, positivity preservation is realized by introducing a parameterized flux limiter that considers a linear combination of high and low-order numerical fluxes. The choice of the free

  19. Stability of cell-free DNA from maternal plasma isolated following a single centrifugation step.

    Barrett, Angela N; Thadani, Henna A; Laureano-Asibal, Cecille; Ponnusamy, Sukumar; Choolani, Mahesh

    2014-12-01

    Cell-free fetal DNA can be used for prenatal testing with no procedure-related risk to the fetus. However, yield of fetal DNA is low compared with maternal cell-free DNA fragments, resulting in technical challenges for some downstream applications. To maximize the fetal fraction, careful blood processing procedures are essential. We demonstrate that fetal fraction can be preserved using a single centrifugation step followed by postage of plasma to the laboratory for further processing. Digital PCR was used to quantify copies of total, maternal, and fetal DNA present in single-spun plasma at time points over a two-week period, compared with immediately processed double-spun plasma, with storage at room temperature, 4°C, and -80°C representing different postage scenarios. There was no significant change in total, maternal, or fetal DNA copy numbers when single-spun plasma samples were stored for up to 1 week at room temperature and 2 weeks at -80°C compared with plasma processed within 4 h. Following storage at 4°C no change in composition of cell-free DNA was observed. Single-spun plasma can be transported at room temperature if the journey is expected to take one week or less; shipping on dry ice is preferable for longer journeys. © 2014 John Wiley & Sons, Ltd.

  20. Single-Stage Step up/down Driver for Permanent-Magnet Synchronous Machines

    Chen, T. R.; Juan, Y. L.; Huang, C. Y.; Kuo, C. T.

    2017-11-01

    The two-stage circuit composed of a step up/down dc converter and a three-phase voltage source inverter is usually adopted as the electric vehicle’s motor driver. The conventional topology is more complicated. Additional power loss resulted from twice power conversion would also cause lower efficiency. A single-stage step up/down Permanent-Magnet Synchronous Motor driver for Brushless DC (BLDC) Motor is proposed in this study. The number components and circuit complexity are reduced. The low frequency six-step square-wave control is used to reduce the switching losses. In the proposed topology, only one active switch is gated with a high frequency PWM signal for adjusting the rotation speed. The rotor position signals are fed back to calculate the motor speed for digital close-loop control in a MCU. A 600W prototype circuit is constructed to drive a BLDC motor with rated speed 3000 rpm, and can control the speed of six sections.

  1. Antibacterial and cytocompatible nanotextured Ti surface incorporating silver via single step hydrothermal processing

    Mohandas, Anu; Krishnan, Amit G.; Biswas, Raja; Menon, Deepthy, E-mail: deepthymenon@aims.amrita.edu; Nair, Manitha B., E-mail: manithanair@aims.amrita.edu

    2017-06-01

    Nanosurface modification of Titanium (Ti) implants and prosthesis is proved to enhance osseointegration at the tissue–implant interface. However, many of these products lack adequate antibacterial capability, which leads to implant loosening. As a curative strategy, in this study, nanotextured Ti substrates embedded with silver nanoparticles were developed through a single step hydrothermal processing in an alkaline medium containing silver nitrate at different concentrations (15, 30 and 75 μM). Scanning electron micrographs revealed a non-periodically oriented nanoleafy structure on Ti (TNL) decorated with Ag nanoparticles (nanoAg), which was verified by XPS, XRD and EDS analysis. This TNLAg substrate proved to be mechanically stable upon nanoindentation and nanoscratch tests. Silver ions at detectable levels were released for a period of ~ 28 days only from substrates incorporating higher nanoAg content. The samples demonstrated antibacterial activity towards both Escherichia coli and Staphylococcus aureus, with a more favorable response to the former. Simultaneously, Ti substrates incorporating nanoAg at all concentrations supported the viability, proliferation and osteogenic differentiation of mesenchymal stem cells. Overall, nanoAg incorporation into surface modified Ti via a simple one-step thermochemical method is a favorable strategy for producing implants with dual characteristics of antibacterial activity and cell compatibility. - Highlights: • Nanosilver was incorporated within Ti nanoleafy topography by simple one-step thermochemical method • The nanosurface demonstrated antibacterial activity against gram positive and gram negative bacteria • The nanosurface promoted the viability, proliferation and osteogenic differentiation of mesenchymal stem cells.

  2. Fabrication of Polydimethylsiloxane Microlenses Utilizing Hydrogel Shrinkage and a Single Molding Step

    Bader Aldalali

    2014-05-01

    Full Text Available We report on polydimethlysiloxane (PDMS microlenses and microlens arrays on flat and curved substrates fabricated via a relatively simple process combining liquid-phase photopolymerization and a single molding step. The mold for the formation of the PDMS lenses is fabricated by photopolymerizing a polyacrylamide (PAAm pre-hydrogel. The shrinkage of PAAm after its polymerization forms concave lenses. The lenses are then transferred to PDMS by a single step molding to form PDMS microlens array on a flat substrate. The PAAm concave lenses are also transferred to PDMS and another flexible polymer, Solaris, to realize artificial compound eyes. The resultant microlenses and microlens arrays possess good uniformity and optical properties. The focal length of the lenses is inversely proportional to the shrinkage time. The microlens mold can also be rehydrated to change the focal length of the ultimate PDMS microlenses. The spherical aberration is 2.85 μm and the surface roughness is on the order of 204 nm. The microlenses can resolve 10.10 line pairs per mm (lp/mm and have an f-number range between f/2.9 and f/56.5. For the compound eye, the field of view is 113°.

  3. Single-step fabrication of electrodes with controlled nanostructured surface roughness using optically-induced electrodeposition

    Liu, N.; Li, M.; Liu, L.; Yang, Y.; Mai, J.; Pu, H.; Sun, Y.; Li, W. J.

    2018-02-01

    The customized fabrication of microelectrodes from gold nanoparticles (AuNPs) has attracted much attention due to their numerous applications in chemistry and biomedical engineering, such as for surface-enhanced Raman spectroscopy (SERS) and as catalyst sites for electrochemistry. Herein, we present a novel optically-induced electrodeposition (OED) method for rapidly fabricating gold electrodes which are also surface-modified with nanoparticles in one single step. The electrodeposition mechanism, with respect to the applied AC voltage signal and the elapsed deposition time, on the resulting morphology and particle sizes was investigated. The results from SEM and AFM analysis demonstrated that 80-200 nm gold particles can be formed on the surface of the gold electrodes. Simultaneously, both the size of the nanoparticles and the roughness of the fabricated electrodes can be regulated by the deposition time. Compared to state-of-the-art methods for fabricating microelectrodes with AuNPs, such as nano-seed-mediated growth and conventional electrodeposition, this OED technique has several advantages including: (1) electrode fabrication and surface modification using nanoparticles are completed in a single step, eliminating the need for prefabricating micro electrodes; (2) the patterning of electrodes is defined using a digitally-customized, projected optical image rather than using fixed physical masks; and (3) both the fabrication and surface modification processes are rapid, and the entire fabrication process only requires less than 6 s.

  4. Structural comparison of anodic nanoporous-titania fabricated from single-step and three-step of anodization using two paralleled-electrodes anodizing cell

    Mallika Thabuot

    2016-02-01

    Full Text Available Anodization of Ti sheet in the ethylene glycol electrolyte containing 0.38wt% NH4F with the addition of 1.79wt% H2O at room temperature was studied. Applied potential of 10-60 V and anodizing time of 1-3 h were conducted by single-step and three-step of anodization within the two paralleled-electrodes anodizing cell. Their structural and textural properties were investigated by X-ray diffraction (XRD and scanning electron microscopy (SEM. After annealing at 600°C in the air furnace for 3 h, TiO2-nanotubes was transformed to the higher proportion of anatase crystal phase. Also crystallization of anatase phase was enhanced as the duration of anodization as the final step increased. By using single-step of anodization, pore texture of oxide film was started to reveal at the applied potential of 30 V. Better orderly arrangement of the TiO2-nanotubes array with larger pore size was obtained with the increase of applied potential. The applied potential of 60 V was selected for the three-step of anodization with anodizing time of 1-3 h. Results showed that the well-smooth surface coverage with higher density of porous-TiO2 was achieved using prolonging time at the first and second step, however, discontinuity tube in length was produced instead of the long-vertical tube. Layer thickness of anodic oxide film depended on the anodizing time at the last step of anodization. More well arrangement of nanostructured-TiO2 was produced using three-step of anodization under 60 V with 3 h for each step.

  5. A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

    Yap, Thai Leong; Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G.; Lescar, Julien

    2007-01-01

    Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration

  6. A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

    Yap, Thai Leong [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore); Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G. [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); Lescar, Julien, E-mail: julien@ntu.edu.sg [Novartis Institute for Tropical Diseases, 10 Biopolis Road, Chromos Building, Singapore 138670 (Singapore); School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637551 (Singapore)

    2007-02-01

    Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.

  7. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

    Pierce, Kenneth E; Wangh, Lawrence J

    2007-01-01

    Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

  9. DNA polymerase I-mediated repair of 365 nm-induced single-strand breaks in the DNA of Escherichia coli

    Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)

    1978-03-01

    Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.

  10. Single step synthesis and organization of gold colloids assisted by copolymer templates

    Sarrazin, Aurélien; Gontier, Arthur; Plaud, Alexandre; Béal, Jérémie; Yockell-Lelièvre, Hélène; Bijeon, Jean-Louis; Plain, Jérôme; Adam, Pierre-Michel; Maurer, Thomas

    2014-01-01

    We report here an original single-step process for the synthesis and self-organization of gold colloids by simply incorporating gold salts into a solution prepared using polystyrene (PS)-polymethylmethacrylate copolymer and thiolated PS with propylene glycol methyl ether acetate as a solvent. The spin-coating and annealing of this solution then allows the formation of PS domains. Depending on the polymer concentration of the as-prepared solution, there can be either one or several gold nanoparticles (Au NPs) per PS domain. For high concentrations of Au NPs in PS domains, the coupling between plasmonic NPs leads to the observation of a second peak in the optical extinction spectrum. Such a collective effect could be relevant for the development of optical strain sensors in the near future. (papers)

  11. Single step synthesis and organization of gold colloids assisted by copolymer templates

    Sarrazin, Aurélien; Gontier, Arthur; Plaud, Alexandre; Béal, Jérémie; Yockell-Lelièvre, Hélène; Bijeon, Jean-Louis; Plain, Jérôme; Adam, Pierre-Michel; Maurer, Thomas

    2014-06-01

    We report here an original single-step process for the synthesis and self-organization of gold colloids by simply incorporating gold salts into a solution prepared using polystyrene (PS)-polymethylmethacrylate copolymer and thiolated PS with propylene glycol methyl ether acetate as a solvent. The spin-coating and annealing of this solution then allows the formation of PS domains. Depending on the polymer concentration of the as-prepared solution, there can be either one or several gold nanoparticles (Au NPs) per PS domain. For high concentrations of Au NPs in PS domains, the coupling between plasmonic NPs leads to the observation of a second peak in the optical extinction spectrum. Such a collective effect could be relevant for the development of optical strain sensors in the near future.

  12. Single step vacuum-free and hydrogen-free synthesis of graphene

    Christian Orellana

    2017-08-01

    Full Text Available We report a modified method to grow graphene in a single-step process. It is based on chemical vapor deposition and considers the use of methane under extremely adverse synthesis conditions, namely in an open chamber without requiring the addition of gaseous hydrogen in any of the synthesis stages. The synthesis occurs between two parallel Cu plates, heated up via electromagnetic induction. The inductive heating yields a strong thermal gradient between the catalytic substrates and the surrounding environment, promoting the enrichment of hydrogen generated as fragments of the methane molecules within the volume confined by the Cu foils. This induced density gradient is due to thermo-diffusion, also known as the Soret effect. Hydrogen and other low mass molecular fractions produced during the process inhibit oxidative effects and simultaneously reduce the native oxide on the Cu surface. As a result, high quality graphene is obtained on the inner surfaces of the Cu sheets as confirmed by Raman spectroscopy.

  13. Cp2 TiX Complexes for Sustainable Catalysis in Single-Electron Steps.

    Richrath, Ruben B; Olyschläger, Theresa; Hildebrandt, Sven; Enny, Daniel G; Fianu, Godfred D; Flowers, Robert A; Gansäuer, Andreas

    2018-04-25

    We present a combined electrochemical, kinetic, and synthetic study with a novel and easily accessible class of titanocene catalysts for catalysis in single-electron steps. The tailoring of the electronic properties of our Cp 2 TiX-catalysts that are prepared in situ from readily available Cp 2 TiX 2 is achieved by varying the anionic ligand X. Of the complexes investigated, Cp 2 TiOMs proved to be either equal or substantially superior to the best catalysts developed earlier. The kinetic and thermodynamic properties pertinent to catalysis have been determined. They allow a mechanistic understanding of the subtle interplay of properties required for an efficient oxidative addition and reduction. Therefore, our study highlights that efficient catalysts do not require the elaborate covalent modification of the cyclopentadienyl ligands. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Single-Step Generation of Conditional Knockout Mouse Embryonic Stem Cells

    Matyas Flemr

    2015-07-01

    Full Text Available Induction of double-strand DNA breaks (DSBs by engineered nucleases, such as CRISPR/Cas9 or transcription activator-like effector nucleases (TALENs, stimulates knockin of exogenous DNA fragments via homologous recombination (HR. However, the knockin efficiencies reported so far have not allowed more complex in vitro genome modifications such as, for instance, simultaneous integration of a DNA fragment at two distinct genomic sites. We developed a reporter system to enrich for cells with engineered nuclease-assisted HR events. Using this system in mouse embryonic stem cells (mESCs, we achieve single-step biallelic and seamless integration of two loxP sites for Cre recombinase-mediated inducible gene knockout, as well as biallelic endogenous gene tagging with high efficiency. Our approach reduces the time and resources required for conditional knockout mESC generation dramatically.

  15. Analytic observations for the d=1+ 1 bridge site (or single-step) deposition model

    Evans, J.W.; Kang, H.C.

    1991-01-01

    Some exact results for a reversible version of the d=1+1 bridge site (or single-step) deposition model are presented. Exact steady-state properties are determined directly for finite systems with various mean slopes. These show explicitly how the asymptotic growth velocity and fluctuations are quenched as the slope approaches its maximum allowed value. Next, exact hierarchial equations for the dynamics are presented. For the special case of ''equilibrium growth,'' these are analyzed exactly at the pair-correlation level directly for an infinite system. This provided further insight into asymptotic scaling behavior. Finally, the above hierarchy is compared with one generated from a discrete form of the Kardar--Parisi--Zhang equations. Some differences are described

  16. Single-step controlled-NOT logic from any exchange interaction

    Galiautdinov, Andrei

    2007-11-01

    A self-contained approach to studying the unitary evolution of coupled qubits is introduced, capable of addressing a variety of physical systems described by exchange Hamiltonians containing Rabi terms. The method automatically determines both the Weyl chamber steering trajectory and the accompanying local rotations. Particular attention is paid to the case of anisotropic exchange with tracking controls, which is solved analytically. It is shown that, if computational subspace is well isolated, any exchange interaction can always generate high fidelity, single-step controlled-NOT (CNOT) logic, provided that both qubits can be individually manipulated. The results are then applied to superconducting qubit architectures, for which several CNOT gate implementations are identified. The paper concludes with consideration of two CNOT gate designs having high efficiency and operating with no significant leakage to higher-lying noncomputational states.

  17. Separation of Be and Al for AMS using single-step column chromatography

    Binnie, Steven A., E-mail: sbinnie@uni-koeln.de [Institute for Geology und Mineralogy, University of Cologne, 4-6 Greinstrasse, Cologne D-50939 (Germany); Dunai, Tibor J.; Voronina, Elena; Goral, Tomasz [Institute for Geology und Mineralogy, University of Cologne, 4-6 Greinstrasse, Cologne D-50939 (Germany); Heinze, Stefan; Dewald, Alfred [University of Cologne, Institut für Kernphysik, Zülpicher Str. 77, Cologne D-50937 (Germany)

    2015-10-15

    With the aim of simplifying AMS target preparation procedures for TCN measurements we tested a new extraction chromatography approach which couples an anion exchange resin (WBEC) to a chelating resin (Beryllium resin) to separate Be and Al from dissolved quartz samples. Results show that WBEC–Beryllium resin stacks can be used to provide high purity Be and Al separations using a combination of hydrochloric/oxalic and nitric acid elutions. {sup 10}Be and {sup 26}Al concentrations from quartz samples prepared using more standard procedures are compared with results from replicate samples prepared using the coupled WBEC–Beryllium resin approach and show good agreement. The new column procedure is performed in a single step, reducing sample preparation times relative to more traditional methods of TCN target production.

  18. Separation of Be and Al for AMS using single-step column chromatography

    Binnie, Steven A.; Dunai, Tibor J.; Voronina, Elena; Goral, Tomasz; Heinze, Stefan; Dewald, Alfred

    2015-10-01

    With the aim of simplifying AMS target preparation procedures for TCN measurements we tested a new extraction chromatography approach which couples an anion exchange resin (WBEC) to a chelating resin (Beryllium resin) to separate Be and Al from dissolved quartz samples. Results show that WBEC-Beryllium resin stacks can be used to provide high purity Be and Al separations using a combination of hydrochloric/oxalic and nitric acid elutions. 10Be and 26Al concentrations from quartz samples prepared using more standard procedures are compared with results from replicate samples prepared using the coupled WBEC-Beryllium resin approach and show good agreement. The new column procedure is performed in a single step, reducing sample preparation times relative to more traditional methods of TCN target production.

  19. Single step biotransformation of corn oil phytosterols to boldenone by a newly isolated Pseudomonas aeruginosa

    Mohamed Eisa

    2016-09-01

    Full Text Available A new potent Pseudomonas aeruginosa isolate capable for biotransformation of corn oil phytosterol (PS to 4-androstene-3, 17-dione (AD, testosterone (T and boldenone (BOL was identified by phenotypic analysis and 16S rRNA gene sequencing. Sequential statistical strategy was used to optimize the biotransformation process mainly concerning BOL using Factorial design and response surface methodology (RSM. The production of BOL in single step microbial biotransformation from corn oil phytosterols by P. aeruginosa was not previously reported. Results showed that the pH concentration of the medium, (NH42SO4 and KH2PO4 were the most significant factors affecting BOL production. By analyzing the statistical model of three-dimensional surface plot, BOL production increased from 36.8% to 42.4% after the first step of optimization, and the overall biotransformation increased to 51.9%. After applying the second step of the sequential statistical strategy BOL production increased to 53.6%, and the overall biotransformation increased to 91.9% using the following optimized medium composition (g/l distilled water (NH42SO4, 2; KH2PO4, 4; Na2HPO4. 1; MgSO4·7H2O, 0.3; NaCl, 0.1; CaCl2·2H2O, 0.1; FeSO4·7H2O, 0.001; ammonium acetate 0.001; Tween 80, 0.05%; corn oil 0.5%; 8-hydroxyquinoline 0.016; pH 8; 200 rpm agitation speed and incubation time 36 h at 30 °C. Validation experiments proved the adequacy and accuracy of model, and the results showed the predicted value agreed well with the experimental values.

  20. Comparison of single-entry and double-entry two-step couple screening for cystic fibrosis carriers

    tenKate, LP; Verheij, JBGM; Wildhagen, MF; Hilderink, HBM; Kooij, L; Verzijl, JG; Habbema, JDF

    1996-01-01

    Both single-entry two-step (SETS) couple screening and double-entry two-step (DETS) couple screening have been recommended as methods to screen for cystic fibrosis gene carriers. In this paper we compare the expected results from both types of screening. In general, DETS results in a higher

  1. Cellobiohydrolase 1 from Trichoderma reesei degrades cellulose in single cellobiose steps

    Brady, Sonia K.; Sreelatha, Sarangapani; Feng, Yinnian; Chundawat, Shishir P. S.; Lang, Matthew J.

    2015-12-01

    Cellobiohydrolase 1 from Trichoderma reesei (TrCel7A) processively hydrolyses cellulose into cellobiose. Although enzymatic techniques have been established as promising tools in biofuel production, a clear understanding of the motor's mechanistic action has yet to be revealed. Here, we develop an optical tweezers-based single-molecule (SM) motility assay for precision tracking of TrCel7A. Direct observation of motility during degradation reveals processive runs and distinct steps on the scale of 1 nm. Our studies suggest TrCel7A is not mechanically limited, can work against 20 pN loads and speeds up when assisted. Temperature-dependent kinetic studies establish the energy requirements for the fundamental stepping cycle, which likely includes energy from glycosidic bonds and other sources. Through SM measurements of isolated TrCel7A domains, we determine that the catalytic domain alone is sufficient for processive motion, providing insight into TrCel7A's molecular motility mechanism.

  2. Determination of beam intensity in a single step for IMRT inverse planning

    Chuang, Keh-Shih; Chen, Tzong-Jer; Kuo, Shan-Chi; Jan, Meei-Ling; Hwang, Ing-Ming; Chen, Sharon; Lin, Ying-Chuan; Wu, Jay

    2003-01-01

    In intensity modulated radiotherapy (IMRT), targets are treated by multiple beams at different orientations each with spatially-modulated beam intensities. This approach spreads the normal tissue dose to a greater volume and produces a higher dose conformation to the target. In general, inverse planning is used for IMRT treatment planning. The inverse planning requires iterative calculation of dose distribution in order to optimize the intensity profile for each beam and is very computation intensive. In this paper, we propose a single-step method utilizing a figure of merit (FoM) to estimate the beam intensities for IMRT treatment planning. The FoM of a ray is defined as the ratio between the delivered tumour dose and normal tissue dose and is a good index for the dose efficacy of the ray. To maximize the beam utility, it is natural to irradiate the tumour with intensity of each ray proportional to the value of the FoM. The nonuniform beam intensity profiles are then fixed and the weights of the beam are determined iteratively in order to yield a uniform tumour dose. In this study, beams are employed at equispaced angles around the patient. Each beam with its field size that just covers the tumour is divided into a fixed number of beamlets. The FoM is calculated for each beamlet and this value is assigned to be the beam intensity. Various weighting factors are incorporated in the FoM computation to accommodate different clinical considerations. Two clinical datasets are used to test the feasibility of the algorithm. The resultant dose-volume histograms of this method are presented and compared to that of conformal therapy. Preliminary results indicate that this method reduces the critical organ doses at a small expense of uniformity in tumour dose distribution. This method estimates the beam intensity in one single step and the computation time is extremely fast and can be finished in less than one minute using a regular PC

  3. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  4. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  5. Single-step colloidal quantum dot films for infrared solar harvesting

    Kiani, Amirreza

    2016-11-01

    Semiconductors with bandgaps in the near- to mid-infrared can harvest solar light that is otherwise wasted by conventional single-junction solar cell architectures. In particular, colloidal quantum dots (CQDs) are promising materials since they are cost-effective, processed from solution, and have a bandgap that can be tuned into the infrared (IR) via the quantum size effect. These characteristics enable them to harvest the infrared portion of the solar spectrum to which silicon is transparent. To date, IR CQD solar cells have been made using a wasteful and complex sequential layer-by-layer process. Here, we demonstrate ∼1 eV bandgap solar-harvesting CQD films deposited in a single step. By engineering a fast-drying solvent mixture for metal iodide-capped CQDs, we deposited active layers greater than 200 nm in thickness having a mean roughness less than 1 nm. We integrated these films into infrared solar cells that are stable in air and exhibit power conversion efficiencies of 3.5% under illumination by the full solar spectrum, and 0.4% through a simulated silicon solar cell filter.

  6. Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

    Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

    2017-07-26

    Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

  7. Complex single step skull reconstruction in Gorham's disease - a technical report and review of the literature.

    Ohla, Victoria; Bayoumi, Ahmed B; Hefty, Markus; Anderson, Matthew; Kasper, Ekkehard M

    2015-03-11

    Gorham's disease is a rare osteolytic disorder characterized by progressive resorption of bone and replacement of osseous matrix by a proliferative non-neoplastic vascular or lymphatic tissue. A standardized treatment protocol has not yet been defined due to the unpredictable natural history of the disease and variable clinical presentations. No single treatment has proven to be superior in arresting the course of the disease. Trials have included surgery, radiation and medical therapies using drugs such as calcium salts, vitamin D supplements and hormones. We report on our advantageous experience in the management of this osteolyic disorder in a case when it affected only the skull vault. A brief review of pertinent literature about Gorham's disease with skull involvement is provided. A 25-year-old Caucasian male presented with a skull depression over the left fronto-temporal region. He noticed progressive enlargement of the skull defect associated with local pain and mild headache. Physical examination revealed a tender palpable depression of the fronto-temporal convexity. Conventional X-ray of the skull showed widespread loss of bone substance. Subsequent CT scans showed features of patchy erosions indicative of an underlying osteolysis. MRI also revealed marginal enhancement at the site of the defect. The patient was in need of a pathological diagnosis as well as complex reconstruction of the afflicted area. A density graded CT scan was done to determine the variable degrees of osteolysis and a custom made allograft was designed for cranioplasty preoperatively to allow for a single step excisional craniectomy with synchronous skull repair. Gorham's disease was diagnosed based on histopathological examination. No neurological deficit or wound complications were reported postoperatively. Over a two-year follow up period, the patient had no evidence of local recurrence or other systemic involvement. A single step excisional craniectomy and cranioplasty can be an

  8. A new plastic scintillation resin for single-step separation, concentration and measurement of technetium-99.

    Barrera, J; Tarancón, A; Bagán, H; García, J F

    2016-09-14

    Technetium is a synthetic element with no stable isotopes, produced as waste in nuclear power plants and in cyclotrons used for nuclear medicine. The element has high mobility, in the form of TcO4(-); its determination is therefore important for environmental protection. Technetium is found in low concentrations and therefore common methods for its analysis include long treatments in several steps and require large amounts of reagents for its purification and preconcentration. Plastic scintillation resins (PSresin) are novel materials used to separate, preconcentrate and measure radionuclides in a single step. The objective of this study is to prepare and characterise a PSresin for the preconcentration and measurement of (99)Tc. The study first evaluates the reproducibility of the production of PSresins between batches and over time; showing good reproducibility and storage stability. Next, we studied the effect of some common non-radioactive interferences, showing small influences on measurement, and radioactive interferences ((36)Cl and (238)U/(234)U). (36)Cl can be removed by a simple treatment with 0.5 M HCl and (238)U/(234)U can be removed from the column by cleaning with a mixture of 0.1 M HNO3 and 0.1 M HF. In the latter case, a slight change in the morphology of the PSresin caused an increase in detection efficiency. Finally, the PSresin was applied to the measurement of real spiked samples (sea water and urine) with deviations lower than 10% in all cases. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. A new plastic scintillation resin for single-step separation, concentration and measurement of technetium-99

    Barrera, J. [Department of Analytical Chemistry, Universitat de Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Tarancón, A., E-mail: alex.tarancon@ub.edu [Department of Analytical Chemistry, Universitat de Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Bagán, H. [Department of Pure and Applied Biochemistry, Lund University, Getingevägen 60, hus II, 22100 SE, Lund (Sweden); García, J.F. [Department of Analytical Chemistry, Universitat de Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain)

    2016-09-14

    Technetium is a synthetic element with no stable isotopes, produced as waste in nuclear power plants and in cyclotrons used for nuclear medicine. The element has high mobility, in the form of TcO{sub 4}{sup −}; its determination is therefore important for environmental protection. Technetium is found in low concentrations and therefore common methods for its analysis include long treatments in several steps and require large amounts of reagents for its purification and preconcentration. Plastic scintillation resins (PSresin) are novel materials used to separate, preconcentrate and measure radionuclides in a single step. The objective of this study is to prepare and characterise a PSresin for the preconcentration and measurement of {sup 99}Tc. The study first evaluates the reproducibility of the production of PSresins between batches and over time; showing good reproducibility and storage stability. Next, we studied the effect of some common non-radioactive interferences, showing small influences on measurement, and radioactive interferences ({sup 36}Cl and {sup 238}U/{sup 234}U). {sup 36}Cl can be removed by a simple treatment with 0.5 M HCl and {sup 238}U/{sup 234}U can be removed from the column by cleaning with a mixture of 0.1 M HNO{sub 3} and 0.1 M HF. In the latter case, a slight change in the morphology of the PSresin caused an increase in detection efficiency. Finally, the PSresin was applied to the measurement of real spiked samples (sea water and urine) with deviations lower than 10% in all cases. - Highlights: • A plastic scintillation resin for selective analysis of {sup 99}Tc has been developed. • The method is valid for analysis of {sup 99}Tc in seawater and urine samples. • Presence of Cl{sup −}, NO{sub 3}{sup −}, SO{sub 4}{sup 2−}, {sup 36}Cl, U and Th not affect retention of {sup 99}Tc.

  10. Well-Defined Silica Supported Aluminum Hydride: Another Step Towards the Utopian Single Site Dream?

    Werghi, Baraa; Bendjeriou-Sedjerari, Anissa; Sofack-Kreutzer, Julien; Jedidi, Abdesslem; Abou-Hamad, Edy; Cavallo, Luigi; Basset, Jean-Marie

    2015-01-01

    Reaction of triisobutylaluminum with SBA15700 at room temperature occurs by two parallel pathways involving either silanol or siloxane bridges. It leads to the formation of a well-defined bipodal [(≡SiO)2Al-CH2CH(CH3)2] 1a, silicon isobutyl [≡Si-CH2CH(CH3)2] 1b and a silicon hydride [≡Si-H] 1c. Their structural identity was characterized by FT-IR and advance solid-state NMR spectroscopies (1H, 13C, 29Si, 27Al and 2D multiple quantum), elemental and gas phase analysis, and DFT calculations. The reaction involves the formation of a highly reactive monopodal intermediate: [≡SiO-Al-[CH2CH(CH3)2]2], with evolution of isobutane. This intermediate undergoes two parallel routes: Transfer of either one isobutyl fragment or of one hydride to an adjacent silicon atom. Both processes occur by opening of a strained siloxane bridge, ≡Si-O-Si≡ but with two different mechanisms, showing that the reality of “single site” catalyst may be an utopia: DFT calculations indicate that isobutyl transfer occurs via a simple metathesis between the Al-isobutyl and O-Si bonds, while hydride transfer occurs via a two steps mechanism, the first one is a ß-H elimination to Al with elimination of isobutene, whereas the second is a metathesis step between the formed Al-H bond and a O-Si bond. Thermal treatment of 1a (at 250 °C) under high vacuum (10-5 mbar) generates Al-H through a ß-H elimination of isobutyl fragment. These supported well-defined Al-H which are highly stable with time, are tetra, penta and octa coordinated as demonstrated by IR and 27Al–1H J-HMQC NMR spectroscopy. All these observations indicate that surfaces atoms around the site of grafting play a considerable role in the reactivity of a single site system.

  11. Well-Defined Silica Supported Aluminum Hydride: Another Step Towards the Utopian Single Site Dream?

    Werghi, Baraa

    2015-07-17

    Reaction of triisobutylaluminum with SBA15700 at room temperature occurs by two parallel pathways involving either silanol or siloxane bridges. It leads to the formation of a well-defined bipodal [(≡SiO)2Al-CH2CH(CH3)2] 1a, silicon isobutyl [≡Si-CH2CH(CH3)2] 1b and a silicon hydride [≡Si-H] 1c. Their structural identity was characterized by FT-IR and advance solid-state NMR spectroscopies (1H, 13C, 29Si, 27Al and 2D multiple quantum), elemental and gas phase analysis, and DFT calculations. The reaction involves the formation of a highly reactive monopodal intermediate: [≡SiO-Al-[CH2CH(CH3)2]2], with evolution of isobutane. This intermediate undergoes two parallel routes: Transfer of either one isobutyl fragment or of one hydride to an adjacent silicon atom. Both processes occur by opening of a strained siloxane bridge, ≡Si-O-Si≡ but with two different mechanisms, showing that the reality of “single site” catalyst may be an utopia: DFT calculations indicate that isobutyl transfer occurs via a simple metathesis between the Al-isobutyl and O-Si bonds, while hydride transfer occurs via a two steps mechanism, the first one is a ß-H elimination to Al with elimination of isobutene, whereas the second is a metathesis step between the formed Al-H bond and a O-Si bond. Thermal treatment of 1a (at 250 °C) under high vacuum (10-5 mbar) generates Al-H through a ß-H elimination of isobutyl fragment. These supported well-defined Al-H which are highly stable with time, are tetra, penta and octa coordinated as demonstrated by IR and 27Al–1H J-HMQC NMR spectroscopy. All these observations indicate that surfaces atoms around the site of grafting play a considerable role in the reactivity of a single site system.

  12. Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis.

    Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

    2015-03-01

    A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).

  13. SYBR green-based one step quantitative real-time polymerase chain reaction assay for the detection of Zika virus in field-caught mosquitoes.

    Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha

    2017-09-19

    The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.

  14. An Immunofluorescence-assisted Microfluidic Single Cell Quantitative Reverse Transcription Polymerase Chain Reaction Analysis of Tumour Cells Separated from Blood

    Kazunori Hoshino

    2015-11-01

    matched the results from a few thousand cells. Some markers (e.g., ER, HER2 that are commonly used for cancer identification showed relatively large deviations in expres‐ sion levels. However, others (e.g., GRB7 showed devia‐ tions that are small enough to supplement single cell disease profiling.

  15. Single step production of Cas9 mRNA for zygote injection.

    Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

    2018-03-01

    Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

  16. Evaluating tamsulosin hydrochloride-released microparticles prepared using single-step matrix coating.

    Maeda, Atsushi; Shinoda, Tatsuki; Ito, Naoki; Baba, Keizo; Oku, Naoto; Mizumoto, Takao

    2011-04-15

    The objective of the present study was to determine the optimum composition for sustained-release of tamsulosin hydrochloride from microparticles intended for orally disintegrating tablets. Microparticles were prepared from an aqueous ethylcellulose dispersion (Aquacoa®), and an aqueous copolymer based on ethyl acrylate and methyl methacrylate dispersion (Eudragit®) NE30D), with microcrystalline cellulose as core particles with a fluidized bed coating process. Prepared microparticles were about 200 μm diameter and spherical. The microparticles were evaluated for in vitro drug release and in vivo absorption to assess bioequivalence in a commercial product, Harnal® pellets. The optimum ratio of Aquacoat® and Eudragit® NE30D in the matrix was 9:1. We observed similar drug release profiles in microparticles and Harnal® pellets. Higuchi model analysis of the in vitro drug release from microparticles was linear up to 80% release, typical of Fickian diffusion sustained-release profile. The in vivo absorption properties from microparticles were comparable to Harnal® pellets, and there was a linear relationship between in vitro drug release and in vivo drug release. In conclusion, this development produces microparticles in single-step coating, that provided a sustained-release of tamsulosin hydrochloride comparable to Harnal® pellets. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Single-step laser-based fabrication and patterning of cell-encapsulated alginate microbeads

    Kingsley, D M; Dias, A D; Corr, D T; Chrisey, D B

    2013-01-01

    Alginate can be used to encapsulate mammalian cells and for the slow release of small molecules. Packaging alginate as microbead structures allows customizable delivery for tissue engineering, drug release, or contrast agents for imaging. However, state-of-the-art microbead fabrication has a limited range in achievable bead sizes, and poor control over bead placement, which may be desired to localize cellular signaling or delivery. Herein, we present a novel, laser-based method for single-step fabrication and precise planar placement of alginate microbeads. Our results show that bead size is controllable within 8%, and fabricated microbeads can remain immobilized within 2% of their target placement. Demonstration of this technique using human breast cancer cells shows that cells encapsulated within these microbeads survive at a rate of 89.6%, decreasing to 84.3% after five days in culture. Infusing rhodamine dye into microbeads prior to fluorescent microscopy shows their 3D spheroidal geometry and the ability to sequester small molecules. Microbead fabrication and patterning is compatible with conventional cellular transfer and patterning by laser direct-write, allowing location-based cellular studies. While this method can also be used to fabricate microbeads en masse for collection, the greatest value to tissue engineering and drug delivery studies and applications lies in the pattern registry of printed microbeads. (paper)

  18. Single step, pH induced gold nanoparticle chain formation in lecithin/water system.

    Sharma, Damyanti

    2013-07-01

    Gold nanoparticle (AuNP) chains have been formed by a single step method in a lecithin/water system where lecithin itself plays the role of a reductant and a template for AuNP chain formation. Two preparative strategies were explored: (1) evaporating lecithin solution with aqueous gold chloride (HAuCl4) at different pHs and (2) dispersing lecithin vesicles in aqueous HAuCl4 solutions of various pHs in the range of 2.5-11.3. In method 1, at initial pH 2.5, 20-50 nm AuNPs are found attached to lecithin vesicles. When pH is raised to 5.5 there are no vesicles present and 20 nm monodisperse particles are found aggregating. Chain formation of fine nanoparticles (3-5 nm) is observed from neutral to basic pH, between 6.5-10.3 The chains formed are hundreds of nanometers to micrometer long and are usually 2-3 nanoparticles wide. On further increasing pH to 11.3, particles form disk-like or raft-like structures. When method (ii) was used a little chain formation was observed. Most of the nanoparticles formed were found either sitting together as raft like structures or scattered on lecithin structures. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Synthetic lethality between gene defects affecting a single non-essential molecular pathway with reversible steps.

    Andrei Zinovyev

    2013-04-01

    Full Text Available Systematic analysis of synthetic lethality (SL constitutes a critical tool for systems biology to decipher molecular pathways. The most accepted mechanistic explanation of SL is that the two genes function in parallel, mutually compensatory pathways, known as between-pathway SL. However, recent genome-wide analyses in yeast identified a significant number of within-pathway negative genetic interactions. The molecular mechanisms leading to within-pathway SL are not fully understood. Here, we propose a novel mechanism leading to within-pathway SL involving two genes functioning in a single non-essential pathway. This type of SL termed within-reversible-pathway SL involves reversible pathway steps, catalyzed by different enzymes in the forward and backward directions, and kinetic trapping of a potentially toxic intermediate. Experimental data with recombinational DNA repair genes validate the concept. Mathematical modeling recapitulates the possibility of kinetic trapping and revealed the potential contributions of synthetic, dosage-lethal interactions in such a genetic system as well as the possibility of within-pathway positive masking interactions. Analysis of yeast gene interaction and pathway data suggests broad applicability of this novel concept. These observations extend the canonical interpretation of synthetic-lethal or synthetic-sick interactions with direct implications to reconstruct molecular pathways and improve therapeutic approaches to diseases such as cancer.

  20. Single step fabrication method of fullerene/TiO2 composite photocatalyst for hydrogen production

    Kum, Jong Min; Cho, Sung Oh

    2011-01-01

    Hydrogen is one of the most promising alternative energy sources. Fossil fuel, which is the most widely used energy source, has two defects. One is CO 2 emission causing global warming. The other is exhaustion. On the other hand, hydrogen emits no CO 2 and can be produced by splitting water which is renewable and easily obtainable source. However, about 95% of hydrogen is derived from fossil fuel. It limits the merits of hydrogen. Hydrogen from fossil fuel is not a renewable energy anymore. To maximize the merits of hydrogen, renewability and no CO 2 emission, unconventional hydrogen production methods without using fossil fuel are required. Photocatalytic water-splitting is one of the unconventional hydrogen production methods. Photocatalytic water-splitting that uses hole/electron pairs of semiconductor is expectable way to produce clean and renewable hydrogen from solar energy. TiO 2 is the semiconductor material which has been most widely used as photocatalyst. TiO 2 shows high photocatalytic reactivity and stability in water. However, its wide band gap only absorbs UV light which is only 5% of sun light. To enhance the visible light responsibility, composition with fullerene based materials has been investigated. 1-2 Methano-fullerene carboxylic acid (FCA) is one of the fullerene based materials. We tried to fabricate FCA/TiO 2 composite using UV assisted single step method. The method not only simplified the fabrication procedures, but enhanced hydrogen production rate

  1. Single-step generation of fluorophore-encapsulated gold nanoparticle core-shell materials

    Sardar, R; Shem, P M; Pecchia-Bekkum, C; Bjorge, N S; Shumaker-Parry, J S

    2010-01-01

    We report a simple route to produce fluorophore-encapsulated gold nanoparticles (AuNPs) in a single step under aqueous conditions using the fluorophore 1-pyrenemethylamine (PMA). Different amounts of PMA were used and the resulting core-shell gold nanoparticles were analyzed using UV-visible absorption spectroscopy, fluorescence spectroscopy, and transmission and scanning electron microscopy. Electron microscopy analysis shows nanoparticles consisting of a gold nanoparticle core which is encapsulated with a lower contrast shell. In the UV-visible spectra, we observed a significant red shift (37 nm) of the localized surface plasmon resonance (LSPR) absorption maximum (λ max ) compared to citrate-stabilized AuNPs of a similar size. We attribute the prominent LSPR wavelength shift for PMA-AuNP conjugates to the increase in the local dielectric environment near the gold nanoparticles due to the shell formation. This simple, aqueous-based synthesis is a new approach to the production of fluorophore-encapsulated AuNPs that could be applicable in biological sensing systems and photonic device fabrication.

  2. Process analysis and modeling of a single-step lutein extraction method for wet microalgae.

    Gong, Mengyue; Wang, Yuruihan; Bassi, Amarjeet

    2017-11-01

    Lutein is a commercial carotenoid with potential health benefits. Microalgae are alternative sources for the lutein production in comparison to conventional approaches using marigold flowers. In this study, a process analysis of a single-step simultaneous extraction, saponification, and primary purification process for free lutein production from wet microalgae biomass was carried out. The feasibility of binary solvent mixtures for wet biomass extraction was successfully demonstrated, and the extraction kinetics of lutein from chloroplast in microalgae were first evaluated. The effects of types of organic solvent, solvent polarity, cell disruption method, and alkali and solvent usage on lutein yields were examined. A mathematical model based on Fick's second law of diffusion was applied to model the experimental data. The mass transfer coefficients were used to estimate the extraction rates. The extraction rate was found more significantly related with alkali ratio to solvent than to biomass. The best conditions for extraction efficiency were found to be pre-treatment with ultrasonication at 0.5 s working cycle per second, react 0.5 h in 0.27 L/g solvent to biomass ratio, and 1:3 ether/ethanol (v/v) with 1.25 g KOH/L. The entire process can be controlled within 1 h and yield over 8 mg/g lutein, which is more economical for scale-up.

  3. Pharmaceutical 3D printing: Design and qualification of a single step print and fill capsule.

    Smith, Derrick M; Kapoor, Yash; Klinzing, Gerard R; Procopio, Adam T

    2018-06-10

    Fused deposition modeling (FDM) 3D printing (3DP) has a potential to change how we envision manufacturing in the pharmaceutical industry. A more common utilization for FDM 3DP is to build upon existing hot melt extrusion (HME) technology where the drug is dispersed in the polymer matrix. However, reliable manufacturing of drug-containing filaments remains a challenge along with the limitation of active ingredients which can sustain the processing risks involved in the HME process. To circumvent this obstacle, a single step FDM 3DP process was developed to manufacture thin-walled drug-free capsules which can be filled with dry or liquid drug product formulations. Drug release from these systems is governed by the combined dissolution of the FDM capsule 'shell' and the dosage form encapsulated in these shells. To prepare the shells, the 3D printer files (extension '.gcode') were modified by creating discrete zones, so-called 'zoning process', with individual print parameters. Capsules printed without the zoning process resulted in macroscopic print defects and holes. X-ray computed tomography, finite element analysis and mechanical testing were used to guide the zoning process and printing parameters in order to manufacture consistent and robust capsule shell geometries. Additionally, dose consistencies of drug containing liquid formulations were investigated in this work. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Single-step gas phase synthesis of stable iron aluminide nanoparticles with soft magnetic properties

    Vernieres, Jerome, E-mail: Jerome.vernieres@oist.jp; Benelmekki, Maria; Kim, Jeong-Hwan; Grammatikopoulos, Panagiotis; Diaz, Rosa E. [Nanoparticles by Design Unit, Okinawa Institute of Science and Technology (OIST) Graduate University, 1919-1 Tancha, Onna Son, Okinawa 904-0495 (Japan); Bobo, Jean-François [Centre d’Elaboration de Materiaux et d’Etudes Structurales (CEMES), 29 rue Jeanne Marvig, 31055 Toulouse Cedex 4 (France); Sowwan, Mukhles, E-mail: Mukhles@oist.jp [Nanoparticles by Design Unit, Okinawa Institute of Science and Technology (OIST) Graduate University, 1919-1 Tancha, Onna Son, Okinawa 904-0495 (Japan); Nanotechnology Research Laboratory, Al-Quds University, P.O. Box 51000, East Jerusalem, Palestine (Country Unknown)

    2014-11-01

    Soft magnetic alloys at the nanoscale level have long generated a vivid interest as candidate materials for technological and biomedical purposes. Consequently, controlling the structure of bimetallic nanoparticles in order to optimize their magnetic properties, such as high magnetization and low coercivity, can significantly boost their potential for related applications. However, traditional synthesis methods stumble upon the long standing challenge of developing true nanoalloys with effective control over morphology and stability against oxidation. Herein, we report on a single-step approach to the gas phase synthesis of soft magnetic bimetallic iron aluminide nanoparticles, using a versatile co-sputter inert gas condensation technique. This method allowed for precise morphological control of the particles; they consisted of an alloy iron aluminide crystalline core (DO{sub 3} phase) and an alumina shell, which reduced inter-particle interactions and also prevented further oxidation and segregation of the bimetallic core. Remarkably, the as-deposited alloy nanoparticles show interesting soft magnetic properties, in that they combine a high saturation magnetization (170 emu/g) and low coercivity (less than 20 Oe) at room temperature. Additional functionality is tenable by modifying the surface of the particles with a polymer, to ensure their good colloidal dispersion in aqueous environments.

