WorldWideScience

Sample records for single restriction enzyme

  1. Full HPV typing by a single restriction enzyme.

    Science.gov (United States)

    Santiago, Enrique; Camacho, Lucía; Junquera, Maria Luisa; Vázquez, Fernando

    2006-09-01

    Restriction fragment length polymorphism (RFLP) methods for genotyping genital human papillomavirus (HPV) are considered labor consuming and constrained by the reduced set of restriction enzymes capable of detecting specific mutations. However, we think that these methods have not taken full advantage of the high diversity of the known restriction enzymes. We have set out to find the best restriction enzyme for HPV typing. An extensive search for enzymes was carried out by combining statistical methods and database information. The search maximized the discrimination between high- and low-risk types by examining the sequence of the L1 gene flanked by primers MY09/11. Different electrophoretic resolutions and two variations of the RFLP method were considered. HpyCH4V is the best enzyme for discriminating between risk types. Moreover, HpyCH4V generates different patterns for virtually all the HPV types. The typical pattern consists of two or three fragments, which facilitates typing in mixed infections. The typing of a set of clinical samples confirmed the expectations. This result illustrates the possibilities of statistical methods to exploit the high diversity of restriction enzymes in order to classify samples in a pre-established hierarchy of types for which DNA sequences are known.

  2. A new multiplexing single molecule technique for measuring restriction enzyme activity

    Science.gov (United States)

    Harbottle, Allison; Cavanaugh, Jillian; Gordon, Wendy; Loparo, Joseph; Price, Allen

    2012-02-01

    We present a new multiplexing single molecule method for observing the cleavage of DNAs by restriction enzymes. DNAs are attached to a surface at one end using a biotin-streptavidin link and to a micro bead at the other end via a digoxigenin-antidigoxigenin link. The DNAs are stretched by applying a flow. After introduction of the restriction enzyme, the exact time of cleavage of individual DNAs is recorded with video microscopy. We can image hundreds to thousands of DNAs in a single experiment. We are using our technique to search for the signature of facilitated diffusion in the measured rate dependence on ionic strength.

  3. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  4. Biocatalytic Single Enzyme Nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Grate, Jay W.; Kim, Jungbae

    2004-03-31

    As an innovative way of enzyme stabilization, we recently developed a new enzyme composite of nano-meter scale that we call "single-enzyme nanoparticles (SENs)" (9). Each enzyme molecule is surrounded with a porous composite organic/inorganic network of less than a few nanometers think. This approach represents a new type of enzyme-containing nanostructure. In experiments with perotease (chymotrypsin, CT), the activity of single enzyme nanoparticle form of the enzyme was greatly stabilized compared to the free form, without imposing a serious mass transfer limitation of substrates. In this chapter we will describe the synthesis, characterization and catalytic activity of the new SENs.

  5. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-05-19

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  6. Restriction enzyme-mediated DNA family shuffling.

    Science.gov (United States)

    Behrendorff, James B Y H; Johnston, Wayne A; Gillam, Elizabeth M J

    2014-01-01

    DNA shuffling is an established recombinatorial method that was originally developed to increase the speed of directed evolution experiments beyond what could be accomplished using error-prone PCR alone. To achieve this, mutated copies of a protein-coding sequence are fragmented with DNase I and the fragments are then reassembled in a PCR without primers. The fragments anneal where there is sufficient sequence identity, resulting in full-length variants of the original gene that have inherited mutations from multiple templates. Subsequent studies demonstrated that directed evolution could be further accelerated by shuffling similar native protein-coding sequences from the same gene family, rather than mutated variants of a single gene. Generally at least 65-75 % global identity between parental sequences is required in DNA family shuffling, with recombination mostly occurring at sites with at least five consecutive nucleotides of local identity. Since DNA shuffling was originally developed, many variations on the method have been published. In particular, the use of restriction enzymes in the fragmentation step allows for greater customization of fragment lengths than DNase I digestion and avoids the risk that parental sequences may be over-digested into unusable very small fragments. Restriction enzyme-mediated fragmentation also reduces the occurrence of undigested parental sequences that would otherwise reduce the number of unique variants in the resulting library. In the current chapter, we provide a brief overview of the alternative methods currently available for DNA shuffling as well as a protocol presented here that improves on several previous implementations of restriction enzyme-mediated DNA family shuffling, in particular with regard to purification of DNA fragments for reassembly.

  7. Biomolecular computers with multiple restriction enzymes

    Directory of Open Access Journals (Sweden)

    Sebastian Sakowski

    2017-10-01

    Full Text Available Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

  8. Biomolecular computers with multiple restriction enzymes

    Science.gov (United States)

    Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

    2017-01-01

    Abstract The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann “bottleneck”. Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro’s group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases. PMID:29064510

  9. Biomolecular computers with multiple restriction enzymes.

    Science.gov (United States)

    Sakowski, Sebastian; Krasinski, Tadeusz; Waldmajer, Jacek; Sarnik, Joanna; Blasiak, Janusz; Poplawski, Tomasz

    2017-01-01

    The development of conventional, silicon-based computers has several limitations, including some related to the Heisenberg uncertainty principle and the von Neumann "bottleneck". Biomolecular computers based on DNA and proteins are largely free of these disadvantages and, along with quantum computers, are reasonable alternatives to their conventional counterparts in some applications. The idea of a DNA computer proposed by Ehud Shapiro's group at the Weizmann Institute of Science was developed using one restriction enzyme as hardware and DNA fragments (the transition molecules) as software and input/output signals. This computer represented a two-state two-symbol finite automaton that was subsequently extended by using two restriction enzymes. In this paper, we propose the idea of a multistate biomolecular computer with multiple commercially available restriction enzymes as hardware. Additionally, an algorithmic method for the construction of transition molecules in the DNA computer based on the use of multiple restriction enzymes is presented. We use this method to construct multistate, biomolecular, nondeterministic finite automata with four commercially available restriction enzymes as hardware. We also describe an experimental applicaton of this theoretical model to a biomolecular finite automaton made of four endonucleases.

  10. Use of Plasmon Coupling to Reveal the Dynamics of DNA Bending andCleavage by Single EcoRV Restriction Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Reinhard, Bjorn; Sheikholeslami, Sassan; Mastroianni, Alexander; Alivisatos, A. Paul; Liphardt, Jan

    2006-09-06

    Pairs of Au nanoparticles have recently been proposed asplasmon rulers based on the dependence of their light scattering on theinterparticle distance. Preliminary work has suggested that plasmonrulers can be used to measure and monitor dynamic distance changes overthe 1 to 100nm length scale in biology. Here, we substantiate thatplasmon rulers can be used to effectively measure dynamical biophysicalprocesses by applying the ruler to a system that has been investigatedextensively using ensemble kinetic measurements: the cleavage of DNA bythe restriction enzyme EcoRV. Temporal resolutions of up to 240 Hz wereobtained, and the end-to-end extension of up to 1000 individual dsDNAenzyme substrates could be monitored in parallel for hours. The singlemolecule cleavage trajectories acquired here agree well with valuesobtained in bulk through other methods, and confirm well-known featuresof the cleavage process, such as the fact that the DNA is bent prior tocleavage. New dynamical information is revealed as well, for instance,the degree of softening of the DNA just prior to cleavage. The unlimitedlife time, high temporal resolution, and high signal/noise make theplasmon ruler an excellent tool for studying macromolecular assembliesand conformational changes at the single molecule level.

  11. Type I restriction enzymes and their relatives.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G

    2014-01-01

    Type I restriction enzymes (REases) are large pentameric proteins with separate restriction (R), methylation (M) and DNA sequence-recognition (S) subunits. They were the first REases to be discovered and purified, but unlike the enormously useful Type II REases, they have yet to find a place in the enzymatic toolbox of molecular biologists. Type I enzymes have been difficult to characterize, but this is changing as genome analysis reveals their genes, and methylome analysis reveals their recognition sequences. Several Type I REases have been studied in detail and what has been learned about them invites greater attention. In this article, we discuss aspects of the biochemistry, biology and regulation of Type I REases, and of the mechanisms that bacteriophages and plasmids have evolved to evade them. Type I REases have a remarkable ability to change sequence specificity by domain shuffling and rearrangements. We summarize the classic experiments and observations that led to this discovery, and we discuss how this ability depends on the modular organizations of the enzymes and of their S subunits. Finally, we describe examples of Type II restriction-modification systems that have features in common with Type I enzymes, with emphasis on the varied Type IIG enzymes.