  5. Single step thermal decomposition approach to prepare supported γ-Fe2O3 nanoparticles

    Sharma, Geetu; Jeevanandam, P.

    2012-01-01

    γ-Fe 2 O 3 nanoparticles supported on MgO (macro-crystalline and nanocrystalline) were prepared by an easy single step thermal decomposition method. Thermal decomposition of iron acetylacetonate in diphenyl ether, in the presence of the supports followed by calcination, leads to iron oxide nanoparticles supported on MgO. The X-ray diffraction results indicate the stability of γ-Fe 2 O 3 phase on MgO (macro-crystalline and nanocrystalline) up to 1150 °C. The scanning electron microscopy images show that the supported iron oxide nanoparticles are agglomerated while the energy dispersive X-ray analysis indicates the presence of iron, magnesium and oxygen in the samples. Transmission electron microscopy images indicate the presence of smaller γ-Fe 2 O 3 nanoparticles on nanocrystalline MgO. The magnetic properties of the supported magnetic nanoparticles at various calcination temperatures (350-1150 °C) were studied using a superconducting quantum interference device which indicates superparamagnetic behavior.

  6. Structural Studies of Silver Nanoparticles Obtained Through Single-Step Green Synthesis

    Prasad Peddi, Siva; Abdallah Sadeh, Bilal

    2015-10-01

    Green synthesis of silver Nanoparticles (AGNP's) has been the most prominent among the metallic nanoparticles for research for over a decade and half now due to both the simplicity of preparation and the applicability of biological species with extensive applications in medicine and biotechnology to reduce and trap the particles. The current article uses Eclipta Prostrata leaf extract as the biological species to cap the AGNP's through a single step process. The characterization data obtained was used for the analysis of the sample structure. The article emphasizes the disquisition of their shape and size of the lattice parameters and proposes a general scheme and a mathematical model for the analysis of their dependence. The data of the synthesized AGNP's has been used to advantage through the introduction of a structural shape factor for the crystalline nanoparticles. The properties of the structure of the AGNP's proposed and evaluated through a theoretical model was undeviating with the experimental consequences. This modus operandi gives scope for the structural studies of ultrafine particles prepared using biological methods.

  7. A new plastic scintillation resin for single-step separation, concentration and measurement of technetium-99

    Barrera, J.; Tarancón, A.; Bagán, H.; García, J.F.

    2016-01-01

    Technetium is a synthetic element with no stable isotopes, produced as waste in nuclear power plants and in cyclotrons used for nuclear medicine. The element has high mobility, in the form of TcO_4"−; its determination is therefore important for environmental protection. Technetium is found in low concentrations and therefore common methods for its analysis include long treatments in several steps and require large amounts of reagents for its purification and preconcentration. Plastic scintillation resins (PSresin) are novel materials used to separate, preconcentrate and measure radionuclides in a single step. The objective of this study is to prepare and characterise a PSresin for the preconcentration and measurement of "9"9Tc. The study first evaluates the reproducibility of the production of PSresins between batches and over time; showing good reproducibility and storage stability. Next, we studied the effect of some common non-radioactive interferences, showing small influences on measurement, and radioactive interferences ("3"6Cl and "2"3"8U/"2"3"4U). "3"6Cl can be removed by a simple treatment with 0.5 M HCl and "2"3"8U/"2"3"4U can be removed from the column by cleaning with a mixture of 0.1 M HNO_3 and 0.1 M HF. In the latter case, a slight change in the morphology of the PSresin caused an increase in detection efficiency. Finally, the PSresin was applied to the measurement of real spiked samples (sea water and urine) with deviations lower than 10% in all cases. - Highlights: • A plastic scintillation resin for selective analysis of "9"9Tc has been developed. • The method is valid for analysis of "9"9Tc in seawater and urine samples. • Presence of Cl"−, NO_3"−, SO_4"2"−, "3"6Cl, U and Th not affect retention of "9"9Tc.

  8. DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

    Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.

    1989-01-01

    We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

  9. Single-step reinitialization and extending algorithms for level-set based multi-phase flow simulations

    Fu, Lin; Hu, Xiangyu Y.; Adams, Nikolaus A.

    2017-12-01

    We propose efficient single-step formulations for reinitialization and extending algorithms, which are critical components of level-set based interface-tracking methods. The level-set field is reinitialized with a single-step (non iterative) "forward tracing" algorithm. A minimum set of cells is defined that describes the interface, and reinitialization employs only data from these cells. Fluid states are extrapolated or extended across the interface by a single-step "backward tracing" algorithm. Both algorithms, which are motivated by analogy to ray-tracing, avoid multiple block-boundary data exchanges that are inevitable for iterative reinitialization and extending approaches within a parallel-computing environment. The single-step algorithms are combined with a multi-resolution conservative sharp-interface method and validated by a wide range of benchmark test cases. We demonstrate that the proposed reinitialization method achieves second-order accuracy in conserving the volume of each phase. The interface location is invariant to reapplication of the single-step reinitialization. Generally, we observe smaller absolute errors than for standard iterative reinitialization on the same grid. The computational efficiency is higher than for the standard and typical high-order iterative reinitialization methods. We observe a 2- to 6-times efficiency improvement over the standard method for serial execution. The proposed single-step extending algorithm, which is commonly employed for assigning data to ghost cells with ghost-fluid or conservative interface interaction methods, shows about 10-times efficiency improvement over the standard method while maintaining same accuracy. Despite their simplicity, the proposed algorithms offer an efficient and robust alternative to iterative reinitialization and extending methods for level-set based multi-phase simulations.

  10. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

    2009-10-30

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  11. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

    2009-01-01

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  12. Chemical fidelity of an RNA polymerase ribozyme

    Attwater, J.; Tagami, S.; Kimoto, M.

    2013-01-01

    for function. Here we have explored the chemical fidelity, i.e. substrate selectivity and specificity for both single and multiple catalytic steps of the Z RNA polymerase ribozyme-a modern day analogue of the primordial RNA replicase. Using a wide range of nucleotide analogues and ionic conditions, we observe......The emergence of catalytically active RNA enzymes (ribozymes) is widely believed to have been an important transition in the origin of life. In the context of a likely heterogeneous chemical environment, substrate specificity and selectivity of these primordial enzymes would have been critical...

  13. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  14. Site-selective substitutional doping with atomic precision on stepped Al (111) surface by single-atom manipulation.

    Chen, Chang; Zhang, Jinhu; Dong, Guofeng; Shao, Hezhu; Ning, Bo-Yuan; Zhao, Li; Ning, Xi-Jing; Zhuang, Jun

    2014-01-01

    In fabrication of nano- and quantum devices, it is sometimes critical to position individual dopants at certain sites precisely to obtain the specific or enhanced functionalities. With first-principles simulations, we propose a method for substitutional doping of individual atom at a certain position on a stepped metal surface by single-atom manipulation. A selected atom at the step of Al (111) surface could be extracted vertically with an Al trimer-apex tip, and then the dopant atom will be positioned to this site. The details of the entire process including potential energy curves are given, which suggests the reliability of the proposed single-atom doping method.

  15. Single-step brazing process for mono-block joints and mechanical testing

    Casalegno, V.; Ferraris, M.; Salvo, M.; Rizzo, S.; Merola, M.

    2007-01-01

    Full text of publication follows: Plasma facing components act as actively cooled thermal shields to sustain thermal and particle loads during normal and transient operations in ITER (International Thermonuclear Experimental Reactor). The plasma-facing layer is referred to as 'armour', which is made of either carbon fibre reinforced carbon composite (CFC) or tungsten (W). CFC is the reference design solution for the lower part of the vertical target of the ITER divertor. The armour is joined onto an actively cooled substrate, the heat sink, made of precipitation hardened copper alloy CuCrZr through a thin pure copper interlayer to decrease, by plastic deformation, the joint interface stresses; in fact, the CFC to Cu joint is affected by the CTE mismatch between the ceramic and metallic material. A new method of joining CFC to copper and CFC/Cu to CuCrZr alloy was effectively developed for the flat-type configuration; the feasibility of this process also for mono-block geometry and the development of a procedure for testing mono-block-type mock-ups is described in this work. The mono-block configuration consists of copper alloy pipe shielded by CFC blocks. It is worth noting that in mono-block configuration, the large thermal expansion mismatch between CFC and copper alloy is more significant than for flat-tile configuration, due to curved interfaces. The joining technique foresees a single-step brazing process: the brazing of the three materials (CFC-Cu-CuCrZr) can be performed in a single heat treatment using the same Cu/Ge based braze. The composite surface was modified by solid state reaction with chromium with the purpose of increasing the wettability of CFC by the brazing alloy. The CFC substrate reacts with Cr which, forming a carbide layer, allows a large reduction of the contact angle; then, the brazing of CFC to pure copper and pure copper to CuCrZr by the same treatment is feasible. This process allows to obtain good joints using a non-active brazing

  16. Single-step brazing process for mono-block joints and mechanical testing

    Casalegno, V.; Ferraris, M.; Salvo, M.; Rizzo, S. [Politecnico di Torino, Materials Science and Chemical Engineering Dept., Torino (Italy); Merola, M. [ITER International Team, llER Joint Work Site, Cadarache, 13 - St Paul Lez Durance (France)

    2007-07-01

    Full text of publication follows: Plasma facing components act as actively cooled thermal shields to sustain thermal and particle loads during normal and transient operations in ITER (International Thermonuclear Experimental Reactor). The plasma-facing layer is referred to as 'armour', which is made of either carbon fibre reinforced carbon composite (CFC) or tungsten (W). CFC is the reference design solution for the lower part of the vertical target of the ITER divertor. The armour is joined onto an actively cooled substrate, the heat sink, made of precipitation hardened copper alloy CuCrZr through a thin pure copper interlayer to decrease, by plastic deformation, the joint interface stresses; in fact, the CFC to Cu joint is affected by the CTE mismatch between the ceramic and metallic material. A new method of joining CFC to copper and CFC/Cu to CuCrZr alloy was effectively developed for the flat-type configuration; the feasibility of this process also for mono-block geometry and the development of a procedure for testing mono-block-type mock-ups is described in this work. The mono-block configuration consists of copper alloy pipe shielded by CFC blocks. It is worth noting that in mono-block configuration, the large thermal expansion mismatch between CFC and copper alloy is more significant than for flat-tile configuration, due to curved interfaces. The joining technique foresees a single-step brazing process: the brazing of the three materials (CFC-Cu-CuCrZr) can be performed in a single heat treatment using the same Cu/Ge based braze. The composite surface was modified by solid state reaction with chromium with the purpose of increasing the wettability of CFC by the brazing alloy. The CFC substrate reacts with Cr which, forming a carbide layer, allows a large reduction of the contact angle; then, the brazing of CFC to pure copper and pure copper to CuCrZr by the same treatment is feasible. This process allows to obtain good joints using a non

  17. Single-Step BLUP with Varying Genotyping Effort in Open-Pollinated Picea glauca.

    Ratcliffe, Blaise; El-Dien, Omnia Gamal; Cappa, Eduardo P; Porth, Ilga; Klápště, Jaroslav; Chen, Charles; El-Kassaby, Yousry A

    2017-03-10

    Maximization of genetic gain in forest tree breeding programs is contingent on the accuracy of the predicted breeding values and precision of the estimated genetic parameters. We investigated the effect of the combined use of contemporary pedigree information and genomic relatedness estimates on the accuracy of predicted breeding values and precision of estimated genetic parameters, as well as rankings of selection candidates, using single-step genomic evaluation (HBLUP). In this study, two traits with diverse heritabilities [tree height (HT) and wood density (WD)] were assessed at various levels of family genotyping efforts (0, 25, 50, 75, and 100%) from a population of white spruce ( Picea glauca ) consisting of 1694 trees from 214 open-pollinated families, representing 43 provenances in Québec, Canada. The results revealed that HBLUP bivariate analysis is effective in reducing the known bias in heritability estimates of open-pollinated populations, as it exposes hidden relatedness, potential pedigree errors, and inbreeding. The addition of genomic information in the analysis considerably improved the accuracy in breeding value estimates by accounting for both Mendelian sampling and historical coancestry that were not captured by the contemporary pedigree alone. Increasing family genotyping efforts were associated with continuous improvement in model fit, precision of genetic parameters, and breeding value accuracy. Yet, improvements were observed even at minimal genotyping effort, indicating that even modest genotyping effort is effective in improving genetic evaluation. The combined utilization of both pedigree and genomic information may be a cost-effective approach to increase the accuracy of breeding values in forest tree breeding programs where shallow pedigrees and large testing populations are the norm. Copyright © 2017 Ratcliffe et al.

  18. Method for making a single-step etch mask for 3D monolithic nanostructures

    Grishina, D A; Harteveld, C A M; Vos, W L; Woldering, L A

    2015-01-01

    Current nanostructure fabrication by etching is usually limited to planar structures as they are defined by a planar mask. The realization of three-dimensional (3D) nanostructures by etching requires technologies beyond planar masks. We present a method for fabricating a 3D mask that allows one to etch three-dimensional monolithic nanostructures using only CMOS-compatible processes. The mask is written in a hard-mask layer that is deposited on two adjacent inclined surfaces of a Si wafer. By projecting in a single step two different 2D patterns within one 3D mask on the two inclined surfaces, the mutual alignment between the patterns is ensured. Thereby after the mask pattern is defined, the etching of deep pores in two oblique directions yields a three-dimensional structure in Si. As a proof of concept we demonstrate 3D mask fabrication for three-dimensional diamond-like photonic band gap crystals in silicon. The fabricated crystals reveal a broad stop gap in optical reflectivity measurements. We propose how 3D nanostructures with five different Bravais lattices can be realized, namely cubic, tetragonal, orthorhombic, monoclinic and hexagonal, and demonstrate a mask for a 3D hexagonal crystal. We also demonstrate the mask for a diamond-structure crystal with a 3D array of cavities. In general, the 2D patterns on the different surfaces can be completely independently structured and still be in perfect mutual alignment. Indeed, we observe an alignment accuracy of better than 3.0 nm between the 2D mask patterns on the inclined surfaces, which permits one to etch well-defined monolithic 3D nanostructures. (paper)

  19. Single-Step BLUP with Varying Genotyping Effort in Open-Pollinated Picea glauca

    Blaise Ratcliffe

    2017-03-01

    Full Text Available Maximization of genetic gain in forest tree breeding programs is contingent on the accuracy of the predicted breeding values and precision of the estimated genetic parameters. We investigated the effect of the combined use of contemporary pedigree information and genomic relatedness estimates on the accuracy of predicted breeding values and precision of estimated genetic parameters, as well as rankings of selection candidates, using single-step genomic evaluation (HBLUP. In this study, two traits with diverse heritabilities [tree height (HT and wood density (WD] were assessed at various levels of family genotyping efforts (0, 25, 50, 75, and 100% from a population of white spruce (Picea glauca consisting of 1694 trees from 214 open-pollinated families, representing 43 provenances in Québec, Canada. The results revealed that HBLUP bivariate analysis is effective in reducing the known bias in heritability estimates of open-pollinated populations, as it exposes hidden relatedness, potential pedigree errors, and inbreeding. The addition of genomic information in the analysis considerably improved the accuracy in breeding value estimates by accounting for both Mendelian sampling and historical coancestry that were not captured by the contemporary pedigree alone. Increasing family genotyping efforts were associated with continuous improvement in model fit, precision of genetic parameters, and breeding value accuracy. Yet, improvements were observed even at minimal genotyping effort, indicating that even modest genotyping effort is effective in improving genetic evaluation. The combined utilization of both pedigree and genomic information may be a cost-effective approach to increase the accuracy of breeding values in forest tree breeding programs where shallow pedigrees and large testing populations are the norm.

  20. The Accuracy and Bias of Single-Step Genomic Prediction for Populations Under Selection

    Wan-Ling Hsu

    2017-08-01

    Full Text Available In single-step analyses, missing genotypes are explicitly or implicitly imputed, and this requires centering the observed genotypes using the means of the unselected founders. If genotypes are only available for selected individuals, centering on the unselected founder mean is not straightforward. Here, computer simulation is used to study an alternative analysis that does not require centering genotypes but fits the mean μg of unselected individuals as a fixed effect. Starting with observed diplotypes from 721 cattle, a five-generation population was simulated with sire selection to produce 40,000 individuals with phenotypes, of which the 1000 sires had genotypes. The next generation of 8000 genotyped individuals was used for validation. Evaluations were undertaken with (J or without (N μg when marker covariates were not centered; and with (JC or without (C μg when all observed and imputed marker covariates were centered. Centering did not influence accuracy of genomic prediction, but fitting μg did. Accuracies were improved when the panel comprised only quantitative trait loci (QTL; models JC and J had accuracies of 99.4%, whereas models C and N had accuracies of 90.2%. When only markers were in the panel, the 4 models had accuracies of 80.4%. In panels that included QTL, fitting μg in the model improved accuracy, but had little impact when the panel contained only markers. In populations undergoing selection, fitting μg in the model is recommended to avoid bias and reduction in prediction accuracy due to selection.

  1. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  2. Out of the picture: a study of family drawings by children from step-, single-parent, and non-step families.

    Dunn, Judy; O'Connor, Thomas G; Levy, Irit

    2002-12-01

    Investigated the family drawings of 180 children ages 5 to 7 years in various family settings, including stepfather, single-parent, complex stepfamilies, and 2-parent control families. The relations of family type and biological relatedness to omission of family members and grouping of parents were examined. Children from step- and single-parent families were more likely to exclude family members than children from "control" non-step families, and exclusion was predicted from biological relatedness. Children who were biologically related to both resident parents were also more likely to group their parents together. Omission of family members was found to be associated with children's adjustment (specifically more externalizing and internalizing behavior) as reported by teachers and parents. The results indicate that biological relatedness is a salient aspect of very young children's representations of their families. The association between adjustment and exclusion of family members and grouping of parents indicates that family drawings may be useful research and clinical tools, when used in combination with other methods of assessment.

  3. Thin film complementary metal oxide semiconductor (CMOS) device using a single-step deposition of the channel layer

    Nayak, Pradipta K.; Caraveo-Frescas, J. A.; Wang, Zhenwei; Hedhili, Mohamed N.; Wang, Q. X.; Alshareef, Husam N.

    2014-01-01

    We report, for the first time, the use of a single step deposition of semiconductor channel layer to simultaneously achieve both n-and p-type transport in transparent oxide thin film transistors (TFTs). This effect is achieved by controlling

  4. An efficient single-step scheme for manipulating quantum information of two trapped ions beyond the Lamb-Dicke limit

    Wei, L.F.; Nori, Franco

    2003-01-01

    Based on the exact conditional quantum dynamics for a two-ion system, we propose an efficient single-step scheme for coherently manipulating quantum information of two trapped cold ions by using a pair of synchronous laser pulses. Neither the auxiliary atomic level nor the Lamb-Dicke approximation are needed

  5. Single-step solution processing of small-molecule organic semiconductor field-effect transistors at high yield

    Yu, Liyang; Li, X.; Pavlica, E.; Loth, M.A.; Anthony, J.E.; Bratina, G.; Kjellander, B.K.C.; Gelinck, G.H.; Stutzmann, N.

    2011-01-01

    Here, we report a simple, alternative route towards high-mobility structures of the small-molecular semiconductor 5,11-bis(triethyl silylethynyl) anthradithiophene that requires one single processing step without the need for any post-deposition processing. The method relies on careful control of

  6. Single mode step-index polymer optical fiber for humidity insensitive high temperature fiber Bragg grating sensors

    Woyessa, Getinet; Fasano, Andrea; Stefani, Alessio

    2016-01-01

    We have fabricated the first single-mode step-index and humidity insensitive polymer optical fiber operating in the 850 nm wavelength ranges. The step-index preform is fabricated using injection molding, which is an efficient method for cost effective, flexible and fast preparation of the fiber...... preform. The fabricated single-mode step-index (SI) polymer optical fiber (POF) has a 4.8µm core made from TOPAS grade 5013S-04 with a glass transition temperature of 134°C and a 150 µm cladding made from ZEONEX grade 480R with a glass transition temperature of 138°C. The key advantages of the proposed...... SIPOF are low water absorption, high operating temperature and chemical inertness to acids and bases and many polar solvents as compared to the conventional poly-methyl-methacrylate (PMMA) and polystyrene based POFs. In addition, the fiber Bragg grating writing time is short compared to microstructured...

  7. Pressure-driven one-step solid phase-based on-chip sample preparation on a microfabricated plastic device and integration with flow-through polymerase chain reaction (PCR).

    Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon

    2013-10-01

    In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Designed optimization of a single-step extraction of fucose-containing sulfated polysaccharides from Sargassum sp

    Ale, Marcel Tutor; Mikkelsen, Jørn Dalgaard; Meyer, Anne S.

    2012-01-01

    Fucose-containing sulfated polysaccharides can be extracted from the brown seaweed, Sargassum sp. It has been reported that fucose-rich sulfated polysaccharides from brown seaweeds exert different beneficial biological activities including anti-inflammatory, anticoagulant, and anti-viral effects....... Classical extraction of fucose-containing sulfated polysaccharides from brown seaweed species typically involves extended, multiple-step, hot acid, or CaCl2 treatments, each step lasting several hours. In this work, we systematically examined the influence of acid concentration (HCl), time, and temperature...... on the yield of fucosecontaining sulfated polysaccharides (FCSPs) in statistically designed two-step and single-step multifactorial extraction experiments. All extraction factors had significant effects on the fucose-containing sulfated polysaccharides yield, with the temperature and time exerting positive...

  9. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  10. AN EFFICIENT ANALYSIS FOR ABSORPTION AND GAIN COEFFICIENTS IN 'SINGLE STEP-INDEX WAVEGUIDE'S BY USING THE ALPHA METHOD

    Mustafa TEMİZ

    2008-02-01

    Full Text Available In this study, some design parameters such as normalized frequency and especially normalized propagation constant have been obtained, depending on some parameters which are functions of energy eigenvalues of the carriers such as electrons and holes confined in a single step-index waveguide laser (SSIWGL or single stepindex waveguide (SSIWG. Some optical expressions about the optical power and probability quantities for the active region and cladding layers of the SSIWG or SSIWGL have been investigated. Investigations have been undertaken in terms of these parameters and also individually the optical even and odd electric field waves with the lowest-modes were theoretically computed. Especially absorption coefficients and loss coefficients addition to some important quantities of the single step-index waveguide lasers for the even and odd electric field waves are evaluated.

  11. Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

    Xia, Shuangluo; Beckman, Jeff; Wang, Jimin; Konigsberg, William H. (Yale)

    2012-10-10

    Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystal structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.

  12. Genetic evaluation using single-step genomic best linear unbiased predictor in American Angus.

    Lourenco, D A L; Tsuruta, S; Fragomeni, B O; Masuda, Y; Aguilar, I; Legarra, A; Bertrand, J K; Amen, T S; Wang, L; Moser, D W; Misztal, I

    2015-06-01

    Predictive ability of genomic EBV when using single-step genomic BLUP (ssGBLUP) in Angus cattle was investigated. Over 6 million records were available on birth weight (BiW) and weaning weight (WW), almost 3.4 million on postweaning gain (PWG), and over 1.3 million on calving ease (CE). Genomic information was available on, at most, 51,883 animals, which included high and low EBV accuracy animals. Traditional EBV was computed by BLUP and genomic EBV by ssGBLUP and indirect prediction based on SNP effects was derived from ssGBLUP; SNP effects were calculated based on the following reference populations: ref_2k (contains top bulls and top cows that had an EBV accuracy for BiW ≥0.85), ref_8k (contains all parents that were genotyped), and ref_33k (contains all genotyped animals born up to 2012). Indirect prediction was obtained as direct genomic value (DGV) or as an index of DGV and parent average (PA). Additionally, runs with ssGBLUP used the inverse of the genomic relationship matrix calculated by an algorithm for proven and young animals (APY) that uses recursions on a small subset of reference animals. An extra reference subset included 3,872 genotyped parents of genotyped animals (ref_4k). Cross-validation was used to assess predictive ability on a validation population of 18,721 animals born in 2013. Computations for growth traits used multiple-trait linear model and, for CE, a bivariate CE-BiW threshold-linear model. With BLUP, predictivities were 0.29, 0.34, 0.23, and 0.12 for BiW, WW, PWG, and CE, respectively. With ssGBLUP and ref_2k, predictivities were 0.34, 0.35, 0.27, and 0.13 for BiW, WW, PWG, and CE, respectively, and with ssGBLUP and ref_33k, predictivities were 0.39, 0.38, 0.29, and 0.13 for BiW, WW, PWG, and CE, respectively. Low predictivity for CE was due to low incidence rate of difficult calving. Indirect predictions with ref_33k were as accurate as with full ssGBLUP. Using the APY and recursions on ref_4k gave 88% gains of full ssGBLUP and

  13. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  14. Comparison on genomic predictions using GBLUP models and two single-step blending methods with different relationship matrices in the Nordic Holstein population

    Gao, Hongding; Christensen, Ole Fredslund; Madsen, Per

    2012-01-01

    Background A single-step blending approach allows genomic prediction using information of genotyped and non-genotyped animals simultaneously. However, the combined relationship matrix in a single-step method may need to be adjusted because marker-based and pedigree-based relationship matrices may...... not be on the same scale. The same may apply when a GBLUP model includes both genomic breeding values and residual polygenic effects. The objective of this study was to compare single-step blending methods and GBLUP methods with and without adjustment of the genomic relationship matrix for genomic prediction of 16......) a simple GBLUP method, 2) a GBLUP method with a polygenic effect, 3) an adjusted GBLUP method with a polygenic effect, 4) a single-step blending method, and 5) an adjusted single-step blending method. In the adjusted GBLUP and single-step methods, the genomic relationship matrix was adjusted...

  15. A single step methane conversion into synthetic fuels using microplasma reactor

    Nozaki, Tomohiro; Agiral, A.; Gardeniers, Johannes G.E.; Yuzawa, Shuhei; Okazaki, Ken

    2011-01-01

    Direct conversion of natural gas into synthetic fuels such as methanol attracts keen attention because direct process can reduce capital and operating costs of high temperature, energy intensive, multi-step processes. We report a direct and selective synthesis of organic oxygenates such as methanol,

  16. Colloidal Quantum Dot Inks for Single-Step-Fabricated Field-Effect Transistors: The Importance of Postdeposition Ligand Removal.

    Balazs, Daniel M; Rizkia, Nisrina; Fang, Hong-Hua; Dirin, Dmitry N; Momand, Jamo; Kooi, Bart J; Kovalenko, Maksym V; Loi, Maria Antonietta

    2018-02-14

    Colloidal quantum dots are a class of solution-processed semiconductors with good prospects for photovoltaic and optoelectronic applications. Removal of the surfactant, so-called ligand exchange, is a crucial step in making the solid films conductive, but performing it in solid state introduces surface defects and cracks in the films. Hence, the formation of thick, device-grade films have only been possible through layer-by-layer processing, limiting the technological interest for quantum dot solids. Solution-phase ligand exchange before the deposition allows for the direct deposition of thick, homogeneous films suitable for device applications. In this work, fabrication of field-effect transistors in a single step is reported using blade-coating, an upscalable, industrially relevant technique. Most importantly, a postdeposition washing step results in device properties comparable to the best layer-by-layer processed devices, opening the way for large-scale fabrication and further interest from the research community.

  17. A permeation theory for single-file ion channels: one- and two-step models.

    Nelson, Peter Hugo

    2011-04-28

    How many steps are required to model permeation through ion channels? This question is investigated by comparing one- and two-step models of permeation with experiment and MD simulation for the first time. In recent MD simulations, the observed permeation mechanism was identified as resembling a Hodgkin and Keynes knock-on mechanism with one voltage-dependent rate-determining step [Jensen et al., PNAS 107, 5833 (2010)]. These previously published simulation data are fitted to a one-step knock-on model that successfully explains the highly non-Ohmic current-voltage curve observed in the simulation. However, these predictions (and the simulations upon which they are based) are not representative of real channel behavior, which is typically Ohmic at low voltages. A two-step association/dissociation (A/D) model is then compared with experiment for the first time. This two-parameter model is shown to be remarkably consistent with previously published permeation experiments through the MaxiK potassium channel over a wide range of concentrations and positive voltages. The A/D model also provides a first-order explanation of permeation through the Shaker potassium channel, but it does not explain the asymmetry observed experimentally. To address this, a new asymmetric variant of the A/D model is developed using the present theoretical framework. It includes a third parameter that represents the value of the "permeation coordinate" (fractional electric potential energy) corresponding to the triply occupied state n of the channel. This asymmetric A/D model is fitted to published permeation data through the Shaker potassium channel at physiological concentrations, and it successfully predicts qualitative changes in the negative current-voltage data (including a transition to super-Ohmic behavior) based solely on a fit to positive-voltage data (that appear linear). The A/D model appears to be qualitatively consistent with a large group of published MD simulations, but no

  18. Balanced Photodetection in One-Step Liquid-Phase-Synthesized CsPbBr3 Micro-/Nanoflake Single Crystals.

    Zheng, Wei; Xiong, Xufan; Lin, Richeng; Zhang, Zhaojun; Xu, Cunhua; Huang, Feng

    2018-01-17

    Here, we reported a low-cost and high-compatibility one-step liquid-phase synthesis method for synthesizing high-purity CsPbBr 3 micro-/nanoflake single crystals. On the basis of the high-purity CsPbBr 3 , we further prepared a low-dimensional photodetector capable of balanced photodetection, involving both high external quantum efficiency and rapid temporal response, which is barely realized in previously reported low-dimensional photodetectors.

  19. Blastocyst utilization rates after continuous culture in two commercial single-step media: a prospective randomized study with sibling oocytes.

    Sfontouris, Ioannis A; Kolibianakis, Efstratios M; Lainas, George T; Venetis, Christos A; Petsas, George K; Tarlatzis, Basil C; Lainas, Tryfon G

    2017-10-01

    The aim of this study is to determine whether blastocyst utilization rates are different after continuous culture in two different commercial single-step media. This is a paired randomized controlled trial with sibling oocytes conducted in infertility patients, aged ≤40 years with ≥10 oocytes retrieved assigned to blastocyst culture and transfer. Retrieved oocytes were randomly allocated to continuous culture in either Sage one-step medium (Origio) or Continuous Single Culture (CSC) medium (Irvine Scientific) without medium renewal up to day 5 post oocyte retrieval. Main outcome measure was the proportion of embryos suitable for clinical use (utilization rate). A total of 502 oocytes from 33 women were randomly allocated to continuous culture in either Sage one-step medium (n = 250) or CSC medium (n = 252). Fertilization was performed by either in vitro fertilization or intracytoplasmic sperm injection, and embryo transfers were performed on day 5. Two patients had all blastocysts frozen due to the occurrence of severe ovarian hyperstimulation syndrome. Fertilization and cleavage rates, as well as embryo quality on day 3, were similar in the two media. Blastocyst utilization rates (%, 95% CI) [55.4% (46.4-64.1) vs 54.7% (44.9-64.6), p = 0.717], blastocyst formation rates [53.6% (44.6-62.5) vs 51.9 (42.2-61.6), p = 0.755], and proportion of good quality blastocysts [36.8% (28.1-45.4) vs 36.1% (27.2-45.0), p = 0.850] were similar in Sage one-step and CSC media, respectively. Continuous culture of embryos in Sage one-step and CSC media is associated with similar blastocyst development and utilization rates. Both single-step media appear to provide adequate support during in vitro preimplantation embryo development. Whether these observations are also valid for other continuous single medium protocols remains to be determined. NCT02302638.

  20. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  1. Production of alpha-amylase from Aspergillus oryzae for several industrial applications in a single step.

    Porfirif, María C; Milatich, Esteban J; Farruggia, Beatriz M; Romanini, Diana

    2016-06-01

    A one-step method as a strategy of alpha-amylase concentration and purification was developed in this work. This methodology requires the use of a very low concentration of biodegradable polyelectrolyte (Eudragit(®) E-PO) and represents a low cost, fast, easy to scale up and non-polluting technology. Besides, this methodology allows recycling the polymer after precipitation. The formation of reversible soluble/insoluble complexes between alpha-amylase and the polymer Eudragit(®) E-PO was studied, and their precipitation in selected conditions was applied with bioseparation purposes. Turbidimetric assays allowed to determine the pH range where the complexes are insoluble (4.50-7.00); pH 5.50 yielded the highest turbidity of the system. The presence of NaCl (0.05M) in the medium totally dissociates the protein-polymer complexes. When the adequate concentration of polymer was added under these conditions to a liquid culture of Aspergillus oryzae, purification factors of alpha-amylase up to 7.43 and recoveries of 88% were obtained in a simple step without previous clarification. These results demonstrate that this methodology is suitable for the concentration and production of alpha-amylase from this source and could be applied at the beginning of downstream processing. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Home-based step training using videogame technology in people with Parkinson's disease: a single-blinded randomised controlled trial.

    Song, Jooeun; Paul, Serene S; Caetano, Maria Joana D; Smith, Stuart; Dibble, Leland E; Love, Rachelle; Schoene, Daniel; Menant, Jasmine C; Sherrington, Cathie; Lord, Stephen R; Canning, Colleen G; Allen, Natalie E

    2018-03-01

    To determine whether 12-week home-based exergame step training can improve stepping performance, gait and complementary physical and neuropsychological measures associated with falls in Parkinson's disease. A single-blinded randomised controlled trial. Community (experimental intervention), university laboratory (outcome measures). Sixty community-dwelling people with Parkinson's disease. Home-based step training using videogame technology. The primary outcomes were the choice stepping reaction time test and Functional Gait Assessment. Secondary outcomes included physical and neuropsychological measures associated with falls in Parkinson's disease, number of falls over six months and self-reported mobility and balance. Post intervention, there were no differences between the intervention ( n = 28) and control ( n = 25) groups in the primary or secondary outcomes except for the Timed Up and Go test, where there was a significant difference in favour of the control group ( P = 0.02). Intervention participants reported mobility improvement, whereas control participants reported mobility deterioration-between-group difference on an 11-point scale = 0.9 (95% confidence interval: -1.8 to -0.1, P = 0.03). Interaction effects between intervention and disease severity on physical function measures were observed ( P = 0.01 to P = 0.08) with seemingly positive effects for the low-severity group and potentially negative effects for the high-severity group. Overall, home-based exergame step training was not effective in improving the outcomes assessed. However, the improved physical function in the lower disease severity intervention participants as well as the self-reported improved mobility in the intervention group suggest home-based exergame step training may have benefits for some people with Parkinson's disease.

  3. Single-step transepithelial photorefractive keratectomy in myopia and astigmatism: 18-month follow-up.

    Adib-Moghaddam, Soheil; Soleyman-Jahi, Saeed; Salmanian, Bahram; Omidvari, Amir-Houshang; Adili-Aghdam, Fatemeh; Noorizadeh, Farsad; Eslani, Medi

    2016-11-01

    To evaluate the long-term quantitative and qualitative optical outcomes of 1-step transepithelial photorefractive keratectomy (PRK) to correct myopia and astigmatism. Bina Eye Hospital, Tehran, Iran. Prospective interventional case series. Eyes with myopia with or without astigmatism were evaluated. One-step transepithelial PRK was performed with an aberration-free aspheric optimized profile and the Amaris 500 laser. Eighteen-month follow-up results for refraction, visual acuities, vector analysis, higher-order aberrations, contrast sensitivity, postoperative pain, and haze grade were assessed. The study enrolled 146 eyes (74 patients). At the end of follow-up, 93.84% of eyes had an uncorrected distance visual acuity of 20/20 or better and 97.94% of eyes were within ±0.5 diopter of the targeted spherical refraction. On vector analysis, the mean correction index value was close to 1 and the mean index of success and magnitude of error values were close to 0. The achieved correction vector was on an axis counterclockwise to the axis of the intended correction. Photopic and mesopic contrast sensitivities and ocular and corneal spherical, cylindrical, and corneal coma aberrations significantly improved (all P < .001). A slight amount of trefoil aberration was induced (P < .001, ocular aberration; P < .01, corneal aberration). No eye lost more than 1 line of corrected distance visual acuity. No eye had a haze grade of 2+ degrees or higher throughout the follow-up. Eighteen-month results indicate the efficacy and safety of transepithelial PRK to correct myopia and astigmatism. It improved refraction and quality of vision. None of the authors has a financial or proprietary interest in any material or method mentioned. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  4. Three-dimensional photonic crystals created by single-step multi-directional plasma etching.

    Suzuki, Katsuyoshi; Kitano, Keisuke; Ishizaki, Kenji; Noda, Susumu

    2014-07-14

    We fabricate 3D photonic nanostructures by simultaneous multi-directional plasma etching. This simple and flexible method is enabled by controlling the ion-sheath in reactive-ion-etching equipment. We realize 3D photonic crystals on single-crystalline silicon wafers and show high reflectance (>95%) and low transmittance (photonic bandgap. Moreover, our method simply demonstrates Si-based 3D photonic crystals that show the photonic bandgap effect in a shorter wavelength range around 0.6 μm, where further fine structures are required.

  5. Rapid, single-step most-probable-number method for enumerating fecal coliforms in effluents from sewage treatment plants

    Munoz, E. F.; Silverman, M. P.

    1979-01-01

    A single-step most-probable-number method for determining the number of fecal coliform bacteria present in sewage treatment plant effluents is discussed. A single growth medium based on that of Reasoner et al. (1976) and consisting of 5.0 gr. proteose peptone, 3.0 gr. yeast extract, 10.0 gr. lactose, 7.5 gr. NaCl, 0.2 gr. sodium lauryl sulfate, and 0.1 gr. sodium desoxycholate per liter is used. The pH is adjusted to 6.5, and samples are incubated at 44.5 deg C. Bacterial growth is detected either by measuring the increase with time in the electrical impedance ratio between the innoculated sample vial and an uninnoculated reference vial or by visual examination for turbidity. Results obtained by the single-step method for chlorinated and unchlorinated effluent samples are in excellent agreement with those obtained by the standard method. It is suggested that in automated treatment plants impedance ratio data could be automatically matched by computer programs with the appropriate dilution factors and most probable number tables already in the computer memory, with the corresponding result displayed as fecal coliforms per 100 ml of effluent.

  6. Bioconversion of starch to ethanol in a single-step process by coculture of amylolytic yeasts and Saccharomyces cerevisiae 21

    Verma, G.; Singh, D.; Chaudhary, K. [CCS Haryana Agricultural Univ., Hisar (India). Dept. of Biotechnology and Molecular Biology; Nigam, P. [Ulster Univ., Coleraine, Northern Ireland (United Kingdom). School of Applied Biological and Chemical Sciences

    2000-05-01

    Ethanol production by a coculture of Saccharomyces diastaticus and Saccharomyces cerevisiae 21 was 24.8 g/l using raw unhydrolysed starch in a single-step fermentation. This was 48% higher than the yield obtained with the monoculture of S. diastaticus (16.8 g/l). The maximum ethanol fermentation efficiency was achieved (93% of the theoretical value) using 60 g/l starch concentration. In another coculture fermentation with E. capsularis and S. cerevisiae 21, maximum ethanol yield was 16.0 g/l, higher than the yield with the monoculture of Endomycopsis capsularis. In batch fermentations using cocultures maximum ethanol production occurred in 48 h of fermentation at 30{sup o}C using 60 g/l starch. Fermentation efficiency was found lower in a two-step process using {alpha}-amylase and glucoamylase-treated starch. (Author)

  7. A direct, single-step plasma arc-vitreous ceramic process for stabilizing spent nuclear fuels, sludges, and associated wastes

    Feng, X.; Einziger, R.E.; Eschenbach, R.C.

    1997-01-01

    A single-step plasma arc-vitreous ceramic (PAVC) process is described for converting spent nuclear fuel (SNF), SNF sludges, and associated wastes into a vitreous ceramic waste form. This proposed technology is built on extensive experience of nuclear waste form development and nuclear waste treatment using the commercially available plasma arc centrifugal (PAC) system. SNF elements will be loaded directly into a PAC furnace with minimum additives and converted into vitreous ceramics with up to 90 wt% waste loading. The vitreous ceramic waste form should meet the functional requirements for borosilicate glasses for permanent disposal in a geologic repository and for interim storage. Criticality safety would be ensured through the use of batch modes, and controlling the amount of fuel processed in one batch. The minimum requirements on SNF characterization and pretreatment, the one-step process, and minimum secondary waste generation may reduce treatment duration, radiation exposure, and treatment cost

  8. Bio-Docklets: virtualization containers for single-step execution of NGS pipelines.

    Kim, Baekdoo; Ali, Thahmina; Lijeron, Carlos; Afgan, Enis; Krampis, Konstantinos

    2017-08-01

    Processing of next-generation sequencing (NGS) data requires significant technical skills, involving installation, configuration, and execution of bioinformatics data pipelines, in addition to specialized postanalysis visualization and data mining software. In order to address some of these challenges, developers have leveraged virtualization containers toward seamless deployment of preconfigured bioinformatics software and pipelines on any computational platform. We present an approach for abstracting the complex data operations of multistep, bioinformatics pipelines for NGS data analysis. As examples, we have deployed 2 pipelines for RNA sequencing and chromatin immunoprecipitation sequencing, preconfigured within Docker virtualization containers we call Bio-Docklets. Each Bio-Docklet exposes a single data input and output endpoint and from a user perspective, running the pipelines as simply as running a single bioinformatics tool. This is achieved using a "meta-script" that automatically starts the Bio-Docklets and controls the pipeline execution through the BioBlend software library and the Galaxy Application Programming Interface. The pipeline output is postprocessed by integration with the Visual Omics Explorer framework, providing interactive data visualizations that users can access through a web browser. Our goal is to enable easy access to NGS data analysis pipelines for nonbioinformatics experts on any computing environment, whether a laboratory workstation, university computer cluster, or a cloud service provider. Beyond end users, the Bio-Docklets also enables developers to programmatically deploy and run a large number of pipeline instances for concurrent analysis of multiple datasets. © The Authors 2017. Published by Oxford University Press.

  9. Single Step In Situ Synthesis and Optical Properties of Polyaniline/ZnO Nanocomposites

    Deepali Sharma

    2014-01-01

    Full Text Available Polyaniline/ZnO nanocomposites were prepared by in situ oxidative polymerization of aniline monomer in the presence of different weight percentages of ZnO nanostructures. The steric stabilizer added to prevent the agglomeration of nanostructures in the polymer matrix was found to affect the final properties of the nanocomposite. ZnO nanostructures of various morphologies and sizes were prepared in the absence and presence of sodium lauryl sulphate (SLS surfactant under different reaction conditions like in the presence of microwave radiation (microwave oven, under pressure (autoclave, under vacuum (vacuum oven, and at room temperature (ambient condition. The conductivity of these synthesized nanocomposites was evaluated using two-probe method and the effect of concentration of ZnO nanostructures on conductivity was observed. X-ray diffraction (XRD, scanning electron microscopy (SEM, transmission electron microscopy (TEM, Fourier transform infrared spectroscopy (FTIR, and UV-visible (UV-VIS spectroscopy techniques were used to characterize nanocomposites. The optical energy band gap of the nanocomposites was calculated from absorption spectra and ranged between 1.5 and 3.21 eV. The reported values depicted the blue shift in nanocomposites as compared to the band gap energies of synthesized ZnO nanostructures. The present work focuses on the one-step synthesis and potential use of PANI/ZnO nanocomposite in molecular electronics as well as in optical devices.

  10. Single-Step Fabrication of Computationally Designed Microneedles by Continuous Liquid Interface Production.

    Ashley R Johnson

    Full Text Available Microneedles, arrays of micron-sized needles that painlessly puncture the skin, enable transdermal delivery of medications that are difficult to deliver using more traditional routes. Many important design parameters, such as microneedle size, shape, spacing, and composition, are known to influence efficacy, but are notoriously difficult to alter due to the complex nature of microfabrication techniques. Herein, we utilize a novel additive manufacturing ("3D printing" technique called Continuous Liquid Interface Production (CLIP to rapidly prototype sharp microneedles with tuneable geometries (size, shape, aspect ratio, spacing. This technology allows for mold-independent, one-step manufacturing of microneedle arrays of virtually any design in less than 10 minutes per patch. Square pyramidal CLIP microneedles composed of trimethylolpropane triacrylate, polyacrylic acid and photopolymerizable derivatives of polyethylene glycol and polycaprolactone were fabricated to demonstrate the range of materials that can be utilized within this platform for encapsulating and controlling the release of therapeutics. These CLIP microneedles effectively pierced murine skin ex vivo and released the fluorescent drug surrogate rhodamine.

  11. Organic chemistry. A rhodium catalyst for single-step styrene production from benzene and ethylene.

    Vaughan, Benjamin A; Webster-Gardiner, Michael S; Cundari, Thomas R; Gunnoe, T Brent

    2015-04-24

    Rising global demand for fossil resources has prompted a renewed interest in catalyst technologies that increase the efficiency of conversion of hydrocarbons from petroleum and natural gas to higher-value materials. Styrene is currently produced from benzene and ethylene through the intermediacy of ethylbenzene, which must be dehydrogenated in a separate step. The direct oxidative conversion of benzene and ethylene to styrene could provide a more efficient route, but achieving high selectivity and yield for this reaction has been challenging. Here, we report that the Rh catalyst ((Fl)DAB)Rh(TFA)(η(2)-C2H4) [(Fl)DAB is N,N'-bis(pentafluorophenyl)-2,3-dimethyl-1,4-diaza-1,3-butadiene; TFA is trifluoroacetate] converts benzene, ethylene, and Cu(II) acetate to styrene, Cu(I) acetate, and acetic acid with 100% selectivity and yields ≥95%. Turnover numbers >800 have been demonstrated, with catalyst stability up to 96 hours. Copyright © 2015, American Association for the Advancement of Science.

  12. Single-Step Purification and Characterization of A Recombinant Serine Proteinase Inhibitor from Transgenic Plants.

    Jha, Shweta; Agarwal, Saurabh; Sanyal, Indraneel; Amla, D V

    2016-05-01

    Expression of recombinant therapeutic proteins in transgenic plants has a tremendous impact on safe and economical production of biomolecules for biopharmaceutical industry. The major limitation in their production is downstream processing of recombinant protein to obtain higher yield and purity of the final product. In this study, a simple and rapid process has been developed for purification of therapeutic recombinant α1-proteinase inhibitor (rα1-PI) from transgenic tomato plants, which is an abundant serine protease inhibitor in human serum and chiefly inhibits the activity of neutrophil elastase in lungs. We have expressed rα1-PI with modified synthetic gene in transgenic tomato plants at a very high level (≃3.2 % of total soluble protein). The heterologous protein was extracted with (NH4)2SO4 precipitation, followed by chromatographic separation on different matrices. However, only immunoaffinity chromatography resulted into homogenous preparation of rα1-PI with 54 % recovery. The plant-purified rα1-PI showed molecular mass and structural conformation comparable to native serum α1-PI, as shown by mass spectrometry and optical spectroscopy. The results of elastase inhibition assay revealed biological activity of the purified rα1-PI protein. This work demonstrates a simple and efficient one-step purification of rα1-PI from transgenic plants, which is an essential prerequisite for further therapeutic development.

  13. The effects of strength and power training on single-step balance recovery in older adults: a preliminary study.

    Pamukoff, Derek N; Haakonssen, Eric C; Zaccaria, Joseph A; Madigan, Michael L; Miller, Michael E; Marsh, Anthony P

    2014-01-01

    Improving muscle strength and power may mitigate the effects of sarcopenia, but it is unknown if this improves an older adult's ability to recover from a large postural perturbation. Forward tripping is prevalent in older adults and lateral falls are important due to risk of hip fracture. We used a forward and a lateral single-step balance recovery task to examine the effects of strength training (ST) or power (PT) training on single-step balance recovery in older adults. Twenty older adults (70.8±4.4 years, eleven male) were randomly assigned to either a 6-week (three times/week) lower extremity ST or PT intervention. Maximum forward (FLean(max)) and lateral (LLean(max)) lean angle and strength and power in knee extension and leg press were assessed at baseline and follow-up. Fifteen participants completed the study (ST =7, PT =8). Least squares means (95% CI) for ΔFLean(max) (ST: +4.1° [0.7, 7.5]; PT: +0.6° [-2.5, 3.8]) and ΔLLean(max) (ST: +2.2° [0.4, 4.1]; PT: +2.6° [0.9, 4.4]) indicated no differences between groups following training. In exploratory post hoc analyses collapsed by group, ΔFLean(max) was +2.4° (0.1, 4.7) and ΔLLean(max) was +2.4° (1.2, 3.6). These improvements on the balance recovery tasks ranged from ~15%-30%. The results of this preliminary study suggest that resistance training may improve balance recovery performance, and that, in this small sample, PT did not lead to larger improvements in single-step balance recovery compared to ST.

  14. Single-step generation of metal-plasma polymer multicore@shell nanoparticles from the gas phase.

    Solař, Pavel; Polonskyi, Oleksandr; Olbricht, Ansgar; Hinz, Alexander; Shelemin, Artem; Kylián, Ondřej; Choukourov, Andrei; Faupel, Franz; Biederman, Hynek

    2017-08-17

    Nanoparticles composed of multiple silver cores and a plasma polymer shell (multicore@shell) were prepared in a single step with a gas aggregation cluster source operating with Ar/hexamethyldisiloxane mixtures and optionally oxygen. The size distribution of the metal inclusions as well as the chemical composition and the thickness of the shells were found to be controlled by the composition of the working gas mixture. Shell matrices ranging from organosilicon plasma polymer to nearly stoichiometric SiO 2 were obtained. The method allows facile fabrication of multicore@shell nanoparticles with tailored functional properties, as demonstrated here with the optical response.

  15. Single-Step Transepithelial PRK vs Alcohol-Assisted PRK in Myopia and Compound Myopic Astigmatism Correction

    Kaluzny, Bartlomiej J.; Cieslinska, Iwona; Mosquera, Samuel A.; Verma, Shwetabh

    2016-01-01

    Abstract Transepithelial photorefractive keratectomy (tPRK), where both the epithelium and stroma are removed in a single-step, is a relatively new procedure of laser refractive error correction. This study compares the 3-month results of myopia and compound myopic astigmatism correction by tPRK or conventional alcohol-assisted PRK (aaPRK). This prospective, nonrandomized, case?control study recruited 148 consecutive patients; 93 underwent tPRK (173 eyes) and 55 aaPRK (103 eyes). Refractive r...

  16. Thin film complementary metal oxide semiconductor (CMOS) device using a single-step deposition of the channel layer

    Nayak, Pradipta K.

    2014-04-14

    We report, for the first time, the use of a single step deposition of semiconductor channel layer to simultaneously achieve both n-and p-type transport in transparent oxide thin film transistors (TFTs). This effect is achieved by controlling the concentration of hydroxyl groups (OH-groups) in the underlying gate dielectrics. The semiconducting tin oxide layer was deposited at room temperature, and the maximum device fabrication temperature was 350C. Both n and p-type TFTs showed fairly comparable performance. A functional CMOS inverter was fabricated using this novel scheme, indicating the potential use of our approach for various practical applications.

  17. Steps towards single source--collecting data about quality of life within clinical information systems.

    Fritz, Fleur; Ständer, Sonja; Breil, Bernhard; Dugas, Martin

    2010-01-01

    Information about the quality of life from patients being treated in routine medical care is important for the attending physician. This data is also needed in research for example to evaluate the therapy and the course of the disease respectively. Especially skin diseases often negatively affect the quality of life. Therefore we aimed to design a concept to collect such data during treatment and use it for both medical care and research in the setting of dermatology. We performed a workflow analysis and implemented a designated form using the tools of the local clinical information system. Quality of life data is now collected within the clinical information system during treatment and is used for discharge letters, progress overviews as well as research about the treatment and course of disease. This concept which contributes to the single source approach was feasible within dermatology and is ready to be expanded into other domains.

  18. From single-species advice to mixed-species management: taking the next step

    Vinther, Morten; Reeves, S.A.; Patterson, K.R.

    2004-01-01

    Fishery management advice has traditionally been given on a stock-by-stock basis. Recent problems in implementing this advice, particularly for the demersal fisheries of the North Sea, have highlighted the limitations of the approach. In the long term, it would be desirable to give advice...... that accounts for mixed-fishery effects, but in the short term there is a need for approaches to resolve the conflicting management advice for different species within the same fishery, and to generate catch or effort advice that accounts for the mixed-species nature of the fishery. This paper documents...... a recent approach used to address these problems. The approach takes the single-species advice for each species in the fishery as a starting point, then attempts to resolve it into consistent catch or effort advice using fleet-disaggregated catch forecasts in combination with explicitly stated management...

  19. From agro-industrial wastes to single cell oils: a step towards prospective biorefinery.

    Diwan, Batul; Parkhey, Piyush; Gupta, Pratima

    2018-04-23

    The reserves of fossil-based fuels, which currently seem sufficient to meet the global demands, is inevitably on the verge of exhaustion. Contemporary raw material for alternate fuel like biodiesel is usually edible plant commodity oils, whose increasing public consumption rate raises the need of finding a non-edible and fungible alternate oil source. In this quest, single cell oils (SCO) from oleaginous yeasts and fungi can provide a sustainable alternate of not only functional but also valuable (polyunsaturated fatty acids (PUFA)-rich) lipids. Researches are been increasingly driven towards increasing the SCO yield in order to realize its commercial importance. However, bulk requirement of expensive synthetic carbon substrate, which inflates the overall SCO production cost, is the major limitation towards complete acceptance of this technology. Even though substrate cost minimization could make the SCO production profitable is uncertain, it is still essential to identify suitable cheap and abundant substrates in an attempt to potentially reduce the overall process economy. One of the most sought-after in-expensive carbon reservoirs, agro-industrial wastes, can be an attractive replacement to expensive synthetic carbon substrates in this regard. The present review assess these possibilities referring to the current experimental investigations on oleaginous yeasts, and fungi reported for conversion of agro-industrial feedstocks into triacylglycerols (TAGs) and PUFA-rich lipids. Multiple associated factors regulating lipid accumulation utilizing such substrates and impeding challenges has been analyzed. The review infers that production of bulk oil in combination to high-value fatty acids, co-production strategies for SCO and different microbial metabolites, and reutilization and value addition to spent wastes could possibly leverage the high operating costs and help in commencing a successful biorefinery. Rigorous research is nevertheless required whether it is

  20. Effect of increased exposure times on amount of residual monomer released from single-step self-etch adhesives.

    Altunsoy, Mustafa; Botsali, Murat Selim; Tosun, Gonca; Yasar, Ahmet

    2015-10-16

    The aim of this study was to evaluate the effect of increased exposure times on the amount of residual Bis-GMA, TEGDMA, HEMA and UDMA released from single-step self-etch adhesive systems. Two adhesive systems were used. The adhesives were applied to bovine dentin surface according to the manufacturer's instructions and were polymerized using an LED curing unit for 10, 20 and 40 seconds (n = 5). After polymerization, the specimens were stored in 75% ethanol-water solution (6 mL). Residual monomers (Bis-GMA, TEGDMA, UDMA and HEMA) that were eluted from the adhesives (after 10 minutes, 1 hour, 1 day, 7 days and 30 days) were analyzed by high-performance liquid chromatography (HPLC). The data were analyzed using 1-way analysis of variance and Tukey HSD tests. Among the time periods, the highest amount of released residual monomers from adhesives was observed in the 10th minute. There were statistically significant differences regarding released Bis-GMA, UDMA, HEMA and TEGDMA between the adhesive systems (p<0.05). There were no significant differences among the 10, 20 and 40 second polymerization times according to their effect on residual monomer release from adhesives (p>0.05). Increasing the polymerization time did not have an effect on residual monomer release from single-step self-etch adhesives.

  1. Novel structure formation at the bottom surface of porous anodic alumina fabricated by single step anodization process.

    Ali, Ghafar; Ahmad, Maqsood; Akhter, Javed Iqbal; Maqbool, Muhammad; Cho, Sung Oh

    2010-08-01

    A simple approach for the growth of long-range highly ordered nanoporous anodic alumina film in H(2)SO(4) electrolyte through a single step anodization without any additional pre-anodizing procedure is reported. Free-standing porous anodic alumina film of 180 microm thickness with through hole morphology was obtained. A simple and single step process was used for the detachment of alumina from aluminum substrate. The effect of anodizing conditions, such as anodizing voltage and time on the pore diameter and pore ordering is discussed. The metal/oxide and oxide/electrolyte interfaces were examined by high resolution scanning transmission electron microscope. The arrangement of pores on metal/oxide interface was well ordered with smaller diameters than that of the oxide/electrolyte interface. The inter-pore distance was larger in metal/oxide interface as compared to the oxide/electrolyte interface. The size of the ordered domain was found to depend strongly upon anodizing voltage and time. (c) 2010 Elsevier Ltd. All rights reserved.

  2. Comparison of Stepped Care Delivery Against a Single, Empirically Validated Cognitive-Behavioral Therapy Program for Youth With Anxiety: A Randomized Clinical Trial.

    Rapee, Ronald M; Lyneham, Heidi J; Wuthrich, Viviana; Chatterton, Mary Lou; Hudson, Jennifer L; Kangas, Maria; Mihalopoulos, Cathrine

    2017-10-01

    Stepped care is embraced as an ideal model of service delivery but is minimally evaluated. The aim of this study was to evaluate the efficacy of cognitive-behavioral therapy (CBT) for child anxiety delivered via a stepped-care framework compared against a single, empirically validated program. A total of 281 youth with anxiety disorders (6-17 years of age) were randomly allocated to receive either empirically validated treatment or stepped care involving the following: (1) low intensity; (2) standard CBT; and (3) individually tailored treatment. Therapist qualifications increased at each step. Interventions did not differ significantly on any outcome measures. Total therapist time per child was significantly shorter to deliver stepped care (774 minutes) compared with best practice (897 minutes). Within stepped care, the first 2 steps returned the strongest treatment gains. Stepped care and a single empirically validated program for youth with anxiety produced similar efficacy, but stepped care required slightly less therapist time. Restricting stepped care to only steps 1 and 2 would have led to considerable time saving with modest loss in efficacy. Clinical trial registration information-A Randomised Controlled Trial of Standard Care Versus Stepped Care for Children and Adolescents With Anxiety Disorders; http://anzctr.org.au/; ACTRN12612000351819. Copyright © 2017 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  3. Single step sequential polydimethylsiloxane wet etching to fabricate a microfluidic channel with various cross-sectional geometries

    Wang, C.-K.; Liao, W.-H.; Wu, H.-M.; Lo, Y.-H.; Lin, T.-R.; Tung, Y.-C.

    2017-11-01

    Polydimethylsiloxane (PDMS) has become a widely used material to construct microfluidic devices for various biomedical and chemical applications due to its desirable material properties and manufacturability. PDMS microfluidic devices are usually fabricated using soft lithography replica molding methods with master molds made of photolithogrpahy patterned photoresist layers on silicon wafers. The fabricated microfluidic channels often have rectangular cross-sectional geometries with single or multiple heights. In this paper, we develop a single step sequential PDMS wet etching process that can be used to fabricate microfluidic channels with various cross-sectional geometries from single-layer PDMS microfluidic channels. The cross-sections of the fabricated channel can be non-rectangular, and varied along the flow direction. Furthermore, the fabricated cross-sectional geometries can be numerically simulated beforehand. In the experiments, we fabricate microfluidic channels with various cross-sectional geometries using the developed technique. In addition, we fabricate a microfluidic mixer with alternative mirrored cross-sectional geometries along the flow direction to demonstrate the practical usage of the developed technique.

  4. Comparison of 10 single and stepped methods to identify frail older persons in primary care: diagnostic and prognostic accuracy.

    Sutorius, Fleur L; Hoogendijk, Emiel O; Prins, Bernard A H; van Hout, Hein P J

    2016-08-03

    Many instruments have been developed to identify frail older adults in primary care. A direct comparison of the accuracy and prevalence of identification methods is rare and most studies ignore the stepped selection typically employed in routine care practice. Also it is unclear whether the various methods select persons with different characteristics. We aimed to estimate the accuracy of 10 single and stepped methods to identify frailty in older adults and to predict adverse health outcomes. In addition, the methods were compared on their prevalence of the identified frail persons and on the characteristics of persons identified. The Groningen Frailty Indicator (GFI), the PRISMA-7, polypharmacy, the clinical judgment of the general practitioner (GP), the self-rated health of the older adult, the Edmonton Frail Scale (EFS), the Identification Seniors At Risk Primary Care (ISAR PC), the Frailty Index (FI), the InterRAI screener and gait speed were compared to three measures: two reference standards (the clinical judgment of a multidisciplinary expert panel and Fried's frailty criteria) and 6-years mortality or long term care admission. Data were used from the Dutch Identification of Frail Elderly Study, consisting of 102 people aged 65 and over from a primary care practice in Amsterdam. Frail older adults were oversampled. The accuracy of each instrument and several stepped strategies was estimated by calculating the area under the ROC-curve. Prevalence rates of frailty ranged from 14.8 to 52.9 %. The accuracy for recommended cut off values ranged from poor (AUC = 0.556 ISAR-PC) to good (AUC = 0.865 gait speed). PRISMA-7 performed best over two reference standards, GP predicted adversities best. Stepped strategies resulted in lower prevalence rates and accuracy. Persons selected by the different instruments varied greatly in age, IADL dependency, receiving homecare and mood. We found huge differences between methods to identify frail persons in prevalence

  5. Compact Ag@Fe3O4 Core-shell Nanoparticles by Means of Single-step Thermal Decomposition Reaction

    Brollo, Maria Eugênia F.; López-Ruiz, Román; Muraca, Diego; Figueroa, Santiago J. A.; Pirota, Kleber R.; Knobel, Marcelo

    2014-10-01

    A temperature pause introduced in a simple single-step thermal decomposition of iron, with the presence of silver seeds formed in the same reaction mixture, gives rise to novel compact heterostructures: brick-like Ag@Fe3O4 core-shell nanoparticles. This novel method is relatively easy to implement, and could contribute to overcome the challenge of obtaining a multifunctional heteroparticle in which a noble metal is surrounded by magnetite. Structural analyses of the samples show 4 nm silver nanoparticles wrapped within compact cubic external structures of Fe oxide, with curious rectangular shape. The magnetic properties indicate a near superparamagnetic like behavior with a weak hysteresis at room temperature. The value of the anisotropy involved makes these particles candidates to potential applications in nanomedicine.

  6. Genomic prediction by single-step genomic BLUP using cow reference population in Holstein crossbred cattle in India

    Nayee, Nilesh Kumar; Su, Guosheng; Gajjar, Swapnil

    2018-01-01

    Advantages of genomic selection in breeds with limited numbers of progeny tested bulls have been demonstrated by adding genotypes of females to the reference population (Thomasen et al., 2014). The current study was conducted to explore the feasibility of implementing genomic selection in a Holst......Advantages of genomic selection in breeds with limited numbers of progeny tested bulls have been demonstrated by adding genotypes of females to the reference population (Thomasen et al., 2014). The current study was conducted to explore the feasibility of implementing genomic selection...... in a Holstein Friesian crossbred population with cows kept under small holder conditions using test day records and single step genomic BLUP (ssGBLUP). Milk yield records from 10,797 daughters sired by 258 bulls were used Of these 2194 daughters and 109 sires were genotyped with customized genotyping chip...

  7. Production of the Q2 doubly excited states of the hydrogen molecule by electron impact in a single step

    Santos, Leonardo O.; Rocha, Alexandre B.; Faria, Nelson Velho de Castro; Jalbert, Ginette

    2017-03-01

    We calculate the single step cross sections for excitation of Q 2 states of H2 and its subsequent dissociation. The cross section calculations were performed within the first Born approximation and the electronic wave functions were obtained via State-Averaged Multiconfigurational Self-Consistent Field followed by Configuration Interaction. We have assumed autoionization is the only important process competing with dissociation into neutral atoms. We have estimated its probability through a semi classical approach and compared with results of literature. Special attention was given to the Q 2 1Σg +(1) state which, as has been shown in a previous work, may dissociate into H(2 sσ) + H(2 sσ) fragments (some figures in this article are in colour only in the electronic version).

  8. A novel multimodal chromatography based single step purification process for efficient manufacturing of an E. coli based biotherapeutic protein product.

    Bhambure, Rahul; Gupta, Darpan; Rathore, Anurag S

    2013-11-01

    Methionine oxidized, reduced and fMet forms of a native recombinant protein product are often the critical product variants which are associated with proteins expressed as bacterial inclusion bodies in E. coli. Such product variants differ from native protein in their structural and functional aspects, and may lead to loss of biological activity and immunogenic response in patients. This investigation focuses on evaluation of multimodal chromatography for selective removal of these product variants using recombinant human granulocyte colony stimulating factor (GCSF) as the model protein. Unique selectivity in separation of closely related product variants was obtained using combined pH and salt based elution gradients in hydrophobic charge induction chromatography. Simultaneous removal of process related impurities was also achieved in flow-through leading to single step purification process for the GCSF. Results indicate that the product recovery of up to 90.0% can be obtained with purity levels of greater than 99.0%. Binding the target protein at pHproduct variants using the combined pH and salt based elution gradient and removal of the host cell impurities in flow-through are the key novel features of the developed multimodal chromatographic purification step. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Sci-Thur PM - Colourful Interactions: Highlights 08: ARC TBI using Single-Step Optimized VMAT Fields

    Hudson, Alana; Gordon, Deborah; Moore, Roseanne; Balogh, Alex; Pierce, Greg

    2016-01-01

    Purpose: This work outlines a new TBI delivery technique to replace a lateral POP full bolus technique. The new technique is done with VMAT arc delivery, without bolus, treating the patient prone and supine. The benefits of the arc technique include: increased patient experience and safety, better dose conformity, better organ at risk sparing, decreased therapist time and reduction of therapist injuries. Methods: In this work we build on a technique developed by Jahnke et al. We use standard arc fields with gantry speeds corrected for varying distance to the patient followed by a single step VMAT optimization on a patient CT to increase dose inhomogeneity and to reduce dose to the lungs (vs. blocks). To compare the arc TBI technique to our full bolus technique, we produced plans on patient CTs for both techniques and evaluated several dosimetric parameters using an ANOVA test. Results and Conclusions: The arc technique is able reduce both the hot areas to the body (D2% reduced from 122.2% to 111.8% p<0.01) and the lungs (mean lung dose reduced from 107.5% to 99.1%, p<0.01), both statistically significant, while maintaining coverage (D98% = 97.8% vs. 94.6%, p=0.313, not statistically significant). We developed a more patient and therapist-friendly TBI treatment technique that utilizes single-step optimized VMAT plans. It was found that this technique was dosimetrically equivalent to our previous lateral technique in terms of coverage and statistically superior in terms of reduced lung dose.

  10. Sci-Thur PM - Colourful Interactions: Highlights 08: ARC TBI using Single-Step Optimized VMAT Fields

    Hudson, Alana; Gordon, Deborah; Moore, Roseanne; Balogh, Alex; Pierce, Greg [Tom Baker Cancer Centre (Canada)

    2016-08-15

    Purpose: This work outlines a new TBI delivery technique to replace a lateral POP full bolus technique. The new technique is done with VMAT arc delivery, without bolus, treating the patient prone and supine. The benefits of the arc technique include: increased patient experience and safety, better dose conformity, better organ at risk sparing, decreased therapist time and reduction of therapist injuries. Methods: In this work we build on a technique developed by Jahnke et al. We use standard arc fields with gantry speeds corrected for varying distance to the patient followed by a single step VMAT optimization on a patient CT to increase dose inhomogeneity and to reduce dose to the lungs (vs. blocks). To compare the arc TBI technique to our full bolus technique, we produced plans on patient CTs for both techniques and evaluated several dosimetric parameters using an ANOVA test. Results and Conclusions: The arc technique is able reduce both the hot areas to the body (D2% reduced from 122.2% to 111.8% p<0.01) and the lungs (mean lung dose reduced from 107.5% to 99.1%, p<0.01), both statistically significant, while maintaining coverage (D98% = 97.8% vs. 94.6%, p=0.313, not statistically significant). We developed a more patient and therapist-friendly TBI treatment technique that utilizes single-step optimized VMAT plans. It was found that this technique was dosimetrically equivalent to our previous lateral technique in terms of coverage and statistically superior in terms of reduced lung dose.

  11. Kinematic Differences During Single-Leg Step-Down Between Individuals With Femoroacetabular Impingement Syndrome and Individuals Without Hip Pain.

    Lewis, Cara L; Loverro, Kari L; Khuu, Anne

    2018-04-01

    Study Design Controlled laboratory study, case-control design. Background Despite recognition that femoroacetabular impingement syndrome (FAIS) is a movement-related disorder, few studies have examined dynamic unilateral tasks in individuals with FAIS. Objectives To determine whether movements of the pelvis and lower extremities in individuals with FAIS differ from those in individuals without hip pain during a single-leg step-down, and to analyze kinematic differences between male and female participants within groups. Methods Individuals with FAIS and individuals without hip pain performed a single-leg step-down while kinematic data were collected. Kinematics were evaluated at 60° of knee flexion. A linear regression analysis assessed the main effects of group, sex, and side, and the interaction of sex by group. Results Twenty individuals with FAIS and 40 individuals without hip pain participated. Individuals with FAIS performed the step-down with greater hip flexion (4.9°; 95% confidence interval [CI]: 0.5°, 9.2°) and anterior pelvic tilt (4.1°; 95% CI: 0.9°, 7.3°) than individuals without hip pain. Across groups, female participants performed the task with more hip flexion (6.1°; 95% CI: 1.7°, 10.4°), hip adduction (4.8°; 95% CI: 2.2°, 7.4°), anterior pelvic tilt (5.8°; 95% CI: 2.6°, 9.0°), pelvic drop (1.4°; 95% CI: 0.3°, 2.5°), and thigh adduction (2.7°; 95% CI: 1.3°, 4.2°) than male participants. Conclusion The results of this study suggest that individuals with FAIS have alterations in pelvic motion during a dynamic unilateral task. The noted altered movement patterns in the FAIS group may contribute to the development of hip pain and may be due to impairments that are modifiable through rehabilitation. J Orthop Sports Phys Ther 2018;48(4):270-279. Epub 6 Mar 2018. doi:10.2519/jospt.2018.7794.

  12. Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique

    Fanzio, Paola; Chang, Chi-Tung; Skolimowski, Maciej; Tanzi, Simone; Sasso, Luigi

    2017-01-01

    We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT), and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline). The patterning of the fluidic (microfluidic channels) and conductive (wiring and electrodes) functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH. PMID:28531106

  13. Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique

    Paola Fanzio

    2017-05-01

    Full Text Available We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT, and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline. The patterning of the fluidic (microfluidic channels and conductive (wiring and electrodes functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH.

  14. Fully-Polymeric pH Sensor Realized by Means of a Single-Step Soft Embossing Technique.

    Fanzio, Paola; Chang, Chi-Tung; Skolimowski, Maciej; Tanzi, Simone; Sasso, Luigi

    2017-05-20

    We present here an electrochemical sensor microsystem for the monitoring of pH. The all-polymeric device is comprised of a cyclic olefin copolymer substrate, a 200 nm-thin patterned layer of conductive polymer (PEDOT), and a 70 nm electropolymerized layer of a pH sensitive conductive polymer (polyaniline). The patterning of the fluidic (microfluidic channels) and conductive (wiring and electrodes) functional elements was achieved with a single soft PDMS mold via a single embossing step process. A post-processing treatment with ethylene glycol assured the functional enhancement of the electrodes, as demonstrated via an electrical and electrochemical characterization. A surface modification of the electrodes was carried out, based on voltammetric electropolymerization, to obtain a thin layer of polyaniline. The mechanism for pH sensing is based on the redox reactions of the polyaniline layer caused by protonation. The sensing performance of the microsystem was finally validated by monitoring its potentiometric response upon exposure to a relevant range of pH.

  15. Electron diffraction of CBr{sub 4} in superfluid helium droplets: A step towards single molecule diffraction

    He, Yunteng; Zhang, Jie; Kong, Wei, E-mail: wei.kong@oregonstate.edu [Department of Chemistry, Oregon State University, Corvallis, Oregon 97331-4003 (United States)

    2016-07-21

    We demonstrate the practicality of electron diffraction of single molecules inside superfluid helium droplets using CBr{sub 4} as a testing case. By reducing the background from pure undoped droplets via multiple doping, with small corrections for dimers and trimers, clearly resolved diffraction rings of CBr{sub 4} similar to those of gas phase molecules can be observed. The experimental data from CBr{sub 4} doped droplets are in agreement with both theoretical calculations and with experimental results of gaseous species. The abundance of monomers and clusters in the droplet beam also qualitatively agrees with the Poisson statistics. Possible extensions of this approach to macromolecular ions will also be discussed. This result marks the first step in building a molecular goniometer using superfluid helium droplet cooling and field induced orientation. The superior cooling effect of helium droplets is ideal for field induced orientation, but the diffraction background from helium is a concern. This work addresses this background issue and identifies a possible solution. Accumulation of diffraction images only becomes meaningful when all images are produced from molecules oriented in the same direction, and hence a molecular goniometer is a crucial technology for serial diffraction of single molecules.

  16. Aesthetic rehabilitation of a patient with an anterior maxillectomy defect, using an innovative single-step, single unit, plastic-based hollow obturator

    Vishwas Bhatia

    2015-06-01

    Full Text Available What could be better than improving the comfort and quality of life of a patient with a life-threatening disease? Maxillectomy, the partial or total removal of the maxilla in patients suffering from benign or malignant neoplasms, creates a challenging defect for the maxillofacial prosthodontist when attempting to provide an effective obturator. Although previous methods have been described for rehabilitation of such patients, our goal should be to devise one stage techniques that will allow the patient an improved quality of life as soon as possible. The present report describes the aesthetic rehabilitation of a maxillectomy patient by use of a hollow obturator. The obturator is fabricated through a processing technique which is a variation of other well-known techniques, consisting of the use of a single-step flasking procedure to fabricate a single-unit hollow obturator using the lost salt technique. As our aim is to aesthetically and functionally rehabilitate the patient as soon as possible, the present method of restoring the maxillectomy defect is cost-effective, time-saving and beneficial for the patient.

  17. Kinetic mechanism of DNA polymerase I (Klenow)

    Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

    1987-01-01

    The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

  18. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  19. Spatial resolution of 2D ionization chamber arrays for IMRT dose verification: single-detector size and sampling step width

    Poppe, Bjoern; Djouguela, Armand; Blechschmidt, Arne; Willborn, Kay; Ruehmann, Antje; Harder, Dietrich

    2007-01-01

    The spatial resolution of 2D detector arrays equipped with ionization chambers or diodes, used for the dose verification of IMRT treatment plans, is limited by the size of the single detector and the centre-to-centre distance between the detectors. Optimization criteria with regard to these parameters have been developed by combining concepts of dosimetry and pattern analysis. The 2D-ARRAY Type 10024 (PTW-Freiburg, Germany), single-chamber cross section 5 x 5 mm 2 , centre-to-centre distance between chambers in each row and column 10 mm, served as an example. Additional frames of given dose distributions can be taken by shifting the whole array parallel or perpendicular to the MLC leaves by, e.g., 5 mm. The size of the single detector is characterized by its lateral response function, a trapezoid with 5 mm top width and 9 mm base width. Therefore, values measured with the 2D array are regarded as sample values from the convolution product of the accelerator generated dose distribution and this lateral response function. Consequently, the dose verification, e.g., by means of the gamma index, is performed by comparing the measured values of the 2D array with the values of the convolution product of the treatment planning system (TPS) calculated dose distribution and the single-detector lateral response function. Sufficiently small misalignments of the measured dose distributions in comparison with the calculated ones can be detected since the lateral response function is symmetric with respect to the centre of the chamber, and the change of dose gradients due to the convolution is sufficiently small. The sampling step width of the 2D array should provide a set of sample values representative of the sampled distribution, which is achieved if the highest spatial frequency contained in this function does not exceed the 'Nyquist frequency', one half of the sampling frequency. Since the convolution products of IMRT-typical dose distributions and the single

  20. A novel single-step synthesis of N-doped TiO2 via a sonochemical method

    Wang, Xi-Kui; Wang, Chen; Guo, Wei-Lin; Wang, Jin-Gang

    2011-01-01

    Graphical abstract: The N-doped anatase TiO 2 nanoparticles were synthesized by sonochemical method. The as-prepared sample is characterized by XRD, TEM, XPS and UV-Vis DRS. The photocatalytic activity of the photocatalyst was evaluated by the photodegradation of an azo dye direct sky blue 5B. Highlights: → A novel singal-step sonochemical synthesis method for the preparation of anatase N-doped TiO 2 nanocrystalline at low temperature has been devoleped. → The as-prepared sample is characterized by XRD, TEM, XPS and UV-Vis DRS. → The photodegradation of azo dye direct sky blue 5 showed that the N-doped TiO 2 catalyst is of high visible-light photocatalytic activity. -- Abstract: A novel single-step synthetic method for the preparation of anatase N-doped TiO 2 nanocrystalline at low temperature has been devoleped. The N-doped anatase TiO 2 nanoparticles were synthesized by sonication of the solution of tetraisopropyl titanium and urea in water and isopropyl alcohol at 80 o C for 150 min. The as-prepared sample was characterized by X-ray diffraction, transmission electron microscopy, X-ray photoelectron spectroscopy and UV-vis absorption spectrum. The product structure depends on the reaction temperature and reaction time. The photocatalytic activity of the as-prepared photocatalyst was evaluated via the photodegradation of an azo dye direct sky blue 5B. The results show that the N-doped TiO 2 nanocrystalline prepared via sonication exhibit an excellent photocatalytic activity under UV light and simulated sunlight.

  1. Single-Step Transepithelial PRK vs Alcohol-Assisted PRK in Myopia and Compound Myopic Astigmatism Correction.

    Kaluzny, Bartlomiej J; Cieslinska, Iwona; Mosquera, Samuel A; Verma, Shwetabh

    2016-02-01

    Transepithelial photorefractive keratectomy (tPRK), where both the epithelium and stroma are removed in a single-step, is a relatively new procedure of laser refractive error correction. This study compares the 3-month results of myopia and compound myopic astigmatism correction by tPRK or conventional alcohol-assisted PRK (aaPRK).This prospective, nonrandomized, case-control study recruited 148 consecutive patients; 93 underwent tPRK (173 eyes) and 55 aaPRK (103 eyes). Refractive results, predictability, safety, and efficacy were evaluated during the 3-month follow-up. The main outcome measures were uncorrected distance visual acuity (UDVA), corrected distance visual acuity (CDVA), and mean refractive spherical equivalent (MRSE).Mean preoperative MRSE was -4.30 ± 1.72 D and -4.33 ± 1.96 D, respectively (P = 0.87). The 3-month follow-up rate was 82.1% in the tPRK group (n = 145) and 86.4% in aaPRK group (n = 90), P = 0.81. Postoperative UDVA was 20/20 or better in 97% and 94% of eyes, respectively (P = 0.45). In the tPRK and aaPRK groups, respectively, 13% and 21% of eyes lost 1 line of CDVA, and 30% and 31% gained 1 or 2 lines (P = 0.48). Mean postoperative MRSE was -0.14 ± 0.26 D in the tPRK group and -0.12 ± 0.20 D in the aaPRK group (P = 0.9). The correlation between attempted versus achieved MRSE was equally high in both groups.Single-step transepithelial PRK and conventional PRK provide very similar results 3 months postoperatively. These procedures are predictable, effective, and safe for correction of myopia and compound myopic astigmatism.

  2. Magnetic Beads-Based Sensor with Tailored Sensitivity for Rapid and Single-Step Amperometric Determination of miRNAs

    Eva Vargas

    2017-11-01

    Full Text Available This work describes a sensitive amperometric magneto-biosensor for single-step and rapid determination of microRNAs (miRNAs. The developed strategy involves the use of direct hybridization of the target miRNA (miRNA-21 with a specific biotinylated DNA probe immobilized on streptavidin-modified magnetic beads (MBs, and labeling of the resulting heteroduplexes with a specific DNA–RNA antibody and the bacterial protein A (ProtA conjugated with an horseradish peroxidase (HRP homopolymer (Poly-HRP40 as an enzymatic label for signal amplification. Amperometric detection is performed upon magnetic capture of the modified MBs onto the working electrode surface of disposable screen-printed carbon electrodes (SPCEs using the H2O2/hydroquinone (HQ system. The magnitude of the cathodic signal obtained at −0.20 V (vs. the Ag pseudo-reference electrode demonstrated linear dependence with the concentration of the synthetic target miRNA over the 1.0 to 100 pM range. The method provided a detection limit (LOD of 10 attomoles (in a 25 μL sample without any target miRNA amplification in just 30 min (once the DNA capture probe-MBs were prepared. This approach shows improved sensitivity compared with that of biosensors constructed with the same anti-DNA–RNA Ab as capture instead of a detector antibody and further labeling with a Strep-HRP conjugate instead of the Poly-HRP40 homopolymer. The developed strategy involves a single step working protocol, as well as the possibility to tailor the sensitivity by enlarging the length of the DNA/miRNA heteroduplexes using additional probes and/or performing the labelling with ProtA conjugated with homopolymers prepared with different numbers of HRP molecules. The practical usefulness was demonstrated by determination of the endogenous levels of the mature target miRNA in 250 ng raw total RNA (RNAt extracted from human mammary epithelial normal (MCF-10A and cancer (MCF-7 cells and tumor tissues.

  3. Are There Mutator Polymerases?

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  4. A Single-step Process to Convert Karanja Oil to Fatty Acid Methyl Esters Using Amberlyst15 as a Catalyst

    Arun K. Gupta

    2018-03-01

    Full Text Available Karanja oil was successfully converted to fatty acid methyl esters (FAME in a single- step process using Amberlyst15 as a catalyst. A methanol to oil ratio of 6 was required to retain the physical structure of the Amberlyst15 catalyst. At higher methanol to oil ratios, the Amberlyst15 catalyst disintegrated. Disintegration of Amberlyst15 caused an irreversible loss in catalytic activity. This loss in activity was due to a decrease in surface area of Amberlyst15, which was caused by a decrease in its mesoporous volume. It appeared that the chemical nature of Amberlyst15 was unaffected. Reuse of Amberlyst15 with a methanol to oil ratio of 6:1 also revealed a loss in FAME yield. However, this loss in activity was recovered by heating the used Amberlyst15 catalyst to 393 K. The kinetic parameters of a power law model were successfully determined for a methanol to oil ratio of 6:1. An activation energy of 54.9 kJ mol–1 was obtained.

  5. Single-step production of the simvastatin precursor monacolin J by engineering of an industrial strain of Aspergillus terreus.

    Huang, Xuenian; Liang, Yajing; Yang, Yong; Lu, Xuefeng

    2017-07-01

    Monacolin J is a key precursor for the synthesis of simvastatin (Zocor), an important drug for treating hypercholesterolemia. Industrially, monacolin J is manufactured through alkaline hydrolysis of lovastatin, a fungal polyketide produced by Aspergillus terreus. Multistep chemical processes for the conversion of lovastatin to simvastatin are laborious, cost expensive and environmentally unfriendly. A biocatalysis process for monacolin J conversion to simvastatin has been developed. However, direct bioproduction of monacolin J has not yet been achieved. Here, we identified a lovastatin hydrolase from Penicillium chrysogenum, which displays a 232-fold higher catalytic efficiency for the in vitro hydrolysis of lovastatin compared to a previously patented hydrolase, but no activity for simvastatin. Furthermore, we showed that an industrial A. terreus strain heterologously expressing this lovastatin hydrolase can produce monacolin J through single-step fermentation with high efficiency, approximately 95% of the biosynthesized lovastatin was hydrolyzed to monacolin J. Our results demonstrate a simple and green technical route for the production of monacolin J, which makes complete bioproduction of the cholesterol-lowering drug simvastatin feasible and promising. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  6. Structural analysis of Hanford's single-shell 241-C-106 tank: A first step toward waste-tank remediation

    Harris, J.P.; Julyk, L.J.; Marlow, R.S.; Moore, C.J.; Day, J.P.; Dyrness, A.D.; Jagadish, P.; Shulman, J.S.

    1993-10-01

    The buried single-shell waste tank 241-C-106, located at the US Department of Energy's Hanford Site, has been a repository for various liquid radioactive waste materials since its construction in 1943. A first step toward waste tank remediation is demonstrating that remediation activities can be performed safely. Determination of the current structural capacity of this high-heat tank is an important element in this assessment. A structural finite-element model of tank 241-C-106 has been developed to assess the tank's structural integrity with respect to in situ conditions and additional remediation surface loads. To predict structural integrity realistically, the model appropriately addresses two complex issues: (1) surrounding soil-tank interaction associated with thermal expansion cycling and surcharge load distribution and (2) concrete-property degradation and creep resulting from exposure to high temperatures generated by the waste. This paper describes the development of the 241-C-106 structural model, analysis methodology, and tank-specific structural acceptance criteria

  7. Effect of a functional monomer (MDP) on the enamel bond durability of single-step self-etch adhesives.

    Tsuchiya, Kenji; Takamizawa, Toshiki; Barkmeier, Wayne W; Tsubota, Keishi; Tsujimoto, Akimasa; Berry, Thomas P; Erickson, Robert L; Latta, Mark A; Miyazaki, Masashi

    2016-02-01

    The present study aimed to determine the effect of the functional monomer, 10-methacryloxydecyl dihydrogen phosphate (MDP), on the enamel bond durability of single-step self-etch adhesives through integrating fatigue testing and long-term water storage. An MDP-containing self-etch adhesive, Clearfil Bond SE ONE (SE), and an experimental adhesive, MDP-free (MF), which comprised the same ingredients as SE apart from MDP, were used. Shear bond strength (SBS) and shear fatigue strength (SFS) were measured with or without phosphoric acid pre-etching. The specimens were stored in distilled water for 24 h, 6 months, or 1 yr. Although similar SBS and SFS values were obtained for SE with pre-etching and for MF after 24 h of storage in distilled water, SE with pre-etching showed higher SBS and SFS values than MF after storage in water for 6 months or 1 yr. Regardless of the pre-etching procedure, SE showed higher SBS and SFS values after 6 months of storage in distilled water than after 24 h or 1 yr. To conclude, MDP might play an important role in enhancing not only bond strength but also bond durability with respect to repeated subcritical loading after long-term water storage. © 2015 Eur J Oral Sci.

  8. Single step purification of recombinant proteins using the metal ion-inducible autocleavage (MIIA) domain as linker for tag removal.

    Ibe, Susan; Schirrmeister, Jana; Zehner, Susanne

    2015-08-20

    For fast and easy purification, proteins are typically fused with an affinity tag, which often needs to be removed after purification. Here, we present a method for the removal of the affinity tag from the target protein in a single step protocol. The protein VIC_001052 of the coral pathogen Vibrio coralliilyticus ATCC BAA-450 contains a metal ion-inducible autocatalytic cleavage (MIIA) domain. Its coding sequence was inserted into an expression vector for the production of recombinant fusion proteins. Following, the target proteins MalE and mCherry were produced as MIIA-Strep fusion proteins in Escherichia coli. The target proteins could be separated from the MIIA-Strep part simply by the addition of calcium or manganese(II) ions within minutes. The cleavage is not affected in the pH range from 5.0 to 9.0 or at low temperatures (6°C). Autocleavage was also observed with immobilized protein on an affinity column. The protein yield was similar to that achieved with a conventional purification protocol. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Experimental Investigation of a Base Isolation System Incorporating MR Dampers with the High-Order Single Step Control Algorithm

    Weiqing Fu

    2017-03-01

    Full Text Available The conventional isolation structure with rubber bearings exhibits large deformation characteristics when subjected to infrequent earthquakes, which may lead to failure of the isolation layer. Although passive dampers can be used to reduce the layer displacement, the layer deformation and superstructure acceleration responses will increase in cases of fortification earthquakes or frequently occurring earthquakes. In addition to secondary damages and loss of life, such excessive displacement results in damages to the facilities in the structure. In order to overcome these shortcomings, this paper presents a structural vibration control system where the base isolation system is composed of rubber bearings with magnetorheological (MR damper and are regulated using the innovative control strategy. The high-order single-step algorithm with continuity and switch control strategies are applied to the control system. Shaking table test results under various earthquake conditions indicate that the proposed isolation method, compared with passive isolation technique, can effectively suppress earthquake responses for acceleration of superstructure and deformation within the isolation layer. As a result, this structural control method exhibits excellent performance, such as fast computation, generic real-time control, acceleration reduction and high seismic energy dissipation etc. The relative merits of the continuity and switch control strategies are also compared and discussed.

  10. Development of a Single-Step Subtraction Method for Eukaryotic 18S and 28S Ribonucleic Acids

    Marie J. Archer

    2011-01-01

    Full Text Available The abundance of mammalian 18S and 28S ribosomal RNA can decrease the detection sensitivity of bacterial or viral targets in complex host-pathogen mixtures. A method to capture human RNA in a single step was developed and characterized to address this issue. For this purpose, capture probes were covalently attached to magnetic microbeads using a dendrimer linker and the solid phase was tested using rat thymus RNA (mammalian components with Escherichia coli RNA (bacterial target as a model system. Our results indicated that random capture probes demonstrated better performance than specific ones presumably by increasing the number of possible binding sites, and the use of a tetrame-thylammonium-chloride (TMA-Cl- based buffer for the hybridization showed a beneficial effect in the selectivity. The subtraction efficiency determined through real-time RT-PCR revealed capture-efficiencies comparable with commercially available enrichment kits. The performance of the solid phase can be further fine tuned by modifying the annealing time and temperature.

  11. Single-Step Seeded-Growth of Graphene Nanoribbons (GNRs) via Plasma-Enhanced Chemical Vapor Deposition (PECVD)

    Hsu, C.-C.; Yang, K.; Tseng, W.-S.; Li, Yiliang; Li, Yilun; Tour, J. M.; Yeh, N.-C.