  12. SNP-RFLPing: restriction enzyme mining for SNPs in genomes

    Directory of Open Access Journals (Sweden)

    Cheng Yu-Huei

    2006-02-01

    Full Text Available Abstract Background The restriction fragment length polymorphism (RFLP is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs. Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Results Three user-friendly inputs are included: 1 NCBI dbSNP "rs" or "ss" IDs; 2 NCBI Entrez gene ID and HUGO gene name; 3 any formats of SNP-in-sequence, are allowed to perform the SNP-RFLPing assay. These inputs are auto-programmed to SNP-containing sequences and their complementary sequences for the selection of restriction enzymes. All SNPs with available RFLP restriction enzymes of each input genes are provided even if many SNPs exist. The SNP-RFLPing analysis provides the SNP contig position, heterozygosity, function, protein residue, and amino acid position for cSNPs, as well as commercial and non-commercial restriction enzymes. Conclusion This web-based software solves the input format problems in similar softwares and greatly simplifies the procedure for providing the RFLP enzyme. Mixed free forms of input data are friendly to users who perform the SNP-RFLPing assay. SNP-RFLPing offers a time-saving application for association studies in personalized medicine and is freely available at http://bio.kuas.edu.tw/snp-rflp/.

  13. SNP-RFLPing: restriction enzyme mining for SNPs in genomes.

    Science.gov (United States)

    Chang, Hsueh-Wei; Yang, Cheng-Hong; Chang, Phei-Lang; Cheng, Yu-Huei; Chuang, Li-Yeh

    2006-02-17

    The restriction fragment length polymorphism (RFLP) is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs). Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Three user-friendly inputs are included: 1) NCBI dbSNP "rs" or "ss" IDs; 2) NCBI Entrez gene ID and HUGO gene name; 3) any formats of SNP-in-sequence, are allowed to perform the SNP-RFLPing assay. These inputs are auto-programmed to SNP-containing sequences and their complementary sequences for the selection of restriction enzymes. All SNPs with available RFLP restriction enzymes of each input genes are provided even if many SNPs exist. The SNP-RFLPing analysis provides the SNP contig position, heterozygosity, function, protein residue, and amino acid position for cSNPs, as well as commercial and non-commercial restriction enzymes. This web-based software solves the input format problems in similar softwares and greatly simplifies the procedure for providing the RFLP enzyme. Mixed free forms of input data are friendly to users who perform the SNP-RFLPing assay. SNP-RFLPing offers a time-saving application for association studies in personalized medicine and is freely available at http://bio.kuas.edu.tw/snp-rflp/.

  14. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  15. Restriction Enzymes in Microbiology, Biotechnology and Biochemistry

    Directory of Open Access Journals (Sweden)

    Geoffrey G. Wilson

    2012-12-01

    Full Text Available Since their discovery in the nineteen-seventies, a collection of simple enzymes termed Type II restriction endonucleases, made by microbes to ward off viral infections, have transformed molecular biology, spawned the multi-billion dollar Biotechnology industry, and yielded fundamental insights into the biochemistry of life, health and disease. In this article we describe how these enzymes were discovered, and we review their properties, organizations and genetics. We summarize current ideas about the mechanism underlying their remarkable ability to recognize and bind to specific base pair sequences in DNA, and we discuss why these ideas might not be correct. We conclude by proposing an alternative explanation for sequence-recognition that resolves certain inconsistencies and provides, in our view, a more satisfactory account of the mechanism.

  16. Mechanistic insights into type III restriction enzymes.

    Science.gov (United States)

    Raghavendra, Nidhanapati K; Bheemanaik, Shivakumara; Rao, Desirazu N

    2012-01-01

    Type III restriction-modification (R-M) enzymes need to interact with two separate unmethylated DNA sequences in indirectly repeated, head-to-head orientations for efficient cleavage to occur at a defined location next to only one of the two sites. However, cleavage of sites that are not in head-to-head orientation have been observed to occur under certain reaction conditions in vitro. ATP hydrolysis is required for the long-distance communication between the sites prior to cleavage. Type III R-M enzymes comprise two subunits, Res and Mod that form a homodimeric Mod2 and a heterotetrameric Res2Mod2 complex. The Mod subunit in M2 or R2M2 complex recognizes and methylates DNA while the Res subunit in R2M2 complex is responsible for ATP hydrolysis, DNA translocation and cleavage. A vast majority of biochemical studies on Type III R-M enzymes have been undertaken using two closely related enzymes, EcoP1I and EcoP15I. Divergent opinions about how the long-distance interaction between the recognition sites exist and at least three mechanistic models based on 1D- diffusion and/or 3D- DNA looping have been proposed.

  17. SNP-RFLPing: restriction enzyme mining for SNPs in genomes

    OpenAIRE

    Chang, Hsueh-Wei; Yang, Cheng-Hong; Chang, Phei-Lang; Cheng, Yu-Huei; Chuang, Li-Yeh

    2006-01-01

    Abstract Background The restriction fragment length polymorphism (RFLP) is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs). Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Results Three user-friendly inputs are included: 1) NCBI dbSNP "rs" or "ss" IDs; 2) NCBI Entrez gene ID and HUGO gene name; 3) any formats of SNP-in-se...

  18. Single-nucleotide polymorphisms may cause erroneous results in primer-introduced restriction enzyme analyses: a case of molecular misdiagnosis of homozygous vs heterozygous familial hypercholesterolemia.

    Science.gov (United States)

    Vuorio, A F; Paulin, L; Saltevo, J; Kontula, K

    1999-12-01

    PCR amplification followed by a primer introduced restriction analysis PCR (PIRA-PCR) is a widely used method to detect point mutations. Usually the artificial RFLP is created by siting one nucleotide mismatch near the 3; end of the primer. This does not alter the hybrization of the primer to the target DNA sequence. Unfortunately, unexpected single nucleotide polymorphisms (SNPs) may lead to additional mismatches and result in no amplification of the allele having unexpected SNP. We describe a warning example in which heterozygous familial hypercholesterolemia patient had an unexpected SNP and this led to his misdiagnosis. Copyright 1999 Academic Press.

  19. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  20. A User-Friendly Method for Teaching Restriction Enzyme Mapping.

    Science.gov (United States)

    Ehrman, Patrick

    1990-01-01

    Presented is a teaching progression that enhances learning through low-cost, manipulative transparencies. Discussed is instruction about restriction enzymes, plasmids, cutting plasmids, plasmid maps, recording data, and mapping restriction sites. Mapping wheels for student use is included. (CW)

  1. How restriction enzymes became the workhorses of molecular biology.

    Science.gov (United States)

    Roberts, Richard J

    2005-04-26

    Restriction enzymes have proved to be invaluable for the physical mapping of DNA. They offer unparalleled opportunities for diagnosing DNA sequence content and are used in fields as disparate as criminal forensics and basic research. In fact, without restriction enzymes, the biotechnology industry would certainly not have flourished as it has. The first experiments demonstrating the utility of restriction enzymes were carried out by Danna and Nathans and reported in 1971. This pioneering study set the stage for the modern practice of molecular biology in which restriction enzymes are ubiquitous tools, although they are often taken for granted.

  2. REtools: A laboratory program for restriction enzyme work: enzyme selection and reaction condition assistance

    OpenAIRE

    Boulukos Kim E; Martin Patrick; Pognonec Philippe

    2006-01-01

    Abstract Background Restriction enzymes are one of the everyday tools used in molecular biology. The continuously expanding panel of known restriction enzymes (several thousands) renders their optimal use virtually impossible without computerized assistance. Several manufacturers propose on-line sites that assist scientists in their restriction enzyme work, however, none of these sites meet all the actual needs of laboratory workers, and they do not take into account the enzymes actually pres...

  3. Distribution, abundance and properties of restriction enzymes On ...

    African Journals Online (AJOL)

    Distribution, abundance and properties of restriction enzymes On genomic dna of granule-bound starch synthase i and ii in Cassava ( Manihot Esculenta ... Ife Journal of Science ... Thirty-one sites of 16 restriction enzymes were evenly distributed on 721 base-pair granule-bound starch synthase I (GBSS I) genomic DNA.