    One of the main challenges in the fabrication of GNRs is achieving large-scale low-cost production with high quality. Current techniques, including lithography and unzipped carbon nanotubes, are not suitable for mass production. We have recently developed a single-step PECVD growth process of high-quality graphene sheets without any active heating. By adding some substituted aromatic as seeding molecules, we are able to rapidly grow GNRs vertically on various transition-metal substrates. The morphology and electrical properties of the GNRs are dependent on the growth parameters such as the growth time, gas flow and species of the seeding molecules. On the other hand, all GNRs exhibit strong infrared and optical absorption. From studies of the Raman spectra, scanning electron microscopic images, and x-ray/ultraviolet photoelectron spectra of these GNRs as functions of the growth parameters, we propose a model for the growth mechanism. Our findings suggest that our approach opens up a pathway to large-scale, inexpensive production of GNRs for applications to supercapacitors and solar cells. This work was supported by the Grubstake Award and NSF through IQIM at Caltech.

  12. Molecular Doping of the Hole-Transporting Layer for Efficient, Single-Step Deposited Colloidal Quantum Dot Photovoltaics

    Kirmani, Ahmad R.

    2017-07-31

    Employment of thin perovskite shells and metal halides as surface-passivants for colloidal quantum dots (CQDs) have been important, recent developments in CQD optoelectronics. These have opened the route to single-step deposited high-performing CQD solar cells. These promising architectures employ a QD hole-transporting layer (HTL) whose intrinsically shallow Fermi level (EF) restricts band-bending at maximum power-point during solar cell operation limiting charge collection. Here, we demonstrate a generalized approach to effectively balance band-edge energy levels of the main CQD absorber and charge-transport layer for these high-performance solar cells. Briefly soaking the QD HTL in a solution of the metal-organic p-dopant, molybdenum tris(1-(trifluoroacetyl)-2-(trifluoromethyl)ethane-1,2-dithiolene), effectively deepens its Fermi level, resulting in enhanced band bending at the HTL:absorber junction. This blocks the back-flow of photo-generated electrons, leading to enhanced photocurrent and fill factor compared to undoped devices. We demonstrate 9.0% perovskite-shelled and 9.5% metal-halide-passivated CQD solar cells, both achieving ca. 10% relative enhancements over undoped baselines.

  13. Single-step in-situ synthesis and optical properties of ZnSe nanostructured dielectric nanocomposites

    Dey, Chirantan; Rahaman Molla, Atiar; Tarafder, Anal; Karmakar, Basudeb, E-mail: basudebk@cgcri.res.in [CSIR-Central Glass and Ceramic Research Institute, Glass Science and Technology Section, Glass Division, 196, Raja S. C. Mullick Road, 700032 Kolkata (India); Kr Mishra, Manish; De, Goutam [CSIR-Central Glass and Ceramic Research Institute, Nano-Structured Materials Division, 196, Raja S. C. Mullick Road, 700032 Kolkata (India); Goswami, Madhumita; Kothiyal, G. P. [Glass and Advanced Ceramics Division, Bhaba Atomic Research Centre, Trombay, 400085 Mumbai (India)

    2014-04-07

    This work provides the evidence of visible red photoluminescent light emission from ZnSe nanocrystals (NCs) grown within a dielectric (borosilicate glass) matrix synthesized by a single step in-situ technique for the first time and the NC sizes were controlled by varying only the concentration of ZnSe in glass matrix. The ZnSe NCs were investigated by UV-Vis optical absorption spectroscopy, Raman spectroscopy, and transmission electron microscopy (TEM). The sizes of the ZnSe NCs estimated from the TEM images are found to alter in the range of 2–53 nm. Their smaller sizes of the NCs were also calculated by using the optical absorption spectra and the effective mass approximation model. The band gap enlargements both for carrier and exciton confinements were evaluated and found to be changed in the range of 0–1.0 eV. The Raman spectroscopic studies showed blue shifted Raman peaks of ZnSe at 295 and 315 cm{sup −1} indicating phonon confinement effect as well as compressive stress effect on the surface atoms of the NCs. Red photoluminescence in ZnSe-glass nanocomposite reveals a broad multiple-peak structure due to overlapping of emission from NC size related electron-hole recombination (∼707 nm) and emissions from defects to traps, which were formed due to Se and Zn vacancies signifying potential application in photonics.

  14. Fire-through Ag contact formation for crystalline Si solar cells using single-step inkjet printing.

    Kim, Hyun-Gang; Cho, Sung-Bin; Chung, Bo-Mook; Huh, Joo-Youl; Yoon, Sam S

    2012-04-01

    Inkjet-printed Ag metallization is a promising method of forming front-side contacts on Si solar cells due to its non-contact printing nature and fine grid resolution. However, conventional Ag inks are unable to punch through the SiN(x) anti-reflection coating (ARC) layer on emitter Si surfaces. In this study, a novel formulation of Ag ink is examined for the formation of fire-through contacts on a SiN(x)-coated Si substrate using the single-step printing of Ag ink, followed by rapid thermal annealing at 800 degrees C. In order to formulate Ag inks with fire-through contact formation capabilities, a liquid etching agent was first formulated by dissolving metal nitrates in an organic solvent and then mixing the resulting solution with a commercial Ag nanoparticle ink at various volume ratios. During the firing process, the dissolved metal nitrates decomposed into metal oxides and acted in a similar manner to the glass frit contained in Ag pastes for screen-printed Ag metallization. The newly formulated ink with a 1 wt% loading ratio of metal oxides to Ag formed finely distributed Ag crystallites on the Si substrate after firing at 800 degrees C for 1 min.

  15. Voluntary stepping behavior under single- and dual-task conditions in chronic stroke survivors: A comparison between the involved and uninvolved legs.

    Melzer, Itshak; Goldring, Melissa; Melzer, Yehudit; Green, Elad; Tzedek, Irit

    2010-12-01

    If balance is lost, quick step execution can prevent falls. Research has shown that speed of voluntary stepping was able to predict future falls in old adults. The aim of the study was to investigate voluntary stepping behavior, as well as to compare timing and leg push-off force-time relation parameters of involved and uninvolved legs in stroke survivors during single- and dual-task conditions. We also aimed to compare timing and leg push-off force-time relation parameters between stroke survivors and healthy individuals in both task conditions. Ten stroke survivors performed a voluntary step execution test with their involved and uninvolved legs under two conditions: while focusing only on the stepping task and while a separate attention-demanding task was performed simultaneously. Temporal parameters related to the step time were measured including the duration of the step initiation phase, the preparatory phase, the swing phase, and the total step time. In addition, force-time parameters representing the push-off power during stepping were calculated from ground reaction data and compared with 10 healthy controls. The involved legs of stroke survivors had a significantly slower stepping time than uninvolved legs due to increased swing phase duration during both single- and dual-task conditions. For dual compared to single task, the stepping time increased significantly due to a significant increase in the duration of step initiation. In general, the force time parameters were significantly different in both legs of stroke survivors as compared to healthy controls, with no significant effect of dual compared with single-task conditions in both groups. The inability of stroke survivors to swing the involved leg quickly may be the most significant factor contributing to the large number of falls to the paretic side. The results suggest that stroke survivors were unable to rapidly produce muscle force in fast actions. This may be the mechanism of delayed execution

  16. Characterization of cyclic deformation behaviour of tempered and quenched 42CrMoS4 at single step and variable amplitude loading

    Schelp, M.; Eifler, D.

    2000-01-01

    Cyclic single steps tests were performed on tempered and quenched specimens of the steel 42CrMoS4. Strain, temperature and electrical resistance measurements yielded an empirical prediction of fatigue life according to Coffin, Manson and Morrow. All measured values are based on physical processes and therefore show a strong interaction. A new testing procedure was developed permitting hysteresis measurements to be used for the characterization and description of fatigue behaviour under variable amplitude loading. The basic idea is to combine fatigue tests with any kind of load spectrum with single step tests. This offers the possibility to apply lifetime prediction methods normally used for single step tests for those with random or service loading. (orig.)

  17. Determination of oil reservoir radiotracer (S14CN−) in a single step using a plastic scintillator extractive resin

    Bagán, H.; Tarancón, A.; Stavsetra, L.; Rauret, G.; García, J.F.

    2012-01-01

    Highlights: ► A new procedure for S 14 CN − radiotracer determination using PS resin was established. ► The minimum detectable activity for a 100 mL sample is 0.08 Bq L −1 . ► The minimum quantifiable activity for a 100 mL sample is 0.31 Bq L −1 . ► PS resin is capable to quantify S 14 CN − radiotracer samples with errors lower than 5%. ► PS resin is also capable to quantify complex matrices obtained from oil reservoirs. - Abstract: The analysis of radiotracers is important in the study of oil reservoir dynamics. One of the most widely used radiotracer is S 14 CN − . Prior to activity measurements by Liquid Scintillation (LS), routine determinations require the pretreatment steps of purification and concentration of the samples using anion exchange columns. The final elution media produces samples with high salt concentration that may lead to problems with phase separation during the LS measurement. Plastic Scintillation (PS) is an alternative technique that provides a solid surface that can be used as a platform for the immobilisation of selective extractants to obtain a PS resin. The proposed procedure unifies chemical separation and sample measurement preparation in a single step, serving to reduce the number of reagents needed and manpower required for the analysis while also avoiding mixed waste production by LS. The objective of this study is to develop a PS resin for the determination of 14 C-labelled thiocyanate radiotracer in water samples. For this purpose, the immobilisation procedure was optimised, including optimisation of the proportion of PS microspheres:extractant and the use of a control blank to monitor the PS resin immobilisation process. The breakthrough volume was studied and the detection and quantification limits for 100 mL of sample were determined to be 0.08 Bq L −1 and 0.31 Bq L −1 , respectively. The established procedure was applied to active samples from oil reservoirs and errors lower than 5% in the sample

  18. The effect of a cognitive-motor intervention on voluntary step execution under single and dual task conditions in older adults: a randomized controlled pilot study

    Pichierri G

    2012-07-01

    Full Text Available Giuseppe Pichierri,1 Amos Coppe,1 Silvio Lorenzetti,2 Kurt Murer,1 Eling D de Bruin11Institute of Human Movement Sciences and Sport, Department of Health Sciences and Technology, ETH Zurich, Switzerland; 2Institute for Biomechanics, Department of Health Sciences and Technology, ETH Zurich, SwitzerlandBackground: This randomized controlled pilot study aimed to explore whether a cognitive-motor exercise program that combines traditional physical exercise with dance video gaming can improve the voluntary stepping responses of older adults under attention demanding dual task conditions.Methods: Elderly subjects received twice weekly cognitive-motor exercise that included progressive strength and balance training supplemented by dance video gaming for 12 weeks (intervention group. The control group received no specific intervention. Voluntary step execution under single and dual task conditions was recorded at baseline and post intervention (Week 12.Results: After intervention between-group comparison revealed significant differences for initiation time of forward steps under dual task conditions (U = 9, P = 0.034, r = 0.55 and backward steps under dual task conditions (U = 10, P = 0.045, r = 0.52 in favor of the intervention group, showing altered stepping levels in the intervention group compared to the control group.Conclusion: A cognitive-motor intervention based on strength and balance exercises with additional dance video gaming is able to improve voluntary step execution under both single and dual task conditions in older adults.Keywords: fall prevention, exercise, dance, video game

  19. Determining Annealing Temperatures for Polymerase Chain Reaction

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  20. Single-Step Syngas-to-Distillates (S2D) Synthesis via Methanol and Dimethyl Ether Intermediates: Final Report

    Dagle, Robert A.; Lebarbier, Vanessa MC; Lizarazo Adarme, Jair A.; King, David L.; Zhu, Yunhua; Gray, Michel J.; Jones, Susanne B.; Biddy, Mary J.; Hallen, Richard T.; Wang, Yong; White, James F.; Holladay, Johnathan E.; Palo, Daniel R.

    2013-11-26

    would be allowed for methanol synthesis alone. Aromatic-rich hydrocarbon liquid (C5+), containing a significant amount of methylated benzenes, was produced under these conditions. However, selectivity control to liquid hydrocarbons was difficult to achieve. Carbon dioxide and methane formation was problematic. Furthermore, saturation of the olefinic intermediates formed in the zeolite, and necessary for gasoline production, occurred over PdZnAl. Thus, yield to desirable hydrocarbon liquid product was limited. Evaluation of other oxygenate-producing catalysts could possibly lead to future advances. Potential exists with discovery of other types of catalysts that suppress carbon dioxide and light hydrocarbon formation. Comparative techno-economics for a single-step syngas-to-distillates process and a more conventional MTG-type process were investigated. Results suggest operating and capital cost savings could only modestly be achieved, given future improvements to catalyst performance. Sensitivity analysis indicated that increased single-pass yield to hydrocarbon liquid is a primary need for this process to achieve cost competiveness.

  1. Single-Step Access to Long-Chain α,ω-Dicarboxylic Acids by Isomerizing Hydroxycarbonylation of Unsaturated Fatty Acids

    Goldbach, Verena; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Mecking, Stefan

    2016-01-01

    active Pd hydride species. Theoretical calculations identified the hydrolysis as the rate-determining step. A low nucleophile concentration in the reaction mixture in combination with this high energetic barrier limits the potential of this reaction

  2. DNA polymerase preference determines PCR priming efficiency.

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  3. [Detection of Echinococcus granulosus and Echinococcus multilocularis in cyst samples using a novel single tube multiplex real-time polymerase chain reaction].

    Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin

    2016-04-01

    Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M

  4. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  5. General methods for analysis of sequential "n-step" kinetic mechanisms: application to single turnover kinetics of helicase-catalyzed DNA unwinding.

    Lucius, Aaron L; Maluf, Nasib K; Fischer, Christopher J; Lohman, Timothy M

    2003-10-01

    Helicase-catalyzed DNA unwinding is often studied using "all or none" assays that detect only the final product of fully unwound DNA. Even using these assays, quantitative analysis of DNA unwinding time courses for DNA duplexes of different lengths, L, using "n-step" sequential mechanisms, can reveal information about the number of intermediates in the unwinding reaction and the "kinetic step size", m, defined as the average number of basepairs unwound between two successive rate limiting steps in the unwinding cycle. Simultaneous nonlinear least-squares analysis using "n-step" sequential mechanisms has previously been limited by an inability to float the number of "unwinding steps", n, and m, in the fitting algorithm. Here we discuss the behavior of single turnover DNA unwinding time courses and describe novel methods for nonlinear least-squares analysis that overcome these problems. Analytic expressions for the time courses, f(ss)(t), when obtainable, can be written using gamma and incomplete gamma functions. When analytic expressions are not obtainable, the numerical solution of the inverse Laplace transform can be used to obtain f(ss)(t). Both methods allow n and m to be continuous fitting parameters. These approaches are generally applicable to enzymes that translocate along a lattice or require repetition of a series of steps before product formation.

  6. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

    2003-01-01

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  7. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  8. Dynamics of Nonlinear Excitation of the High-Order Mode in a Single-Mode Step-Index Optical Fiber

    Burdin, V.; Bourdine, A.

    2018-04-01

    This work is concerned with approximate model of higher-order mode nonlinear excitation in a singlemode silica optical fiber. We present some results of simulation for step-index optical fiber under femtosecond optical pulse launching, which confirm ability of relatively stable higher-order mode excitation in such singlemode optical fiber over sufficiently narrow range of launched optical power variation.

  9. Promotion of the oxidation of carbon monoxide at stepped platinum single-crystal electrodes in alkaline media by lithium and beryllium cations.

    Stoffelsma, Chantal; Rodriguez, Paramaconi; Garcia, Gonzalo; Garcia-Araez, Nuria; Strmcnik, Dusan; Marković, Nenad M; Koper, Marc T M

    2010-11-17

    The role of alkali cations (Li(+), Na(+), K(+), Cs(+), and Be(2+)) on the blank voltammetric response and the oxidative stripping of carbon monoxide from stepped Pt single-crystal electrodes in alkaline media has been investigated by cyclic voltammetry. A strong influence of the nature of the cation on both the blank voltammetric profile and the CO oxidation is observed and related to the influence of the cation on the specific adsorption of OH on the platinum surface. Especially Li(+) and Be(2+) cations markedly affect the adsorption of OH and thereby have a significant promoting effect on CO(ads) oxidation. The voltammetric experiments suggest that, on Pt(111), the influence of Li(+) (and Be(2+)) is primarily through a weakening of the repulsive interactions between the OH in the OH adlayer, whereas in the presence of steps also, the onset of OH adsorption is at a lower potential, both on steps and on terraces.

  10. Step size of the rotary proton motor in single FoF1-ATP synthase from a thermoalkaliphilic bacterium by DCO-ALEX FRET

    Hammann, Eva; Zappe, Andrea; Keis, Stefanie; Ernst, Stefan; Matthies, Doreen; Meier, Thomas; Cook, Gregory M.; Börsch, Michael

    2012-02-01

    Thermophilic enzymes operate at high temperatures but show reduced activities at room temperature. They are in general more stable during preparation and, accordingly, are considered to be more rigid in structure. Crystallization is often easier compared to proteins from bacteria growing at ambient temperatures, especially for membrane proteins. The ATP-producing enzyme FoF1-ATP synthase from thermoalkaliphilic Caldalkalibacillus thermarum strain TA2.A1 is driven by a Fo motor consisting of a ring of 13 c-subunits. We applied a single-molecule Förster resonance energy transfer (FRET) approach using duty cycle-optimized alternating laser excitation (DCO-ALEX) to monitor the expected 13-stepped rotary Fo motor at work. New FRET transition histograms were developed to identify the smaller step sizes compared to the 10-stepped Fo motor of the Escherichia coli enzyme. Dwell time analysis revealed the temperature and the LDAO dependence of the Fo motor activity on the single molecule level. Back-and-forth stepping of the Fo motor occurs fast indicating a high flexibility in the membrane part of this thermophilic enzyme.

  11. Single-step synthesis of [18F]haloperidol from the chloro-precursor and its applications in PET imaging of a cat's brain

    Hashizume, Kazunari; Tamakawa, Hiroki; Hashimoto, Naoto; Miyake, Yoshihiro

    1997-01-01

    We have established a convenient synthesis process for the synthesis of [ 18 F]haloperidol using a single-step 18 F - for -Cl exchange reaction and a new elution system for the preparative high performance liquid chromatography (HPLC) using C18 bonded vinylalcohol copolymer gel (ODP) and a basic eluent. We successfully applied the product to cat-PET study and got clear images of the striatum, showing the usefulness of this synthesis. (author)

  12. Single-step preparation of TiO2/MWCNT Nanohybrid materials by laser pyrolysis and application to efficient photovoltaic energy conversion.

    Wang, Jin; Lin, Yaochen; Pinault, Mathieu; Filoramo, Arianna; Fabert, Marc; Ratier, Bernard; Bouclé, Johann; Herlin-Boime, Nathalie

    2015-01-14

    This paper presents the continuous-flowand single-step synthesis of a TiO2/MWCNT (multiwall carbon nanotubes) nanohybrid material. The synthesis method allows achieving high coverage and intimate interface between the TiO2particles and MWCNTs, together with a highly homogeneous distribution of nanotubes within the oxide. Such materials used as active layer in theporous photoelectrode of solid-state dye-sensitized solar cells leads to a substantial performance improvement (20%) as compared to reference devices.

  13. Single-step synthesis of [{sup 18}F]haloperidol from the chloro-precursor and its applications in PET imaging of a cat`s brain

    Hashizume, Kazunari; Tamakawa, Hiroki; Hashimoto, Naoto; Miyake, Yoshihiro [National Cardiovascular Center, Suita (Japan). Inst. of Biofunctional Research

    1997-09-01

    We have established a convenient synthesis process for the synthesis of [{sup 18}F]haloperidol using a single-step {sup 18}F - for -Cl exchange reaction and a new elution system for the preparative high performance liquid chromatography (HPLC) using C18 bonded vinylalcohol copolymer gel (ODP) and a basic eluent. We successfully applied the product to cat-PET study and got clear images of the striatum, showing the usefulness of this synthesis. (author).

  14. Single-step syngas-to-distillates (S2D) process based on biomass-derived syngas--a techno-economic analysis.

    Zhu, Yunhua; Jones, Susanne B; Biddy, Mary J; Dagle, Robert A; Palo, Daniel R

    2012-08-01

    This study compared biomass gasification based syngas-to-distillate (S2D) systems using techno-economic analysis (TEA). Three cases, state of technology (SOT), goal, and conventional, were compared in terms of performance and cost. The SOT case represented the best available experimental results for a process starting with syngas using a single-step dual-catalyst reactor for distillate generation. The conventional case mirrored a conventional two-step S2D process consisting of separate syngas-to-methanol and methanol-to-gasoline (MTG) processes. The goal case assumed the same performance as the conventional, but with a single-step S2D technology. TEA results revealed that the SOT was more expensive than the conventional and goal cases. The SOT case suffers from low one-pass yield and high selectivity to light hydrocarbons, both of which drive up production cost. Sensitivity analysis indicated that light hydrocarbon yield and single pass conversion efficiency were the key factors driving the high cost for the SOT case. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor [version 2; referees: 1 approved, 4 approved with reservations

    Aaron T.L. Lun

    2016-10-01

    Full Text Available Single-cell RNA sequencing (scRNA-seq is widely used to profile the transcriptome of individual cells. This provides biological resolution that cannot be matched by bulk RNA sequencing, at the cost of increased technical noise and data complexity. The differences between scRNA-seq and bulk RNA-seq data mean that the analysis of the former cannot be performed by recycling bioinformatics pipelines for the latter. Rather, dedicated single-cell methods are required at various steps to exploit the cellular resolution while accounting for technical noise. This article describes a computational workflow for low-level analyses of scRNA-seq data, based primarily on software packages from the open-source Bioconductor project. It covers basic steps including quality control, data exploration and normalization, as well as more complex procedures such as cell cycle phase assignment, identification of highly variable and correlated genes, clustering into subpopulations and marker gene detection. Analyses were demonstrated on gene-level count data from several publicly available datasets involving haematopoietic stem cells, brain-derived cells, T-helper cells and mouse embryonic stem cells. This will provide a range of usage scenarios from which readers can construct their own analysis pipelines.

  16. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi

    2009-07-01

    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  17. One-Step Nucleic Acid Amplification in Breast Cancer Sentinel Lymph Node: A Single Institutional Experience and a Short Review

    Brambilla, Tatiana; Fiamengo, Barbara; Tinterri, Corrado; Testori, Alberto; Grassi, Massimo Maria; Sciarra, Amedeo; Abbate, Tommaso; Gatzemeier, Wolfgang; Roncalli, Massimo; Di Tommaso, Luca

    2015-01-01

    Sentinel lymph node (SLN) examination is a standard in breast cancer patients, with several methods employed along its 20 years history, the last one represented by one-step nucleic acid amplification (OSNA). The latter is a intra-operative molecular assay searching for CK19 mRNA as a surrogate of metastatic cells. Our 3 years experience with OSNA (1122 patients) showed results overlapping those recorded in the same institution with a morphological evaluation (930 patients) of SLN. In detail,...

  18. Single-Molecule Fluorescence Reveals the Oligomerization and Folding Steps Driving the Prion-like Behavior of ASC.

    Gambin, Yann; Giles, Nichole; O'Carroll, Ailís; Polinkovsky, Mark; Hunter, Dominic; Sierecki, Emma

    2018-02-16

    Single-molecule fluorescence has the unique ability to quantify small oligomers and track conformational changes at a single-protein level. Here we tackled one of the most extreme protein behaviors, found recently in an inflammation pathway. Upon danger recognition in the cytosol, NLRP3 recruits its signaling adaptor, ASC. ASC start polymerizing in a prion-like manner and the system goes in "overdrive" by producing a single micron-sized "speck." By precisely controlling protein expression levels in an in vitro translation system, we could trigger the polymerization of ASC and mimic formation of specks in the absence of inflammasome nucleators. We utilized single-molecule spectroscopy to fully characterize prion-like behaviors and self-propagation of ASC fibrils. We next used our controlled system to monitor the conformational changes of ASC upon fibrillation. Indeed, ASC consists of a PYD and CARD domains, separated by a flexible linker. Individually, both domains have been found to form fibrils, but the structure of the polymers formed by the full-length ASC proteins remains elusive. For the first time, using single-molecule Förster resonance energy transfer, we studied the relative positions of the CARD and PYD domains of full-length ASC. An unexpectedly large conformational change occurred upon ASC fibrillation, suggesting that the CARD domain folds back onto the PYD domain. However, contradicting current models, the "prion-like" conformer was not initiated by binding of ASC to the NLRP3 platform. Rather, using a new method, hybrid between Photon Counting Histogram and Number and Brightness analysis, we showed that NLRP3 forms hexamers with self-binding affinities around 300nM. Overall our data suggest a new mechanism, where NLRP3 can initiate ASC polymerization simply by increasing the local concentration of ASC above a supercritical level. Copyright © 2017. Published by Elsevier Ltd.

  19. Single-step direct fabrication of pillar-on-pore hybrid nanostructures in anodizing aluminum for superior superhydrophobic efficiency.

    Jeong, Chanyoung; Choi, Chang-Hwan

    2012-02-01

    Conventional electrochemical anodizing processes of metals such as aluminum typically produce planar and homogeneous nanopore structures. If hydrophobically treated, such 2D planar and interconnected pore structures typically result in lower contact angle and larger contact angle hysteresis than 3D disconnected pillar structures and, hence, exhibit inferior superhydrophobic efficiency. In this study, we demonstrate for the first time that the anodizing parameters can be engineered to design novel pillar-on-pore (POP) hybrid nanostructures directly in a simple one-step fabrication process so that superior surface superhydrophobicity can also be realized effectively from the electrochemical anodization process. On the basis of the characteristic of forming a self-ordered porous morphology in a hexagonal array, the modulation of anodizing voltage and duration enabled the formulation of the hybrid-type nanostructures having controlled pillar morphology on top of a porous layer in both mild and hard anodization modes. The hybrid nanostructures of the anodized metal oxide layer initially enhanced the surface hydrophilicity significantly (i.e., superhydrophilic). However, after a hydrophobic monolayer coating, such hybrid nanostructures then showed superior superhydrophobic nonwetting properties not attainable by the plain nanoporous surfaces produced by conventional anodization conditions. The well-regulated anodization process suggests that electrochemical anodizing can expand its usefulness and efficacy to render various metallic substrates with great superhydrophilicity or -hydrophobicity by directly realizing pillar-like structures on top of a self-ordered nanoporous array through a simple one-step fabrication procedure.

  20. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Lina Marcela Villa

    2013-11-01

    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  1. Realization of a four-step molecular switch in scanning tunneling microscope manipulation of single chlorophyll-a molecules

    Iancu, Violeta; Hla, Saw-Wai

    2006-01-01

    Single chlorophyll-a molecules, a vital resource for the sustenance of life on Earth, have been investigated by using scanning tunneling microscope manipulation and spectroscopy on a gold substrate at 4.6 K. Chlorophyll-a binds on Au(111) via its porphyrin unit while the phytyl-chain is elevated from the surface by the support of four CH3 groups. By injecting tunneling electrons from the scanning tunneling microscope tip, we are able to bend the phytyl-chain, which enables the switching of four molecular conformations in a controlled manner. Statistical analyses and structural calculations reveal that all reversible switching mechanisms are initiated by a single tunneling-electron energy-transfer process, which induces bond rotation within the phytyl-chain. PMID:16954201

  2. Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

    Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

    2009-07-17

    Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

  3. Megajoule-class single-pulse KrF laser test facility as a logical step toward inertial fusion commercialization

    Harris, D.B.; Pendergrass, J.H.

    1985-01-01

    The cost and efficiency of megajoule-class KrF laser single pulse test facilities have been examined. A baseline design is described which illuminates targets with 5 MJ with shaped 10-ns pulses. The system uses 24 main amplifiers and operates with an optics operating fluence of 4.0 J/cm 2 . This system has 9.0% efficiency and costs $200/joule. Tradeoff studies indicate that large amplifier modules and high fluences lead to the lowest laser system costs, but that only a 20% cost savings can be realized by going to amplifier modules larger than 200 kJ and/or fluences greater than 4 J/cm 2 . The role of the megajoule-class single-pulse test facility towards inertial fusion commercialization will also be discussed

  4. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  5. A novel single-step procedure for the calibration of the mounting parameters of a multi-camera terrestrial mobile mapping system

    Habib, A.; Kersting, P.; Bang, K.; Rau, J.

    2011-12-01

    Mobile Mapping Systems (MMS) can be defined as moving platforms which integrates a set of imaging sensors and a position and orientation system (POS) for the collection of geo-spatial information. In order to fully explore the potential accuracy of such systems and guarantee accurate multi-sensor integration, a careful system calibration must be carried out. System calibration involves individual sensor calibration as well as the estimation of the inter-sensor geometric relationship. This paper tackles a specific component of the system calibration process of a multi-camera MMS - the estimation of the relative orientation parameters among the cameras, i.e., the inter-camera geometric relationship (lever-arm offsets and boresight angles among the cameras). For that purpose, a novel single step procedure, which is easy to implement and not computationally intensive, will be introduced. The proposed method is implemented in such a way that it can also be used for the estimation of the mounting parameters among the cameras and the IMU body frame, in case of directly georeferenced systems. The performance of the proposed method is evaluated through experimental results using simulated data. A comparative analysis between the proposed single-step and the two-step, which makes use of the traditional bundle adjustment procedure, is demonstrated.

  6. Properties of nano-structured Ni/YSZ anodes fabricated from plasma sprayable NiO/YSZ powder prepared by single step solution combustion method

    Prakash, B. Shri; Balaji, N.; Kumar, S. Senthil; Aruna, S.T., E-mail: staruna194@gmail.com

    2016-12-15

    Highlights: • Preparation of plasma grade NiO/YSZ powder in single step. • Fabrication of nano-structured Ni/YSZ coating. • Conductivity of 600 S/cm at 800 °C. - Abstract: NiO/YSZ anode coatings are fabricated by atmospheric plasma spraying at different plasma powers from plasma grade NiO/YSZ powders that are prepared in a single step by solution combustion method. The process adopted is devoid of multi-steps that are generally involved in conventional spray drying or fusing and crushing methods. Density of the coating increased and porosity decreased with increase in the plasma power of deposition. An ideal nano-structured Ni/YSZ anode encompassing nano YSZ particles, nano Ni particles and nano pores is achieved on reducing the coating deposited at lower plasma powers. The coating exhibit porosities in the range of 27%, sufficient for anode functional layers. Electronic conductivity of the coatings is in the range of 600 S/cm at 800 °C.

  7. Synthesis and integration of Fe-soc-MOF cubes into colloidosomes via a single-step emulsion-based approach

    Pang, Maolin

    2013-07-17

    Bottom-up fabrication of complex 3D hollow superstructures from nonspherical building blocks (BBs) poses a significant challenge for scientists in materials chemistry and physics. Spherical colloidal silica or polystyrene particles are therefore often integrated as BBs for the preparation of an emerging class of materials, namely colloidosomes (using colloidal particles for Pickering stabilization and fusing them to form a permeable shell). Herein, we describe for the first time a one-step emulsion-based technique that permits the assembly of metal-organic framework (MOF) faceted polyhedral BBs (i.e., cubes instead of spheres) into 3D hollow superstructures (or "colloidosomes" ). The shell of each resultant hollow MOF colloidosome is constructed from a monolayer of cubic BBs, whose dimensions can be precisely controlled by varying the amount of emulsifier used in the synthesis. © 2013 American Chemical Society.

  8. A novel single-step surgical technique for vestibular deepening using laser in conjunction with periodontal flap surgery

    Ashu Bhardwaj

    2016-01-01

    Full Text Available Moderate-to-severe chronic periodontitis results in clinical loss of attachment, reduced width of attached gingiva (AG, periodontal pockets beyond mucogingival junction (MGJ, gingival recession, loss of alveolar bone, and decreased vestibular depth (VD. The encroachment of frenal and muscle attachments on marginal gingiva increases the rate of progression of periodontal pockets, prevents healing, and causes their recurrence after therapy. Loss of VD and AG associated with continuous progression of pocket formation and bone loss requires two-stage surgical procedures. In this article, one-stage surgical procedure is being described for the first time, to treat the periodontal pockets extending beyond the MGJ by periodontal flap surgery along with vestibular deepening with diode laser to increase the AG. One-step surgical technique is illustrated whereby pocket therapy with reconstruction of lost periodontal tissues can be done along with gingival augmentation by vestibular deepening.

  9. Mixed-order phase transition in a two-step contagion model with a single infectious seed.

    Choi, Wonjun; Lee, Deokjae; Kahng, B

    2017-02-01

    Percolation is known as one of the most robust continuous transitions, because its occupation rule is intrinsically local. As one of the ways to break the robustness, occupation is allowed to more than one species of particles and they occupy cooperatively. This generalized percolation model undergoes a discontinuous transition. Here we investigate an epidemic model with two contagion steps and characterize its phase transition analytically and numerically. We find that even though the order parameter jumps at a transition point r_{c}, then increases continuously, it does not exhibit any critical behavior: the fluctuations of the order parameter do not diverge at r_{c}. However, critical behavior appears in mean outbreak size, which diverges at the transition point in a manner that the ordinary percolation shows. Such a type of phase transition is regarded as a mixed-order phase transition. We also obtain scaling relations of cascade outbreak statistics when the order parameter jumps at r_{c}.

  10. Single-Step Access to Long-Chain α,ω-Dicarboxylic Acids by Isomerizing Hydroxycarbonylation of Unsaturated Fatty Acids

    Goldbach, Verena

    2016-11-09

    Dicarboxylic acids are compounds of high value, but to date long-chain alpha,omega-dicarboxylic acids have been difficult to access in a direct way. Unsaturated fatty acids are ideal starting materials with their molecular structure of long methylene sequences and a carboxylate functionality, in addition to a double bond that offers itself for functionalization. Within this paper, we established a direct access to alpha,omega-dicarboxylic acids by combining isomerization and selective terminal carbonylation of the internal double bond with water as a nucleophile on unsaturated fatty acids. We identified the key elements of this reaction: a homogeneous reaction mixture ensuring sufficient contact between all reactants and a catalyst system allowing for activation of the Pd precursor under aqueous conditions. Experiments under pressure reactor conditions with [(dtbpx)Pd(OTf)(2)] as catalyst precursor revealed the importance of nucleophile and reactant concentrations and the addition of the diprotonated diphosphine ligand (dtbpxH(2))(OTf)(2) to achieve turnover numbers >120. A variety of unsaturated fatty acids, including a triglyceride, were converted to valuable long-chain dicarboxylic acids with high turnover numbers and selectivities for the linear product of >90%. We unraveled the activation pathway of the Pd-II precursor, which proceeds via a reductive elimination step forming a Pd species and oxidative addition of the diprotonated diphosphine ligand, resulting in the formation of the catalytically active Pd hydride species. Theoretical calculations identified the hydrolysis as the rate-determining step. A low nucleophile concentration in the reaction mixture in combination with this high energetic barrier limits the potential of this reaction. In conclusion, water can be utilized as a nucleophile in isomerizing functionalization reactions and gives access to long-chain dicarboxylic acids from a variety of unsaturated substrates. The activity of the catalytic

  11. Single Switch Nonisolated Ultra-Step-Up DC-DC Converter with an Integrated Coupled Inductor for High Boost Applications

    Siwakoti, Yam P.; Blaabjerg, Frede

    2017-01-01

    This paper introduces a new single-switch nonisolated dc-dc converter with very high voltage gain and reduced semiconductor voltage stress. The converter utilizes an integrated autotransformer and a coupled inductor on the same core in order to achieve a very high voltage gain without using extreme...... duty cycle. Furthermore, a passive lossless clamp circuit recycles the leakage energy of the coupled magnetics and alleviates the voltage spikes across the main switch. This feature along with low stress on the switching device enables the designer to use a low voltage and low RDS-on MOSFET, which...

  12. Microchannel-connected SU-8 honeycombs by single-step projection photolithography for positioning cells on silicon oxide nanopillar arrays

    Larramendy, Florian; Paul, Oliver; Blatche, Marie Charline; Mazenq, Laurent; Laborde, Adrian; Temple-Boyer, Pierre

    2015-01-01

    We report on the fabrication, functionalization and testing of SU-8 microstructures for cell culture and positioning over large areas. The microstructure consists of a honeycomb arrangement of cell containers interconnected by microchannels and centered on nanopillar arrays designed for promoting cell positioning. The containers have been dimensioned to trap single cells and, with a height of 50 µm, prevent cells from escaping. The structures are fabricated using a single ultraviolet photolithography exposure with focus depth in the lower part of the SU-8 resist. With optimized process parameters, microchannels of various aspect ratios are thus produced. The cell containers and microchannels serve for the organization of axonal growth between neurons. The roughly 2 µm-high and 500 nm-wide nanopillars are made of silicon oxide structured by deep reactive ion etching. In future work, beyond their cell positioning purpose, the nanopillars could be functionalized as sensors. The proof of concept of the novel microstructure for organized cell culture is given by the successful growth of interconnected PC12 cells. Promoted by the honeycomb geometry, a dense network of interconnections between the cells has formed and the intended intimate contact of cells with the nanopillar arrays was observed by scanning electron microscopy. This proves the potential of these new devices as tools for the controlled cell growth in an interconnected container system with well-defined 3D geometry. (paper)

  13. Effect of different air-drying time on the microleakage of single-step self-etch adhesives

    Horieh Moosavi

    2013-05-01

    Full Text Available Objectives This study evaluated the effect of three different air-drying times on microleakage of three self-etch adhesive systems. Materials and Methods Class I cavities were prepared for 108 extracted sound human premolars. The teeth were divided into three main groups based on three different adhesives: Opti Bond All in One (OBAO, Clearfil S3 Bond (CSB, Bond Force (BF. Each main group divided into three subgroups regarding the air-drying time: without application of air stream, following the manufacturer's instruction, for 10 sec more than manufacturer's instruction. After completion of restorations, specimens were thermocycled and then connected to a fluid filtration system to evaluate microleakage. The data were statistically analyzed using two-way ANOVA and Tukey-test (α = 0.05. Results The microleakage of all adhesives decreased when the air-drying time increased from 0 sec to manufacturer's instruction (p < 0.001. The microleakage of BF reached its lowest values after increasing the drying time to 10 sec more than the manufacturer's instruction (p < 0.001. Microleakage of OBAO and CSB was significantly lower compared to BF in all three drying time (p < 0.001. Conclusions Increasing in air-drying time of adhesive layer in one-step self-etch adhesives caused reduction of microleakage, but the amount of this reduction may be dependent on the adhesive components of self-etch adhesives.

  14. One-Step Nucleic Acid Amplification in Breast Cancer Sentinel Lymph Node: A Single Institutional Experience and a Short Review.

    Brambilla, Tatiana; Fiamengo, Barbara; Tinterri, Corrado; Testori, Alberto; Grassi, Massimo Maria; Sciarra, Amedeo; Abbate, Tommaso; Gatzemeier, Wolfgang; Roncalli, Massimo; Di Tommaso, Luca

    2015-01-01

    Sentinel lymph node (SLN) examination is a standard in breast cancer patients, with several methods employed along its 20 years history, the last one represented by one-step nucleic acid amplification (OSNA). The latter is a intra-operative molecular assay searching for CK19 mRNA as a surrogate of metastatic cells. Our 3 years experience with OSNA (1122 patients) showed results overlapping those recorded in the same institution with a morphological evaluation (930 patients) of SLN. In detail, the data of OSNA were almost identical to those observed with standard post-operative procedure in terms of patients with positive SLN (30%) and micrometastatic/macrometastatic involvement of SLN (respectively, 38-45 and 62-55%). By contrast, when OSNA was compared to the standard intraoperatory procedure, it was superior in terms of accuracy, prompting the use of this molecular assay as a very valid, and reproducible for intra-operative evaluation of SLN. Further possibilities prompting the use of OSNA range from adhesion to quality control programs, saving of medical time, ability to predict, during surgery, additional nodal metastasis, and molecular bio-banking.

  15. Surfactant-directed synthesis of mesoporous films made single-step by a tandem photosol-gel/photocalcination route

    De Paz-Simon, Héloïse; Chemtob, Abraham, E-mail: abraham.chemtob@uha.fr; Croutxé-Barghorn, Céline [Laboratory of Macromolecular Photochemistry and Engineering, ENSCMu, University of Haute-Alsace, 3 bis rue Alfred Werner, 68093 Mulhouse Cedex (France); Rigolet, Séverinne; Michelin, Laure; Vidal, Loïc; Lebeau, Bénédicte [Institut de Science des Matériaux de Mulhouse, UMR-CNRS 7361, University of Haute-Alsace, 3 rue Alfred Werner, 68093 Mulhouse Cedex (France)

    2014-11-01

    In view of their technological impact in materials chemistry, a simplified and more efficient synthetic route to mesoporous films is highly sought. We report, herein, a smart UV-mediated approach coupling in a one-stage process sol-gel photopolymerization and photoinduced template decomposition/ablation to making mesoporous silica films. Performed at room temperature with a solvent-free solution of silicate precursor and amphiphilic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) block copolymer, the synthesis relies on photoacid generation to induce the fast formation (≈10 min) of mesostructured silica/surfactant domains. Continuation of UV exposure for three additional hours enables subsequent and complete photodegradation of the polyether copolymer, resulting in ordered or disordered mesoporous silica film. One of the most attractive features is that the one-step procedure relies on a continuous illumination provided by the same conventional medium-pressure Hg-Xe arc lamp equipped with a 254 nm reflector to enhance the emission of energetic photons <300 nm. In addition to X-ray diffraction and transmission electron microscopy, time-resolved Fourier transform infrared spectroscopy has proved to be a powerful in situ technique to probe the different chemical transformations accompanying irradiation. Photocalcination strengthens the inorganic network, while allowing to preserve a higher fraction of residual silanol groups compared with thermal calcination. A polyether chain degradation mechanism based on oxygen reactive species-mediated photo-oxidation is proposed.

  16. The Effect of Phosphoric Acid Pre-etching Times on Bonding Performance and Surface Free Energy with Single-step Self-etch Adhesives.

    Tsujimoto, A; Barkmeier, W W; Takamizawa, T; Latta, M A; Miyazaki, M

    2016-01-01

    The purpose of this study was to evaluate the effect of phosphoric acid pre-etching times on shear bond strength (SBS) and surface free energy (SFE) with single-step self-etch adhesives. The three single-step self-etch adhesives used were: 1) Scotchbond Universal Adhesive (3M ESPE), 2) Clearfil tri-S Bond (Kuraray Noritake Dental), and 3) G-Bond Plus (GC). Two no pre-etching groups, 1) untreated enamel and 2) enamel surfaces after ultrasonic cleaning with distilled water for 30 seconds to remove the smear layer, were prepared. There were four pre-etching groups: 1) enamel surfaces were pre-etched with phosphoric acid (Etchant, 3M ESPE) for 3 seconds, 2) enamel surfaces were pre-etched for 5 seconds, 3) enamel surfaces were pre-etched for 10 seconds, and 4) enamel surfaces were pre-etched for 15 seconds. Resin composite was bonded to the treated enamel surface to determine SBS. The SFEs of treated enamel surfaces were determined by measuring the contact angles of three test liquids. Scanning electron microscopy was used to examine the enamel surfaces and enamel-adhesive interface. The specimens with phosphoric acid pre-etching showed significantly higher SBS and SFEs than the specimens without phosphoric acid pre-etching regardless of the adhesive system used. SBS and SFEs did not increase for phosphoric acid pre-etching times over 3 seconds. There were no significant differences in SBS and SFEs between the specimens with and without a smear layer. The data suggest that phosphoric acid pre-etching of ground enamel improves the bonding performance of single-step self-etch adhesives, but these bonding properties do not increase for phosphoric acid pre-etching times over 3 seconds.

  17. Direct and seamless coupling of TiO{sub 2} nanotube photonic crystal to dye-sensitized solar cell: a single-step approach

    Yip, Cho Tung; Zhou, Limin [Department of Mechanical Engineering, Hong Kong Polytechnic University, Hung Hom, Kowloon (China); Huang, Haitao; Xie, Keyu; Wang, Yu. [Department of Applied Physics and Materials Research Center, Hong Kong Polytechnic University, Hung Hom, Kowloon (China); Feng, Tianhua; Li, Jensen [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon (China); Tam, Wing Yim [Department of Physics, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon (China)

    2011-12-15

    A TiO{sub 2} nanotube layer with a periodic structure is used as a photonic crystal to greatly enhance light harvesting in TiO{sub 2} nanotube-based dye-sensitized solar cells. Such a tube-on-tube structure fabricated by a single-step approach facilitates good physical contact, easy electrolyte infiltration, and efficient charge transport. An increase of over 50% in power conversion efficiency is obtained in comparison to reference cells without a photonic crystal layer (under similar total thickness and dye loading). (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Combination of electromembrane extraction and liquid-phase microextraction in a single step: Simultaneous group separation of acidic and basic drugs

    Huang, Chuixiu; Seip, Knut Fredrik; Gjelstad, Astrid

    2015-01-01

    at high concentration. This approach was further investigated from human plasma. Extraction recoveries were strongly dependent on dilution of plasma with buffer and on extraction time. Finally, this simultaneous EME/LPME approach was evaluated in combination with liquid chromatography (LC......Electromembrane extraction (EME) and liquid-phase microextraction (LPME) were combined in a single step for the first time to realize simultaneous and clear group separation of basic and acidic drugs. Using 2-nitrophenyl octyl ether as the supported liquid membrane (SLM) for EME and dihexyl ether...

  19. Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR/Cas9.

    Honda, Arata; Hirose, Michiko; Sankai, Tadashi; Yasmin, Lubna; Yuzawa, Kazuaki; Honsho, Kimiko; Izu, Haruna; Iguchi, Atsushi; Ikawa, Masahito; Ogura, Atsuo

    2015-01-01

    Targeted genome editing of nonrodent mammalian species has provided the potential for highly accurate interventions into gene function in humans and the generation of useful animal models of human diseases. Here we show successful clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated (Cas)-mediated gene targeting via circular plasmid injection in rabbits. The rabbit tyrosinase gene (TYR) was effectively disrupted, and we confirmed germline transmission by pronuclear injection of a circular plasmid expressing humanized Cas9 (hCas9) and single-guide RNA. Direct injection into pronuclear stage zygotes was possible following an in vitro validation assay. Neither off-target mutagenesis nor hCas9 transgenesis was detected in any of the genetically targeted pups and embryos examined. Gene targeting with this rapid and simplified strategy will help accelerate the development of translational research using other nonrodent mammalian species.

  20. Single step 18F-labeling of dimeric cycloRGD for functional PET imaging of tumors in mice

    Li, Ying; Liu, Zhibo; Lozada, Jerome; Wong, May Q.; Lin, Kuo-Shyan; Yapp, Donald; Perrin, David M.

    2013-01-01

    Introduction: Arylboronates afford rapid aqueous 18 F-labeling via the creation of a highly polar 18 F-aryltrifluoroborate anion ( 18 F-ArBF 3 − ). Hypothesis: Radiosynthesis of an 18 F-ArBF 3 − can be successfully applied to a clinically relevant peptide. To test this hypothesis, we labeled dimeric-cylcoRGD, [c(RGDfK)] 2 E because a) it is molecularly complex and provides a challenging substrate to test the application of this technique, and b) [c(RGDfK)] 2 E has already been labeled via several 18 F-labeling methods which provide for a preliminary comparison. Goal: To validate this labeling method in the context of a complex and clinically relevant tracer to show tumor-specific uptake ex vivo with representative PET images in vivo. Methods: An arylborimidine was conjugated to [c(RGDfK)] 2 E to give the precursor [c(RGDfK)] 2 E-ArB(dan), which was aliquoted and stored at − 20 °C. Aliquots of 10 or 25 nmol, containing only micrograms of precursor, were labeled using relatively low levels of 18 F-activity. Following purification eight mice (pre-blocked/unblocked) with U87M xenograft tumors were injected with [c(RGDfK)] 2 E- 18 F-ArBF 3 − (n = 4) for ex vivo tissue dissection. Two sets of mice (pre-blocked/unblocked) were also imaged with PET–CT (n = 2). Results: The [c(RGDfK)] 2 E-ArB(dan) is converted within 15 min to [c(RGDfK)] 2 E- 18 F-ArBF 3 − in isolated radiochemical yields of ∼ 10% (n = 3) at a minimum effective specific activity of 0.3 Ci/μmol. Biodistribution shows rapid clearance to the bladder via the kidney resulting in high tumor-to-blood and tumor-to-muscle ratios of > 9 and > 6 respectively while pre-blocking with [c(RGDfK)] 2 E showed high tumor specificity. PET imaging showed good contrast between tumor and non-target tissues confirming the biodistribution data. Conclusion: An arylborimidine-RGD peptide is rapidly 18 F-labeled in one step, in good yield, at useful specific activity. Biodistribution studies with blocking controls

  1. Feasibility of electrospray deposition for rapid screening of the cocrystal formation and single step, continuous production of pharmaceutical nanococrystals.

    Emami, Shahram; Siahi-Shadbad, Mohammadreza; Barzegar-Jalali, Mohammad; Adibkia, Khosro

    2018-06-01

    This study employed electrospray deposition (ESD) for simultaneous synthesis and particle engineering of cocrystals. Exploring new methods for the efficient production of cocrystals with desired particle properties is an essential demand. The possibility of cocrystal formation by ESD was examined for indomethacin-saccharin, indomethacin-nicotinamide, naproxen-nicotinamide, and naproxen-iso-nicotinamide cocrystals. Solutions of the drug and coformer at stoichiometric ratios were sprayed to a high electric field which caused rapid evaporation of the solvent and the formation of fine particles. The phase purity, size, and morphology of products were compared with reference cocrystals. Experiments were performed to evaluate the effects of stoichiometric ratio, concentration and solvent type on the cocrystal formation. Physical stability and dissolution properties of the electrosprayed cocrystals were also compared with reference cocrystals. ESD was found to be an efficient and rapid method to produce cocrystals for all studied systems other than indomethacin-nicotinamide. Pure cocrystals only formed at a specific drug:coformer ratio. The solvent type has a weak effect on the cocrystal formation and morphology. Electrosprayed cocrystals exhibited nano to micrometer sizes with distinct morphologies with comparable physical stability with reference cocrystals. Nanococrystals of indomethacin-saccharin with a mean size of 219 nm displayed a threefold higher dissolution rate than solvent evaporated cocrystal. ESD successfully was utilized to produce pure cocrystals of poorly soluble drugs with different morphologies and sizes ranging from nano to micrometer sizes in one step. This study highlighted the usefulness of ESD for simultaneous preparation and particle engineering of pharmaceutical cocrystals.

  2. Comparison of single-step reverse transepithelial all-surface laser ablation (ASLA) to alcohol-assisted photorefractive keratectomy.

    Aslanides, Ioannis M; Padroni, Sara; Arba Mosquera, Samuel; Ioannides, Antonis; Mukherjee, Achyut

    2012-01-01

    To evaluate postoperative pain, corneal epithelial healing, development of corneal haze, refractive outcomes, and corneal aberrations in a novel one-step, modified transepithelial photorefractive keratectomy (PRK), termed All-surface laser ablation (ASLA), compared to conventional, alcohol-assisted PRK. Sixty eyes of 30 myopic patients were prospectively recruited to a randomized fellow eye study. Patients underwent conventional alcohol-assisted PRK in one eye (control group) and ASLA-modified transepithelial PRK in the other (30 eyes in each treatment arm). Primary endpoints were postoperative pain and haze scores at 1 day, 3 days, 1 week, and 1, 3, 6, and 12 months. Secondary endpoints included visual acuity at 1, 3, 6, and 12 months, corneal aberrations at 3, 6, and 12 months, and early and late onset haze. Refractive predictability, safety, and efficacy of the two methods were considered. The average age of the cohort was 29 years (standard deviation [SD]: 9; range: 18-46), and the average spherical equivalent refractive error was -4.18 diopters (SD: 1.9). At 3 days after surgery, the average pain score was 64% lower in the ASLA group (P < 0.0005). At this point, 96% of ASLA eyes had no epithelial defect, whereas 43% in the alcohol-assisted group did not achieve complete epithelial healing, and required replacement of bandage contact lens. The haze level was consistently lower in the ASLA group at all time points from 1 to 6 months. This study shows that the ASLA technique may have a future role in refractive surgery, due to the fact that it offers faster epithelial healing, lower pain scores, and significantly less haze formation.

  3. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  4. Comparison of single-step reverse transepithelial all-surface laser ablation (ASLA to alcohol-assisted photorefractive keratectomy

    Aslanides IM

    2012-06-01

    Full Text Available Ioannis M Aslanides,1 Sara Padroni,1 Samuel Arba Mosquera,2 Antonis Ioannides,1 Achyut Mukherjee11Emmetropia Mediterranean Eye Institute, Heraklion, Crete, Greece; 2Schwind eye-tech-solutions GmbH, Kleinostheim, GermanyPurpose: To evaluate postoperative pain, corneal epithelial healing, development of corneal haze, refractive outcomes, and corneal aberrations in a novel one-step, modified transepithelial photorefractive keratectomy (PRK, termed All-surface laser ablation (ASLA, compared to conventional, alcohol-assisted PRK.Materials and methods: Sixty eyes of 30 myopic patients were prospectively recruited to a randomized fellow eye study. Patients underwent conventional alcohol-assisted PRK in one eye (control group and ASLA-modified transepithelial PRK in the other (30 eyes in each treatment arm. Primary endpoints were postoperative pain and haze scores at 1 day, 3 days, 1 week, and 1, 3, 6, and 12 months. Secondary endpoints included visual acuity at 1, 3, 6, and 12 months, corneal aberrations at 3, 6, and 12 months, and early and late onset haze. Refractive predictability, safety, and efficacy of the two methods were considered.Results: The average age of the cohort was 29 years (standard deviation [SD]: 9; range: 18–46, and the average spherical equivalent refractive error was -4.18 diopters (SD: 1.9. At 3 days after surgery, the average pain score was 64% lower in the ASLA group (P < 0.0005. At this point, 96% of ASLA eyes had no epithelial defect, whereas 43% in the alcohol-assisted group did not achieve complete epithelial healing, and required replacement of bandage contact lens. The haze level was consistently lower in the ASLA group at all time points from 1 to 6 months.Conclusion: This study shows that the ASLA technique may have a future role in refractive surgery, due to the fact that it offers faster epithelial healing, lower pain scores, and significantly less haze formation.Keywords: cornea, ASLA, PRK, alcohol

  5. Initial steps toward the realization of large area arrays of single photon counting pixels based on polycrystalline silicon TFTs

    Liang, Albert K.; Koniczek, Martin; Antonuk, Larry E.; El-Mohri, Youcef; Zhao, Qihua; Jiang, Hao; Street, Robert A.; Lu, Jeng Ping

    2014-03-01

    The thin-film semiconductor processing methods that enabled creation of inexpensive liquid crystal displays based on amorphous silicon transistors for cell phones and televisions, as well as desktop, laptop and mobile computers, also facilitated the development of devices that have become ubiquitous in medical x-ray imaging environments. These devices, called active matrix flat-panel imagers (AMFPIs), measure the integrated signal generated by incident X rays and offer detection areas as large as ~43×43 cm2. In recent years, there has been growing interest in medical x-ray imagers that record information from X ray photons on an individual basis. However, such photon counting devices have generally been based on crystalline silicon, a material not inherently suited to the cost-effective manufacture of monolithic devices of a size comparable to that of AMFPIs. Motivated by these considerations, we have developed an initial set of small area prototype arrays using thin-film processing methods and polycrystalline silicon transistors. These prototypes were developed in the spirit of exploring the possibility of creating large area arrays offering single photon counting capabilities and, to our knowledge, are the first photon counting arrays fabricated using thin film techniques. In this paper, the architecture of the prototype pixels is presented and considerations that influenced the design of the pixel circuits, including amplifier noise, TFT performance variations, and minimum feature size, are discussed.

  6. An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

    Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

    2016-06-01

    The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

  7. One small step for a yeast--microevolution within macrophages renders Candida glabrata hypervirulent due to a single point mutation.

    Sascha Brunke

    2014-10-01

    Full Text Available Candida glabrata is one of the most common causes of candidemia, a life-threatening, systemic fungal infection, and is surpassed in frequency only by Candida albicans. Major factors contributing to the success of this opportunistic pathogen include its ability to readily acquire resistance to antifungals and to colonize and adapt to many different niches in the human body. Here we addressed the flexibility and adaptability of C. glabrata during interaction with macrophages with a serial passage approach. Continuous co-incubation of C. glabrata with a murine macrophage cell line for over six months resulted in a striking alteration in fungal morphology: The growth form changed from typical spherical yeasts to pseudohyphae-like structures - a phenotype which was stable over several generations without any selective pressure. Transmission electron microscopy and FACS analyses showed that the filamentous-like morphology was accompanied by changes in cell wall architecture. This altered growth form permitted faster escape from macrophages and increased damage of macrophages. In addition, the evolved strain (Evo showed transiently increased virulence in a systemic mouse infection model, which correlated with increased organ-specific fungal burden and inflammatory response (TNFα and IL-6 in the brain. Similarly, the Evo mutant significantly increased TNFα production in the brain on day 2, which is mirrored in macrophages confronted with the Evo mutant, but not with the parental wild type. Whole genome sequencing of the Evo strain, genetic analyses, targeted gene disruption and a reverse microevolution experiment revealed a single nucleotide exchange in the chitin synthase-encoding CHS2 gene as the sole basis for this phenotypic alteration. A targeted CHS2 mutant with the same SNP showed similar phenotypes as the Evo strain under all experimental conditions tested. These results indicate that microevolutionary processes in host-simulative conditions

  8. Microwave pyrolysis using self-generated pyrolysis gas as activating agent: An innovative single-step approach to convert waste palm shell into activated carbon

    Yek, Peter Nai Yuh; Keey Liew, Rock; Shahril Osman, Mohammad; Chung Wong, Chee; Lam, Su Shiung

    2017-11-01

    Waste palm shell (WPS) is a biomass residue largely available from palm oil industries. An innovative microwave pyrolysis method was developed to produce biochar from WPS while the pyrolysis gas generated as another product is simultaneously used as activating agent to transform the biochar into waste palm shell activated carbon (WPSAC), thus allowing carbonization and activation to be performed simultaneously in a single-step approach. The pyrolysis method was investigated over a range of process temperature and feedstock amount with emphasis on the yield and composition of the WPSAC obtained. The WPSAC was tested as dye adsorbent in removing methylene blue. This pyrolysis approach provided a fast heating rate (37.5°/min) and short process time (20 min) in transforming WPS into WPSAC, recording a product yield of 40 wt%. The WPSAC was detected with high BET surface area (≥ 1200 m2/g), low ash content (< 5 wt%), and high pore volume (≥ 0.54 cm3/g), thus recording high adsorption efficiency of 440 mg of dye/g. The desirable process features (fast heating rate, short process time) and the recovery of WPSAC suggest the exceptional promise of the single-step microwave pyrolysis approach to produce high-grade WPSAC from WPS.

  9. Development of a method to extract and purify target compounds from medicinal plants in a single step: online hyphenation of expanded bed adsorption chromatography and countercurrent chromatography.

    Li, Yang; Wang, Nan; Zhang, Min; Ito, Yoichiro; Zhang, Hongyang; Wang, Yuerong; Guo, Xin; Hu, Ping

    2014-04-01

    Pure compounds extracted and purified from natural sources are crucial to lead discovery and drug screening. This study presents a novel two-dimensional hyphenation of expanded bed adsorption chromatography (EBAC) and high-speed countercurrent chromatography (HSCCC) for extraction and purification of target compounds from medicinal plants in a single step. The EBAC and HSCCC were hyphenated via a six-port injection valve as an interface. Fractionation of ingredients of Salvia miltiorrhiza and Rhizoma coptidis was performed on the hyphenated system to verify its efficacy. Two compounds were harvested from Salvia miltiorrhiza, one was 52.9 mg of salvianolic acid B with an over 95% purity and the other was 2.1 mg of rosmarinic acid with a 74% purity. Another two components were purified from Rhizoma coptidis, one was 4.6 mg of coptisine with a 98% purity and one was 4.1 mg of berberine with a 82% purity. The processing time was nearly 50% that of the multistep method. The results indicate that the present method is a rapid and green way to harvest targets from medicinal plants in a single step.

  10. Characterizing the Final Steps of Chromosomal Replication at the Single-molecule Level in the Model System Escherichia coli

    Elshenawy, Mohamed M.

    2015-12-01

    In the circular Escherichia coli chromosome, two replisomes are assembled at the unique origin of replication and drive DNA synthesis in opposite directions until they meet in the terminus region across from the origin. Despite the difference in rates of the two replisomes, their arrival at the terminus is synchronized through a highly specialized system consisting of the terminator protein (Tus) bound to the termination sites (Ter). This synchronicity is mediated by the polarity of the Tus−Ter complex that stops replisomes from one direction (non-permissive face) but not the other (permissive face). Two oppositely oriented clusters of five Tus–Ters that each block one of the two replisomes create a “replication fork trap” for the first arriving replisome while waiting for the late arriving one. Despite extensive biochemical and structural studies, the molecular mechanism behind Tus−Ter polar arrest activity remained controversial. Moreover, none of the previous work provided answers for the long-standing discrepancy between the ability of Tus−Ter to permanently stop replisomes in vitro and its low efficiency in vivo. Here, I spearheaded a collaborative project that combined single-molecule DNA replication assays, X-ray crystallography and binding studies to provide a true molecular-level understanding of the underlying mechanism of Tus−Ter polar arrest activity. We showed that efficiency of Tus−Ter is determined by a head-to-head kinetic competition between rate of strand separation by the replisome and rate of rearrangement of Tus−Ter interactions during the melting of the first 6 base pairs of Ter. This rearrangement maintains Tus’s strong grip on the DNA and stops the advancing replisome from breaking into Tus−Ter central interactions, but only transiently. We further showed how this kinetic competition functions within the context of two mechanisms to impose permanent fork stoppage. The rate-dependent fork arrest activity of Tus

  11. Real-time dynamics of RNA Polymerase II clustering in live human cells

    Cisse, Ibrahim

    2014-03-01

    Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.

  12. Comparison of the phenolic composition of fruit juices by single step gradient HPLC analysis of multiple components versus multiple chromatographic runs optimised for individual families.

    Bremner, P D; Blacklock, C J; Paganga, G; Mullen, W; Rice-Evans, C A; Crozier, A

    2000-06-01

    After minimal sample preparation, two different HPLC methodologies, one based on a single gradient reversed-phase HPLC step, the other on multiple HPLC runs each optimised for specific components, were used to investigate the composition of flavonoids and phenolic acids in apple and tomato juices. The principal components in apple juice were identified as chlorogenic acid, phloridzin, caffeic acid and p-coumaric acid. Tomato juice was found to contain chlorogenic acid, caffeic acid, p-coumaric acid, naringenin and rutin. The quantitative estimates of the levels of these compounds, obtained with the two HPLC procedures, were very similar, demonstrating that either method can be used to analyse accurately the phenolic components of apple and tomato juices. Chlorogenic acid in tomato juice was the only component not fully resolved in the single run study and the multiple run analysis prior to enzyme treatment. The single run system of analysis is recommended for the initial investigation of plant phenolics and the multiple run approach for analyses where chromatographic resolution requires improvement.

  13. A rapid, ratiometric, enzyme-free, and sensitive single-step miRNA detection using three-way junction based FRET probes

    Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen

    2018-03-01

    MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.

  14. A high-yield, one-step synthesis of surfactant-free gold nanostars and numerical study for single-molecule SERS application

    Chatterjee, S.; Ringane, A. B.; Arya, A.; Das, G. M.; Dantham, V. R., E-mail: dantham@iitp.ac.in; Laha, R. [Indian Institute of Technology Patna, Department of Physics (India); Hussian, S. [Indian Institute of Technology Patna, Department of Chemistry (India)

    2016-08-15

    We report a high-yield synthesis of star-shaped gold nanostructures in one step, using a new surfactant-free wet chemistry method. Compared to the existing reports, these nanostars were found to have longer and sharper spikes anchored uniformly on the surface of the spherical core, allowing at least a few hot spots irrespective of the incident light polarization. The average experimental values of core radius and spike length were found to be 88.5 and 72 nm, respectively. Using these values in numerical simulations, the local electric field enhancement (η) and localized surface plasmon resonance (LSPR) spectrum were obtained. Moreover, the single-molecule surface-enhanced Raman scattering (SERS) enhancement factor was found to vary from 10{sup 10} to 10{sup 13} depending on the excitation wavelengths. Our theoretical calculations suggest that these nanostructures can be used to fabricate efficient SERS-based biosensors for the detection of single molecules in real time and for predicting structural information of single molecules.

  15. Implementation of genomic recursions in single-step genomic best linear unbiased predictor for US Holsteins with a large number of genotyped animals.

    Masuda, Y; Misztal, I; Tsuruta, S; Legarra, A; Aguilar, I; Lourenco, D A L; Fragomeni, B O; Lawlor, T J

    2016-03-01

    The objectives of this study were to develop and evaluate an efficient implementation in the computation of the inverse of genomic relationship matrix with the recursion algorithm, called the algorithm for proven and young (APY), in single-step genomic BLUP. We validated genomic predictions for young bulls with more than 500,000 genotyped animals in final score for US Holsteins. Phenotypic data included 11,626,576 final scores on 7,093,380 US Holstein cows, and genotypes were available for 569,404 animals. Daughter deviations for young bulls with no classified daughters in 2009, but at least 30 classified daughters in 2014 were computed using all the phenotypic data. Genomic predictions for the same bulls were calculated with single-step genomic BLUP using phenotypes up to 2009. We calculated the inverse of the genomic relationship matrix GAPY(-1) based on a direct inversion of genomic relationship matrix on a small subset of genotyped animals (core animals) and extended that information to noncore animals by recursion. We tested several sets of core animals including 9,406 bulls with at least 1 classified daughter, 9,406 bulls and 1,052 classified dams of bulls, 9,406 bulls and 7,422 classified cows, and random samples of 5,000 to 30,000 animals. Validation reliability was assessed by the coefficient of determination from regression of daughter deviation on genomic predictions for the predicted young bulls. The reliabilities were 0.39 with 5,000 randomly chosen core animals, 0.45 with the 9,406 bulls, and 7,422 cows as core animals, and 0.44 with the remaining sets. With phenotypes truncated in 2009 and the preconditioned conjugate gradient to solve mixed model equations, the number of rounds to convergence for core animals defined by bulls was 1,343; defined by bulls and cows, 2,066; and defined by 10,000 random animals, at most 1,629. With complete phenotype data, the number of rounds decreased to 858, 1,299, and at most 1,092, respectively. Setting up GAPY(-1

  16. Single-Step Electrophoretic Deposition of Non-noble Metal Catalyst Layer with Low Onset Voltage for Ethanol Electro-oxidation.

    Ahmadi Daryakenari, Ahmad; Hosseini, Davood; Ho, Ya-Lun; Saito, Takumi; Apostoluk, Aleksandra; Müller, Christoph R; Delaunay, Jean-Jacques

    2016-06-29

    A single-step electrophoretic deposition (EPD) process is used to fabricate catalyst layers which consist of nickel oxide nanoparticles attached on the surface of nanographitic flakes. Magnesium ions present in the colloid charge positively the flake's surface as they attach on it and are also used to bind nanographitic flakes together. The fabricated catalyst layers showed a very low onset voltage (-0.2 V vs Ag/AgCl) in the electro-oxidation of ethanol. To clarify the occurring catalytic mechanism, we performed annealing treatment to produce samples having a different electrochemical behavior with a large onset voltage. Temperature dependence measurements of the layer conductivity pointed toward a charge transport mechanism based on hopping for the nonannealed layers, while the drift transport is observed in the annealed layers. The hopping charge transport is responsible for the appearance of the low onset voltage in ethanol electro-oxidation.

  17. A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

    Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

    2018-06-05

    Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

    Matsunaga, Taichi; Yamashita, Jun K

    2014-02-07

    Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Kinematic and kinetic analysis of the knee joint before and after a PCL retaining total knee replacement during gait and single step ascent.

    Apostolopoulos, Alexandros; Lallos, Stergios; Mastrokalos, Dimitrios; Michos, Ioannis; Darras, Nikolaos; Tzomaki, Magda; Efstathopoulos, Nikolaos

    2011-01-01

    The objective of this study was to capture and analyze the kinetics and kinematics and determine the functional performance of the osteoarthritic knee after a posterior cruciate ligament (PCL) retaining total knee arthroplasty. Kinematic and kinetic gait analysis of level walking was performed in 20 subjects (12 female and 8 male) with knee ostoarthritis. These patients were free of any neurological diseases that could affect their normal gait. Mean age was 69.6 ± 6.6 years; mean height was 157.6 cm ± 7.6 cm; and mean weight was 77.2 ± 12.1 kg. Full body gait analyses were performed using the BIOKIN 3D motion analysis system before and 9 months after total knee arthroplasty procedures. Single-step ascending kinetic analyses and plantar pressure distribution analyses were also performed for all subjects. International Knee Society Scores (IKSSs) were also assessed pre- and postoperatively. Significant increases were noted postoperatively in average cadence (preoperative mean = 99.26, postoperative mean = 110.5; p knee adduction moment were also reported postoperatively. All patients showed a significant improvement of knee kinetics and kinematics after a PCL retaining total knee arthroplasty. Significant differences were found in the cadence, step length, stride length, and walk velocity postoperatively. IKSSs also significantly improved. Further research is warranted to determine the clinical relevance of these findings.

  20. Improving genetic evaluation of litter size and piglet mortality for both genotyped and nongenotyped individuals using a single-step method.

    Guo, X; Christensen, O F; Ostersen, T; Wang, Y; Lund, M S; Su, G

    2015-02-01

    A single-step method allows genetic evaluation using information of phenotypes, pedigree, and markers from genotyped and nongenotyped individuals simultaneously. This paper compared genomic predictions obtained from a single-step BLUP (SSBLUP) method, a genomic BLUP (GBLUP) method, a selection index blending (SELIND) method, and a traditional pedigree-based method (BLUP) for total number of piglets born (TNB), litter size at d 5 after birth (LS5), and mortality rate before d 5 (Mort; including stillbirth) in Danish Landrace and Yorkshire pigs. Data sets of 778,095 litters from 309,362 Landrace sows and 472,001 litters from 190,760 Yorkshire sows were used for the analysis. There were 332,795 Landrace and 207,255 Yorkshire animals in the pedigree data, among which 3,445 Landrace pigs (1,366 boars and 2,079 sows) and 3,372 Yorkshire pigs (1,241 boars and 2,131 sows) were genotyped with the Illumina PorcineSNP60 BeadChip. The results showed that the 3 methods with marker information (SSBLUP, GBLUP, and SELIND) produced more accurate predictions for genotyped animals than the pedigree-based method. For genotyped animals, the average of reliabilities for all traits in both breeds using traditional BLUP was 0.091, which increased to 0.171 w+hen using GBLUP and to 0.179 when using SELIND and further increased to 0.209 when using SSBLUP. Furthermore, the average reliability of EBV for nongenotyped animals was increased from 0.091 for traditional BLUP to 0.105 for the SSBLUP. The results indicate that the SSBLUP is a good approach to practical genomic prediction of litter size and piglet mortality in Danish Landrace and Yorkshire populations.

  1. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  2. Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity.

    Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J

    2018-02-20

    The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

  3. Single-fabrication-step Ge nanosphere/SiO2/SiGe heterostructures: a key enabler for realizing Ge MOS devices

    Liao, P. H.; Peng, K. P.; Lin, H. C.; George, T.; Li, P. W.

    2018-05-01

    We report channel and strain engineering of self-organized, gate-stacking heterostructures comprising Ge-nanosphere gate/SiO2/SiGe-channels. An exquisitely-controlled dynamic balance between the concentrations of oxygen, Si, and Ge interstitials was effectively exploited to simultaneously create these heterostructures in a single oxidation step. Process-controlled tunability of the channel length (5–95 nm diameters for the Ge-nanospheres), gate oxide thickness (2.5–4.8 nm), as well as crystal orientation, chemical composition and strain engineering of the SiGe-channel was achieved. Single-crystalline (100) Si1‑x Ge x shells with Ge content as high as x = 0.85 and with a compressive strain of 3%, as well as (110) Si1‑x Ge x shells with Ge content of x = 0.35 and corresponding compressive strain of 1.5% were achieved. For each crystal orientation, our high Ge-content, highly-stressed SiGe shells feature a high degree of crystallinity and thus, provide a core ‘building block’ required for the fabrication of Ge-based MOS devices.

  4. Single-step laser deposition of functionally graded coating by dual ‘wire powder’ or ‘powder powder’ feeding—A comparative study

    Syed, Waheed Ul Haq; Pinkerton, Andrew J.; Liu, Zhu; Li, Lin

    2007-07-01

    The creation of iron-copper (Fe-Cu) alloys has practical application in improving the surface heat conduction and corrosion resistance of, for example, conformal cooling channels in steel moulds, but is difficult to achieve because the elements have got low inter-solubility and are prone to solidification cracking. Previous work by these authors has reported a method to produce a graded iron-nickel-copper coating in a single-step by direct diode laser deposition (DLD) of nickel wire and copper powder as a combined feedstock. This work investigates whether dual powder feeds can be used in that process to afford greater geometric flexibility and compares attributes of the 'nickel wire and copper powder' and 'nickel powder and copper powder' processes for deposition on a H13 tool steel substrate. In wire-powder deposition, a higher temperature developed in the melt pool causing a clad with a smooth gradient structure. The nickel powder in powder-powder deposition did not impart much heat into the melt pool so the melt pool solidified with sharp composition boundaries due to single metal melting in some parts. In wire-powder experiments, a graded structure was obtained by varying the flow rates of wire and powder. However, a graded structure was not realised in powder-powder experiments by varying either the feed or the directions. Reasons for the differences and flow patterns in the melt pools and their effect on final part properties of parts produced are discussed.

  5. Design and Implementation of a High Efficiency, Low Component Voltage Stress, Single-Switch High Step-Up Voltage Converter for Vehicular Green Energy Systems

    Yu-En Wu

    2016-09-01

    Full Text Available In this study, a novel, non-isolated, cascade-type, single-switch, high step-up DC/DC converter was developed for green energy systems. An integrated coupled inductor and voltage lift circuit were applied to simplify the converter structure and satisfy the requirements of high efficiency and high voltage gain ratios. In addition, the proposed structure is controllable with a single switch, which effectively reduces the circuit cost and simplifies the control circuit. With the leakage inductor energy recovery function and active voltage clamp characteristics being present, the circuit yields optimizable conversion efficiency and low component voltage stress. After the operating principles of the proposed structure and characteristics of a steady-state circuit were analyzed, a converter prototype with 450 W, 40 V of input voltage, 400 V of output voltage, and 95% operating efficiency was fabricated. The Renesas MCU RX62T was employed to control the circuits. Experimental results were analyzed to validate the feasibility and effectiveness of the proposed system.

  6. Use of modified Harvard step test for the evaluation of exercise tolerance in patients with a functional single ventricle after total cavopulmonary connection

    A. A. Tupikina

    2016-01-01

    Full Text Available According to the literature, nearly one-third of patients with congenital heart diseases have signs of heart failure. Objective: to assess the possibility and results of using a modified Harvard step test (MHST for the evaluation of exercise tolerance in children with a functional single ventricle. The investigation covered 110 healthy children aged 6 to 16 years and 29 patients aged 3 to 16 years with a functional single ventricle after total cavopulmonary connection with an extracardiac conduit a year after surgery and fenestration closure. MHST using a complete protocol was carried out in 44,8% of the patients. In the other examinees, the reason for stopping the test was premature muscle weakness and dyspnea. This could establish Functional Class (FC II heart failure in 55,2% of the sick children. In the examinees, the MHST index (MHSTI characterizing exercise tolerance ranged from 22,4 to 111. The median MHSTI scores significantly differed between the groups of patients with FC I and II heart failure (p=0,021. Exercise tolerance was lower in 17,2% of the patients with a functional single ventricle; in the others it was average and above average (41,5 and 41,3%, respectively, which was suggestive of good hemodynamic adaptation in patients after surgery. The findings prove the safety and efficiency of using the above test in the evaluation of exercise tolerance in children 3 years of age and older.

  7. Thermally multiplexed polymerase chain reaction.

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  8. Single-step preparation of selected biological fluids for the high performance liquid chromatographic analysis of fat-soluble vitamins and antioxidants.

    Lazzarino, Giacomo; Longo, Salvatore; Amorini, Angela Maria; Di Pietro, Valentina; D'Urso, Serafina; Lazzarino, Giuseppe; Belli, Antonio; Tavazzi, Barbara

    2017-12-08

    Fat-soluble vitamins and antioxidants are of relevance in health and disease. Current methods to extract these compounds from biological fluids mainly need use of multi-steps and multi organic solvents. They are time-consuming and difficult to apply to treat simultaneously large sample number. We here describe a single-step, one solvent extraction of fat-soluble vitamins and antioxidants from biological fluids, and the chromatographic separation of all-trans-retinoic acid, 25-hydroxycholecalciferol, all-trans-retinol, astaxanthin, lutein, zeaxanthin, trans-β-apo-8'-carotenal, γ-tocopherol, β-cryptoxanthin, α-tocopherol, phylloquinone, lycopene, α-carotene, β-carotene and coenzyme Q 10 . Extraction is obtained by adding one volume of biological fluid to two acetonitrile volumes, vortexing for 60s and incubating for 60min at 37°C under agitation. HPLC separation occurs in 30min using Hypersil C18, 100×4.6mm, 5μm particle size column, gradient from 70% methanol+30% H 2 O to 100% acetonitrile, flow rate of 1.0ml/min and 37°C column temperature. Compounds are revealed using highly sensitive UV-VIS diode array detector. The HPLC method suitability was assessed in terms of sensitivity, reproducibility and recovery. Using the present extraction and chromatographic conditions we obtained values of the fat-soluble vitamins and antioxidants in serum from 50 healthy controls similar to those found in literature. Additionally, the profile of these compounds was also measured in seminal plasma from 20 healthy fertile donors. Results indicate that this simple, rapid and low cost sample processing is suitable to extract fat-soluble vitamins and antioxidants from biological fluids and can be applied in clinical and nutritional studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Effect of annealing temperature on a single step processed Cu{sub 2}ZnSnS{sub 4} thin film via solution method

    Prabeesh, P.; Selvam, I. Packia; Potty, S.N.

    2016-05-01

    Cu{sub 2}ZnSnS{sub 4} (CZTS) is a promising material for thin film solar cell applications because of its excellent photovoltaic properties, high abundance and non-toxicity. Thin films of CZTS are generally fabricated by vacuum based techniques or by using toxic solvents and these routes reduce its attention as a low cost and environmental friendly material. In this study, we have prepared CZTS through a solution based single step approach using non-toxic chemicals by spin coating and studied the effect of annealing temperature in the range 350–550 °C in nitrogen atmosphere on structural, optical and electrical properties. XRD results revealed the formation of kesterite phase at all annealing temperatures, while the Raman studies indicated Cu{sub 2}SnS{sub 2} impurity phase in the film annealed at 550 °C. Band gap of the films annealed in nitrogen varies from 1.46 eV to 1.56 eV, depending on the annealing temperature. Optimum properties, such as, good crystallinity, dense structure, ideal band gap (1.49 eV) and good absorption coefficient (10{sup 4} cm{sup −1}), were obtained for the film annealed at 500 °C for 30 min in nitrogen. - Highlights: • Prepared CZTS film through one-step liquid based approach using non-toxic chemicals. • Studied the effect of N{sub 2} annealing on structural, optical and electrical properties. • The phase pure CZTS absorber film exhibited excellent photovoltaic properties • The film annealed at 500 °C for 30 min in nitrogen exhibited optimum properties.

  10. Single-molecule Imaging Analysis of Elementary Reaction Steps of Trichoderma reesei Cellobiohydrolase I (Cel7A) Hydrolyzing Crystalline Cellulose Iα and IIII*

    Shibafuji, Yusuke; Nakamura, Akihiko; Uchihashi, Takayuki; Sugimoto, Naohisa; Fukuda, Shingo; Watanabe, Hiroki; Samejima, Masahiro; Ando, Toshio; Noji, Hiroyuki; Koivula, Anu; Igarashi, Kiyohiko; Iino, Ryota

    2014-01-01

    Trichoderma reesei cellobiohydrolase I (TrCel7A) is a molecular motor that directly hydrolyzes crystalline celluloses into water-soluble cellobioses. It has recently drawn attention as a tool that could be used to convert cellulosic materials into biofuel. However, detailed mechanisms of action, including elementary reaction steps such as binding, processive hydrolysis, and dissociation, have not been thoroughly explored because of the inherent challenges associated with monitoring reactions occurring at the solid/liquid interface. The crystalline cellulose Iα and IIII were previously reported as substrates with different crystalline forms and different susceptibilities to hydrolysis by TrCel7A. In this study, we observed that different susceptibilities of cellulose Iα and IIII are highly dependent on enzyme concentration, and at nanomolar enzyme concentration, TrCel7A shows similar rates of hydrolysis against cellulose Iα and IIII. Using single-molecule fluorescence microscopy and high speed atomic force microscopy, we also determined kinetic constants of the elementary reaction steps for TrCel7A against cellulose Iα and IIII. These measurements were performed at picomolar enzyme concentration in which density of TrCel7A on crystalline cellulose was very low. Under this condition, TrCel7A displayed similar binding and dissociation rate constants for cellulose Iα and IIII and similar fractions of productive binding on cellulose Iα and IIII. Furthermore, once productively bound, TrCel7A processively hydrolyzes and moves along cellulose Iα and IIII with similar translational rates. With structural models of cellulose Iα and IIII, we propose that different susceptibilities at high TrCel7A concentration arise from surface properties of substrate, including ratio of hydrophobic surface and number of available lanes. PMID:24692563

  11. Single-reagent one-step procedures for the purification of ovine IgG, F(ab')2 and Fab antivenoms by caprylic acid.

    Al-Abdulla, Ibrahim; Casewell, Nicholas R; Landon, John

    2014-01-15

    Antivenoms are typically produced in horses or sheep and often purified using salt precipitation of immunoglobulins or F(ab')2 fragments. Caprylic (octanoic) acid fractionation of antiserum has the advantage of not precipitating the desired antibodies, thereby avoiding potential degradation that can lead to the formation of aggregates, which may be the cause of some adverse reactions to antivenoms. Here we report that when optimising the purification of immunoglobulins from ovine antiserum raised against snake venom, caprylic acid was found to have no effect on the activity of the enzymes pepsin and papain, which are employed in antivenom manufacturing to digest immunoglobulins to obtain F(ab')2 and Fab fragments, respectively. A "single-reagent" method was developed for the production of F(ab')2 antivenom whereby whole ovine antiserum was mixed with both caprylic acid and pepsin and incubated for 4h at 37°C. For ovine Fab antivenom production from whole antiserum, the "single reagent" comprised of caprylic acid, papain and l-cysteine; after incubation at 37°C for 18-20h, iodoacetamide was added to stop the reaction. Caprylic acid facilitated the precipitation of albumin, resulting in a reduced protein load presented to the digestion enzymes, culminating in substantial reductions in processing time. The ovine IgG, F(ab')2 and Fab products obtained using these novel caprylic acid methods were comparable in terms of yield, purity and specific activity to those obtained by multi-step conventional salt fractionation with sodium sulphate. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

    Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-01-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

  13. Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

    Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

    2012-08-01

    A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

  14. Single-step selection of drug resistant Acinetobacter baylyi ADP1 mutants reveals a functional redundancy in the recruitment of multidrug efflux systems.

    Anthony J Brzoska

    Full Text Available Members of the genus Acinetobacter have been the focus recent attention due to both their clinical significance and application to molecular biology. The soil commensal bacterium Acinetobacter baylyi ADP1 has been proposed as a model system for molecular and genetic studies, whereas in a clinical environment, Acinetobacter spp. are of increasing importance due to their propensity to cause serious and intractable systemic infections. Clinically, a major factor in the success of Acinetobacter spp. as opportunistic pathogens can be attributed to their ability to rapidly evolve resistance to common antimicrobial compounds. Whole genome sequencing of clinical and environmental Acinetobacter spp. isolates has revealed the presence of numerous multidrug transporters within the core and accessory genomes, suggesting that efflux is an important host defense response in this genus. In this work, we used the drug-susceptible organism A. baylyi ADP1 as a model for studies into the evolution of efflux mediated resistance in genus Acinetobacter, due to the high level of conservation of efflux determinants across four diverse Acinetobacter strains, including clinical isolates. A single exposure of therapeutic concentrations of chloramphenicol to populations of A. baylyi ADP1 cells produced five individual colonies displaying multidrug resistance. The major facilitator superfamily pump craA was upregulated in one mutant strain, whereas the resistance nodulation division pump adeJ was upregulated in the remaining four. Within the adeJ upregulated population, two different levels of adeJ mRNA transcription were observed, suggesting at least three separate mutations were selected after single-step exposure to chloramphenicol. In the craA upregulated strain, a T to G substitution 12 nt upstream of the craA translation initiation codon was observed. Subsequent mRNA stability analyses using this strain revealed that the half-life of mutant craA mRNA was significantly

  15. Optical and electrical characterizations of a single step ion beam milling mesa devices of chloride passivated PbS colloidal quantum dots based film

    Hechster, Elad, E-mail: elad.hechster@gmail.com; Sarusi, Gabby [Electro-Optics Engineering Unit and Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer-Sheva, 84100 Israel (Israel); Shapiro, Arthur; Lifshitz, Efrat [Schulich Faculty of Chemistry, Solid State Institute, Russel Berrie Nanotechnology Institute, Technion – Israel Institute of technology, 32000 Haifa (Israel)

    2016-07-15

    Colloidal Quantum Dots (CQDs) are of increasing interest, thanks to their quantum size effect that gives rise to their usage in various applications, such as biological tagging, solar cells and as the sensitizing layer of night vision devices. Here, we analyze the optical absorbance of chloride passivated PbS CQDs as well as revealing a correlation between their photoluminescence and sizes distribution, using theoretical models and experimental results from the literature. Next, we calculate the CQDs resistivity as a film. Although resistivity can be calculated from sheet resistance measurement using four point probes, such measurement is usually carried-out on the layer’s surface that in most cases has dangling bonds and surface states, which might affect the charges flow and modify the resistivity. Therefore; our approach, which was applied in this work, is to extract the actual resistivity from measurements that are performed along the film’s thickness (z-direction). For this intent, we fabricated gold capped PbS mesas devices using a single step Ion Beam Milling (IBM) process where we milled the gold and the PbS film continually, and then measured the vertical resistance. Knowing the mesas’ dimensions, we calculate the resistivity. To the best of our knowledge, no previous work has extracted, vertically, the resistivity of chloride passivated PbS CQDs using the above method.

  16. Development of a new Xe-133 single dose multi-step method (SDMM) for muscle blood flow measurement using gamma camera

    Bunko, Hisashi; Seto, Mikito; Taki, Junichi

    1985-01-01

    In order to measure the muscle blood flow (MBF) during exercise (Ex), a new Xe-133 single dose multi-step method (SDMM) for leg MBF measurement before, during and after Ex using gamma camera was developped. Theoretically, if the activity of Xe-133 in the muscle immediately before and after Ex are known, then the mean MBF during Ex can be calculated. In SDMM, these activities are corrected through correction formula using time delays between end of data aquisition (DA) at rest (R1) and begining of the Ex (TAB), and between end of Ex and begining of the DA after Ex (R2) (TDA). Validity of the SDMM and MBF response on mild and heavy Ex were evaluated in 11 normal volunteers. Ex MBF calculated from 5 and 2.5 min DA (5 sec/frame) both at R1 and R2 were highly correlated (r=.996). Ex MBF by SDMM and direct(measurement by fixed leg exercise were also highly correlated (r=.999). Reproducibility of the R1 and Ex MBF were excellent (r=.999). The highest MBF was seen in GCM on miled walking Ex and in VLM on heavy squatting Ex. After miled Ex, MBF rapidly returned to normal. After heavy Ex, MBF remaind high in VLM In conclusion, SDMM is simple and accurate method for evaluation of dynamic MBF response according to exercise. SDMM is also applicable to the field of sports medicine. (author)

  17. Single-step transepithelial ASLA (SCHWIND) with mitomycin-C for the correction of high myopia: long term follow-up.

    Aslanides, Ioannis M; Georgoudis, Panagiotis N; Selimis, Vasilis D; Mukherjee, Achyut N

    2015-01-01

    We wanted to compare the outcomes of single-step modified transepithelial photorefractive keratectomy (tPRK) termed a SCHWIND all surface laser ablation (ASLA) versus conventional alcohol-assisted photorefractive keratectomy (PRK) and laser-assisted in situ keratomileusis (LASIK) for the correction of higher myopia of 6.00 diopters (D) or more, in an area with high risk of haze due to high intensity of sunlight. We used a prospective interventional cohort with matched retrospective control groups. Patients with >6 D myopia and 0.05). Mean logMAR (logarithm of the minimum angle of resolution) uncorrected distance visual acuity at 12 months was 0.00 (SD: 0.05), 0.06 (SD: 0.1), and 0.05 (SD: 0.09) in the ASLA, PRK, and LASIK groups, with significantly better vision in the tPRK group versus LASIK (P=0.01) and PRK (P=0.01) groups. ASLA (SCHWIND) tPRK with mitomycin C for high myopia demonstrates comparable refractive outcomes to LASIK and PRK, with relatively favorable visual acuity outcomes. There was no increased incidence of haze in the ASLA group.

  18. Application of single-step genomic best linear unbiased prediction with a multiple-lactation random regression test-day model for Japanese Holsteins.

    Baba, Toshimi; Gotoh, Yusaku; Yamaguchi, Satoshi; Nakagawa, Satoshi; Abe, Hayato; Masuda, Yutaka; Kawahara, Takayoshi

    2017-08-01

    This study aimed to evaluate a validation reliability of single-step genomic best linear unbiased prediction (ssGBLUP) with a multiple-lactation random regression test-day model and investigate an effect of adding genotyped cows on the reliability. Two data sets for test-day records from the first three lactations were used: full data from February 1975 to December 2015 (60 850 534 records from 2 853 810 cows) and reduced data cut off in 2011 (53 091 066 records from 2 502 307 cows). We used marker genotypes of 4480 bulls and 608 cows. Genomic enhanced breeding values (GEBV) of 305-day milk yield in all the lactations were estimated for at least 535 young bulls using two marker data sets: bull genotypes only and both bulls and cows genotypes. The realized reliability (R 2 ) from linear regression analysis was used as an indicator of validation reliability. Using only genotyped bulls, R 2 was ranged from 0.41 to 0.46 and it was always higher than parent averages. The very similar R 2 were observed when genotyped cows were added. An application of ssGBLUP to a multiple-lactation random regression model is feasible and adding a limited number of genotyped cows has no significant effect on reliability of GEBV for genotyped bulls. © 2016 Japanese Society of Animal Science.