  4. Type I restriction endonucleases are true catalytic enzymes.

    Science.gov (United States)

    Bianco, Piero R; Xu, Cuiling; Chi, Min

    2009-06-01

    Type I restriction endonucleases are intriguing, multifunctional complexes that restrict DNA randomly, at sites distant from the target sequence. Restriction at distant sites is facilitated by ATP hydrolysis-dependent, translocation of double-stranded DNA towards the stationary enzyme bound at the recognition sequence. Following restriction, the enzymes are thought to remain associated with the DNA at the target site, hydrolyzing copious amounts of ATP. As a result, for the past 35 years type I restriction endonucleases could only be loosely classified as enzymes since they functioned stoichiometrically relative to DNA. To further understand enzyme mechanism, a detailed analysis of DNA cleavage by the EcoR124I holoenzyme was done. We demonstrate for the first time that type I restriction endonucleases are not stoichiometric but are instead catalytic with respect to DNA. Further, the mechanism involves formation of a dimer of holoenzymes, with each monomer bound to a target sequence and, following cleavage, each dissociates in an intact form to bind and restrict subsequent DNA molecules. Therefore, type I restriction endonucleases, like their type II counterparts, are true enzymes. The conclusion that type I restriction enzymes are catalytic relative to DNA has important implications for the in vivo function of these previously enigmatic enzymes.

  5. The other face of restriction: modification-dependent enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Raleigh, Elisabeth A

    2014-01-01

    The 1952 observation of host-induced non-hereditary variation in bacteriophages by Salvador Luria and Mary Human led to the discovery in the 1960s of modifying enzymes that glucosylate hydroxymethylcytosine in T-even phages and of genes encoding corresponding host activities that restrict non-glucosylated phage DNA: rglA and rglB (restricts glucoseless phage). In the 1980's, appreciation of the biological scope of these activities was dramatically expanded with the demonstration that plant and animal DNA was also sensitive to restriction in cloning experiments. The rgl genes were renamed mcrA and mcrBC (modified cytosine restriction). The new class of modification-dependent restriction enzymes was named Type IV, as distinct from the familiar modification-blocked Types I-III. A third Escherichia coli enzyme, mrr (modified DNA rejection and restriction) recognizes both methylcytosine and methyladenine. In recent years, the universe of modification-dependent enzymes has expanded greatly. Technical advances allow use of Type IV enzymes to study epigenetic mechanisms in mammals and plants. Type IV enzymes recognize modified DNA with low sequence selectivity and have emerged many times independently during evolution. Here, we review biochemical and structural data on these proteins, the resurgent interest in Type IV enzymes as tools for epigenetic research and the evolutionary pressures on these systems.

  6. Restriction enzyme fingerprinting of enterobacterial plasmids: a simple strategy with wide application.

    OpenAIRE

    Platt, D. J.; Chesham, J. S.; Brown, D. J.; Kraft, C. A.; Taggart, J.

    1986-01-01

    Restriction enzyme fingerprints were generated from purified plasmid DNA from 324 clinical isolates that belonged to 7 enterobacterial genera and 88 single plasmids in Escherichia coli K 12 according to the following strategy. Purified plasmid DNA was digested with PstI. The number of fragments detected in a 0.8 agarose gel was used to determine which 2 of 6 restriction enzymes including PstI was most likely to provide a fingerprint comprising sufficient fragments to ensure specificity but su...

  7. REtools: a laboratory program for restriction enzyme work: enzyme selection and reaction condition assistance.

    Science.gov (United States)

    Martin, Patrick; Boulukos, Kim E; Pognonec, Philippe

    2006-02-28

    Restriction enzymes are one of the everyday tools used in molecular biology. The continuously expanding panel of known restriction enzymes (several thousands) renders their optimal use virtually impossible without computerized assistance. Several manufacturers propose on-line sites that assist scientists in their restriction enzyme work, however, none of these sites meet all the actual needs of laboratory workers, and they do not take into account the enzymes actually present in one's own laboratory. Using FileMaker Pro, we developed a stand-alone application which can run on both PCs and Macintoshes. We called it REtools, for Restriction Enzyme tools. This program, which references all currently known enzymes (>3500), permits the creation and update of a personalized list of restriction enzymes actually available in one's own laboratory. Upon opening the program, scientists will be presented with a user friendly interface that will direct them to different menus, each one corresponding to different situations that restriction enzyme users commonly encounter. We particularly emphasized the ease of use to make REtools a solution that laboratory members would actually want to use. REtools, a user friendly and easily customized program to organize any laboratory enzyme stock, brings a software solution that will make restriction enzyme use and reaction condition determination straightforward and efficient. The usually unexplored potential of isoschizomers also becomes accessible to all, since REtools proposes all possible enzymes similar to the one(s) chosen by the user. Finally, many of the commonly overlooked subtleties of restriction enzyme work, such as methylation requirement, unusual reaction conditions, or the number of flanking bases required for cleavage, are automatically provided by REtools.

  8. REtools: A laboratory program for restriction enzyme work: enzyme selection and reaction condition assistance

    Directory of Open Access Journals (Sweden)

    Boulukos Kim E

    2006-02-01

    Full Text Available Abstract Background Restriction enzymes are one of the everyday tools used in molecular biology. The continuously expanding panel of known restriction enzymes (several thousands renders their optimal use virtually impossible without computerized assistance. Several manufacturers propose on-line sites that assist scientists in their restriction enzyme work, however, none of these sites meet all the actual needs of laboratory workers, and they do not take into account the enzymes actually present in one's own laboratory. Results Using FileMaker Pro, we developed a stand-alone application which can run on both PCs and Macintoshes. We called it REtools, for Restriction Enzyme tools. This program, which references all currently known enzymes (>3500, permits the creation and update of a personalized list of restriction enzymes actually available in one's own laboratory. Upon opening the program, scientists will be presented with a user friendly interface that will direct them to different menus, each one corresponding to different situations that restriction enzyme users commonly encounter. We particularly emphasized the ease of use to make REtools a solution that laboratory members would actually want to use. Conclusion REtools, a user friendly and easily customized program to organize any laboratory enzyme stock, brings a software solution that will make restriction enzyme use and reaction condition determination straightforward and efficient. The usually unexplored potential of isoschizomers also becomes accessible to all, since REtools proposes all possible enzymes similar to the one(s chosen by the user. Finally, many of the commonly overlooked subtleties of restriction enzyme work, such as methylation requirement, unusual reaction conditions, or the number of flanking bases required for cleavage, are automatically provided by REtools.

  9. Revised selection criteria for candidate restriction enzymes in genome walking.

    Science.gov (United States)

    Taheri, Ali; Robinson, Stephen J; Parkin, Isobel; Gruber, Margaret Y

    2012-01-01

    A new method to improve the efficiency of flanking sequence identification by genome walking was developed based on an expanded, sequential list of criteria for selecting candidate enzymes, plus several other optimization steps. These criteria include: step (1) initially choosing the most appropriate restriction enzyme according to the average fragment size produced by each enzyme determined using in silico digestion of genomic DNA, step (2) evaluating the in silico frequency of fragment size distribution between individual chromosomes, step (3) selecting those enzymes that generate fragments with the majority between 100 bp and 3,000 bp, step (4) weighing the advantages and disadvantages of blunt-end sites vs. cohesive-end sites, step (5) elimination of methylation sensitive enzymes with methylation-insensitive isoschizomers, and step (6) elimination of enzymes with recognition sites within the binary vector sequence (T-DNA and plasmid backbone). Step (7) includes the selection of a second restriction enzyme with highest number of recognition sites within regions not covered by the first restriction enzyme. Step (8) considers primer and adapter sequence optimization, selecting the best adapter-primer pairs according to their hairpin/dimers and secondary structure. In step (9), the efficiency of genomic library development was improved by column-filtration of digested DNA to remove restriction enzyme and phosphatase enzyme, and most important, to remove small genomic fragments (enzymes, NsiI and NdeI, fit these criteria for the Arabidopsis thaliana genome. Their efficiency was assessed using 54 T(3) lines from an Arabidopsis SK enhancer population. Over 70% success rate was achieved in amplifying the flanking sequences of these lines. This strategy was also tested with Brachypodium distachyon to demonstrate its applicability to other larger genomes.