  19. Rudimentary simple, single step fabrication of nano-flakes like AgCd alloy electro-catalyst for oxygen reduction reaction in alkaline fuel cell

    Bhandary, Nimai; Basu, Suddhasatwa; Ingole, Pravin P.

    2016-01-01

    In this work, for the first time, we report rudimentary simple, single step fabrication of an electro-catalyst based on AgCd alloy nanoparticles with flakes like geometry which shows highly efficient activity towards oxygen reduction reaction (ORR). A simple potentiostatic deposition method has been employed for co-depositing AgCd alloy nanostructures with flakes like shapes along with dendrites on the surface of carbon fibre paper. The chemico-physical properties of the catalyst are investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS) and energy dispersive X-ray spectroscopy (EDXS). Electro-catalytic activity of AgCd alloy based electro-catalyst towards ORR is studied in alkaline medium by cyclic voltammetry and rotating ring disk electrode (RRDE) technique. Electrochemical in-situ FTIR measurements are also performed to identify the species generated during ORR process. Based on the results from electro-catalysis experiment, it is concluded that nano-alloyed AgCd electrodeposited on carbon paper shows excellent activity for ORR, following four electron pathways with H_2O_2 yield less than 15%. The combination of low cost of Ag and Cd, fast and facile method of its fabrication and higher activity towards ORR makes the AgCd electro-catalyst an attractive catalyst of choice for alkaline fuel cell.

  20. A Multi-Resolution Mode CMOS Image Sensor with a Novel Two-Step Single-Slope ADC for Intelligent Surveillance Systems

    Daehyeok Kim

    2017-06-01

    Full Text Available In this paper, we present a multi-resolution mode CMOS image sensor (CIS for intelligent surveillance system (ISS applications. A low column fixed-pattern noise (CFPN comparator is proposed in 8-bit two-step single-slope analog-to-digital converter (TSSS ADC for the CIS that supports normal, 1/2, 1/4, 1/8, 1/16, 1/32, and 1/64 mode of pixel resolution. We show that the scaled-resolution images enable CIS to reduce total power consumption while images hold steady without events. A prototype sensor of 176 × 144 pixels has been fabricated with a 0.18 μm 1-poly 4-metal CMOS process. The area of 4-shared 4T-active pixel sensor (APS is 4.4 μm × 4.4 μm and the total chip size is 2.35 mm × 2.35 mm. The maximum power consumption is 10 mW (with full resolution with supply voltages of 3.3 V (analog and 1.8 V (digital and 14 frame/s of frame rates.

  1. Single-step affinity and cost-effective purification of recombinant proteins using the Sepharose-binding lectin-tag from the mushroom Laetiporus sulphureus as fusion partner.

    Li, Xiao-Jing; Liu, Jin-Ling; Gao, Dong-Sheng; Wan, Wen-Yan; Yang, Xia; Li, Yong-Tao; Chang, Hong-Tao; Chen, Lu; Wang, Chuan-Qing; Zhao, Jun

    2016-03-01

    Previous research showed that a lectin from the mushroom Laetiporus sulphureus, designed LSL, bound to Sepharose and could be eluted by lactose. In this study, by taking advantage of the strong affinity of LSL-tag for Sepharose, we developed a single-step purification method for LSL-tagged fusion proteins. We utilized unmodified Sepharose-4B as a specific adsorbent and 0.2 M lactose solution as an elution buffer. Fusion proteins of LSL-tag and porcine circovirus capsid protein, designated LSL-Cap was recovered with purity of 90 ± 4%, and yield of 87 ± 3% from crude extract of recombinant Escherichia coli. To enable the remove of LSL-tag, tobacco etch virus (TEV) protease recognition sequence was placed downstream of LSL-tag in the expression vector, and LSL-tagged TEV protease, designated LSL-TEV, was also expressed in E. coli., and was recovered with purity of 82 ± 5%, and yield of 85 ± 2% from crude extract of recombinant E. coli. After digestion of LSL-tagged recombinant proteins with LSL-TEV, the LSL tag and LSL-TEV can be easily removed by passing the digested products through the Sepharose column. It is of worthy noting that the Sepharose can be reused after washing with PBS. The LSL affinity purification method enables rapid and inexpensive purification of LSL-tagged fusion proteins and scale-up production of native proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Polymer Nanocomposite Film with Metal Rich Surface Prepared by In Situ Single-Step Formation of Palladium Nanoparticles: An Interesting Way to Combine Specific Functional Properties

    David Thompson

    2016-10-01

    Full Text Available This paper presents a continuous single-step route that permits preparation of a thermostable polymer/metal nanocomposite film and to combine different functional properties in a unique material. More precisely, palladium nanoparticles are in situ generated in a polyimide matrix thanks to a designed curing cycle which is applied to a polyamic acid/metal precursor solution cast on a glass plate. A metal-rich surface layer which is strongly bonded to the bulk film is formed in addition to homogeneously dispersed metal nanoparticles. This specific morphology leads to obtaining an optically reflective film. The metal nanoparticles act as gas diffusion barriers for helium, oxygen, and carbon dioxide; they induce a tortuosity effect which allows dividing the gas permeation coefficients by a factor near to 2 with respect to the neat polyimide matrix. Moreover, the ability of the in situ synthesized palladium nanoparticles to entrap hydrogen is evidenced. The nanocomposite film properties can be modulated as a function of the location of the film metal-rich surface with respect to the hydrogen feed. The synthesized nanocomposite could represent a major interest for a wide variety of applications, from specific coatings for aerospace or automotive industry, to catalysis applications or sensors.

  3. Optical and electrical characterizations of a single step ion beam milling mesa devices of chloride passivated PbS colloidal quantum dots based film

    Hechster, Elad; Sarusi, Gabby; Shapiro, Arthur; Lifshitz, Efrat

    2016-01-01

    Colloidal Quantum Dots (CQDs) are of increasing interest, thanks to their quantum size effect that gives rise to their usage in various applications, such as biological tagging, solar cells and as the sensitizing layer of night vision devices. Here, we analyze the optical absorbance of chloride passivated PbS CQDs as well as revealing a correlation between their photoluminescence and sizes distribution, using theoretical models and experimental results from the literature. Next, we calculate the CQDs resistivity as a film. Although resistivity can be calculated from sheet resistance measurement using four point probes, such measurement is usually carried-out on the layer’s surface that in most cases has dangling bonds and surface states, which might affect the charges flow and modify the resistivity. Therefore; our approach, which was applied in this work, is to extract the actual resistivity from measurements that are performed along the film’s thickness (z-direction). For this intent, we fabricated gold capped PbS mesas devices using a single step Ion Beam Milling (IBM) process where we milled the gold and the PbS film continually, and then measured the vertical resistance. Knowing the mesas’ dimensions, we calculate the resistivity. To the best of our knowledge, no previous work has extracted, vertically, the resistivity of chloride passivated PbS CQDs using the above method.

  4. Mesoporous-activated carbon prepared from chitosan flakes via single-step sodium hydroxide activation for the adsorption of methylene blue.

    Marrakchi, F; Ahmed, M J; Khanday, W A; Asif, M; Hameed, B H

    2017-05-01

    In this work, mesoporous-activated carbon (CSAC) was prepared from chitosan flakes (CS) via single-step sodium hydroxide activation for the adsorption of methylene blue (MB). CSAC was prepared using different impregnation ratios of NaOH:CS (1:1, 2:1, 3:1, and 4:1) at 800°C for 90min. The adsorption performance of CSAC was evaluated for MB at different adsorption variables, such MB initial concentrations (25-400mg/L), solution pH (3-11), and temperature (30-50°C). The adsorption isotherm data of CSAC-MB were well fitted to Langmuir model with a maximum adsorption capacity 143.53mg/g at 50°C. Best representation of kinetic data was obtained by the pseudo-second order model. CSAC exhibited excellent adsorption uptake for MB and can potentially be used for other cationic dyes. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A single-step synthesis of nitrogen-doped graphene sheets decorated with cobalt hydroxide nanoflakes for the determination of dopamine

    Muhammad Mehmood Shahid

    2017-10-01

    Full Text Available Nitrogen-doped reduced graphene oxide (NrGO sheets decorated with Co(OH2 nanoflakes were prepared by a single-step hydrothermal process. The morphological and structural characterizations of as synthesized NrGO@Co(OH2 nanoflakes were performed by field emission scanning electron microscopy (FESEM, EDX-mapping and X-ray diffraction (XRD. NrGO@Co(OH2 nanoflakes modified glassy carbon electrode (GCE was used for electrochemical sensing of dopamine in neutral medium. The nanocomposite modified electrode showed enhanced electrochemical sensing ability for the detection of dopamine and the limit of detection (LoD was found to be 0.201 μM with a sensitivity value of 0.0286 ± 0.002 mA mM−1. Interference studies revealed that NrGO@Co(OH2─GCE endow excellent selectivity for DA detection even in the presence of higher concentration of common co-existing physiological interfering analytes. Additionally, proposed sensor demonstrated excellent performance in urine samples with promising reproducibility and stability. Keywords: Nitrogen doped graphene, Dopamine, Electrochemical sensor, Amperometric detection

  6. A Multi-Resolution Mode CMOS Image Sensor with a Novel Two-Step Single-Slope ADC for Intelligent Surveillance Systems.

    Kim, Daehyeok; Song, Minkyu; Choe, Byeongseong; Kim, Soo Youn

    2017-06-25

    In this paper, we present a multi-resolution mode CMOS image sensor (CIS) for intelligent surveillance system (ISS) applications. A low column fixed-pattern noise (CFPN) comparator is proposed in 8-bit two-step single-slope analog-to-digital converter (TSSS ADC) for the CIS that supports normal, 1/2, 1/4, 1/8, 1/16, 1/32, and 1/64 mode of pixel resolution. We show that the scaled-resolution images enable CIS to reduce total power consumption while images hold steady without events. A prototype sensor of 176 × 144 pixels has been fabricated with a 0.18 μm 1-poly 4-metal CMOS process. The area of 4-shared 4T-active pixel sensor (APS) is 4.4 μm × 4.4 μm and the total chip size is 2.35 mm × 2.35 mm. The maximum power consumption is 10 mW (with full resolution) with supply voltages of 3.3 V (analog) and 1.8 V (digital) and 14 frame/s of frame rates.

  7. Single Step Formation of C-TiO2 Nanotubes: Influence of Applied Voltage and Their Photocatalytic Activity under Solar Illumination

    Chin Wei Lai

    2013-01-01

    Full Text Available Self-aligned and high-uniformity carbon (C- titania (TiO2 nanotube arrays were successfully formed via single step anodization of titanium (Ti foil at 30 V for 1 h in a bath composed of ethylene glycol (EG, ammonium fluoride (NH4F, and hydrogen peroxide (H2O2. It was well established that applied voltage played an important role in controlling field-assisted oxidation and field-assisted dissolution during electrochemical anodization process. Therefore, the influences of applied voltage on the formation of C-TiO2 nanotube arrays were discussed. It was found that a minimal applied voltage of 30 V was required to form the self-aligned and high-uniformity C-TiO2 nanotube arrays with diameter of ~75 nm and length of ~2 μm. The samples synthesized using different applied voltages were then subjected to heat treatment for the conversion of amorphous phase to crystalline phase. The photocatalytic activity evaluation of C-TiO2 samples was made under degradation of organic dye (methyl orange (MO solution. The results revealed that controlled nanoarchitecture C-TiO2 photocatalyst led to a significant enhancement in photocatalytic activity due to the creation of more specific active surface areas for incident photons absorption from the solar illumination.

  8. Genome-wide association mapping including phenotypes from relatives without genotypes in a single-step (ssGWAS for 6-week body weight in broiler chickens

    Huiyu eWang

    2014-05-01

    Full Text Available The purpose of this study was to compare results obtained from various methodologies for genome-wide association studies, when applied to real data, in terms of number and commonality of regions identified and their genetic variance explained, computational speed, and possible pitfalls in interpretations of results. Methodologies include: two iteratively reweighted single-step genomic BLUP procedures (ssGWAS1 and ssGWAS2, a single-marker model (CGWAS, and BayesB. The ssGWAS methods utilize genomic breeding values (GEBVs based on combined pedigree, genomic and phenotypic information, while CGWAS and BayesB only utilize phenotypes from genotyped animals or pseudo-phenotypes. In this study, ssGWAS was performed by converting GEBVs to SNP marker effects. Unequal variances for markers were incorporated for calculating weights into a new genomic relationship matrix. SNP weights were refined iteratively. The data was body weight at 6 weeks on 274,776 broiler chickens, of which 4553 were genotyped using a 60k SNP chip. Comparison of genomic regions was based on genetic variances explained by local SNP regions (20 SNPs. After 3 iterations, the noise was greatly reduced of ssGWAS1 and results are similar to that of CGWAS, with 4 out of the top 10 regions in common. In contrast, for BayesB, the plot was dominated by a single region explaining 23.1% of the genetic variance. This same region was found by ssGWAS1 with the same rank, but the amount of genetic variation attributed to the region was only 3%. These finding emphasize the need for caution when comparing and interpreting results from various methods, and highlight that detected associations, and strength of association, strongly depends on methodologies and details of implementations. BayesB appears to overly shrink regions to zero, while overestimating the amount of genetic variation attributed to the remaining SNP effects. The real world is most likely a compromise between methods and remains to

  9. Two-Step Single Particle Mass Spectrometry for On-Line Monitoring of Polycyclic Aromatic Hydrocarbons Bound to Ambient Fine Particulate Matter

    Zimmermann, R.; Bente, M.; Sklorz, M.

    2007-12-01

    Polycyclic aromatic hydrocarbons (PAH) are formed as trace products in combustion processes and are emitted to the atmosphere. Larger PAH have low vapour pressure and are predominantly bound to the ambient fine particulate matter (PM). Upon inhalation, PAH show both, chronic human toxicity (i.e. many PAH are potent carcinogens) as well as acute human toxicity (i.e. inflammatory effects due to oxi-dative stress) and are discussed to be relevant for the observed health effect of ambient PM. Therefore a better understanding of the occurrence, dynamics and particle size dependence of particle bound-PAH is of great interest. On-line aerosol mass spectrometry in principle is the method of choice to investigate the size resolved changes in the chemical speciation of particles as well the status of internal vs. external mixing of chemical constituents. However the present available aerosol mass spectrometers (ATOFMS and AMS) do not allow detection of PAH from ambient air PM. In order to allow a single particle based monitoring of PAH from ambient PM a new single particle laser ionisation mass spectrometer was built and applied. The system is based on ATOFMS principle but uses a two- step photo-ionization. A tracked and sized particle firstly is laser desorbed (LD) by a IR-laser pulse (CO2-laser, λ=10.2 μm) and subsequently the released PAH are selectively ionized by an intense UV-laser pulse (ArF excimer, λ=248 nm) in a resonance enhanced multiphoton ionisation process (REMPI). The PAH-ions are detected in a time of flight mass spectrometer (TOFMS). A virtual impactor enrichment unit is used to increase the detection frequency of the ambient particles. With the current inlet system particles from about 400 nm to 10 μm are accessible. Single particle based temporal profiles of PAH containing particles ion (size distribution and PAH speciation) have been recorded in Oberschleissheim, Germany from ambient air. Furthermore profiles of relevant emission sources (e

  10. Using single-step genomic best linear unbiased predictor to enhance the mitigation of seasonal losses due to heat stress in pigs.

    Fragomeni, B O; Lourenco, D A L; Tsuruta, S; Bradford, H L; Gray, K A; Huang, Y; Misztal, I

    2016-12-01

    The purposes of this study were to analyze the impact of seasonal losses due to heat stress in pigs from different breeds raised in different environments and to evaluate the accuracy improvement from adding genomic information to genetic evaluations. Data were available for 2 different swine populations: purebred Duroc animals raised in Texas and North Carolina and commercial crosses of Duroc and F females (Landrace × Large White) raised in Missouri and North Carolina; pedigrees provided links for animals from different states. Pedigree information was available for 553,442 animals, of which 8,232 pure breeds were genotyped. Traits were BW at 170 d for purebred animals and HCW for crossbred animals. Analyses were done with an animal model as either single- or 2-trait models using phenotypes measured in different states as separate traits. Additionally, reaction norm models were fitted for 1 or 2 traits using heat load index as a covariable. Heat load was calculated as temperature-humidity index greater than 70 and was averaged over 30 d prior to data collection. Variance components were estimated with average information REML, and EBV and genomic EBV (GEBV) with BLUP or single-step genomic BLUP (ssGBLUP). Validation was assessed for 146 genotyped sires with progeny in the last generation. Accuracy was calculated as a correlation between EBV and GEBV using reduced data (all animals, except the last generation) and using complete data. Heritability estimates for purebred animals were similar across states (varying from 0.23 to 0.26), and reaction norm models did not show evidence of a heat stress effect. Genetic correlations between states for heat loads were always strong (>0.91). For crossbred animals, no differences in heritability were found in single- or 2-trait analysis (from 0.17 to 0.18), and genetic correlations between states were moderate (0.43). In the reaction norm for crossbreeds, heritabilities ranged from 0.15 to 0.30 and genetic correlations

  11. Determination of oil reservoir radiotracer (S{sup 14}CN{sup -}) in a single step using a plastic scintillator extractive resin

    Bagan, H.; Tarancon, A. [Departament de Quimica Analitica, Universitat de Barcelona, Diagonal 645, E-08028 Barcelona (Spain); Stavsetra, L. [Department for Reservoir and Exploration Technology, Institute for Energy Technology (IFE), Instituttveien 18, N-2027 Kjeller (Norway); Rauret, G. [Departament de Quimica Analitica, Universitat de Barcelona, Diagonal 645, E-08028 Barcelona (Spain); Garcia, J.F., E-mail: jfgarcia@ub.edu [Departament de Quimica Analitica, Universitat de Barcelona, Diagonal 645, E-08028 Barcelona (Spain)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer A new procedure for S{sup 14}CN{sup -} radiotracer determination using PS resin was established. Black-Right-Pointing-Pointer The minimum detectable activity for a 100 mL sample is 0.08 Bq L{sup -1}. Black-Right-Pointing-Pointer The minimum quantifiable activity for a 100 mL sample is 0.31 Bq L{sup -1}. Black-Right-Pointing-Pointer PS resin is capable to quantify S{sup 14}CN{sup -} radiotracer samples with errors lower than 5%. Black-Right-Pointing-Pointer PS resin is also capable to quantify complex matrices obtained from oil reservoirs. - Abstract: The analysis of radiotracers is important in the study of oil reservoir dynamics. One of the most widely used radiotracer is S{sup 14}CN{sup -}. Prior to activity measurements by Liquid Scintillation (LS), routine determinations require the pretreatment steps of purification and concentration of the samples using anion exchange columns. The final elution media produces samples with high salt concentration that may lead to problems with phase separation during the LS measurement. Plastic Scintillation (PS) is an alternative technique that provides a solid surface that can be used as a platform for the immobilisation of selective extractants to obtain a PS resin. The proposed procedure unifies chemical separation and sample measurement preparation in a single step, serving to reduce the number of reagents needed and manpower required for the analysis while also avoiding mixed waste production by LS. The objective of this study is to develop a PS resin for the determination of {sup 14}C-labelled thiocyanate radiotracer in water samples. For this purpose, the immobilisation procedure was optimised, including optimisation of the proportion of PS microspheres:extractant and the use of a control blank to monitor the PS resin immobilisation process. The breakthrough volume was studied and the detection and quantification limits for 100 mL of sample were determined to be 0.08 Bq L{sup -1

  12. Combination of granular activated carbon adsorption and deep-bed filtration as a single advanced wastewater treatment step for organic micropollutant and phosphorus removal.

    Altmann, Johannes; Rehfeld, Daniel; Träder, Kai; Sperlich, Alexander; Jekel, Martin

    2016-04-01

    Adsorption onto granular activated carbon (GAC) is an established technology in water and advanced wastewater treatment for the removal of organic substances from the liquid phase. Besides adsorption, the removal of particulate matter by filtration and biodegradation of organic substances in GAC contactors has frequently been reported. The application of GAC as both adsorbent for organic micropollutant (OMP) removal and filter medium for solids retention in tertiary wastewater filtration represents an energy- and space saving option, but has rarely been considered because high dissolved organic carbon (DOC) and suspended solids concentrations in the influent of the GAC adsorber put a significant burden on this integrated treatment step and might result in frequent backwashing and unsatisfactory filtration efficiency. This pilot-scale study investigates the combination of GAC adsorption and deep-bed filtration with coagulation as a single advanced treatment step for simultaneous removal of OMPs and phosphorus from secondary effluent. GAC was assessed as upper filter layer in dual-media downflow filtration and as mono-media upflow filter with regard to filtration performance and OMP removal. Both filtration concepts effectively removed suspended solids and phosphorus, achieving effluent concentrations of 0.1 mg/L TP and 1 mg/L TSS, respectively. Analysis of grain size distribution and head loss within the filter bed showed that considerable head loss occurred in the topmost filter layer in downflow filtration, indicating that most particles do not penetrate deeply into the filter bed. Upflow filtration exhibited substantially lower head loss and effective utilization of the whole filter bed. Well-adsorbing OMPs (e.g. benzotriazole, carbamazepine) were removed by >80% up to throughputs of 8000-10,000 bed volumes (BV), whereas weakly to medium adsorbing OMPs (e.g. primidone, sulfamethoxazole) showed removals activated carbon (PAC) to deep-bed filtration as a direct

  13. Single-step solvothermal synthesis of mesoporous Ag-TiO2-reduced graphene oxide ternary composites with enhanced photocatalytic activity

    Arif Sher Shah, Md. Selim; Zhang, Kan; Park, A. Reum; Kim, Kwang Su; Park, Nam-Gyu; Park, Jong Hyeok; Yoo, Pil J.

    2013-05-01

    With growing interest in the photocatalytic performance of TiO2-graphene composite systems, the ternary phase of TiO2, graphene, and Ag is expected to exhibit improved photocatalytic characteristics because of the improved recombination rate of photogenerated charge carriers and potential contribution of the generation of localized surface plasmon resonance at Ag sites on a surface of the TiO2-graphene binary matrix. In this work, Ag-TiO2-reduced graphene oxide ternary nanocomposites were successfully synthesized by a simple solvothermal process. In a single-step synthetic procedure, the reduction of AgNO3 and graphene oxide and the hydrolysis of titanium tetraisopropoxide were spontaneously performed in a mixed solvent system of ethylene glycol, N,N-dimethylformamide and a stoichiometric amount of water without resorting to the use of typical reducing agents. The nanocomposites were characterized by X-ray diffraction, X-ray photoelectron spectroscopy, along with different microscopic and spectroscopic techniques, enabling us to confirm the successful reduction of AgNO3 and graphite oxide to metallic Ag and reduced graphene oxide, respectively. Due to the highly facilitated electron transport of well distributed Ag nanoparticles, the synthesized ternary nanocomposite showed enhanced photocatalytic activity for degradation of rhodamine B dye under visible light irradiation.With growing interest in the photocatalytic performance of TiO2-graphene composite systems, the ternary phase of TiO2, graphene, and Ag is expected to exhibit improved photocatalytic characteristics because of the improved recombination rate of photogenerated charge carriers and potential contribution of the generation of localized surface plasmon resonance at Ag sites on a surface of the TiO2-graphene binary matrix. In this work, Ag-TiO2-reduced graphene oxide ternary nanocomposites were successfully synthesized by a simple solvothermal process. In a single-step synthetic procedure, the reduction

  14. One-step synthesis of single phase micro-sized BaFe12O19 hexaplates via a modified hydrothermal approach

    Cao, Liangliang; Zeng, Yanwei; Ding, Chuan; Li, Rongjie; Li, Chuanming; Zhang, Chengzhe

    2016-01-01

    Single phase BaFe 12 O 19 ferrite identified by X-ray diffraction and Raman spectroscopy has been successfully synthesized using Fe(NO 3 ) 3 ·9H 2 O and Ba(NO 3 ) 2 as starting materials and NaOH as a precipitant via a modified one-step hydrothermal approach which involves the elimination of carbonate radicals from reaction system based on the stoichiometric ratio of [Ba 2+ ]/[Fe 3+ ]. Hydrothermal products under various synthetic conditions were studied, including different addition amounts of Ba(NO 3 ) 2 in the modified operation, reaction temperatures and times, and hydroxyl concentrations. The BaFe 12 O 19 particles featuring an excellent hexagonal plates shape can be hydrothermally synthesized with the aid of polyethylene glycol. It has been found that the presence of α-Fe 2 O 3 in a traditional hydrothermal process is motivated by the deviation from the desired [Ba 2+ ]/[Fe 3+ ] ratio caused by the negligent precipitation of Ba 2+ ions to BaCO 3 . An investigation on the preferred hydrothermal product through thermodynamic calculation shows that the reduction in Gibbs free energy for the exclusive formation of BaFe 12 O 19 with 1 mol of Fe 3+ ions at 220 °C is approximately 32 kJ higher than that for the complete transformation to α-Fe 2 O 3 with an equal consumption quantity of Fe 3+ ions. - Highlights: • Pure BaFe 12 O 19 was hydrothermally synthesized based on the stoichiometric ratio. • A modified operation was employed to eliminate self-invited carbonate ions. • BaFe 12 O 19 particles feature an excellent micro-sized hexaplates shape. • BaFe 12 O 19 was thermodynamically confirmed to be preferred result instead of α-Fe 2 O 3 .

  15. Single-step biosynthesis and characterization of silver nanoparticles using Zornia diphylla leaves: A potent eco-friendly tool against malaria and arbovirus vectors.

    Govindarajan, Marimuthu; Rajeswary, Mohan; Muthukumaran, Udaiyan; Hoti, S L; Khater, Hanem F; Benelli, Giovanni

    2016-08-01

    Mosquitoes (Diptera: Culicidae) are vectors of important pathogens and parasites, including malaria, dengue, chikungunya, Japanese encephalitis, lymphatic filariasis and Zika virus. The application of synthetic insecticides causes development of resistance, biological magnification of toxic substances through the food chain, and adverse effects on the environment and human health. In this scenario, eco-friendly control tools of mosquito vectors are a priority. Here single-step fabrication of silver nanoparticles (AgNP) using a cheap aqueous leaf extract of Zornia diphylla as reducing and capping agent pf Ag(+) ions has been carried out. Biosynthesized AgNP were characterized by UV-visible spectrophotometry, Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy-dispersive spectroscopy (EDX) and X-ray diffraction analysis (XRD). The acute toxicity of Z. diphylla leaf extract and biosynthesized AgNP was evaluated against larvae of the malaria vector Anopheles subpictus, the dengue vector Aedes albopictus and the Japanese encephalitis vector Culex tritaeniorhynchus. Both the Z. diphylla leaf extract and Ag NP showed dose dependent larvicidal effect against all tested mosquito species. Compared to the leaf aqueous extract, biosynthesized Ag NP showed higher toxicity against An. subpictus, Ae. albopictus, and Cx. tritaeniorhynchus with LC50 values of 12.53, 13.42 and 14.61μg/ml, respectively. Biosynthesized Ag NP were found safer to non-target organisms Chironomus circumdatus, Anisops bouvieri and Gambusia affinis, with the respective LC50 values ranging from 613.11 to 6903.93μg/ml, if compared to target mosquitoes. Overall, our results highlight that Z. diphylla-fabricated Ag NP are a promising and eco-friendly tool against larval populations of mosquito vectors of medical and veterinary importance, with negligible toxicity against other non-target organisms. Copyright © 2016 Elsevier B

  16. Solid-state flurbiprofen and methyl-β-cyclodextrin inclusion complexes prepared using a single-step, organic solvent-free supercritical fluid process.

    Rudrangi, Shashi Ravi Suman; Kaialy, Waseem; Ghori, Muhammad U; Trivedi, Vivek; Snowden, Martin J; Alexander, Bruce David

    2016-07-01

    The aim of this study was to enhance the apparent solubility and dissolution properties of flurbiprofen through inclusion complexation with cyclodextrins. Especially, the efficacy of supercritical fluid technology as a preparative technique for the preparation of flurbiprofen-methyl-β-cyclodextrin inclusion complexes was evaluated. The complexes were prepared by supercritical carbon dioxide processing and were evaluated by solubility, differential scanning calorimetry, X-ray powder diffraction, scanning electron microscopy, practical yield, drug content estimation and in vitro dissolution studies. Computational molecular docking studies were conducted to study the possibility of molecular arrangement of inclusion complexes between flurbiprofen and methyl-β-cyclodextrin. The studies support the formation of stable molecular inclusion complexes between the drug and cyclodextrin in a 1:1 stoichiometry. In vitro dissolution studies showed that the dissolution properties of flurbiprofen were significantly enhanced by the binary mixtures prepared by supercritical carbon dioxide processing. The amount of flurbiprofen dissolved into solution alone was very low with 1.11±0.09% dissolving at the end of 60min, while the binary mixtures processed by supercritical carbon dioxide at 45°C and 200bar released 99.39±2.34% of the drug at the end of 30min. All the binary mixtures processed by supercritical carbon dioxide at 45°C exhibited a drug release of more than 80% within the first 10min irrespective of the pressure employed. The study demonstrated the single step, organic solvent-free supercritical carbon dioxide process as a promising approach for the preparation of inclusion complexes between flurbiprofen and methyl-β-cyclodextrin in solid-state. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Clinical utility of simultaneous whole-body 18F-FDG PET/MRI as a single-step imaging modality in the staging of primary nasopharyngeal carcinoma.

    Chan, Sheng-Chieh; Yeh, Chih-Hua; Yen, Tzu-Chen; Ng, Shu-Hang; Chang, Joseph Tung-Chieh; Lin, Chien-Yu; Yen-Ming, Tsang; Fan, Kang-Hsing; Huang, Bing-Shen; Hsu, Cheng-Lung; Chang, Kai-Ping; Wang, Hung-Ming; Liao, Chun-Ta

    2018-03-03

    Both head and neck magnetic resonance imaging (MRI) and 18F-fluorodeoxyglucose (18F-FDG) positron emission tomography (PET)/computed tomography (CT) play a crucial role in the staging of primary nasopharyngeal carcinoma (NPC). In this study, we sought to prospectively investigate the clinical utility of simultaneous whole-body 18F-FDG PET/MRI for primary staging of NPC patients. We examined 113 patients with histologically confirmed NPC who underwent pretreatment, simultaneous whole-body PET/MRI and PET/CT for primary tumor staging. The images obtained with the different imaging modalities were interpreted independently and compared with each other. PET/MRI increased the accuracy of head and neck MRI for assessment of primary tumor extent in four patients via addition of FDG uptake information to increase the conspicuity of morphologically subtle lesions. PET/MR images were more discernible than PET/CT images for mapping tumor extension, especially intracranial invasion. Regarding the N staging assessment, the sensitivity of PET/MRI (99.5%) was higher than that of head and neck MRI (94.2%) and PET/CT (90.9%). PET/MRI was particularly useful for distinguishing retropharyngeal nodal metastasis from adjacent nasopharyngeal tumors. For distant metastasis evaluation, PET/MRI exhibited a similar sensitivity (90% vs. 86.7% vs. 83.3%), but higher positive predictive value (93.1% vs. 78.8% vs. 83.3%) than whole-body MRI and PET/CT, respectively. For tumor staging of NPC, simultaneous whole-body PET/MRI was more accurate than head and neck MRI and PET/CT, and may serve as a single-step staging modality.

  18. Single turnover studies of oxidative halophenol dehalogenation by horseradish peroxidase reveal a mechanism involving two consecutive one electron steps: toward a functional halophenol bioremediation catalyst.

    Sumithran, Suganya; Sono, Masanori; Raner, Gregory M; Dawson, John H

    2012-12-01

    Horseradish peroxidase (HRP) catalyzes the oxidative para-dechlorination of the environmental pollutant/carcinogen 2,4,6-trichlorophenol (2,4,6-TCP). A possible mechanism for this reaction is a direct oxygen atom transfer from HRP compound I (HRP I) to trichlorophenol to generate 2,6-dichloro 1,4-benzoquinone, a two-electron transfer process. An alternative mechanism involves two consecutive one-electron transfer steps in which HRP I is reduced to compound II (HRP II) and then to the ferric enzyme as first proposed by Wiese et al. [F.W. Wiese, H.C. Chang, R.V. Lloyd, J.P. Freeman, V.M. Samokyszyn, Arch. Environ. Contam. Toxicol. 34 (1998) 217-222]. To probe the mechanism of oxidative halophenol dehalogenation, the reactions between 2,4,6-TCP and HRP compounds I or II have been investigated under single turnover conditions (i.e., without excess H(2)O(2)) using rapid scan stopped-flow spectroscopy. Addition of 2,4,6-TCP to HRP I leads rapidly to HRP II and then more slowly to the ferric resting state, consistent with a mechanism involving two consecutive one-electron oxidations of the substrate via a phenoxy radical intermediate. HRP II can also directly dechlorinate 2,4,6-TCP as judged by rapid scan stopped-flow and mass spectrometry. This observation is particularly significant since HRP II can only carry out one-electron oxidations. A more detailed understanding of the mechanism of oxidative halophenol dehalogenation will facilitate the use of HRP as a halophenol bioremediation catalyst. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Single-Step Incubation Determination of miRNAs in Cancer Cells Using an Amperometric Biosensor Based on Competitive Hybridization onto Magnetic Beads

    Eva Vargas

    2018-03-01

    Full Text Available This work reports an amperometric biosensor for the determination of miRNA-21, a relevant oncogene. The methodology involves a competitive DNA-target miRNA hybridization assay performed on the surface of magnetic microbeads (MBs and amperometric transduction at screen-printed carbon electrodes (SPCEs. The target miRNA competes with a synthetic fluorescein isothiocyanate (FITC-modified miRNA with an identical sequence for hybridization with a biotinylated and complementary DNA probe (b-Cp immobilized on the surface of streptavidin-modified MBs (b-Cp-MBs. Upon labeling, the FITC-modified miRNA attached to the MBs with horseradish peroxidase (HRP-conjugated anti-FITC Fab fragments and magnetic capturing of the MBs onto the working electrode surface of SPCEs. The cathodic current measured at −0.20 V (versus the Ag pseudo-reference electrode was demonstrated to be inversely proportional to the concentration of the target miRNA. This convenient biosensing method provided a linear range between 0.7 and 10.0 nM and a limit of detection (LOD of 0.2 nM (5 fmol in 25 μL of sample for the synthetic target miRNA without any amplification step. An acceptable selectivity towards single-base mismatched oligonucleotides, a high storage stability of the b-Cp-MBs, and usefulness for the accurate determination of miRNA-21 in raw total RNA (RNAt extracted from breast cancer cells (MCF-7 were demonstrated.

  20. Single-Step Fabrication Using a Phase Inversion Method of Poly(vinylidene fluoride) (PVDF) Activated Carbon Air Cathodes for Microbial Fuel Cells

    Yang, Wulin

    2014-10-14

    Air cathodes used in microbial fuel cells (MFCs) need to have high catalytic activity for oxygen reduction, but they must also be easy to manufacture, inexpensive, and watertight. A simple one-step, phase inversion process was used here to construct an inexpensive MFC cathode using a poly(vinylidene fluoride) (PVDF) binder and an activated carbon catalyst. The phase inversion process enabled cathode preparation at room temperatures, without the need for additional heat treatment, and it produced for the first time a cathode that did not require a separate diffusion layer to prevent water leakage. MFCs using this new type of cathode produced a maximum power density of 1470 ± 50 mW m–2 with acetate as a substrate, and 230 ± 10 mW m–2 with domestic wastewater. These power densities were similar to those obtained using cathodes made using more expensive materials or more complex procedures, such as cathodes with a polytetrafluoroethylene (PTFE) binder and a poly(dimethylsiloxane) (PDMS) diffusion layer, or a Pt catalyst. Even though the PVDF cathodes did not have a diffusion layer, they withstood up to 1.22 ± 0.04 m of water head (∼12 kPa) without leakage, compared to 0.18 ± 0.02 m for cathodes made using PTFE binder and PDMS diffusion layer. The cost of PVDF and activated carbon ($3 m–2) was less than that of the stainless steel mesh current collector ($12 m–2). PVDF-based AC cathodes therefore are inexpensive, have excellent performance in terms of power and water leakage, and they can be easily manufactured using a single phase inversion process at room temperature.

  1. Single-step synthesis of In{sub 2}O{sub 3} nanowires decorated with TeO{sub 2} nanobeads and their acetone-sensing properties

    Park, Sunghoon; Kheel, Hyejoon; Sun, Gun-Joo; Lee, Chongmu [Inha University, Department of Materials Science and Engineering, Incheon (Korea, Republic of); Park, Sang Eon [Inha University, Department of Chemistry, Incheon (Korea, Republic of)

    2016-04-15

    In{sub 2}O{sub 3} nanowires decorated with TeO{sub 2} nanobeads were synthesized by a facile single-step thermal evaporation process, and their acetone-gas-sensing properties were examined. The diameters and lengths of the In{sub 2}O{sub 3} nanowires ranged from 10 to 20 nm and up to 100 μm, respectively, whereas the diameters of the TeO{sub 2} beads ranged from 50 to 200 nm. The TeO{sub 2}-decorated In{sub 2}O{sub 3} nanowire sensor showed stronger response to acetone gas than the pristine In{sub 2}O{sub 3} nanowire sensor. The pristine and TeO{sub 2}-decorated In{sub 2}O{sub 3} nanowires exhibited sensitivity of ∝10.13 and ∝24.87, respectively, to 200 ppm acetone at 300 C. The decorated nanowire sensor also showed much more rapid response and recovery than the latter. Both sensors showed the strongest response to acetone gas at 300 C, respectively. The mechanism and origin of the enhanced acetone-gas-sensing performance of the TeO{sub 2}-decorated In{sub 2}O{sub 3} nanowire sensor compared to the pristine In{sub 2}O{sub 3} nanowire sensor were discussed in detail. The enhanced sensing performance of the TeO{sub 2}-decorated In{sub 2}O{sub 3} nanowire is mainly due to the modulation of the potential barrier height at the TeO{sub 2}-In{sub 2}O{sub 3} interface, high catalytic activity of TeO{sub 2,} and creation of active adsorption sites by incorporation of TeO{sub 2}. (orig.)

  2. Performance of single-pass and by-pass multi-step multi-soil-layering systems for low-(C/N)-ratio polluted river water treatment.

    Wei, Cai-Jie; Wu, Wei-Zhong

    2018-09-01

    Two kinds of hybrid two-step multi-soil-layering (MSL) systems loaded with different filter medias (zeolite-ceramsite MSL-1 and ceramsite-red clay MSL-2) were set-up for the low-(C/N)-ratio polluted river water treatment. A long-term pollutant removal performance of these two kinds of MSL systems was evaluated for 214 days. By-pass was employed in MSL systems to evaluate its effect on nitrogen removal enhancement. Zeolite-ceramsite single-pass MSL-1 system owns outstanding ammonia removal capability (24 g NH 4 + -Nm -2 d -1 ), 3 times higher than MSL-2 without zeolite under low aeration rate condition (0.8 × 10 4  L m -2 .h -1 ). Aeration rate up to 1.6 × 10 4  L m -2 .h -1 well satisfied the requirement of complete nitrification in first unit of both two MSLs. However, weak denitrification in second unit was commonly observed. By-pass of 50% influent into second unit can improve about 20% TN removal rate for both MSL-1 and MSL-2. Complete nitrification and denitrification was achieved in by-pass MSL systems after addition of carbon source with the resulting C/N ratio up to 2.5. The characters of biofilms distributed in different sections inside MSL-1 system well illustrated the nitrogen removal mechanism inside MSL systems. Two kinds of MSLs are both promising as an appealing nitrifying biofilm reactor. Recirculation can be considered further for by-pass MSL-2 system to ensure a complete ammonia removal. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Use of genomic recursions and algorithm for proven and young animals for single-step genomic BLUP analyses--a simulation study.

    Fragomeni, B O; Lourenco, D A L; Tsuruta, S; Masuda, Y; Aguilar, I; Misztal, I

    2015-10-01

    The purpose of this study was to examine accuracy of genomic selection via single-step genomic BLUP (ssGBLUP) when the direct inverse of the genomic relationship matrix (G) is replaced by an approximation of G(-1) based on recursions for young genotyped animals conditioned on a subset of proven animals, termed algorithm for proven and young animals (APY). With the efficient implementation, this algorithm has a cubic cost with proven animals and linear with young animals. Ten duplicate data sets mimicking a dairy cattle population were simulated. In a first scenario, genomic information for 20k genotyped bulls, divided in 7k proven and 13k young bulls, was generated for each replicate. In a second scenario, 5k genotyped cows with phenotypes were included in the analysis as young animals. Accuracies (average for the 10 replicates) in regular EBV were 0.72 and 0.34 for proven and young animals, respectively. When genomic information was included, they increased to 0.75 and 0.50. No differences between genomic EBV (GEBV) obtained with the regular G(-1) and the approximated G(-1) via the recursive method were observed. In the second scenario, accuracies in GEBV (0.76, 0.51 and 0.59 for proven bulls, young males and young females, respectively) were also higher than those in EBV (0.72, 0.35 and 0.49). Again, no differences between GEBV with regular G(-1) and with recursions were observed. With the recursive algorithm, the number of iterations to achieve convergence was reduced from 227 to 206 in the first scenario and from 232 to 209 in the second scenario. Cows can be treated as young animals in APY without reducing the accuracy. The proposed algorithm can be implemented to reduce computing costs and to overcome current limitations on the number of genotyped animals in the ssGBLUP method. © 2015 Blackwell Verlag GmbH.

  4. Solving the RNA polymerase I structural puzzle

    Moreno-Morcillo, María [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Taylor, Nicholas M. I. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Gruene, Tim [Georg-August-University, Tammannstrasse 4, 37077 Göttingen (Germany); Legrand, Pierre [SOLEIL Synchrotron, L’Orme de Merisiers, Saint Aubin, Gif-sur-Yvette (France); Rashid, Umar J. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Ruiz, Federico M. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Steuerwald, Ulrich; Müller, Christoph W. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Fernández-Tornero, Carlos, E-mail: cftornero@cib.csic.es [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany)

    2014-10-01

    Details of the RNA polymerase I crystal structure determination provide a framework for solution of the structures of other multi-subunit complexes. Simple crystallographic experiments are described to extract relevant biological information such as the location of the enzyme active site. Knowing the structure of multi-subunit complexes is critical to understand basic cellular functions. However, when crystals of these complexes can be obtained they rarely diffract beyond 3 Å resolution, which complicates X-ray structure determination and refinement. The crystal structure of RNA polymerase I, an essential cellular machine that synthesizes the precursor of ribosomal RNA in the nucleolus of eukaryotic cells, has recently been solved. Here, the crucial steps that were undertaken to build the atomic model of this multi-subunit enzyme are reported, emphasizing how simple crystallographic experiments can be used to extract relevant biological information. In particular, this report discusses the combination of poor molecular replacement and experimental phases, the application of multi-crystal averaging and the use of anomalous scatterers as sequence markers to guide tracing and to locate the active site. The methods outlined here will likely serve as a reference for future structural determination of large complexes at low resolution.

  5. Single-step transepithelial ASLA (SCHWIND with mitomycin-C for the correction of high myopia: long term follow-up

    Aslanides IM

    2014-12-01

    Full Text Available Ioannis M Aslanides, Panagiotis N Georgoudis, Vasilis D Selimis, Achyut N Mukherjee Emmetropia Mediterranean Eye Institute, Heraklion, Crete, Greece Purpose: We wanted to compare the outcomes of single-step modified transepithelial photorefractive keratectomy (tPRK termed a SCHWIND all surface laser ablation (ASLA versus conventional alcohol-assisted photorefractive keratectomy (PRK and laser-assisted in situ keratomileusis (LASIK for the correction of higher myopia of 6.00 diopters (D or more, in an area with high risk of haze due to high intensity of sunlight.Methods: We used a prospective interventional cohort with matched retrospective control groups. Patients with >6 D myopia and <3.5 D of astigmatism were included. All treatments were performed with the SCHWIND Amaris system using aspheric ablation profiles. Mitomycin C was used in all PRK and ASLA cases. Outcomes were postoperative refraction, visual acuity, stability, and complications. The follow-up period was up to 12 months.Results: In total, 101 eyes were included after exclusions. Mean preoperative spherical equivalent refraction was −7.9 D, −8.2 D, and −7.4 D in the ASLA (n=41, PRK (n=29, and LASIK (n=31 groups. Mean postoperative spherical equivalent at 12 months postoperatively was −0.1 (standard deviation [SD]: 0.34, −0.2 (SD: 0.59, and −0.08 (SD: 0.36 in the ASLA, PRK, and LASIK groups, with 91.4%, 85.7%, and 83.9% within 0.5 D of target, respectively. Refractive outcomes and regression at 12 months did not vary among groups (P>0.05. Mean logMAR (logarithm of the minimum angle of resolution uncorrected distance visual acuity at 12 months was 0.00 (SD: 0.05, 0.06 (SD: 0.1, and 0.05 (SD: 0.09 in the ASLA, PRK, and LASIK groups, with significantly better vision in the tPRK group versus LASIK (P=0.01 and PRK (P=0.01 groups.Conclusion: ASLA (SCHWIND tPRK with mitomycin C for high myopia demonstrates comparable refractive outcomes to LASIK and PRK, with relatively

  6. Backtracking dynamics of RNA polymerase: pausing and error correction

    Sahoo, Mamata; Klumpp, Stefan

    2013-09-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

  7. Polymerase chain reaction methods (PCR in agrobiotechnology

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  8. Repair of Clustered Damage and DNA Polymerase Iota.

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  9. Fluoroscopic-guided primary single-step percutaneous gastrostomy. Initial results using the Freka {sup registered} GastroTube; Primaere einzeitige durchleuchtungsgesteuerte perkutane Gastrostomie (PG). Erste Ergebnisse mit dem Freka {sup registered} GastroTube

    Hahne, J.D.; Schoennagel, B.P.; Arndt, C.; Bannas, P.; Koops, A.; Adam, G.; Habermann, C.R. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Zentrum fuer Radiologie; Herrmann, J. [Universitaetsklinikum Hamburg-Eppendorf (Germany). Zentrum fuer Radiologie; Universitaetsklinikum Hamburg-Eppendorf (Germany). Abt. Paediatrische Radiologie

    2011-07-15

    Purpose: To determine the practicability and outcome of fluoroscopic-guided primary one-step treatment of percutaneous gastrostomy (PG) with the system Freka {sup registered} Gastro Tube (Fresenius Kabi, Germany). Materials and Methods: In 39 patients (mean age 62.7 {+-} 12.0 years), primary PG was performed based on clinical indication from August 2009 to April 2010. The intervention was performed by an experienced radiologist under aseptic conditions by direct puncture with Freka {sup registered} Gastro Tube under fluoroscopic guidance. The clinical data and outcome as well as any complications originated from the electronic archive of the University Medical Center Hamburg-Eppendorf. Results: The intervention was technically successful in all 39 patients. Within the mean follow-up time of 155.3 {+-} 73.6 days, 29 patients (74.4 %) did not experience complications. 10 patients (25.6 %) had to be revised. Complications manifested after a mean of 135.6 {+-} 61.2 days and mainly corresponded to accidental dislocation (50 %). One patient had to be surgically revised under suspicion of a malpositioned tube and suspected intestinal perforation. Clinically relevant wound infections were not detected. The total costs per patient were 553.17 Euro for our single-step treatment (OPS 5 - 431.x) vs. 963.69 Euro (OPS 5 - 431.x and OPS 8 - 123.0) for the recommended two-step treatment. Conclusion: Fluoroscopic-guided primary single-step treatment with Freka {sup registered} Gastro Tube system is feasible and not associated with an increased complication rate when compared to published literature applying a two-step treatment approach. Material costs as well as human and time resources could be significantly reduced using the single-step treatment. (orig.)

  10. Single-step green synthesis and characterization of gold-conjugated polyphenol nanoparticles with antioxidant and biological activities

    Sanna V

    2014-10-01

    Full Text Available Vanna Sanna,1,2 Nicolino Pala,1 Giuseppina Dessì,1 Paola Manconi,1 Alberto Mariani,1 Sonia Dedola,3 Mauro Rassu,3 Claudia Crosio,3 Ciro Iaccarino,3 Mario Sechi1,2 1Department of Chemistry and Pharmacy, University of Sassari, Sassari, Italy; 2Laboratory of Nanomedicine, Department of Chemistry and Pharmacy, University of Sassari, c/o Porto Conte Ricerche, Tramariglio, Alghero, Italy; 3Department of Biomedical Sciences, University of Sassari, Sassari, Italy Background: Gold nanoparticles (GNPs are likely to provide an attractive platform for combining a variety of biophysicochemical properties into a unified nanodevice with great therapeutic potential. In this study we investigated the capabilities of three different natural polyphenols, epigallocatechin-3-gallate (EGCG, resveratrol (RSV, and fisetin (FS, to allow synergistic chemical reduction of gold salts to GNPs and stabilization in a single-step green process. Moreover, antioxidant properties of the nanosystems, as well as preliminary antiproliferative activity and apoptotic process investigation of model EGCG-GNPs on stable clones of neuroblastoma SH-SY5Y cells expressing CFP-DEVD-YFP reporter, were examined. Methods: The GNPs were characterized by physicochemical techniques, polyphenol content, and in vitro stability. The antioxidant activity of the GNPs was also determined by 2,2-diphenyl-1-picrylhydrazyl (DPPH and 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid cation (ABTS radical-scavenging assays. Stable clones of neuronal SH-SY5Y-CFP-DEVD-YFP were generated and characterized, and cell viability after treatment with EGCG-GNPs was assessed after 72 hours through a 3(4,5-dimethylthiazol-2yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium assay. Activation of the apoptotic pathways was also investigated by Western blot analysis. Results: With a diameter in the size range of 10–25 nm, the obtained nanoparticles (NPs were found to contain 2.71%, 3.23%, and 5.47% of EGCG

  11. Advancing Polymerase Ribozymes Towards Self-Replication

    Tjhung, K. F.; Joyce, G. F.

    2017-07-01

    Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

  12. Single-Step Fabrication Using a Phase Inversion Method of Poly(vinylidene fluoride) (PVDF) Activated Carbon Air Cathodes for Microbial Fuel Cells

    Yang, Wulin; He, Weihua; Zhang, Fang; Hickner, Michael A.; Logan, Bruce E.

    2014-01-01

    Air cathodes used in microbial fuel cells (MFCs) need to have high catalytic activity for oxygen reduction, but they must also be easy to manufacture, inexpensive, and watertight. A simple one-step, phase inversion process was used here to construct

  13. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  14. Online hyphenation of extraction, Sephadex LH-20 column chromatography, and high-speed countercurrent chromatography: A highly efficient strategy for the preparative separation of andrographolide from Andrographis paniculata in a single step.

    Zhang, Ying-Qi; Wang, Shan-Shan; Han, Chao; Xu, Jin-Fang; Luo, Jian-Guang; Kong, Ling-Yi

    2017-12-01

    A novel isolation strategy, online hyphenation of ultrasonic extraction, Sephadex LH-20 column chromatography combined with high-speed countercurrent chromatography, was developed for pure compounds extraction and purification. Andrographolide from Andrographis paniculata was achieved only in a single step purification protocol via the present strategy. The crude powder was ultrasonic extracted and extraction was pumped into Sephadex LH-20 column directly to cut the nontarget fractions followed by the second-dimensional high-speed countercurrent chromatography, hyphenated by a six-port valve equipped at the post-end of Sephadex LH-20 column, for the final purification. The results yielded andrographolide with the amount of 1.02 mg and a purity of 98.5% in a single step, indicating that the present method is effective to harvest target compound from medicinal plant. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  16. Effect of two-step aging on spatial distribution of γ-phase particles and mechanical properties of Ni-14at.% Al single crystals

    Tyapkin, Yu.D.; Travina, N.T.; Ugarova, E.V.

    1977-01-01

    Electron microscope images were processed by statistical methods to investigate the space distribution of particles of the γ'-phase (formation of ''quasiperiodic micro-lattices'') after various conditions of single- and double-stage aging of the Ni-14 at.% Al alloy. Mechanical properties in uniaxial tension of single crystals were studied. Parameters of the space distribution of particles have been correlated with the mechanical properties

  17. Step-wise integration of single-port laparoscopic surgery into routine colorectal surgical practice by use of a surgical glove port.

    Hompes, R; Lindsey, I; Jones, O M; Guy, R; Cunningham, C; Mortensen, N J; Cahill, R A

    2011-06-01

    The cost associated with single-port laparoscopic access devices may limit utilisation of single-port laparoscopic surgery by colorectal surgeons. This paper describes a simple and cheap access modality that has facilitated the widespread adoption of single-port technology in our practice both as a stand-alone procedure and as a useful adjunct to traditional multiport techniques. A surgical glove port is constructed by applying a standard glove onto the rim of the wound protector/retractor used during laparoscopic resectional colorectal surgery. To illustrate its usefulness, we present our total experience to date and highlight a selection of patients presenting for a range of elective colorectal surgery procedures. The surgical glove port allowed successful completion of 25 single-port laparoscopic procedures (including laparoscopic adhesiolysis, ileo-rectal anastomosis, right hemicolectomy, total colectomy and low anterior resection) and has been used as an adjunct in over 80 additional multiport procedures (including refashioning of a colorectal anastomosis made after specimen extraction during a standard multiport laparoscopic anterior resection). This simple, efficient device can allow use of single-port laparoscopy in a broader spectrum of patients either in isolation or in combination with multiport surgery than may be otherwise possible for economic reasons. By separating issues of cost from utility, the usefulness of the technical advance inherent within single-port laparoscopy for colorectal surgery can be better appreciated. We endorse the creative innovation inherent in this approach as surgical practice continues to evolve for ever greater patient benefit.

  18. Design of a single-step immunoassay principle based on the combination of an enzyme-labeled antibody release coating and a hydrogel copolymerized with a fluorescent enzyme substrate in a microfluidic capillary device.

    Wakayama, Hideki; Henares, Terence G; Jigawa, Kaede; Funano, Shun-ichi; Sueyoshi, Kenji; Endo, Tatsuro; Hisamoto, Hideaki

    2013-11-21

    A combination of an enzyme-labeled antibody release coating and a novel fluorescent enzyme substrate-copolymerized hydrogel in a microchannel for a single-step, no-wash microfluidic immunoassay is demonstrated. This hydrogel discriminates the free enzyme-conjugated antibody from an antigen-enzyme-conjugated antibody immunocomplex based on the difference in molecular size. A selective and sensitive immunoassay, with 10-1000 ng mL(-1) linear range, is reported.

  19. An evaluation of a single-step extraction chromatography separation method for Sm-Nd isotope analysis of micro-samples of silicate rocks by high-sensitivity thermal ionization mass spectrometry

    Li Chaofeng; Li Xianhua; Li Qiuli; Guo Jinghui; Li Xianghui; Liu Tao

    2011-01-01

    Graphical abstract: Distribution curve of all eluting fractions for a BCR-2 (1-2-3.5-7 mg) on LN column using HCl and HF as eluting reagent. Highlights: → This analytical protocol affords a simple and rapid analysis for Sm and Nd isotope in minor rock samples. → The single-step separation method exhibits satisfactory separation effect for complex silicate samples. → Corrected 143 Nd/ 144 Nd data show excellent accuracy even if the 140 Ce 16 O + / 144 Nd 16 O + ratio reached to 0.03. - Abstract: A single-step separation scheme is presented for Sm-Nd radiogenic isotope system on very small samples (1-3 mg) of silicate rock. This method is based on Eichrom LN Spec chromatographic material and affords a straightforward separation of Sm-Nd from complex matrix with good purity and satisfactory blank levels, suitable for thermal ionization mass spectrometry (TIMS). This technique, characterized by high efficiency (single-step Sm-Nd separation) and high sensitivity (TIMS on NdO + ion beam), is able to process rapidly (3-4 h), with low procedure blanks ( 143 Nd/ 144 Nd ratios and Sm-Nd concentrations are presented for eleven international silicate rock reference materials, spanning a wide range of Sm-Nd contents and bulk compositions. The analytical results show a good agreement with recommended values within ±0.004% for the 143 Nd/ 144 Nd isotopic ratio and ±2% for Sm-Nd quantification at the 95% confidence level. It is noted that the uncertainty of this method is about 3 times larger than typical precision achievable with two-stage full separation followed by state-of-the-art conventional TIMS using Nd + ion beams which require much larger amounts of Nd. Hence, our single-step separation followed by NdO + ion beam technique is preferred to the analysis for microsamples.

  20. The Seven Step Strategy

    Schaffer, Connie

    2017-01-01

    Many well-intended instructors use Socratic or leveled questioning to facilitate the discussion of an assigned reading. While this engages a few students, most can opt to remain silent. The seven step strategy described in this article provides an alternative to classroom silence and engages all students. Students discuss a single reading as they…

  1. Single-step simultaneous side-by-side placement of a self-expandable metallic stent with a 6-Fr delivery system for unresectable malignant hilar biliary obstruction: a feasibility study.

    Kawakubo, Kazumichi; Kawakami, Hiroshi; Kuwatani, Masaki; Kudo, Taiki; Abe, Yoko; Kawahata, Shuhei; Kubo, Kimitoshi; Kubota, Yoshimasa; Sakamoto, Naoya

    2015-02-01

    Bilateral self-expandable metallic stent (SEMS) placement for the management of unresectable malignant hilar biliary obstruction (UMHBO) is technically challenging to perform using the existing metallic stents with thick delivery systems. The recently developed 6-Fr delivery systems could facilitate a single-step simultaneous side-by-side placement through the accessory channel of the duodenoscope. The aim of this study was to evaluate the feasibility of this procedure. Between May and September 2013, 13 consecutive patients with UMHBO underwent a single-step simultaneous side-by-side placement of SEMS with the 6-Fr delivery system. The technical success rate, stent patency, and rate of complications were evaluated from the prospectively collected database. Technical success was achieved in 11 (84.6%, 95% confidence interval [CI]: 57.8-95.8) patients. The median procedure time was 25 min. Early and late complications were observed in 23% (one segmental cholangitis and two liver abscesses) and 15% (one segmental cholangitis and one cholecystitis) patients, respectively. Median dysfunction free patency was 263 days (95% CI: 37-263). Five patients (38%) experienced stent occlusion that was successfully managed by endoscopic stent placement. A single-step simultaneous side-by-side placement of SEMS with a 6-Fr delivery system was feasible for the management of UMHBO. © 2014 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

  2. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  3. The normally expressed kappa immunoglobulin light chain gene repertoire and somatic mutations studied by single-sided specific polymerase chain reaction (PCR); frequent occurrence of features often assigned to autoimmunity

    Juul, L; Hougs, L; Andersen, V

    1997-01-01

    The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...

  4. An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

    Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

    2017-01-01

    Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)

  5. Estimating trematode prevalence in snail hosts using a single-step duplex PCR: how badly does cercarial shedding underestimate infection rates?

    Born-Torrijos, A.; Poulin, R.; Raga, J. A.; Holzer, Astrid S.

    2014-01-01

    Roč. 7, MAY 2014 (2014), s. 243 ISSN 1756-3305 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : prevalence * detection * snail host * double infection * single-steo duplex PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.430, year: 2014

  6. Two-step transition towards the reversibility region in Bi2Sr2CaCu2O8-δ single crystals

    Pastoriza, H.; de La Cruz, F.; Mitzi, D. B.; Kapitulnik, A.

    1992-10-01

    We have performed magnetization measurements on Bi2Sr2CaCu2O8-δ single crystals in the c^ crystallographic direction for fields from 2 Oe up to 700 Oe. The results strongly suggest that the reversible thermodynamic region is achieved after the vortex flux structure shows an abrupt transition at a temperature lower than that determined by the irreversibility line.

  7. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  8. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

    1988-01-01

    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  9. Examining the rudimentary steps of the oxygen reduction reaction on single-atomic Pt using Ti-based non-oxide supports

    Tak, Young Joo; Yang, Sungeun; Lee, Hyunjoo

    2018-01-01

    C(100)-supported single Pt atoms. The O2 and OOH* dissociation processes on Pt/TiN(100) are determined to be non-activated (i.e. "barrier-less" dissociation) while an activation energy barrier of 0.19 and 0.51eV is found for these dissociation processes on Pt/TiC(100), respectively. Moreover, the series...

  10. System for separation of cortisol, 11-deoxycortisol, 17-hydroxyprogesterone and progesterone in a single chromatographic step and its application to radioimmunoassay

    Cunningham, S K; McKenna, T J [St. Vincent' s Hospital, Dublin (Republic of Ireland). Dept. of Endocrinology

    1982-08-18

    A procedure for accurate, sensitive and highly specific measurement of cortisol, 11-deoxycortisol, 17-hydroxyprogesterone and progesterone is described. We have developed a chromatographic system whereby the steroids may be separated in a single passage over celite microcolumns. This permits the specific radioimmunoassay of the principal glucocorticoid in man and its ..delta..4-pregnene precursors and thus facilitates investigation of the physiological control and pathological disorders of glucocorticoid biosynthesis.

  11. A single and two step isomerization process for d-tagatose and l-ribose bioproduction using l-arabinose isomerase and d-lyxose isomerase.

    Patel, Manisha J; Akhani, Rekha C; Patel, Arti T; Dedania, Samir R; Patel, Darshan H

    2017-02-01

    l-ribose and d-tagatose are biochemically synthesized using sugar isomerases. The l-arabinose isomerase gene from Shigella flexneri (Sf-AI) was cloned and expressed in Escherichia coli BL-21. Sf-AI was applied for the bioproduction of d-tagatose from d-galactose. l-ribose synthesis was performed by two step isomerization using Sf-AI and d-lyxose/ribose isomerase from Cohnella laevoribosii. The overall 22.3% and 25% conversion rate were observed for d-tagatose and l-ribose production from d-galactose and l-arabinose respectively. In the present manuscript, synthesis of rare sugars from naturally available sugars is discussed along with the biochemical characterization of Sf-AI and its efficiency. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  13. A single one-step radiosynthesis of [{sup 18}F]L.B.T.-999, a novel and selective dat radioligand for PET

    Dolle, F.; Hinnen, F.; Saba, W.; Schollhorn-peyronneau, M.A.; Valette, H.; Bottlaender, M. [Service Hospitalier Frederic Joliot, DSV/ Institut d' Imagerie BioMedicale, 91 - Orsay (France); Helfenbein, J.; Le gailliard, J. [Institut National de la Sante et de la Recherche Medicale (INSERM), U484, Orphachem, ZATE, 63 - Clermont Ferrand (France); Mavel, S.; Mincheva, Z.; Garreau, L.; Chalon, S.; Guilloteau, D.; Emond, P. [Institut National de la Sante et de la Recherche Medicale (INSERM), U619, 37 - Tours (France); Mavel, S.; Garreau, L.; Chalon, S.; Guilloteau, D.; Emond, P. [Universite Francois Rabelais de Tours, 37 (France); Halldin, C. [Karolinska Institut, Dept. of Clinical Neuroscience, Karolinska Hospital, Stockholm (Sweden); Madelmont, J.C. [Institut National de la Sante et de la Recherche Medicale (INSERM) U484, Lab. Etude Metabolique des Molecules Marquees, 63 - Clermont Ferrand (France); Deloye, J.B. [Biopole Clermont Limagne, Lab. Cyclopharma, 63 - Saint Beauzire (France); Guilloteau, D. [Centre Hospitalier Regional Universitaire, 37 - Tours (France)

    2008-02-15

    L.B.T.-999 (8-((E)-4-fluoro-but-2-enyl)-3-beta-p-tolyl-8- aza-bi-cyclo[3.2.1]octane-2-beta-carboxylic acid methyl ester) is a recently developed cocaine derivative belonging to a new generation of highly selective D.A.T. ligands [1-3]. Initial fluorine-18-labelling of L.B.T.-999 was based on the robust and reliable two-step radiochemical pathway often reported for such tropane derivatives, involving first the preparation of (E)-1-[{sup 18}F]fluoro-4-tosyloxybut-2-ene followed by a N-alkylation reaction with the appropriate nor-tropane moiety [4]. In the present work, a simple one-step fluorine-18-labelling of L.B.T.-999 is reported, based on a chlorine-for-fluorine nucleophilic aliphatic substitution, facilitating as expected both automation and final H.P.L.C. purification. The process involves: (A) reaction of K[{sup 18}F]F-Kryptofix 222 with the chlorinated precursor (3.5-4.5 mg) at 165 degrees C for 10 min in D.M.S.O. (0.6 m L) followed by (B) C-18 PrepSep cartridge pre-purification and finally (C) semi preparative HPLC purification on a Waters Symmetry C-18. Typically, 3.70-5.92 GBq of [{sup 18}F]L.B.T.-999 (> 95% chemically and radiochemically pure) could be obtained with specific radioactivities ranging from 37 to 111 GBq/micro-mol within 85-90 min (HPLC purification and Sep-Pak-based formulation included), starting from a 37.0 GBq [{sup 18}F]fluoride batch (overall radiochemical yields: 10-16%, non decay corrected) [5].Supported in part by the E.C. - F.P.6-project D.i.M.I. (L.S.H.B.-C.T.- 2005-512146) and the R.N.T.S. 03 B 243 Fluoropak program. (authors)

  14. Comparison of two commercial embryo culture media (SAGE-1 step single medium vs. G1-PLUSTM/G2-PLUSTM sequential media): Influence on in vitro fertilization outcomes and human embryo quality.

    López-Pelayo, Iratxe; Gutiérrez-Romero, Javier María; Armada, Ana Isabel Mangano; Calero-Ruiz, María Mercedes; Acevedo-Yagüe, Pablo Javier Moreno de

    2018-04-26

    To compare embryo quality, fertilization, implantation, miscarriage and clinical pregnancy rates for embryos cultured in two different commercial culture media until D-2 or D-3. In this retrospective study, we analyzed 189 cycles performed in 2016. Metaphase II oocytes were microinjected and allocated into single medium (SAGE 1-STEP, Origio) until transferred, frozen or discarded; or, if sequential media were used, the oocytes were cultured in G1-PLUSTM (Vitrolife) up to D-2 or D-3 and in G2-PLUSTM (Vitrolife) to transfer. On the following day, the oocytes were checked for normal fertilization and on D-2 and D-3 for morphological classification. Statistical analysis was performed using the chi-square and Mann-Whitney tests in PASW Statistics 18.0. The fertilization rates were 70.07% for single and 69.11% for sequential media (p=0.736). The mean number of embryos with high morphological quality (class A/B) was higher in the single medium than in the sequential media: D-2 [class A (190 vs. 107, pcultured in single medium were frozen: 197 (21.00%) vs. sequential: 102 (11.00%), pculture in single medium yields greater efficiency per cycle than in sequential media. Higher embryo quality and quantity were achieved, resulting in more frozen embryos. There were no differences in clinical pregnancy rates.

  15. Enhanced Water Oxidation Photoactivity of Nano-Architectured α-Fe2O3-WO3 Composite Synthesized by Single-Step Hydrothermal Method

    Rahman, Gul; Joo, Oh-Shim; Chae, Sang Youn; Shah, Anwar-ul-Haq Ali; Mian, Shabeer Ahmad

    2018-04-01

    This study reports the one-step in situ synthesis of a hematite-tungsten oxide (α-Fe2O3-WO3) composite on fluorine-doped tin oxide substrate via a simple hydrothermal method. Scanning electron microscopy images indicated that the addition of tungsten (W) precursor into the reaction mixture altered the surface morphology from nanorods to nanospindles. Energy-dispersive x-ray spectroscopy analysis confirmed the presence of W content in the composite. From the ultraviolet-visible spectrum of α-Fe2O3-WO3, it was observed that absorption began at ˜ 600 nm which corresponded to the bandgap energy of ˜ 2.01 eV. The α-Fe2O3-WO3 electrode demonstrated superior performance, with water oxidation photocurrent density of 0.80 mA/cm2 (at 1.6 V vs. reversible hydrogen electrode under standard illumination conditions; AM 1.5G, 100 mW/cm2) which is 2.4 times higher than α-Fe2O3 (0.34 mA/cm2). This enhanced water oxidation performance can be attributed to the better charge separation properties in addition to the large interfacial area of small-sized particles present in the α-Fe2O3-WO3 nanocomposite film.

  16. The Oxidative Fermentation of Ethanol in Gluconacetobacter diazotrophicus Is a Two-Step Pathway Catalyzed by a Single Enzyme: Alcohol-Aldehyde Dehydrogenase (ADHa

    Saúl Gómez-Manzo

    2015-01-01

    Full Text Available Gluconacetobacter diazotrophicus is a N2-fixing bacterium endophyte from sugar cane. The oxidation of ethanol to acetic acid of this organism takes place in the periplasmic space, and this reaction is catalyzed by two membrane-bound enzymes complexes: the alcohol dehydrogenase (ADH and the aldehyde dehydrogenase (ALDH. We present strong evidence showing that the well-known membrane-bound Alcohol dehydrogenase (ADHa of Ga. diazotrophicus is indeed a double function enzyme, which is able to use primary alcohols (C2–C6 and its respective aldehydes as alternate substrates. Moreover, the enzyme utilizes ethanol as a substrate in a reaction mechanism where this is subjected to a two-step oxidation process to produce acetic acid without releasing the acetaldehyde intermediary to the media. Moreover, we propose a mechanism that, under physiological conditions, might permit a massive conversion of ethanol to acetic acid, as usually occurs in the acetic acid bacteria, but without the transient accumulation of the highly toxic acetaldehyde.

  17. One-Step Condensation and Hydrogenation of Furfural-Acetone Using Mixed and Single Catalyst Based on Ni/M-Oxide [M=Al; Mg

    Ulfa, S. M.; Pramesti, I. N.; Mustafidah, H.

    2018-01-01

    Modification of furfural by condensation and hydrogenation reaction is a promising approach to produce higher alkane derivatives (C8-C13) as diesel fraction. This research investigated the catalytic activity of Ni/MgO as bifunctional catalyst compared with MgO-Ni/Al2O3 mixed catalyst for condensation-hydrogenation reaction. The Ni/MgO and Ni/Al2O3 with 20% Ni loading were prepared by wet impregnation methods using Ni(NO3)2.6H2O salt, calcined and reduced at 500°C. The catalyst performance was tested for one-step condensation-hydrogenation reaction using autoclave oil batch reactor. The reaction was conducted by reacting furfural and acetone in 1:1 ratio using water as solvent. Condensation reaction was performed at 100°C for 8 hours, followed by hydrogenation at 120°C during 7 hours. Analysis by gas chromatography showed that C=C double bond of furfurylidene acetone were successfully hydrogenated. Using Ni/MgO catalyst at 120°C, the products were identified as 1,5-bis-(2-furanyl)-1,4-penta-1-ene-3-one (2.68%) and 1,5-bis-(2-furanyl)-1,4-pentan-3-one (trace amount). On the other hand, reaction using mixed catalyst, MgO-Ni/Al2O3 showed better activity over bifunctional Ni/MgO at the same reaction temperature. The products were identified as 4-(2-furanyl)-3-butan-2-one (27.30%); 1,5-bis-(2-furanyl)-1,4-penta-1-ene-3-one (3.82%) and 1,5-bis-(2-furanyl)-1,4-pentan-3-one (1.11%). The impregnation of Ni on MgO decrease the physical properties of catalyst, confirmed by surface area analysis (SAA).

  18. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  19. Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

    Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

    2012-01-01

    Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

  20. Single-step transesterification with simultaneous concentration and stable isotope analysis of fatty acid methyl esters by gas chromatography-combustion-isotope ratio mass spectrometry.

    Panetta, Robert J; Jahren, A Hope

    2011-05-30

    Gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS) is increasingly applied to food and metabolic studies for stable isotope analysis (δ(13) C), with the quantification of analyte concentration often obtained via a second alternative method. We describe a rapid direct transesterification of triacylglycerides (TAGs) for fatty acid methyl ester (FAME) analysis by GC-C-IRMS demonstrating robust simultaneous quantification of amount of analyte (mean r(2) =0.99, accuracy ±2% for 37 FAMEs) and δ(13) C (±0.13‰) in a single analytical run. The maximum FAME yield and optimal δ(13) C values are obtained by derivatizing with 10% (v/v) acetyl chloride in methanol for 1 h, while lower levels of acetyl chloride and shorter reaction times skewed the δ(13) C values by as much as 0.80‰. A Bland-Altman evaluation of the GC-C-IRMS measurements resulted in excellent agreement for pure oils (±0.08‰) and oils extracted from French fries (±0.49‰), demonstrating reliable simultaneous quantification of FAME concentration and δ(13) C values. Thus, we conclude that for studies requiring both the quantification of analyte and δ(13) C data, such as authentication or metabolic flux studies, GC-C-IRMS can be used as the sole analytical method. Copyright © 2011 John Wiley & Sons, Ltd.

  1. Single HIV-1 Imaging Reveals Progression of Infection through CA-Dependent Steps of Docking at the Nuclear Pore, Uncoating, and Nuclear Transport.

    Francis, Ashwanth C; Melikyan, Gregory B

    2018-04-11

    The HIV-1 core consists of capsid proteins (CA) surrounding viral genomic RNA. After virus-cell fusion, the core enters the cytoplasm and the capsid shell is lost through uncoating. CA loss precedes nuclear import and HIV integration into the host genome, but the timing and location of uncoating remain unclear. By visualizing single HIV-1 infection, we find that CA is required for core docking at the nuclear envelope (NE), whereas early uncoating in the cytoplasm promotes proteasomal degradation of viral complexes. Only docked cores exhibiting accelerated loss of CA at the NE enter the nucleus. Interestingly, a CA mutation (N74D) altering virus engagement of host factors involved in nuclear transport does not alter the uncoating site at the NE but reduces the nuclear penetration depth. Thus, CA protects HIV-1 complexes from degradation, mediates docking at the nuclear pore before uncoating, and determines the depth of nuclear penetration en route to integration. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. The single-process biochemical reaction of Rubisco: a unified theory and model with the effects of irradiance, CO₂ and rate-limiting step on the kinetics of C₃ and C₄ photosynthesis from gas exchange.

    Farazdaghi, Hadi

    2011-02-01

    Photosynthesis is the origin of oxygenic life on the planet, and its models are the core of all models of plant biology, agriculture, environmental quality and global climate change. A theory is presented here, based on single process biochemical reactions of Rubisco, recognizing that: In the light, Rubisco activase helps separate Rubisco from the stored ribulose-1,5-bisphosphate (RuBP), activates Rubisco with carbamylation and addition of Mg²(+), and then produces two products, in two steps: (Step 1) Reaction of Rubisco with RuBP produces a Rubisco-enediol complex, which is the carboxylase-oxygenase enzyme (Enco) and (Step 2) Enco captures CO₂ and/or O₂ and produces intermediate products leading to production and release of 3-phosphoglycerate (PGA) and Rubisco. PGA interactively controls (1) the carboxylation-oxygenation, (2) electron transport, and (3) triosephosphate pathway of the Calvin-Benson cycle that leads to the release of glucose and regeneration of RuBP. Initially, the total enzyme participates in the two steps of the reaction transitionally and its rate follows Michaelis-Menten kinetics. But, for a continuous steady state, Rubisco must be divided into two concurrently active segments for the two steps. This causes a deviation of the steady state from the transitional rate. Kinetic models are developed that integrate the transitional and the steady state reactions. They are tested and successfully validated with verifiable experimental data. The single-process theory is compared to the widely used two-process theory of Farquhar et al. (1980. Planta 149, 78-90), which assumes that the carboxylation rate is either Rubisco-limited at low CO₂ levels such as CO₂ compensation point, or RuBP regeneration-limited at high CO₂. Since the photosynthesis rate cannot increase beyond the two-process theory's Rubisco limit at the CO₂ compensation point, net photosynthesis cannot increase above zero in daylight, and since there is always respiration at

  3. Single molecule TPM analysis of the catalytic pentad mutants of Cre and Flp site-specific recombinases: contributions of the pentad residues to the pre-chemical steps of recombination

    Fan, Hsiu-Fang; Cheng, Yong-Song; Ma, Chien-Hui; Jayaram, Makkuni

    2015-01-01

    Cre and Flp site-specific recombinase variants harboring point mutations at their conserved catalytic pentad positions were characterized using single molecule tethered particle motion (TPM) analysis. The findings reveal contributions of these amino acids to the pre-chemical steps of recombination. They suggest functional differences between positionally conserved residues in how they influence recombinase-target site association and formation of ‘non-productive’, ‘pre-synaptic’ and ‘synaptic’ complexes. The most striking difference between the two systems is noted for the single conserved lysine. The pentad residues in Cre enhance commitment to recombination by kinetically favoring the formation of pre-synaptic complexes. These residues in Flp serve a similar function by promoting Flp binding to target sites, reducing non-productive binding and/or enhancing the rate of assembly of synaptic complexes. Kinetic comparisons between Cre and Flp, and between their derivatives lacking the tyrosine nucleophile, are consistent with a stronger commitment to recombination in the Flp system. The effect of target site orientation (head-to-head or head-to-tail) on the TPM behavior of synapsed DNA molecules supports the selection of anti-parallel target site alignment prior to the chemical steps. The integrity of the synapse, whose establishment/stability is fostered by strand cleavage in the case of Flp but not Cre, appears to be compromised by the pentad mutations. PMID:25765648

  4. Polymerase Gamma Disease through the Ages

    Saneto, Russell P.; Naviaux, Robert K.

    2010-01-01

    The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

  5. DNA Polymerase Fidelity: Beyond Right and Wrong.

    Washington, M Todd

    2016-11-01

    Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

    Claudia Huber

    Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

  7. Site-specifically modified oligodeoxyribonucleotides as templates for Escherichia coli DNA polymerase I

    O'Connor, D.; Stoehrer, G.

    1985-01-01

    Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis

  8. Two-step irradiance schedule versus single-dose tramadol sustained-release tablets for pain control during topical 5-aminolevulinic acid-photodynamic therapy of condyloma acuminatum in Chinese patients: a randomized comparative study.

    Mchepange, Uwesu O; Huang, Chun-Yan; Sun, Yi; Tu, Ya-Ting; Tao, Juan

    2014-07-01

    Photodynamic therapy with 5-aminolevulinic acid (ALA-PDT) offers promising results for the treatment of condyloma acuminatum. However, patients have to dwell with pain to benefit from this otherwise effective and safe "off-label" treatment modality. Several techniques have been explored to control ALA-PDT-induced pain, but the desperate search for a universally accepted method is still ongoing. This study compares the two-step irradiance approach with single-dose administration of 100 mg tramadol sustained-release tablets for pain induced by ALA-PDT of condyloma acuminatum in Chinese patients. Adult Chinese patients with condyloma acuminatum were enrolled in a randomized comparative study. Pain levels were compared using the Numeric Rating Scale (NRS) at pre-defined assessment points during and after irradiation. The pain was dominated by characteristics such as burning and pricking and was almost always local and superficial. The median pain scores were lower in the two-step irradiance group at 1 minute (U = 621.5, P = 0.002) but higher at 20 minutes (U = 585.5, P = 0.002). The median pain scores between the two groups did not differ significantly at other assessment points. The pain was moderate in both groups and peaked earlier in the analgesics group (median: 5 minutes) but later in the two-step irradiance group (median: 15 minutes). The pain was generally mild. The median pain scores were equal at each assessment point, except at 3 hours where the median was lower in the analgesics group (1.0) as compared with the two-step irradiance group (2.0) (U = 725.0, P = 0.056). Pain in the two-step irradiance protocol is irradiance-dependent. The two-step irradiance approach produces significant benefits over analgesics during the initial stages of therapy but analgesics offer significant benefits thereafter. There are potential benefits of combining the two approaches in minimizing ALA-PDT-induced pain. © 2014 Wiley Periodicals

  9. DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis

    Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.

    1987-06-01

    Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.

  10. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

    Fabio Lapenta

    Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

  11. Application of stepping motor

    1980-10-01

    This book is divided into three parts, which is about practical using of stepping motor. The first part has six chapters. The contents of the first part are about stepping motor, classification of stepping motor, basic theory og stepping motor, characteristic and basic words, types and characteristic of stepping motor in hybrid type and basic control of stepping motor. The second part deals with application of stepping motor with hardware of stepping motor control, stepping motor control by microcomputer and software of stepping motor control. The last part mentions choice of stepping motor system, examples of stepping motor, measurement of stepping motor and practical cases of application of stepping motor.

  12. Backtracking dynamics of RNA polymerase: pausing and error correction

    Sahoo, Mamata; Klumpp, Stefan

    2013-01-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

  13. Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

    Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

    1977-03-02

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

  14. Step out - Step in Sequencing Games

    Musegaas, M.; Borm, P.E.M.; Quant, M.

    2014-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out - Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order.

  15. Step out-step in sequencing games

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2015-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out–Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order. First,

  16. Some calculated (p,α) cross-sections using the alpha particle knock-on and triton pick-up reaction mechanisms: An optimisation of the single-step Feshbach-Kerman-Koonin (FKK) theory

    Olise, Felix S.; Ajala, Afis; Olamiyl, Hezekiah B. [Dept. of Physics and Engineering Physics, Obafemi Awolowo University, Ile-Ife (Nigeria)

    2016-04-15

    The Feshbach-Kerman-Koonin (FKK) multi-step direct (MSD) theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α) reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core) by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process) and proton-triton (for the pick-up process) interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  17. Some Calculated (p,α Cross-Sections Using the Alpha Particle Knock-On and Triton Pick-Up Reaction Mechanisms: An Optimisation of the Single-Step Feshbach–Kerman–Koonin (FKK Theory

    Felix S. Olise

    2016-04-01

    Full Text Available The Feshbach–Kerman–Koonin (FKK multi-step direct (MSD theory of pre-equilibrium reactions has been used to compute the single-step cross-sections for some (p,α reactions using the knock-on and pick-up reaction mechanisms at two incident proton energies. For the knock-on mechanism, the reaction was assumed to have taken place by the direct ejection of a preformed alpha cluster in a shell-model state of the target. But the reaction was assumed to have taken place by the pick-up of a preformed triton cluster (also bound in a shell-model state of the target core by the incident proton for the pick-up mechanism. The Yukawa forms of potential were used for the proton-alpha (for the knock-on process and proton-triton (for the pick-up process interaction and several parameter sets for the proton and alpha-particle optical potentials. The calculated cross-sections for both mechanisms gave satisfactory fits to the experimental data. Furthermore, it has been shown that some combinations of the calculated distorted wave Born approximation cross-sections for the two reaction mechanisms in the FKK MSD theory are able to give better fits to the experimental data, especially in terms of range of agreement. In addition, the theory has been observed to be valid over a wider range of energy.

  18. Examination of the Effects of Activated Carbon Produced from Coal Using Single-Step H3PO4/N2+H2O Vapor Activation on the Adsorption of Bovine Serum Albumin at Different Temperatures and pH Values

    Atakan Toprak

    2017-12-01

    Full Text Available This study examined protein adsorption equilibrium and kinetics on activated carbon (AC that we obtained from coal by single-step H3PO4 activation under N2+H2O vapor at 800 °C. Surface properties, pore size distribution, and volumes of AC were determined using the volumetric method with N2 adsorption at 77 K. Also, the textural properties were characterized by SEM-EDAX and XRD. The zeta potential values were measured to elucidate the electrostatic interactions between the protein and AC. The obtained AC discrete system was also used as an adsorbent for adsorbing bovine serum albumin (BSA from aqueous solution. The effects of pH (4.0, 5.0, and 7.4 and temperatures (20, 30 and 40 °C on the adsorption of BSA on AC were examined. The surface area, micropore, mesopore and total pore volumes of AC were found to be 1175 m2/g, 0.477 cm3/g, 0.061 cm3/g and 0.538 cm3/g, respectively. The optimum temperature for AC in BSA adsorption was found to be 40 °C and the pH was found to be 4.0. The highest BSA adsorption was found to be 159 mg/g and pH to be 4.0. The experimental equilibrium data were compared with the Langmuir and Freundlich models and found to be compatible with both models. The adsorption process is best described by the pseudo-first-order kinetic model. As a result, it was found out that AC obtained by single step H3PO4/N2+H2O vapor activation is an effective adsorbent for the adsorption of BSA from aqueous solution.

  19. Evolving a polymerase for hydrophobic base analogues.

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  20. Fast-Rate Capable Electrode Material with Higher Energy Density than LiFePO4: 4.2V LiVPO4F Synthesized by Scalable Single-Step Solid-State Reaction.

    Kim, Minkyung; Lee, Seongsu; Kang, Byoungwoo

    2016-03-01

    Use of compounds that contain fluorine (F) as electrode materials in lithium ion batteries has been considered, but synthesizing single-phase samples of these compounds is a difficult task. Here, it is demonstrated that a simple scalable single-step solid-state process with additional fluorine source can obtain highly pure LiVPO 4 F. The resulting material with submicron particles achieves very high rate capability ≈100 mAh g -1 at 60 C-rate (1-min discharge) and even at 200 C-rate (18 s discharge). It retains superior capacity, ≈120 mAh g -1 at 10 C charge/10 C discharge rate (6-min) for 500 cycles with >95% retention efficiency. Furthermore, LiVPO 4 F shows low polarization even at high rates leading to higher operating potential >3.45 V (≈3.6 V at 60 C-rate), so it achieves high energy density. It is demonstrated for the first time that highly pure LiVPO 4 F can achieve high power capability comparable to LiFePO 4 and much higher energy density (≈521 Wh g -1 at 20 C-rate) than LiFePO 4 even without nanostructured particles. LiVPO 4 F can be a real substitute of LiFePO 4.

  1. Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications.

    Rodrigo Jácome

    Full Text Available The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, "fingertips" that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection.

  2. Global conformational dynamics of a Y-family DNA polymerase during catalysis.

    Cuiling Xu

    2009-10-01

    Full Text Available Replicative DNA polymerases are stalled by damaged DNA while the newly discovered Y-family DNA polymerases are recruited to rescue these stalled replication forks, thereby enhancing cell survival. The Y-family DNA polymerases, characterized by low fidelity and processivity, are able to bypass different classes of DNA lesions. A variety of kinetic and structural studies have established a minimal reaction pathway common to all DNA polymerases, although the conformational intermediates are not well defined. Furthermore, the identification of the rate-limiting step of nucleotide incorporation catalyzed by any DNA polymerase has been a matter of long debate. By monitoring time-dependent fluorescence resonance energy transfer (FRET signal changes at multiple sites in each domain and DNA during catalysis, we present here a real-time picture of the global conformational transitions of a model Y-family enzyme: DNA polymerase IV (Dpo4 from Sulfolobus solfataricus. Our results provide evidence for a hypothetical DNA translocation event followed by a rapid protein conformational change prior to catalysis and a subsequent slow, post-chemistry protein conformational change. Surprisingly, the DNA translocation step was induced by the binding of a correct nucleotide. Moreover, we have determined the directions, rates, and activation energy barriers of the protein conformational transitions, which indicated that the four domains of Dpo4 moved in a synchronized manner. These results showed conclusively that a pre-chemistry conformational change associated with domain movements was too fast to be the rate-limiting step. Rather, the rearrangement of active site residues limited the rate of correct nucleotide incorporation. Collectively, the conformational dynamics of Dpo4 offer insights into how the inter-domain movements are related to enzymatic function and their concerted interactions with other proteins at the replication fork.

  3. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  4. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  5. Structure and function of DNA polymerase μ

    Matsumoto, Takuro; Maezawa, So

    2013-01-01

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  6. A new family of 1D exchange biased heterometal single-molecule magnets: observation of pronounced quantum tunneling steps in the hysteresis loops of quasi-linear {Mn2Ni3} clusters.

    Das, Animesh; Gieb, Klaus; Krupskaya, Yulia; Demeshko, Serhiy; Dechert, Sebastian; Klingeler, Rüdiger; Kataev, Vladislav; Büchner, Bernd; Müller, Paul; Meyer, Franc

    2011-03-16

    First members of a new family of heterometallic Mn/Ni complexes [Mn(2)Ni(3)X(2)L(4)(LH)(2)(H(2)O)(2)] (X = Cl: 1; X = Br: 2) with the new ligand 2-{3-(2-hydroxyphenyl)-1H-pyrazol-1-yl}ethanol (H(2)L) have been synthesized, and single crystals obtained from CH(2)Cl(2) solutions have been characterized crystallographically. The molecular structures feature a quasi-linear Mn(III)-Ni(II)-Ni(II)-Ni(II)-Mn(III) core with six-coordinate metal ions, where elongated axes of all the distorted octahedral coordination polyhedra are aligned parallel and are fixed with respect to each other by intramolecular hydrogen bonds. 1 and 2 exhibit quite strong ferromagnetic exchange interactions throughout (J(Mn-Ni) ≈ 40 K (1) or 42 K (2); J(Ni-Ni) ≈ 22 K (1) or 18 K (2)) that lead to an S(tot) = 7 ground state, and a sizable uniaxial magnetoanisotropy with D(mol) values -0.55 K (1) and -0.45 K (2). These values are directly derived also from frequency- and temperature-dependent high-field EPR spectra. Slow relaxation of the magnetization at low temperatures and single-molecule magnet (SMM) behavior are evident from frequency-dependent peaks in the out-of-phase ac susceptibilities and magnetization versus dc field measurements, with significant energy barriers to spin reversal U(eff) = 27 K (1) and 22 K (2). Pronounced quantum tunnelling steps are observed in the hysteresis loops of the temperature- and scan rate-dependent magnetization data, but with the first relaxation step shifted above (1) or below (2) the zero crossing of the magnetic field, despite the very similar molecular structures. The different behavior of 1 and 2 is interpreted in terms of antiferromagnetic (1) or ferromagnetic (2) intermolecular interactions, which are discussed in view of the subtle differences of intermolecular contacts within the crystal lattice.

  7. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  8. Towards the molecular bases of polymerase dynamics

    Chela Flores, J.