  10. Determination of restriction enzyme activity when cutting DNA labeled with the TOTO dye family.

    Science.gov (United States)

    Maschmann, April; Kounovsky-Shafer, Kristy L

    2017-06-03

    Optical mapping, a single DNA molecule genome analysis platform that can determine methylation profiles, uses fluorescently labeled DNA molecules that are elongated on the surface and digested with a restriction enzyme to produce a barcode of that molecule. Understanding how the cyanine fluorochromes affect enzyme activity can lead to other fluorochromes used in the optical mapping system. The effects of restriction digestion on fluorochrome labeled DNA (Ethidium Bromide, DAPI, H33258, EthD-1, TOTO-1) have been analyzed previously. However, TOTO-1 is a part of a family of cyanine fluorochromes (YOYO-1, TOTO-1, BOBO-1, POPO-1, YOYO-3, TOTO-3, BOBO-3, and POPO-3) and the rest of the fluorochromes have not been examined in terms of their effects on restriction digestion. In order to determine if the other dyes in the TOTO-1 family inhibit restriction enzymes in the same way as TOTO-1, lambda DNA was stained with a dye from the TOTO family and digested. The restriction enzyme activity in regards to each dye, as well as each restriction enzyme, was compared to determine the extent of digestion. YOYO-1, TOTO-1, and POPO-1 fluorochromes inhibited ScaI-HF, PmlI, and EcoRI restriction enzymes. Additionally, the mobility of labeled DNA fragments in an agarose gel changed depending on which dye was intercalated.

  11. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  12. Restriction Enzyme Body Doubles and PCR Cloning: On the General Use of Type IIS Restriction Enzymes for Cloning

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease - a Body Double of the Type IIP enzyme - is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers. PMID:24618593

  13. Sequence specific inhibition of DNA restriction enzyme cleavage by PNA

    DEFF Research Database (Denmark)

    Nielsen, P.E.; Egholm, M.; Berg, R.H.

    1993-01-01

    Plasmids containing double-stranded 10-mer PNA (peptide nucleic acid chimera) targets proximally flanked by two restriction enzyme sites were challenged with the complementary PNA or PNAs having one or two mismatches, and the effect on the restriction enzyme cleavage of the flanking sites...... was assayed. The following PNAs were used: T10-LysNH2, T5CT4-LysNH2 and T2CT2CT4-LysNH2 and the corresponding targets cloned into pUC 19 were flanked by BamH1, Sal1 or Pstl sites, respectively. In all cases it was found that complete inhibition of restriction enzyme cleavage was obtained...

  14. Real-time observation of DNA looping dynamics of type IIE restriction enzymes NaeI and NarI

    NARCIS (Netherlands)

    van den Broek, B.; Vanzi, F.; Normanno, D.; Pavone, F. S.; Wuite, G.J.L.

    2006-01-01

    Many restriction enzymes require binding of two copies of a recognition sequence for DNA cleavage, thereby introducing a loop in the DNA. We investigated looping dynamics of Type IIE restriction enzymes NaeI and NarI by tracking the Brownian motion of single tethered DNA molecules. DNA containing

  15. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    Science.gov (United States)

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  16. REBASE--enzymes and genes for DNA restriction and modification.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2007-01-01

    REBASE is a comprehensive database of information about restriction enzymes, DNA methyltransferases and related proteins involved in the biological process of restriction-modification. It contains fully referenced information about recognition and cleavage sites, isoschizomers, neoschizomers, commercial availability, methylation sensitivity, crystal and sequence data. Experimentally characterized homing endonucleases are also included. All newly sequenced genomes are analyzed for the presence of putative restriction systems and these data are included within the REBASE. The contents or REBASE may be browsed from the web (http://rebase.neb.com/rebase/rebase.ftp.html) and selected compilations can be downloaded by ftp (ftp.neb.com). Additionally, monthly updates can be requested via email.

  17. Type III restriction-modification enzymes: a historical perspective.

    Science.gov (United States)

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  18. Cleavage of mispaired heteroduplex DNA substrates by numerous restriction enzymes.

    Science.gov (United States)

    Langhans, Mark T; Palladino, Michael J

    2009-01-01

    The utility of restriction endonucleases as a tool in molecular biology is in large part due to the high degree of specificity with which they cleave well-characterized DNA recognition sequences. The specificity of restriction endonucleases is not absolute, yet many commonly used assays of biological phenomena and contemporary molecular biology techniques rely on the premise that restriction enzymes will cleave only perfect cognate recognition sites. In vitro, mispaired heteroduplex DNAs are commonly formed, especially subsequent to polymerase chain reaction amplification. We investigated a panel of restriction endonucleases to determine their ability to cleave mispaired heteroduplex DNA substrates. Two straightforward, non-radioactive assays are used to evaluate mispaired heteroduplex DNA cleavage: a PCR amplification method and an oligonucleotide-based assay. These assays demonstrated that most restriction endonucleases are capable of site-specific double-strand cleavage with heteroduplex mispaired DNA substrates, however, certain mispaired substrates do effectively abrogate cleavage to undetectable levels. These data are consistent with mispaired substrate cleavage previously reported for Eco RI and, importantly, extend our knowledge of mispaired heteroduplex substrate cleavage to 13 additional enzymes.

  19. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assays...... exonuclease and phosphatase contaminating activities in some critical steps of the purification process of the restriction enzyme Kpn I....... results in a real cloning experience, we performed a cloning simulation assay using the same conditions established for the radioactive assay (enzyme units and pmols of DNA ends). As a result, we found that for degradation percentages of the radioactive DNA substrate per enzyme unit below 0.5, the false...

  20. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assays...... results in a real cloning experience, we performed a cloning simulation assay using the same conditions established for the radioactive assay (enzyme units and pmols of DNA ends). As a result, we found that for degradation percentages of the radioactive DNA substrate per enzyme unit below 0.5, the false...... positives in the cloning stimulation assay were less than 5%. This conditions could ensure a good performance of the enzyme preparations for cloning experiments. Finally, we described the use of the radiolabeled [gamma 33P] ATP lambda Hpa II DNA substrate to detect 5'-->3' single stranded DNA dependent...

  1. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Science.gov (United States)

    Lundin, Sverker; Jemt, Anders; Terje-Hegge, Finn; Foam, Napoleon; Pettersson, Erik; Käller, Max; Wirta, Valtteri; Lexow, Preben; Lundeberg, Joakim

    2015-01-01

    Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage) and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI). We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  2. Endonuclease specificity and sequence dependence of type IIS restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Sverker Lundin

    Full Text Available Restriction enzymes that recognize specific sequences but cleave unknown sequence outside the recognition site are extensively utilized tools in molecular biology. Despite this, systematic functional categorization of cleavage performance has largely been lacking. We established a simple and automatable model system to assay cleavage distance variation (termed slippage and the sequence dependence thereof. We coupled this to massively parallel sequencing in order to provide sensitive and accurate measurement. With this system 14 enzymes were assayed (AcuI, BbvI, BpmI, BpuEI, BseRI, BsgI, Eco57I, Eco57MI, EcoP15I, FauI, FokI, GsuI, MmeI and SmuI. We report significant variation of slippage ranging from 1-54%, variations in sequence context dependence, as well as variation between isoschizomers. We believe this largely overlooked property of enzymes with shifted cleavage would benefit from further large scale classification and engineering efforts seeking to improve performance. The gained insights of in-vitro performance may also aid the in-vivo understanding of these enzymes.

  3. UPDATING HIGH SCHOOL TEACHERS ON GEL ELETROPHORESIS AND RESTRICTION ENZYMES

    Directory of Open Access Journals (Sweden)

    V.S. Barbuto,

    2007-05-01

    Full Text Available The current evolution of the science and technology generated a demand in the teachers' formation that needs constant updating. In that sense, CBME has been elaborating courses and workshops to update teachers of Sciences and Biology involving current themes.  The activities on  Molecular  Biotechnology were elaborated, especially on restriction enzymes and gel electrophoresis.  Thirty-seven teachers of public schools participated in the activities. Firstly, it was made an experiment demonstrating the digestion of a plasmidial DNA by two restriction enzymes (DraI  and  EcoRI, with the subsequent application in gel, in order to elucidate the electrophoresis technique. After the demonstration, simple and practical exercises were distributed  to the teachers to simulate those processes using paper ribbons and charts,  being  concluded with an exercise of a paternity test. A questionnaire was applied as an evaluation tool and from the teachers' answers it was observed, among other data, that 100%  of the teachers classified the activities as interesting, 43% classified the thematic as actual, 22% defined it as appropriate to their school reality and 19% pointed it as a subject on which they have doubts. Also, it was observed that the teachers felt confident dealing with the most specific subjects, when relating it with the daily events and visualizing a possibility of didactic transposition of those themes.

  4. Polyphosphate present in DNA preparations from fungal species of Collectotrichum inhibits restriction endonucleases and other enzymes

    Science.gov (United States)

    Rodriguez, R.J.