    1991-03-01

    One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

  9. Mechanisms by which herpes simplex virus DNA polymerase limits translesion synthesis through abasic sites.

    Zhu, Yali; Song, Liping; Stroud, Jason; Parris, Deborah S

    2008-01-01

    Results suggest a high probability that abasic (AP) sites occur at least once per herpes simplex virus type 1 (HSV-1) genome. The parameters that control the ability of HSV-1 DNA polymerase (pol) to engage in AP translesion synthesis (TLS) were examined because AP lesions could influence the completion and fidelity of viral DNA synthesis. Pre-steady-state kinetic experiments demonstrated that wildtype (WT) and exonuclease-deficient (exo-) pol could incorporate opposite an AP lesion, but full TLS required absence of exo function. Virtually all of the WT pol was bound at the exo site to AP-containing primer-templates (P/Ts) at equilibrium, and the pre-steady-state rate of excision by WT pol was higher on AP-containing than on matched DNA. However, several factors influencing polymerization work synergistically with exo activity to prevent HSV-1 pol from engaging in TLS. Although the pre-steady-state catalytic rate constant for insertion of dATP opposite a T or AP site was similar, ground-state-binding affinity of dATP for insertion opposite an AP site was reduced 3-9-fold. Single-turnover running-start experiments demonstrated a reduced proportion of P/Ts extended to the AP site compared to the preceding site during processive synthesis by WT or exo- pol. Only the exo- pol engaged in TLS, though inefficiently and without burst kinetics, suggesting a much slower rate-limiting step for extension beyond the AP site.

  10. New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

    Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

    2018-02-15

    Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.

  11. Single-step purification and characterization of an extreme halophilic, ethanol tolerant and acidophilic xylanase from Aureobasidium pullulans NRRL Y-2311-1 with application potential in the food industry.

    Yegin, Sirma

    2017-04-15

    An extracellular xylanase from Aureobasidium pullulans NRRL Y-2311-1 produced on wheat bran was purified by a single-step chromatographic procedure. The enzyme had a molecular weight of 21.6kDa. The optimum pH and temperature for xylanase activity were 4.0 and 30-50°C, respectively. The enzyme was stable in the pH range of 3.0-8.0. The inactivation energy of the enzyme was calculated as 218kJmol -1 . The xylanase was ethanol tolerant and kept complete activity in the presence of 10% ethanol. Likewise, it retained almost complete activity at a concentration range of 0-20% NaCl. In general, the enzyme was resistant to several metal ions and reagents. Mg 2+ , Zn 2+ , Cu 2+ , K 1+ , EDTA and β-mercaptoethanol resulted in enhanced xylanase activity. The K m and V max values on beechwood xylan were determined to be 19.43mgml -1 and 848.4Uml -1 , respectively. The enzyme exhibits excellent characteristics and could, therefore, be a promising candidate for application in food and bio-industries. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Study on single step solid state synthesis of WC@C nanocomposite and electrochemical stability of synthesized WC@C & Pt/WC@C for alcohol oxidation (methanol/ethanol)

    Singla, Gourav, E-mail: gsinghla@gmail.com; Singh, K., E-mail: kusingh@thapar.edu; Pandey, O.P., E-mail: oppandey@thapar.edu

    2016-04-25

    WC@C nano composite was prepared by a single step solid–state reaction through in situ reduction and carburization of WO{sub 3} in the presence of Mg and activated charcoal. The XRD results and thermodynamics analysis showed that the optimization of reaction temperature facilitates the reduction as well as carburization of tungsten oxide(s) at different reaction temperature. Thermogravimetric analysis of the product was done to assess the thermal stability in air. The Raman spectroscopy was used to find out the nature (amorphous/graphitic) of carbon in the obtained phase. The N{sub 2} adsorption–desorption measurement showed a narrow pore size distribution from 3 to 4 nm with BET surface area of up to 522.5 m{sup 2}/g. TEM/HRTEM images confirmed formation of the WC nano particles with spherical morphology. Electrochemical stability of pure and platinized carbide sample (Pt/WC) has been investigated using cyclic voltammetry in acidic media for alcohol (methanol and ethanol) oxidation. - Highlights: • Tungsten carbide nano powder was synthesized using charcoal as carbon source. • Formation of WC occurs through the formation of lower tungsten oxide. • CO{sub 2}/CO ratio effect the formation of WC. • Mesoporous tungsten carbide with surface areas 522.5 m{sup 2}/g obtained by using charcoal. • Pt modified WC powder showed higher electrochemical stability.

  13. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Cheng-Yao eChen

    2014-06-01

    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  14. Structure and mechanism of human DNA polymerase [eta

    Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)

    2010-11-03

    The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.

  15. Muscle activation in healthy subjects during single step up [Aktivace svalů u zdravých osob při nákroku na schod

    Jaroslav Opavský

    2010-03-01

    Full Text Available BACKGROUND: The single step up is an integral movement performance for functional mobility and activities of daily living. During this activity the body has to be able to keep its balance and maintain a stable upright posture for performing voluntary movement. For this purpose the central nervous system creates different motor programs specific to the task. A motor programme is believed to contain the pre-programmed sequence of muscle activity prior to the initiation of the task, and includes both the muscle activity for the task, as well as postural muscle activity. OBJECTIVE: The aim of this paper was to examine the sequence of muscular activation, and to determine the timing of the involvement of selected trunk and leg muscles whilst stepping up. The further aim was to find out the most common muscle patterns in this model of motor activity in healthy subjects. METHODS: The bilateral electromyographic (EMG signal from the gluteus maximus, biceps femoris and erectores spinae muscles were recorded using surface electromyography. The visual record of the step up performance was registered simultaneously with surface electromyography. The tested group consisted of 16 healthy (5 men with an average age of 23.6, 11 women with an average age of 23.2. They were monitored during the motor task – the step up task, that is which was performed by the dominant leg. The subject stood facing the step (height of the step = 20 cm. Upon request he/she stepped up with the right leg at a spontaneous speed. The motor task was completed by bringing the left leg up onto the step. RESULTS: During this task, we registered the activation of the right erector spinae muscle, right biceps femoris muscle, left erector spinae muscle and left biceps femoris muscle before the beginning of the visually recognizable movement. The most frequently registered pattern of activation on the side that carried out the step was: right biceps femoris muscle → right erector spinae

  16. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  17. RNA Polymerase II–The Transcription Machine

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

  18. RNA polymerase II collision interrupts convergent transcription

    Hobson, David J; Wei, Wu; Steinmetz, Lars M

    2012-01-01

    Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

  19. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  20. Crowding-induced transcriptional bursts dictate polymerase and nucleosome density profiles along genes

    van den Berg, A.A.; Depken, S.M.

    2017-01-01

    During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a

  1. Biomechanical influences on balance recovery by stepping.

    Hsiao, E T; Robinovitch, S N

    1999-10-01

    Stepping represents a common means for balance recovery after a perturbation to upright posture. Yet little is known regarding the biomechanical factors which determine whether a step succeeds in preventing a fall. In the present study, we developed a simple pendulum-spring model of balance recovery by stepping, and used this to assess how step length and step contact time influence the effort (leg contact force) and feasibility of balance recovery by stepping. We then compared model predictions of step characteristics which minimize leg contact force to experimentally observed values over a range of perturbation strengths. At all perturbation levels, experimentally observed step execution times were higher than optimal, and step lengths were smaller than optimal. However, the predicted increase in leg contact force associated with these deviations was substantial only for large perturbations. Furthermore, increases in the strength of the perturbation caused subjects to take larger, quicker steps, which reduced their predicted leg contact force. We interpret these data to reflect young subjects' desire to minimize recovery effort, subject to neuromuscular constraints on step execution time and step length. Finally, our model predicts that successful balance recovery by stepping is governed by a coupling between step length, step execution time, and leg strength, so that the feasibility of balance recovery decreases unless declines in one capacity are offset by enhancements in the others. This suggests that one's risk for falls may be affected more by small but diffuse neuromuscular impairments than by larger impairment in a single motor capacity.

  2. Internship guide : Work placements step by step

    Haag, Esther

    2013-01-01

    Internship Guide: Work Placements Step by Step has been written from the practical perspective of a placement coordinator. This book addresses the following questions : what problems do students encounter when they start thinking about the jobs their degree programme prepares them for? How do you

  3. The way to collisions, step by step

    2009-01-01

    While the LHC sectors cool down and reach the cryogenic operating temperature, spirits are warming up as we all eagerly await the first collisions. No reason to hurry, though. Making particles collide involves the complex manoeuvring of thousands of delicate components. The experts will make it happen using a step-by-step approach.

  4. Hepatitis B virus DNA quantification with the three-in-one (3io) method allows accurate single-step differentiation of total HBV DNA and cccDNA in biopsy-size liver samples.

    Taranta, Andrzej; Tien Sy, Bui; Zacher, Behrend Johan; Rogalska-Taranta, Magdalena; Manns, Michael Peter; Bock, Claus Thomas; Wursthorn, Karsten

    2014-08-01

    Hepatitis B virus (HBV) replicates via reverse transcription converting its partially double stranded genome into the covalently closed circular DNA (cccDNA). The long-lasting cccDNA serves as a replication intermediate in the nuclei of hepatocytes. It is an excellent, though evasive, parameter for monitoring the course of liver disease and treatment efficiency. To develop and test a new approach for HBV DNA quantification in serum and small-size liver samples. The p3io plasmid contains an HBV fragment and human β-actin gene (hACTB) as a standard. Respective TaqMan probes were labeled with different fluorescent dyes. A triplex real-time PCR for simultaneous quantification of total HBV DNA, cccDNA and hACTB could be established. Three-in-one method allows simultaneous analysis of 3 targets with a lower limit of quantification of 48 copies per 20 μl PCR reaction and a wide range of linearity (R(2)>0.99, pDNA samples from HBV infected patients. Total HBV DNA and cccDNA could be quantified in 32 and 22 of 33 FFPE preserved liver specimens, respectively. Total HBV DNA concentrations quantified by the 3io method remained comparable with Cobas TaqMan HBV Test v2.0. The three-in-one protocol allows the single step quantification of viral DNA in samples from different sources. Therefore lower sample input, faster data acquisition, a lowered error and significantly lower costs are the advantages of the method. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Technical note: Avoiding the direct inversion of the numerator relationship matrix for genotyped animals in single-step genomic best linear unbiased prediction solved with the preconditioned conjugate gradient.

    Masuda, Y; Misztal, I; Legarra, A; Tsuruta, S; Lourenco, D A L; Fragomeni, B O; Aguilar, I

    2017-01-01

    This paper evaluates an efficient implementation to multiply the inverse of a numerator relationship matrix for genotyped animals () by a vector (). The computation is required for solving mixed model equations in single-step genomic BLUP (ssGBLUP) with the preconditioned conjugate gradient (PCG). The inverse can be decomposed into sparse matrices that are blocks of the sparse inverse of a numerator relationship matrix () including genotyped animals and their ancestors. The elements of were rapidly calculated with the Henderson's rule and stored as sparse matrices in memory. Implementation of was by a series of sparse matrix-vector multiplications. Diagonal elements of , which were required as preconditioners in PCG, were approximated with a Monte Carlo method using 1,000 samples. The efficient implementation of was compared with explicit inversion of with 3 data sets including about 15,000, 81,000, and 570,000 genotyped animals selected from populations with 213,000, 8.2 million, and 10.7 million pedigree animals, respectively. The explicit inversion required 1.8 GB, 49 GB, and 2,415 GB (estimated) of memory, respectively, and 42 s, 56 min, and 13.5 d (estimated), respectively, for the computations. The efficient implementation required <1 MB, 2.9 GB, and 2.3 GB of memory, respectively, and <1 sec, 3 min, and 5 min, respectively, for setting up. Only <1 sec was required for the multiplication in each PCG iteration for any data sets. When the equations in ssGBLUP are solved with the PCG algorithm, is no longer a limiting factor in the computations.

  6. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    Cline, J; Braman, J C; Hogrefe, H H

    1996-09-15

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

  7. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  8. Functional roles of DNA polymerases β and γ

    Huebscher, U.; Kuenzle, C.C.; Spadari, S.

    1979-01-01

    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  9. DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

    Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

    2014-01-01

    The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

  10. Microsoft Office professional 2010 step by step

    Cox, Joyce; Frye, Curtis

    2011-01-01

    Teach yourself exactly what you need to know about using Office Professional 2010-one step at a time! With STEP BY STEP, you build and practice new skills hands-on, at your own pace. Covering Microsoft Word, PowerPoint, Outlook, Excel, Access, Publisher, and OneNote, this book will help you learn the core features and capabilities needed to: Create attractive documents, publications, and spreadsheetsManage your e-mail, calendar, meetings, and communicationsPut your business data to workDevelop and deliver great presentationsOrganize your ideas and notes in one placeConnect, share, and accom

  11. Chromosomal location of the human gene for DNA polymerase β

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

    1987-01-01

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  12. Linking pedestrian flow characteristics with stepping locomotion

    Wang, Jiayue; Boltes, Maik; Seyfried, Armin; Zhang, Jun; Ziemer, Verena; Weng, Wenguo

    2018-06-01

    While properties of human traffic flow are described by speed, density and flow, the locomotion of pedestrian is based on steps. To relate characteristics of human locomotor system with properties of human traffic flow, this paper aims to connect gait characteristics like step length, step frequency, swaying amplitude and synchronization with speed and density and thus to build a ground for advanced pedestrian models. For this aim, observational and experimental study on the single-file movement of pedestrians at different densities is conducted. Methods to measure step length, step frequency, swaying amplitude and step synchronization are proposed by means of trajectories of the head. Mathematical models for the relations of step length or frequency and speed are evaluated. The problem how step length and step duration are influenced by factors like body height and density is investigated. It is shown that the effect of body height on step length and step duration changes with density. Furthermore, two different types of step in-phase synchronization between two successive pedestrians are observed and the influence of step synchronization on step length is examined.

  13. Molecular diagnosis of eosinophilic meningitis due to Angiostrongylus cantonensis (Nematoda: Metastrongyloidea by polymerase chain reaction-DNA sequencing of cerebrospinal fluids of patients

    Praphathip Eamsobhana

    2013-02-01

    Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.

  14. Mammalian RNA polymerase II core promoters: insights from genome-wide studies

    Sandelin, Albin; Carninci, Piero; Lenhard, Boris

    2007-01-01

    The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

  15. The essential DNA polymerases δ and ε are involved in repair of UV-damaged DNA in the yeast Saccharomyces cerevisiae

    Halas, A.; Policinska, Z.; Baranowska, H.; Jachymczyk, W.J.

    1999-01-01

    We have studied the ability of yeast DNA polymerases to carry out repair of lesions caused by UV irradiation in Saccharomyces cerevisiae. By the analysis of postirradiation relative molecular mass changes in cellular DNA of different DNA polymerases mutant strains, it was established that mutations in DNA polymerases δ and ε showed accumulation of single-strand breaks indicating defective repair. Mutations in other DNA polymerase genes exhibited no defects in DNA repair. Thus, the data obtained suggest that DNA polymerases δ and ε are both necessary for DNA replication and for repair of lesions caused by UV irradiation. The results are discussed in the light of current concepts concerning the specificity of DNA polymerases in DNA repair. (author)

  16. The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli

    Tang, M.-S.; Patrick, M.H.

    1977-01-01

    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)

  17. Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli

    Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)

    1977-09-01

    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.

  18. Higher cytoplasmic and nuclear poly(ADP-ribose) polymerase expression in familial than in sporadic breast cancer

    Klauke, M.L.; Hoogerbrugge-van der Linden, N.; Budczies, J.; Bult, P.; Prinzler, J.; Radke, C.; van Krieken, J.H.; Dietel, M.; Denkert, C.; Muller, B.M.

    2012-01-01

    Poly(ADP-ribose) polymerase 1 (PARP) is a key element of the single-base excision pathway for repair of DNA single-strand breaks. To compare the cytoplasmic and nuclear poly(ADP-ribose) expression between familial (BRCA1, BRCA2, or non BRCA1/2) and sporadic breast cancer, we investigated 39 sporadic

  19. Biochemical and genetic analysis of the role of the viral polymerase in enterovirus recombination.

    Woodman, Andrew; Arnold, Jamie J; Cameron, Craig E; Evans, David J

    2016-08-19

    Genetic recombination in single-strand, positive-sense RNA viruses is a poorly understand mechanism responsible for generating extensive genetic change and novel phenotypes. By moving a critical cis-acting replication element (CRE) from the polyprotein coding region to the 3' non-coding region we have further developed a cell-based assay (the 3'CRE-REP assay) to yield recombinants throughout the non-structural coding region of poliovirus from dually transfected cells. We have additionally developed a defined biochemical assay in which the only protein present is the poliovirus RNA dependent RNA polymerase (RdRp), which recapitulates the strand transfer events of the recombination process. We have used both assays to investigate the role of the polymerase fidelity and nucleotide turnover rates in recombination. Our results, of both poliovirus intertypic and intratypic recombination in the CRE-REP assay and using a range of polymerase variants in the biochemical assay, demonstrate that RdRp fidelity is a fundamental determinant of recombination frequency. High fidelity polymerases exhibit reduced recombination and low fidelity polymerases exhibit increased recombination in both assays. These studies provide the basis for the analysis of poliovirus recombination throughout the non-structural region of the virus genome and provide a defined biochemical assay to further dissect this important evolutionary process. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

    Yu, Chuanhe; Gan, Haiyun

    2017-01-01

    ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

  1. Mitochondrial DNA polymerase from embryos of Drosophila melanogaster: purification, subunit structure, and partial characterization

    Wernette, C.M.; Kaguni, L.S.

    1986-01-01

    The mitochondrial DNA polymerase has been purified to near-homogeneity from early embryos of Drosophila melanogaster. Sodium dodecyl sulfate gel electrophoresis of the highly purified enzyme reveals two polypeptides with molecular masses of 125,000 and 35,000 daltons, in a ratio of 1:1. The enzyme has a sedimentation coefficient of 7.6 S and a stokes radius of 51 A. Taken together, the data suggest that the D. melanogaster DNA polymerase γ is a heterodimer. DNA polymerase activity gel analysis has allowed the assignment of the DNA polymerization function to the large subunit. The DNA polymerase exhibits a remarkable ability to utilize efficiently a variety of template-primers including gapped DNA, poly(rA).oligo(dT) and singly primed phiX174 DNA. Both the crude and the highly purified enzymes are stimulated by KCl, and inhibited by dideoxythymidine triphosphate and by N-ethylmaleimide. Thus, the catalytic properties of the near-homogeneous Drosophila enzyme are consistent with those of DNA polymerase γ as partially purified from several vertebrates

  2. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Preliminary results in single-step wound closure procedure of full-thickness facial burns in children by using the collagen-elastin matrix and review of pediatric facial burns.

    Demircan, Mehmet; Cicek, Tugrul; Yetis, Muhammed Ikbal

    2015-09-01

    Management of full-thickness facial burns remains one of the greatest challenges. Controversy exists among surgeons regarding the use of early excision for facial burns. Unfortunately, delayed excision of deeper burns often results in more scarring and subsequent reconstruction becomes more difficult. A collagen-elastin matrix is used to improve the quality of the reconstructed skin, to reduce scarring and to prevent wound contraction. It serves as a foundation for split thickness skin graft and enhances short and long-term results. We report the usage of a collagen-elastin matrix during single-step wound closure technique of severe full-thickness facial burns in 15 children with large burned body surface area, and also we review the literature about pediatric facial burns. There were 15 pediatric patients with severe facial burns, 8 girls and 7 boys ranging in age from 10 months to 12 years, mean age 7 years and 6 months old. The facial burn surface area (FBSA) among the patients includes seven patients with 100%, five with 75%, and three with 50%. The average total body surface area (TBSA) for the patients was 72%, ranging between 50 and 90%. 5 of the patients' admissions were late, more than four days after burns while the rest of the patients were admitted within the first four days (acute admission time). The burns were caused by flame in eight of the patients, bomb blast in four, and scalding in three. All patients were treated by the simultaneous application of the collagen-elastin matrix and an unmeshed split thickness skin graft at Turgut Özal Medical Center, Pediatric Burn Center, Malatya, Turkey. After the treatment only two patients needed a second operation for revision of the grafts. All grafts transplanted to the face survived. The average Vancouver scar scales (VSS) were 2.55±1.42, ranging between one and six, in the first 10 of 15 patients at the end of 6 months postoperatively. VSS measurements of the last 5 patients were not taken since the 6

  4. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  5. Step by Step Microsoft Office Visio 2003

    Lemke, Judy

    2004-01-01

    Experience learning made easy-and quickly teach yourself how to use Visio 2003, the Microsoft Office business and technical diagramming program. With STEP BY STEP, you can take just the lessons you need, or work from cover to cover. Either way, you drive the instruction-building and practicing the skills you need, just when you need them! Produce computer network diagrams, organization charts, floor plans, and moreUse templates to create new diagrams and drawings quicklyAdd text, color, and 1-D and 2-D shapesInsert graphics and pictures, such as company logosConnect shapes to create a basic f

  6. Free Modal Algebras Revisited: The Step-by-Step Method

    Bezhanishvili, N.; Ghilardi, Silvio; Jibladze, Mamuka

    2012-01-01

    We review the step-by-step method of constructing finitely generated free modal algebras. First we discuss the global step-by-step method, which works well for rank one modal logics. Next we refine the global step-by-step method to obtain the local step-by-step method, which is applicable beyond

  7. Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus.

    De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M

    1999-08-06

    Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.

  8. Diabetes PSA (:30) Step By Step

    2009-10-24

    First steps to preventing diabetes. For Hispanic and Latino American audiences.  Created: 10/24/2009 by National Diabetes Education Program (NDEP), a joint program of the Centers for Disease Control and Prevention and the National Institutes of Health.   Date Released: 10/24/2009.

  9. Diabetes PSA (:60) Step By Step

    2009-10-24

    First steps to preventing diabetes. For Hispanic and Latino American audiences.  Created: 10/24/2009 by National Diabetes Education Program (NDEP), a joint program of the Centers for Disease Control and Prevention and the National Institutes of Health.   Date Released: 10/24/2009.

  10. Bordetella pertussis diagnosed by polymerase chain reaction

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

  11. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai

    2010-01-01

    Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

  12. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    Jessica A. Brown

    2010-01-01

    Full Text Available Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη, a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average than the ground-state binding step (18-fold on average. Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.

  13. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun

    2016-04-01

    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

  14. Evaluating the Effectiveness of an Antimicrobial Stewardship Program on Reducing the Incidence Rate of Healthcare-Associated Clostridium difficile Infection: A Non-Randomized, Stepped Wedge, Single-Site, Observational Study.

    DiDiodato, Giulio; McArthur, Leslie

    2016-01-01

    The incidence rate of healthcare-associated Clostridium difficile infection (HA-CDI) is estimated at 1 in 100 patients. Antibiotic exposure is the most consistently reported risk factor for HA-CDI. Strategies to reduce the risk of HA-CDI have focused on reducing antibiotic utilization. Prospective audit and feedback is a commonly used antimicrobial stewardship intervention (ASi). The impact of this ASi on risk of HA-CDI is equivocal. This study examines the effectiveness of a prospective audit and feedback ASi on reducing the risk of HA-CDI. Single-site, 339 bed community-hospital in Barrie, Ontario, Canada. Primary outcome is HA-CDI incidence rate. Daily prospective and audit ASi is the exposure variable. ASi implemented across 6 wards in a non-randomized, stepped wedge design. Criteria for ASi; any intravenous antibiotic use for ≥ 48 hrs, any oral fluoroquinolone or oral second generation cephalosporin use for ≥ 48 hrs, or any antimicrobial use for ≥ 5 days. HA-CDI cases and model covariates were aggregated by ward, year and month starting September 2008 and ending February 2016. Multi-level mixed effect negative binomial regression analysis was used to model the primary outcome, with intercept and slope coefficients for ward-level random effects estimated. Other covariates tested for inclusion in the final model were derived from previously published risk factors. Deviance residuals were used to assess the model's goodness-of-fit. The dataset included 486 observation periods, of which 350 were control periods and 136 were intervention periods. After accounting for all other model covariates, the estimated overall ASi incidence rate ratio (IRR) was 0.48 (95% 0.30, 0.79). The ASi effect was independent of antimicrobial utilization. The ASi did not seem to reduce the risk of Clostridium difficile infection on the surgery wards (IRR 0.87, 95% CI 0.45, 1.69) compared to the medicine wards (IRR 0.42, 95% CI 0.28, 0.63). The ward-level burden of Clostridium

  15. Evaluating the Effectiveness of an Antimicrobial Stewardship Program on Reducing the Incidence Rate of Healthcare-Associated Clostridium difficile Infection: A Non-Randomized, Stepped Wedge, Single-Site, Observational Study.

    Giulio DiDiodato

    Full Text Available The incidence rate of healthcare-associated Clostridium difficile infection (HA-CDI is estimated at 1 in 100 patients. Antibiotic exposure is the most consistently reported risk factor for HA-CDI. Strategies to reduce the risk of HA-CDI have focused on reducing antibiotic utilization. Prospective audit and feedback is a commonly used antimicrobial stewardship intervention (ASi. The impact of this ASi on risk of HA-CDI is equivocal. This study examines the effectiveness of a prospective audit and feedback ASi on reducing the risk of HA-CDI.Single-site, 339 bed community-hospital in Barrie, Ontario, Canada. Primary outcome is HA-CDI incidence rate. Daily prospective and audit ASi is the exposure variable. ASi implemented across 6 wards in a non-randomized, stepped wedge design. Criteria for ASi; any intravenous antibiotic use for ≥ 48 hrs, any oral fluoroquinolone or oral second generation cephalosporin use for ≥ 48 hrs, or any antimicrobial use for ≥ 5 days. HA-CDI cases and model covariates were aggregated by ward, year and month starting September 2008 and ending February 2016. Multi-level mixed effect negative binomial regression analysis was used to model the primary outcome, with intercept and slope coefficients for ward-level random effects estimated. Other covariates tested for inclusion in the final model were derived from previously published risk factors. Deviance residuals were used to assess the model's goodness-of-fit.The dataset included 486 observation periods, of which 350 were control periods and 136 were intervention periods. After accounting for all other model covariates, the estimated overall ASi incidence rate ratio (IRR was 0.48 (95% 0.30, 0.79. The ASi effect was independent of antimicrobial utilization. The ASi did not seem to reduce the risk of Clostridium difficile infection on the surgery wards (IRR 0.87, 95% CI 0.45, 1.69 compared to the medicine wards (IRR 0.42, 95% CI 0.28, 0.63. The ward-level burden of

  16. RNA polymerase activity of Ustilago maydis virus

    Yie, S.W.

    1986-01-01

    Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

  17. Replicative DNA polymerase mutations in cancer☆

    Heitzer, Ellen; Tomlinson, Ian

    2014-01-01

    Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

  18. Replicative DNA polymerase mutations in cancer.

    Heitzer, Ellen; Tomlinson, Ian

    2014-02-01

    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Interaction of sigma factor sigmaN with Escherichia coli RNA polymerase core enzyme.

    Scott, D J; Ferguson, A L; Gallegos, M T; Pitt, M; Buck, M; Hoggett, J G

    2000-12-01

    The equilibrium binding and kinetics of assembly of the DNA-dependent RNA polymerase (RNAP) sigma(N)-holoenzyme has been investigated using biosynthetically labelled 7-azatryptophyl- (7AW)sigma(N). The spectroscopic properties of such 7AW proteins allows their absorbance and fluorescence to be monitored selectively, even in the presence of high concentrations of other tryptophan-containing proteins. The 7AWsigma(N) retained its biological activity in stimulating transcription from sigma(N)-specific promoters, and in in vitro gel electrophoresis assays of binding to core RNAP from Escherichia coli. Furthermore, five Trp-->Ala single mutants of sigma(N) were shown to support growth under conditions of nitrogen limitation, and showed comparable efficiency in activating the sigma(N)-dependent nifH promoter in vivo, indicating that none of the tryptophan residues were essential for activity. The equilibrium binding of 7AWsigma(N) to core RNAP was examined by analytical ultracentrifugation. In sedimentation equilibrium experiments, absorbance data at 315 nm (which reports selectively on the distribution of free and bound 7AWsigma(N)) established that a 1:1 complex was formed, with a dissociation constant lower than 2 microM. The kinetics of the interaction between 7AWsigma(N) and core RNAP was investigated using stopped-flow spectrofluorimetry. A biphasic decrease in fluorescence intensity was observed when samples were excited at 280 nm, whereas only the slower of the two phases was observed at 315 nm. The kinetic data were analysed in terms of a mechanism in which a fast bimolecular association of sigma(N) with core RNAP is followed by a relatively slow isomerization step. The consequences of these findings on the competition between sigma(N) and the major sigma factor, sigma(70), in Escherichia coli are discussed.

  20. Microsoft Office Word 2007 step by step

    Cox, Joyce

    2007-01-01

    Experience learning made easy-and quickly teach yourself how to create impressive documents with Word 2007. With Step By Step, you set the pace-building and practicing the skills you need, just when you need them!Apply styles and themes to your document for a polished lookAdd graphics and text effects-and see a live previewOrganize information with new SmartArt diagrams and chartsInsert references, footnotes, indexes, a table of contentsSend documents for review and manage revisionsTurn your ideas into blogs, Web pages, and moreYour all-in-one learning experience includes:Files for building sk

  1. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  2. Multispot single-molecule FRET: High-throughput analysis of freely diffusing molecules.

    Antonino Ingargiola

    Full Text Available We describe an 8-spot confocal setup for high-throughput smFRET assays and illustrate its performance with two characteristic experiments. First, measurements on a series of freely diffusing doubly-labeled dsDNA samples allow us to demonstrate that data acquired in multiple spots in parallel can be properly corrected and result in measured sample characteristics consistent with those obtained with a standard single-spot setup. We then take advantage of the higher throughput provided by parallel acquisition to address an outstanding question about the kinetics of the initial steps of bacterial RNA transcription. Our real-time kinetic analysis of promoter escape by bacterial RNA polymerase confirms results obtained by a more indirect route, shedding additional light on the initial steps of transcription. Finally, we discuss the advantages of our multispot setup, while pointing potential limitations of the current single laser excitation design, as well as analysis challenges and their solutions.

  3. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

    2018-03-27

    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  4. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  5. Pathogen detection by the polymerase chain reaction

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  6. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  7. Molecular typing for blood group antigens within 40 min by direct polymerase chain reaction from plasma or serum.

    Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea

    2017-03-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.

  8. RNA binding and replication by the poliovirus RNA polymerase

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

  9. Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production

    Slaine, Patrick D.; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M.; Hatchette, Todd

    2018-01-01

    Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation. PMID:29783694

  10. Novel Polymerase Gene Mutations for Human Adaptation in Clinical Isolates of Avian H5N1 Influenza Viruses.

    Yasuha Arai

    2016-04-01

    Full Text Available A major determinant in the change of the avian influenza virus host range to humans is the E627K substitution in the PB2 polymerase protein. However, the polymerase activity of avian influenza viruses with a single PB2-E627K mutation is still lower than that of seasonal human influenza viruses, implying that avian viruses require polymerase mutations in addition to PB2-627K for human adaptation. Here, we used a database search of H5N1 clade 2.2.1 virus sequences with the PB2-627K mutation to identify other polymerase adaptation mutations that have been selected in infected patients. Several of the mutations identified acted cooperatively with PB2-627K to increase viral growth in human airway epithelial cells and mouse lungs. These mutations were in multiple domains of the polymerase complex other than the PB2-627 domain, highlighting a complicated avian-to-human adaptation pathway of avian influenza viruses. Thus, H5N1 viruses could rapidly acquire multiple polymerase mutations that function cooperatively with PB2-627K in infected patients for optimal human adaptation.

  11. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Optimizing Taq polymerase concentration for improved signal-to-noise in the broad range detection of low abundance bacteria.

    Rudolph Spangler

    Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.

  13. Focal cryotherapy: step by step technique description

    Cristina Redondo

    Full Text Available ABSTRACT Introduction and objective: Focal cryotherapy emerged as an efficient option to treat favorable and localized prostate cancer (PCa. The purpose of this video is to describe the procedure step by step. Materials and methods: We present the case of a 68 year-old man with localized PCa in the anterior aspect of the prostate. Results: The procedure is performed under general anesthesia, with the patient in lithotomy position. Briefly, the equipment utilized includes the cryotherapy console coupled with an ultrasound system, argon and helium gas bottles, cryoprobes, temperature probes and an urethral warming catheter. The procedure starts with a real-time trans-rectal prostate ultrasound, which is used to outline the prostate, the urethra and the rectal wall. The cryoprobes are pretested and placed in to the prostate through the perineum, following a grid template, along with the temperature sensors under ultrasound guidance. A cystoscopy confirms the right positioning of the needles and the urethral warming catheter is installed. Thereafter, the freeze sequence with argon gas is started, achieving extremely low temperatures (-40°C to induce tumor cell lysis. Sequentially, the thawing cycle is performed using helium gas. This process is repeated one time. Results among several series showed a biochemical disease-free survival between 71-93% at 9-70 month- follow-up, incontinence rates between 0-3.6% and erectile dysfunction between 0-42% (1–5. Conclusions: Focal cryotherapy is a feasible procedure to treat anterior PCa that may offer minimal morbidity, allowing good cancer control and better functional outcomes when compared to whole-gland treatment.

  14. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

    2017-02-07

    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  15. Involvement of DNA polymerase beta in repair of ionizing radiation damage as measured by in vitro plasmid assays.

    Vens, C.; Hofland, I.; Begg, A.C.

    2007-01-01

    Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta

  16. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  17. A Double Polymerase Chain Reaction Method for Detecting African ...

    Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

  18. Polymerase chain reaction for the detection of Mycobacterium leprae

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  19. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  20. Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae

    Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)

    2013-02-08

    Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.

  1. CDK9-dependent RNA polymerase II pausing controls transcription initiation.

    Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

    2017-10-10

    Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

  2. Step-by-step cyclic processes scheduling

    Bocewicz, G.; Nielsen, Izabela Ewa; Banaszak, Z.

    2013-01-01

    Automated Guided Vehicles (AGVs) fleet scheduling is one of the big problems in Flexible Manufacturing System (FMS) control. The problem is more complicated when concurrent multi-product manufacturing and resource deadlock avoidance policies are considered. The objective of the research is to pro......Automated Guided Vehicles (AGVs) fleet scheduling is one of the big problems in Flexible Manufacturing System (FMS) control. The problem is more complicated when concurrent multi-product manufacturing and resource deadlock avoidance policies are considered. The objective of the research...... is to provide a declarative model enabling to state a constraint satisfaction problem aimed at AGVs fleet scheduling subject to assumed itineraries of concurrently manufactured product types. In other words, assuming a given layout of FMS’s material handling and production routes of simultaneously manufactured...... orders, the main objective is to provide the declarative framework aimed at conditions allowing one to calculate the AGVs fleet schedule in online mode. An illustrative example of the relevant algebra-like driven step-by-stem cyclic scheduling is provided....

  3. Archaeal RNA polymerase arrests transcription at DNA lesions.

    Gehring, Alexandra M; Santangelo, Thomas J

    2017-01-01

    Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

  4. RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications

    Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong

    2016-01-01

    Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

  5. Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

    Plotch, S.J.; Palant, O.; Gluzman, Y.

    1989-01-01

    A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer, RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, [α- 32 P]UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro

  6. DNA damage mediated transcription arrest: Step back to go forward.

    Mullenders, Leon

    2015-12-01

    The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. High-Resolution Phenotypic Landscape of the RNA Polymerase II Trigger Loop.

    Chenxi Qiu

    2016-11-01

    Full Text Available The active sites of multisubunit RNA polymerases have a "trigger loop" (TL that multitasks in substrate selection, catalysis, and translocation. To dissect the Saccharomyces cerevisiae RNA polymerase II TL at individual-residue resolution, we quantitatively phenotyped nearly all TL single variants en masse. Three mutant classes, revealed by phenotypes linked to transcription defects or various stresses, have distinct distributions among TL residues. We find that mutations disrupting an intra-TL hydrophobic pocket, proposed to provide a mechanism for substrate-triggered TL folding through destabilization of a catalytically inactive TL state, confer phenotypes consistent with pocket disruption and increased catalysis. Furthermore, allele-specific genetic interactions among TL and TL-proximal domain residues support the contribution of the funnel and bridge helices (BH to TL dynamics. Our structural genetics approach incorporates structural and phenotypic data for high-resolution dissection of transcription mechanisms and their evolution, and is readily applicable to other essential yeast proteins.

  8. [Health of children and adolescents in single-parent, step-, and nuclear families: results of the KiGGS study: first follow-up (KiGGS Wave 1)].

    Rattay, P; von der Lippe, E; Lampert, T

    2014-07-01

    On the basis of data from KiGGS Wave 1, the following manuscript investigates potential differences in the health status of children and adolescents aged 3-17 years according to the family form they live in: nuclear, single-parent, or stepfamily (n = 10,298). Additionally, we investigate whether differences persist after controlling for age, gender, living area, parental social status, and getting along in the family. Parent-rated health, chronic diseases, emotional or behavior problems, health-related quality of life, and daily consumption of fruits and vegetables were analyzed (prevalence, odds ratios). While the parent-rated health was independent of the family form, the prevalence of the other outcomes differed significantly according to the family form. Emotional or behavior problems were measured more often among children and adolescents growing up in single-parent families (OR 1.62; 95% CI 1.17-2.26) or stepfamily households (OR 2.36; 95% CI 1.63-3.41) than among those growing up in nuclear families, after adjusting for age, gender, living area, social status, and getting along in the family. Additionally, children and adolescents from single-parent families had chronic diseases (OR 1.53; 95% CI 1.20-1.96) more often than their counterparts who lived together with both parents. Compared with those growing up in nuclear families, children and adolescents from stepfamilies showed a greater risk of lower health-related quality of life (OR 2.91; 95% CI 1.76-4.80) and of lower daily consumption of fruits and vegetables (OR 1.30; 95% CI 1.01-1.67). The results indicate the importance of the family context for the health of children and adolescents.

  9. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  10. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  11. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  12. Sintering uranium oxide using a preheating step

    Jensen, N.J.; Nivas, Y.; Packard, D.R.

    1977-01-01

    Compacted pellets of uranium oxide or uranium oxide with one or more additives are heated in a kiln in a process having a preheating step, a sintering step, a reduction step, and a cooling step in a controlled atmosphere. The process is practiced to give a range of temperature and atmosphere conditions for obtaining optimum fluoride removal from the compacted pellets along with optimum sintering in a single process. The preheating step of this process is conducted in a temperature range of about 600 0 to about 900 0 C and the pellets are held for at least twenty min, and preferably about 60 min, in an atmosphere having a composition in the range of about 10 to about 75 vol % hydrogen with the balance being carbon dioxide. The sintering step is conducted at a temperature in the range of about 900 0 C to 1500 0 C in the presence of an atmosphere having a composition in the range of about 0.5 to about 90 vol % hydrogen with the balance being carbon dioxide. The reduction step reduces the oxygen to metal ratio of the pellets to a range of about 1.98 to 2.10:1 and this is accomplished by gradually cooling the pellets for about 30 to about 120 min from the temperature of the sintering step to about 1100 0 C in an atmosphere of about 10 to 90 vol % hydrogen with the balance being carbon dioxide. Thereafter the pellets are cooled to about 100 0 C under a protective atmosphere, and in one preferred practice the same atmosphere used in the reduction step is used in the cooling step. The preheating, sintering and reduction steps may also be conducted with their respective atmospheres having an initial additional component of water vapor and the water vapor can comprise up to about 20 vol %

  13. One-step in-diffusion as a result of multipulse laser irradiation of LiNbO3 single-crystalline substrates covered with thin Ti deposits on the effect of the radiation wavelength

    Ferrari, A.; Schirone, L.; Maiello, G.

    1994-05-01

    We studied Ti in-diffusion as an effect of multiple laser irradiation, in either visible of ultraviolet (u.v.) spectral ranges, of LiNbO 3 single-crystalline structures with Ti coatings of two different thickness. It is shown that while u.v. (excimer, λ approx. 308 nm) laser irradiation causes a complete expulsion of the Ti deposit, the visible (ruby, λ approx. 694.3 nm) laser irradiation at intermediate incident laser fluence (up to approx. 0.7J cm -2 ) promotes efficient Ti in-diffusion from the thin (400 A width) Ti deposit down to a micrometre range implantation depth. (author). 7 refs, 6 figs

  14. Dynamics of termination during in vitro replication of ultraviolet-irradiated DNA with DNA polymerase III holoenzyme of Escherichia coli

    Shwartz, H.; Livneh, Z.

    1987-01-01

    During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini

  15. Comparison of step-by-step kinematics of resisted, assisted and unloaded 20-m sprint runs.

    van den Tillaar, Roland; Gamble, Paul

    2018-03-26

    This investigation examined step-by-step kinematics of sprint running acceleration. Using a randomised counterbalanced approach, 37 female team handball players (age 17.8 ± 1.6 years, body mass 69.6 ± 9.1 kg, height 1.74 ± 0.06 m) performed resisted, assisted and unloaded 20-m sprints within a single session. 20-m sprint times and step velocity, as well as step length, step frequency, contact and flight times of each step were evaluated for each condition with a laser gun and an infrared mat. Almost all measured parameters were altered for each step under the resisted and assisted sprint conditions (η 2  ≥ 0.28). The exception was step frequency, which did not differ between assisted and normal sprints. Contact time, flight time and step frequency at almost each step were different between 'fast' vs. 'slow' sub-groups (η 2  ≥ 0.22). Nevertheless overall both groups responded similarly to the respective sprint conditions. No significant differences in step length were observed between groups for the respective condition. It is possible that continued exposure to assisted sprinting might allow the female team-sports players studied to adapt their coordination to the 'over-speed' condition and increase step frequency. It is notable that step-by-step kinematics in these sprints were easy to obtain using relatively inexpensive equipment with possibilities of direct feedback.

  16. Translesion DNA polymerases Pol ζ, Pol η, Pol ι, Pol κ and Rev1 are ...

    MADU

    Specialized DNA polymerases called translesion polymerases are among the major determinants of spontaneous and DNA damage-induced mutation in both prokaryotes and eukaryotes. (Livneh 2001). The classical replicative DNA polymerases can synthesize DNA with remarkable efficiency and fidelity.

  17. The structure of stepped surfaces

    Algra, A.J.

    1981-01-01

    The state-of-the-art of Low Energy Ion Scattering (LEIS) as far as multiple scattering effects are concerned, is discussed. The ion fractions of lithium, sodium and potassium scattered from a copper (100) surface have been measured as a function of several experimental parameters. The ratio of the intensities of the single and double scattering peaks observed in ion scattering spectroscopy has been determined and ion scattering spectroscopy applied in the multiple scattering mode is used to determine the structure of a stepped Cu(410) surface. The average relaxation of the (100) terraces of this surface appears to be very small. The adsorption of oxygen on this surface has been studied with LEIS and it is indicated that oxygen absorbs dissociatively. (C.F.)

  18. Electric-current-induced step bunching on Si(111)

    Homma, Yoshikazu; Aizawa, Noriyuki

    2000-01-01

    We experimentally investigated step bunching induced by direct current on vicinal Si(111)'1x1' surfaces using scanning electron microscopy and atomic force microscopy. The scaling relation between the average step spacing l b and the number of steps N in a bunch, l b ∼N -α , was determined for four step-bunching temperature regimes above the 7x7-'1x1' transition temperature. The step-bunching rate and scaling exponent differ between neighboring step-bunching regimes. The exponent α is 0.7 for the two regimes where the step-down current induces step bunching (860-960 and 1210-1300 deg. C), and 0.6 for the two regimes where the step-up current induces step bunching (1060-1190 and >1320 deg. C). The number of single steps on terraces also differs in each of the four temperature regimes. For temperatures higher than 1280 deg. C, the prefactor of the scaling relation increases, indicating an increase in step-step repulsion. The scaling exponents obtained agree reasonably well with those predicted by theoretical models. However, they give unrealistic values for the effective charges of adatoms for step-up-current-induced step bunching when the 'transparent' step model is used

  19. Linear step drive

    Haniger, L.; Elger, R.; Kocandrle, L.; Zdebor, J.

    1986-01-01

    A linear step drive is described developed in Czechoslovak-Soviet cooperation and intended for driving WWER-1000 control rods. The functional principle is explained of the motor and the mechanical and electrical parts of the drive, power control, and the indicator of position are described. The motor has latches situated in the reactor at a distance of 3 m from magnetic armatures, it has a low structural height above the reactor cover, which suggests its suitability for seismic localities. Its magnetic circuits use counterpoles; the mechanical shocks at the completion of each step are damped using special design features. The position indicator is of a special design and evaluates motor position within ±1% of total travel. A drive diagram and the flow chart of both the control electronics and the position indicator are presented. (author) 4 figs

  20. Computational Abstraction Steps

    Thomsen, Lone Leth; Thomsen, Bent; Nørmark, Kurt

    2010-01-01

    and class instantiations. Our teaching experience shows that many novice programmers find it difficult to write programs with abstractions that materialise to concrete objects later in the development process. The contribution of this paper is the idea of initiating a programming process by creating...... or capturing concrete values, objects, or actions. As the next step, some of these are lifted to a higher level by computational means. In the object-oriented paradigm the target of such steps is classes. We hypothesise that the proposed approach primarily will be beneficial to novice programmers or during...... the exploratory phase of a program development process. In some specific niches it is also expected that our approach will benefit professional programmers....