    1993-01-01

    During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.

  5. Comprehensive evaluation of SNP identification with the Restriction Enzyme-based Reduced Representation Library (RRL method

    Directory of Open Access Journals (Sweden)

    Du Ye

    2012-02-01

    Full Text Available Abstract Background Restriction Enzyme-based Reduced Representation Library (RRL method represents a relatively feasible and flexible strategy used for Single Nucleotide Polymorphism (SNP identification in different species. It has remarkable advantage of reducing the complexity of the genome by orders of magnitude. However, comprehensive evaluation for actual efficacy of SNP identification by this method is still unavailable. Results In order to evaluate the efficacy of Restriction Enzyme-based RRL method, we selected Tsp 45I enzyme which covers 266 Mb flanking region of the enzyme recognition site according to in silico simulation on human reference genome, then we sequenced YH RRL after Tsp 45I treatment and obtained reads of which 80.8% were mapped to target region with an 20-fold average coverage, about 96.8% of target region was covered by at least one read and 257 K SNPs were identified in the region using SOAPsnp software. Compared with whole genome resequencing data, we observed false discovery rate (FDR of 13.95% and false negative rate (FNR of 25.90%. The concordance rate of homozygote loci was over 99.8%, but that of heterozygote were only 92.56%. Repeat sequences and bases quality were proved to have a great effect on the accuracy of SNP calling, SNPs in recognition sites contributed evidently to the high FNR and the low concordance rate of heterozygote. Our results indicated that repeat masking and high stringent filter criteria could significantly decrease both FDR and FNR. Conclusions This study demonstrates that Restriction Enzyme-based RRL method was effective for SNP identification. The results highlight the important role of bias and the method-derived defects represented in this method and emphasize the special attentions noteworthy.

  6. Restriction enzymes in the analysis of genetic alterations responsible for cancer progression.

    Science.gov (United States)

    Jenkins, G J S; Williams, G L; Beynon, J; Ye, Z; Baxter, J N; Parry, J M

    2002-01-01

    Molecular approaches are increasingly being employed to dissect the genetic changes accompanying tumour formation. These methods can often be confusing to the non-specialist as they include complex molecular steps. This can reduce the usefulness of such molecular data to clinicians. The authors aim to aid interpretation of molecular studies in general by presenting a comprehensive review of one molecular approach, i.e. the use of restriction enzymes in molecular studies of tumour development. A review was made of the molecular studies that have employed restriction enzymes in gastrointestinal cancer research. These studies have used restriction enzymes to analyse point mutation induction, gene methylation status and the deletion of chromosomal loci. In addition, emphasis is placed on some of the important considerations for the molecular analysis of tumours that can affect the molecular data obtained. Restriction enzyme digestion has played, and continues to play, a major role in analysing the genetic changes in cancer. Many adaptations of basic restriction enzyme methodologies have enhanced the application of this approach in cancer genetics. The availability of 200 different restriction enzymes, each recognizing different sequences in DNA, has been invaluable in studying cancer genetics. It is hoped that current advances in protein engineering will facilitate the creation of novel restriction enzymes with tailor-made sequence specificities. This will further improve the applicability of restriction enzymes in cancer genetics.

  7. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  8. The first discovery of RNA interference by RNA restriction enzymes to inhibit protein synthesis.

    Science.gov (United States)

    Inouye, Masayori

    2017-01-15

    In this article, I review how an RNA restriction enzyme, a highly sequence-specific endoribonuclease, was for the first time discovered in 2003 and how the concept of RNA interference using RNA restriction enzymes or mRNA interferases has been developed. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Translocation-coupled DNA cleavage by the Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Chand, Mahesh K; Nirwan, Neha; Diffin, Fiona M; van Aelst, Kara; Kulkarni, Manasi; Pernstich, Christian; Szczelkun, Mark D; Saikrishnan, Kayarat

    2015-11-01

    Production of endonucleolytic double-strand DNA breaks requires separate strand cleavage events. Although catalytic mechanisms for simple, dimeric endonucleases are known, there are many complex nuclease machines that are poorly understood. Here we studied the single polypeptide Type ISP restriction-modification (RM) enzymes, which cleave random DNA between distant target sites when two enzymes collide after convergent ATP-driven translocation. We report the 2.7-Å resolution X-ray crystal structure of a Type ISP enzyme-DNA complex, revealing that both the helicase-like ATPase and nuclease are located upstream of the direction of translocation, an observation inconsistent with simple nuclease-domain dimerization. Using single-molecule and biochemical techniques, we demonstrate that each ATPase remodels its DNA-protein complex and translocates along DNA without looping it, leading to a collision complex in which the nuclease domains are distal. Sequencing of the products of single cleavage events suggests a previously undescribed endonuclease model, where multiple, stochastic strand-nicking events combine to produce DNA scission.

  10. Partial digestion with restriction enzymes of ultraviolet-irradiated human genomic DNA: a method for identifying restriction site polymorphisms

    International Nuclear Information System (INIS)

    Nobile, C.; Romeo, G.

    1988-01-01

    A method for partial digestion of total human DNA with restriction enzymes has been developed on the basis of a principle already utilized by P.A. Whittaker and E. Southern for the analysis of phage lambda recombinants. Total human DNA irradiated with uv light of 254 nm is partially digested by restriction enzymes that recognize sequences containing adjacent thymidines because of TT dimer formation. The products resulting from partial digestion of specific genomic regions are detected in Southern blots by genomic-unique DNA probes with high reproducibility. This procedure is rapid and simple to perform because the same conditions of uv irradiation are used for different enzymes and probes. It is shown that restriction site polymorphisms occurring in the genomic regions analyzed are recognized by the allelic partial digest patterns they determine

  11. Optimising restriction enzyme cleavage of DNA derived from archival histopathological samples: an improved HUMARA assay.

    Science.gov (United States)

    Jovanovic, Lidija; Delahunt, Brett; McIver, Bryan; Eberhardt, Norman L; Grebe, Stefan K G

    2003-02-01

    Our aim was to evaluate and optimise methylation-sensitive restriction enzyme assays for use in formalin-fixed, paraffin-embedded tissue (FFPET) samples, in order to improve the application of the HUMARA X-chromosome inactivation assay to FFPET samples. We extracted DNA from normal male colon and thyroid FFPET. Several DNA clean-up procedures and restriction enzyme buffer compositions were tested for two methylation-sensitive enzymes, HhaI and HpaII and a non-methylation-sensitive isoschizomere, MspI. By including both a non-methylation-sensitive control enzyme and DNA from male archival specimens in our experiments, we were able to detect even subtle degrees of incomplete digestion. We showed that FFPET-derived DNA is a poor substrate for restriction enzymes, especially for methylation-sensitive restriction endonucleases. An optimised DNA clean-up protocol and restriction enzyme buffer-mix allowed us to achieve complete digestion. The combination of multiple, rigorous controls, DNA clean-up and restriction buffer optimisation increases the reliability of HUMARA-based X-chromosome inactivation analysis of FFPET samples. Analogous approaches are likely to allow optimisation of other restriction enzyme-based assays of FFPET samples.

  12. Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes.

    Science.gov (United States)

    Maschmann, April; Masters, Cody; Davison, Melissa; Lallman, Joshua; Thompson, Drew; Kounovsky-Shafer, Kristy L

    2018-02-02

    Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and sensitivity for DNA. In order to determine if the DNA molecules are full length after the completion of the experiment, a method is required to determine if the stained molecules are full length by digesting DNA with restriction enzymes. However, stained DNA may inhibit the enzymes, so a method is needed to determine what enzymes one could use for fluorochrome stained DNA. In this method, DNA is stained with a cyanine dye overnight to allow the dye and DNA to equilibrate. Next, stained DNA is digested with a restriction enzyme, loaded into a gel and electrophoresed. The experimental DNA digest bands are compared to an in silico digest to determine the restriction enzyme activity. If there is the same number of bands as expected, then the reaction is complete. More bands than expected indicate partial digestion and less bands indicate incomplete digestion. The advantage of this method is its simplicity and it uses equipment that a scientist would need for a restriction enzyme assay and gel electrophoresis. A limitation of this method is that the enzymes available to most scientists are commercially available enzymes; however, any restriction enzymes could be used.

  13. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes.

    Directory of Open Access Journals (Sweden)

    Carola Engler

    Full Text Available We have developed a protocol to assemble in one step and one tube at least nine separate DNA fragments together into an acceptor vector, with 90% of recombinant clones obtained containing the desired construct. This protocol is based on the use of type IIs restriction enzymes and is performed by simply subjecting a mix of 10 undigested input plasmids (nine insert plasmids and the acceptor vector to a restriction-ligation and transforming the resulting mix in competent cells. The efficiency of this protocol allows generating libraries of recombinant genes by combining in one reaction several fragment sets prepared from different parental templates. As an example, we have applied this strategy for shuffling of trypsinogen from three parental templates (bovine cationic trypsinogen, bovine anionic trypsinogen and human cationic trypsinogen each divided in 9 separate modules. We show that one round of shuffling using the 27 trypsinogen entry plasmids can easily produce the 19,683 different possible combinations in one single restriction-ligation and that expression screening of a subset of the library allows identification of variants that can lead to higher expression levels of trypsin activity. This protocol, that we call 'Golden Gate shuffling', is robust, simple and efficient, can be performed with templates that have no homology, and can be combined with other shuffling protocols in order to introduce any variation in any part of a given gene.

  14. Comparison of restriction enzymes for pulsed-field gel electrophoresis typing of Moraxella catarrhalis.

    Science.gov (United States)

    Marti, Sara; Puig, Carmen; Domenech, Arnau; Liñares, Josefina; Ardanuy, Carmen

    2013-07-01

    NotI, the most prevalent restriction enzyme used for typing Moraxella catarrhalis, failed to digest genomic DNA from respiratory samples. An improved pulsed-field gel electrophoresis (PFGE) methodology determined SpeI as the best choice for typing this bacterial species, with a good restriction of clinical samples and a good clustering correlation with NotI.

  15. msgbsR: An R package for analysing methylation-sensitive restriction enzyme sequencing data.

    Science.gov (United States)

    Mayne, Benjamin T; Leemaqz, Shalem Y; Buckberry, Sam; Rodriguez Lopez, Carlos M; Roberts, Claire T; Bianco-Miotto, Tina; Breen, James

    2018-02-01

    Genotyping-by-sequencing (GBS) or restriction-site associated DNA marker sequencing (RAD-seq) is a practical and cost-effective method for analysing large genomes from high diversity species. This method of sequencing, coupled with methylation-sensitive enzymes (often referred to as methylation-sensitive restriction enzyme sequencing or MRE-seq), is an effective tool to study DNA methylation in parts of the genome that are inaccessible in other sequencing techniques or are not annotated in microarray technologies. Current software tools do not fulfil all methylation-sensitive restriction sequencing assays for determining differences in DNA methylation between samples. To fill this computational need, we present msgbsR, an R package that contains tools for the analysis of methylation-sensitive restriction enzyme sequencing experiments. msgbsR can be used to identify and quantify read counts at methylated sites directly from alignment files (BAM files) and enables verification of restriction enzyme cut sites with the correct recognition sequence of the individual enzyme. In addition, msgbsR assesses DNA methylation based on read coverage, similar to RNA sequencing experiments, rather than methylation proportion and is a useful tool in analysing differential methylation on large populations. The package is fully documented and available freely online as a Bioconductor package ( https://bioconductor.org/packages/release/bioc/html/msgbsR.html ).

  16. Expression and purification of the modification-dependent restriction enzyme BisI and its homologous enzymes.

    Science.gov (United States)

    Xu, Shuang-Yong; Klein, Pernelle; Degtyarev, Sergey Kh; Roberts, Richard J

    2016-06-29

    The methylation-dependent restriction endonuclease (REase) BisI (G(m5)C ↓ NGC) is found in Bacillus subtilis T30. We expressed and purified the BisI endonuclease and 34 BisI homologs identified in bacterial genomes. 23 of these BisI homologs are active based on digestion of (m5)C-modified substrates. Two major specificities were found among these BisI family enzymes: Group I enzymes cut GCNGC containing two to four (m5)C in the two strands, or hemi-methylated sites containing two (m5)C in one strand; Group II enzymes only cut GCNGC sites containing three to four (m5)C, while one enzyme requires all four cytosines to be modified for cleavage. Another homolog, Esp638I cleaves GCS ↓ SGC (relaxed specificity RCN ↓ NGY, containing at least four (m5)C). Two BisI homologs show degenerate specificity cleaving unmodified DNA. Many homologs are small proteins ranging from 150 to 190 amino acid (aa) residues, but some homologs associated with mobile genetic elements are larger and contain an extra C-terminal domain. More than 156 BisI homologs are found in >60 bacterial genera, indicating that these enzymes are widespread in bacteria. They may play an important biological function in restricting pre-modified phage DNA.

  17. Structure and operation of the DNA-translocating type I DNA restriction enzymes

    Science.gov (United States)

    Kennaway, Christopher K.; Taylor, James E.; Song, Chun Feng; Potrzebowski, Wojciech; Nicholson, William; White, John H.; Swiderska, Anna; Obarska-Kosinska, Agnieszka; Callow, Philip; Cooper, Laurie P.; Roberts, Gareth A.; Artero, Jean-Baptiste; Bujnicki, Janusz M.; Trinick, John; Kneale, G. Geoff; Dryden, David T.F.

    2012-01-01

    Type I DNA restriction/modification (RM) enzymes are molecular machines found in the majority of bacterial species. Their early discovery paved the way for the development of genetic engineering. They control (restrict) the influx of foreign DNA via horizontal gene transfer into the bacterium while maintaining sequence-specific methylation (modification) of host DNA. The endonuclease reaction of these enzymes on unmethylated DNA is preceded by bidirectional translocation of thousands of base pairs of DNA toward the enzyme. We present the structures of two type I RM enzymes, EcoKI and EcoR124I, derived using electron microscopy (EM), small-angle scattering (neutron and X-ray), and detailed molecular modeling. DNA binding triggers a large contraction of the open form of the enzyme to a compact form. The path followed by DNA through the complexes is revealed by using a DNA mimic anti-restriction protein. The structures reveal an evolutionary link between type I RM enzymes and type II RM enzymes. PMID:22215814

  18. Structure and operation of the DNA-translocating type I DNA restriction enzymes.

    Science.gov (United States)

    Kennaway, Christopher K; Taylor, James E; Song, Chun Feng; Potrzebowski, Wojciech; Nicholson, William; White, John H; Swiderska, Anna; Obarska-Kosinska, Agnieszka; Callow, Philip; Cooper, Laurie P; Roberts, Gareth A; Artero, Jean-Baptiste; Bujnicki, Janusz M; Trinick, John; Kneale, G Geoff; Dryden, David T F

    2012-01-01

    Type I DNA restriction/modification (RM) enzymes are molecular machines found in the majority of bacterial species. Their early discovery paved the way for the development of genetic engineering. They control (restrict) the influx of foreign DNA via horizontal gene transfer into the bacterium while maintaining sequence-specific methylation (modification) of host DNA. The endonuclease reaction of these enzymes on unmethylated DNA is preceded by bidirectional translocation of thousands of base pairs of DNA toward the enzyme. We present the structures of two type I RM enzymes, EcoKI and EcoR124I, derived using electron microscopy (EM), small-angle scattering (neutron and X-ray), and detailed molecular modeling. DNA binding triggers a large contraction of the open form of the enzyme to a compact form. The path followed by DNA through the complexes is revealed by using a DNA mimic anti-restriction protein. The structures reveal an evolutionary link between type I RM enzymes and type II RM enzymes.

  19. Single cell enzyme diagnosis on the chip

    DEFF Research Database (Denmark)

    Jensen, Sissel Juul; Harmsen, Charlotte; Nielsen, Mette Juul

    2013-01-01

    Conventional diagnosis based on ensemble measurements often overlooks the variation among cells. Here, we present a droplet-microfluidics based platform to investigate single cell activities. Adopting a previously developed isothermal rolling circle amplification-based assay, we demonstrate detec...

  20. Highlights of the DNA cutters: a short history of the restriction enzymes.

    Science.gov (United States)

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2014-01-01

    In the early 1950's, 'host-controlled variation in bacterial viruses' was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltransferase activities of what are now termed Type I, II, III and IV DNA restriction-modification systems. The Type II restriction enzymes (e.g. EcoRI) gave rise to recombinant DNA technology that has transformed molecular biology and medicine. This review traces the discovery of restriction enzymes and their continuing impact on molecular biology and medicine.

  1. Manipulating single enzymes by an external harmonic force

    DEFF Research Database (Denmark)

    Lomholt, Michael A; Urbakh, Michael; Metzler, Ralf

    2007-01-01

    We study a Michaelis-Menten reaction for a single two-state enzyme molecule, whose transition rates between the two conformations are modulated by an harmonically oscillating external force. In particular, we obtain a range of optimal driving frequencies for changing the conformation of the enzyme...

  2. Fast conversion of scFv to Fab antibodies using type IIs restriction enzymes.

    Science.gov (United States)

    Sanmark, Hanna; Huovinen, Tuomas; Matikka, Tero; Pettersson, Tiina; Lahti, Maria; Lamminmäki, Urpo

    2015-11-01

    Single chain variable fragment (scFv) antibody libraries are widely used for developing novel bioaffinity reagents, although Fab or IgG molecules are the preferred antibody formats in many final applications. Therefore, rapid conversion methods for combining multiple DNA fragments are needed to attach constant domains to the scFv derived variable domains. In this study we describe a fast and easy cloning method for the conversion of single framework scFv fragments to Fab fragments using type IIS restriction enzymes. All cloning steps excluding plating of the Fab transformants can be done in 96 well plates and the procedure can be completed in one working day. The concept was tested by converting 69 scFv clones into Fab format on 96 well plates, which resulted in 93% success rate. The method is particularly useful as a high-throughput tool for the conversion of the chosen scFv clones into Fab molecules in order to analyze them as early as possible, as the conversion can significantly affect the binding properties of the chosen clones. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Site accessibility tailors DNA cleavage by restriction enzymes in DNA confined monolayers.

    Science.gov (United States)

    Rotella, Chiara; Doni, Giovanni; Bosco, Alessandro; Castronovo, Matteo; De Vita, Alessandro; Casalis, Loredana; Pavan, Giovanni M; Parisse, Pietro

    2017-05-18

    Density-tunable nanografted monolayers (NAMs) of short oligonucleotide sequences on gold surfaces show novel properties that make them suitable for advanced biosensing applications, and in particular to study the effects of crowding and confinement on biomolecular interactions. Here, combining atomic force microscopy nanolithography, topography measurements and coarse-grained molecular dynamics simulations, we investigated restriction enzyme reaction mechanisms within confined DNA brushes highlighting the role played by the DNA sequence conformation and restriction site position along the chain, respectively, in determining the accessibility of the enzyme, and its consequent cleavage efficiency.

  4. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

    Science.gov (United States)

    Lacks, S.A.

    1990-10-02

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

  5. Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction.

    Science.gov (United States)

    van Harten, S; Brito, R; Almeida, A M; Scanlon, T; Kilminster, T; Milton, J; Greeff, J; Oldham, C; Cardoso, L A

    2013-03-01

    The effect of feed restriction on gene expression of regulatory enzymes of intermediary metabolism was studied in two sheep breeds (Australian Merino and Dorper) subjected to two nutritional treatments: feed restriction (85% of daily maintenance requirements) and control (ad libitum feeding), during 42 days. The experimental animals (ram lambs) were divided into four groups, n = 5 (Australian Merino control (MC), Australian Merino Restriction (MR), Dorper control (DC) and Dorper Restriction (DR)). After the trial, animals were sacrificed and samples were taken from liver tissue to quantify glucose levels and gene expression of relevant intermediary metabolism enzymes (phosphofructokinase (PFK), pyruvate kinase (PK), phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphatase, glycogen synthase (GS), fatty acid synthase (FAS), glutamate dehydrogenase (GDH) and carbamoyl phosphate synthase (CPS)) through real-time PCR. During the experimental period, the MR animals lost 12.6% in BW compared with 5.3% lost by the Dorper lambs. MC and DC rams gained, respectively, 8.8% and 14% during the same period. Within the Dorper breed, restricted feed animals revealed a significant decrease over controls in the transcription of PFK (1.95-fold) and PK (2.26-fold), both glycolytic enzymes. The gluconeogenesis showed no change in the feed restricted animals of both breeds. DR feed group presented a significant decrease over the homologous Merino sheep group on GS. In both experimental breeds, FAS mRNA expression was decreased in restricted feed groups. GDH expression was decreased only in the DR animals (1.84-fold) indicating a reduced catabolism of amino acids in these animals. Finally, CPS was significantly (P enzymes and hepatic glucose production of Dorper sheep to feed restriction concurring with the BW results in the experimental groups.

  6. Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

    Science.gov (United States)

    Lacks, Sanford A.

    1990-01-01

    Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

  7. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  8. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  9. A versatile prokaryotic cloning vector with six dual restriction enzyme sites in the polylinker facilitates efficient subcloning into vectors with unique cloning sites.

    Science.gov (United States)

    Sage, D R; Chillemi, A C; Fingeroth, J D

    1998-09-01

    In large and complex vectors a single restriction enzyme recognition site may be available for introduction of additional DNA requiring the development of linker fragments to create compatible insertion sites. This technology can be time consuming and costly. We describe the construction of a simple phagemid, pSFI, with a polylinker that contains six pairs of dual, rare-cutting, restriction enzyme recognition sites (NotI, SpeI, EcoRV, PstI, SacII, EagI) with multiple unique sites between each pair. This has permitted rapid subcloning of DNA with creation of single flanking restriction enzyme sites. pSFI was used to expedite transfer of viral genes to a LacZ-inducible expression vector and to an adenovirus expression cassette for production of replication-defective virus. The use of this phagemid has facilitated complex vector manipulations and is a valuable adjunct to the family of multifunctional cloning vectors.

  10. Functional analysis of MmeI from methanol utilizer Methylophilus methylotrophus, a subtype IIC restriction-modification enzyme related to type I enzymes.

    Science.gov (United States)

    Nakonieczna, Joanna; Kaczorowski, Tadeusz; Obarska-Kosinska, Agnieszka; Bujnicki, Janusz M

    2009-01-01

    MmeI from Methylophilus methylotrophus belongs to the type II restriction-modification enzymes. It recognizes an asymmetric DNA sequence, 5'-TCCRAC-3' (R indicates G or A), and cuts both strands at fixed positions downstream of the specific site. This particular feature has been exploited in transcript profiling of complex genomes (using serial analysis of gene expression technology). We have shown previously that the endonucleolytic activity of MmeI is strongly dependent on the presence of S-adenosyl-l-methionine (J. Nakonieczna, J. W. Zmijewski, B. Banecki, and A. J. Podhajska, Mol. Biotechnol. 37:127-135, 2007), which puts MmeI in subtype IIG. The same cofactor is used by MmeI as a methyl group donor for modification of an adenine in the upper strand of the recognition site to N(6)-methyladenine. Both enzymatic activities reside in a single polypeptide (919 amino acids [aa]), which puts MmeI also in subtype IIC of the restriction-modification systems. Based on a molecular model, generated with the use of bioinformatic tools and validated by site-directed mutagenesis, we were able to localize three functional domains in the structure of the MmeI enzyme: (i) the N-terminal portion containing the endonucleolytic domain with the catalytic Mg2+-binding motif D(70)-X(9)-EXK(82), characteristic for the PD-(D/E)XK superfamily of nucleases; (ii) a central portion (aa 310 to 610) containing nine sequence motifs conserved among N(6)-adenine gamma-class DNA methyltransferases; (iii) the C-terminal portion (aa 610 to 919) containing a putative target recognition domain. Interestingly, all three domains showed highest similarity to the corresponding elements of type I enzymes rather than to classical type II enzymes. We have found that MmeI variants deficient in restriction activity (D70A, E80A, and K82A) can bind and methylate specific nucleotide sequence. This suggests that domains of MmeI responsible for DNA restriction and modification can act independently. Moreover, we

  11. DNA synapsis through transient tetramerization triggers cleavage by Ecl18kI restriction enzyme

    NARCIS (Netherlands)

    Zaremba, M.; Lyubchenko, Y.L.; Laurens, N.; van den Broek, B.; Wuite, G.J.L.; Siksnys, V.

    2010-01-01

    To cut DNA at their target sites, restriction enzymes assemble into different oligomeric structures. The Ecl18kI endonuclease in the crystal is arranged as a tetramer made of two dimers each bound to a DNA copy. However, free in solution Ecl18kI is a dimer. To find out whether the Ecl18kI dimer or

  12. A method for selection of restriction enzymes for sdCAPS marker construction

    Science.gov (United States)

    Development of PCR-based markers for SNP detection is prerequisite for various genetic analyses. The use of restriction enzymes following PCR amplification is a common and relatively low cost method for SNP detection. Simple and cost-effective methodologies for SNP marker development that would en...

  13. Identification and differentiation of Fasciola hepatica and Fasciola gigantica using a simple PCR-restriction enzyme method.

    Science.gov (United States)

    Rokni, Mohammad Bagher; Mirhendi, Hossein; Mizani, Azadeh; Mohebali, Mehdi; Sharbatkhori, Mitra; Kia, Eshrat Beigom; Abdoli, Hamid; Izadi, Shahrokh

    2010-02-01

    Accurate morphological differentiation between the liver fluke species Fasciola hepatica and Fasciola gigantica is difficult. We evaluated PCR-restriction enzyme profiles of internal transcribed spacer 1 (ITS1) that could aid in their identification. Fifty F. hepatica and 30 F. gigantica specimens were collected from different hosts in three provinces of Iran. For DNA extraction, we crushed fragments of the worms between two glass slides as a new method to break down the cells. DNA from the crushed materials was then extracted with a conventional phenol-chloroform method and with the newly developed technique, commercial FTA cards. A primer pair was selected to amplify a 463-bp region of the ITS1 sequence. After sequencing 14 samples and in silico analysis, cutting sites of all known enzymes were predicted and TasI was selected as the enzyme that yielded the most informative profile. Crushing produced enough DNA for PCR amplification with both the phenol-chloroform and commercial FTA card method. The DNA extracted from all samples was successfully amplified and yielded a single sharp band of the expected size. Digestion of PCR products with TasI allowed us to distinguish the two species. In all samples, molecular identification was consistent with morphological identification. Our PCR-restriction enzyme profile is a simple, rapid and reliable method for differentiating F. hepatica and F. gigantica, and can be used for diagnostic and epidemiological purposes. Copyright 2009 Elsevier Inc. All rights reserved.

  14. Identification of SNPs in closely related Temperate Japonica rice cultivars using restriction enzyme-phased sequencing.

    Science.gov (United States)

    Kim, Sang-Ic; Tai, Thomas H

    2013-01-01

    Very low polymorphism in the germplasm typically used by breeding programs poses a significant bottleneck with regards to molecular breeding and the exploitation of breeding materials for quantitative trait analyses. California rice cultivars, derived from a very small base of temperate japonica germplasm and having a relatively brief breeding history, are a good example. In this study, we employed a reduced representation sequencing approach called Restriction Enzyme Site Comparative Analysis (RESCAN) to simultaneously identify and genotype single nucleotide polymorphisms (SNPs) in forty-five rice cultivars representing the majority of the 100 year-old breeding history in California. Over 20,000 putative SNPs were detected relative to the Nipponbare reference genome which enabled the identification and analysis of inheritance of pedigree haplotypes. Haplotype blocks distinguishing modern California cultivars from each other and from the ancestral short grain temperate japonica cultivars were easily identified. Reduced representation sequencing methods such as RESCAN are a valuable alternative to SNP chip genotyping and low coverage whole genome sequencing.

  15. Reference genome-independent assessment of mutation density using restriction enzyme-phased sequencing.

    Science.gov (United States)

    Monson-Miller, Jennifer; Sanchez-Mendez, Diana C; Fass, Joseph; Henry, Isabelle M; Tai, Thomas H; Comai, Luca

    2012-02-14

    The availability of low cost sequencing has spurred its application to discovery and typing of variation, including variation induced by mutagenesis. Mutation discovery is challenging as it requires a substantial amount of sequencing and analysis to detect very rare changes and distinguish them from noise. Also challenging are the cases when the organism of interest has not been sequenced or is highly divergent from the reference. We describe the development of a simple method for reduced representation sequencing. Input DNA was digested with a single restriction enzyme and ligated to Y adapters modified to contain a sequence barcode and to provide a compatible overhang for ligation. We demonstrated the efficiency of this method at SNP discovery using rice and arabidopsis. To test its suitability for the discovery of very rare SNP, one control and three mutagenized rice individuals (1, 5 and 10 mM sodium azide) were used to prepare genomic libraries for Illumina sequencers by ligating barcoded adapters to NlaIII restriction sites. For genome-dependent discovery 15-30 million of 80 base reads per individual were aligned to the reference sequence achieving individual sequencing coverage from 7 to 15×. We identified high-confidence base changes by comparing sequences across individuals and identified instances consistent with mutations, i.e. changes that were found in a single treated individual and were solely GC to AT transitions. For genome-independent discovery 70-mers were extracted from the sequence of the control individual and single-copy sequence was identified by comparing the 70-mers across samples to evaluate copy number and variation. This de novo "genome" was used to align the reads and identify mutations as above. Covering approximately 1/5 of the 380 Mb genome of rice we detected mutation densities ranging from 0.6 to 4 per Mb of diploid DNA depending on the mutagenic treatment. The combination of a simple and cost-effective library construction

  16. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes

    Science.gov (United States)

    Neely, Robert K.; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C.

    2009-01-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage. PMID:19740769

  17. Time-resolved fluorescence studies of nucleotide flipping by restriction enzymes.

    Science.gov (United States)

    Neely, Robert K; Tamulaitis, Gintautas; Chen, Kai; Kubala, Marta; Siksnys, Virginijus; Jones, Anita C

    2009-11-01

    Restriction enzymes Ecl18kI, PspGI and EcoRII-C, specific for interrupted 5-bp target sequences, flip the central base pair of these sequences into their protein pockets to facilitate sequence recognition and adjust the DNA cleavage pattern. We have used time-resolved fluorescence spectroscopy of 2-aminopurine-labelled DNA in complex with each of these enzymes in solution to explore the nucleotide flipping mechanism and to obtain a detailed picture of the molecular environment of the extrahelical bases. We also report the first study of the 7-bp cutter, PfoI, whose recognition sequence (T/CCNGGA) overlaps with that of the Ecl18kI-type enzymes, and for which the crystal structure is unknown. The time-resolved fluorescence experiments reveal that PfoI also uses base flipping as part of its DNA recognition mechanism and that the extrahelical bases are captured by PfoI in binding pockets whose structures are quite different to those of the structurally characterized enzymes Ecl18kI, PspGI and EcoRII-C. The fluorescence decay parameters of all the enzyme-DNA complexes are interpreted to provide insight into the mechanisms used by these four restriction enzymes to flip and recognize bases and the relationship between nucleotide flipping and DNA cleavage.

  18. Structural insights into DNA sequence recognition by Type ISP restriction-modification enzymes.

    Science.gov (United States)

    Kulkarni, Manasi; Nirwan, Neha; van Aelst, Kara; Szczelkun, Mark D; Saikrishnan, Kayarat

    2016-05-19

    Engineering restriction enzymes with new sequence specificity has been an unaccomplished challenge, presumably because of the complexity of target recognition. Here we report detailed analyses of target recognition by Type ISP restriction-modification enzymes. We determined the structure of the Type ISP enzyme LlaGI bound to its target and compared it with the previously reported structure of a close homologue that binds to a distinct target, LlaBIII. The comparison revealed that, although the two enzymes use almost a similar set of structural elements for target recognition, the residues that read the bases vary. Change in specificity resulted not only from appropriate substitution of amino acids that contacted the bases but also from new contacts made by positionally distinct residues directly or through a water bridge. Sequence analyses of 552 Type ISP enzymes showed that the structural elements involved in target recognition of LlaGI and LlaBIII were structurally well-conserved but sequentially less-conserved. In addition, the residue positions within these structural elements were under strong evolutionary constraint, highlighting the functional importance of these regions. The comparative study helped decipher a partial consensus code for target recognition by Type ISP enzymes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Manipulating single enzymes by an external harmonic force

    DEFF Research Database (Denmark)

    Lomholt, Michael A; Urbakh, Michael; Metzler, Ralf

    2007-01-01

    We study a Michaelis-Menten reaction for a single two-state enzyme molecule, whose transition rates between the two conformations are modulated by an harmonically oscillating external force. In particular, we obtain a range of optimal driving frequencies for changing the conformation of the enzyme......, thereby controlling the enzymatic activity (i.e., product formation). This analysis demonstrates that it is, in principle, possible to obtain information about particular rates within the kinetic scheme....

  20. Sequence dependent DNA conformations: Raman spectroscopic studies and a model of action of restriction enzymes

    International Nuclear Information System (INIS)

    Nishimura, Y.

    1985-01-01

    Raman spectra have been examined to clarify the polymorphic forms of DNA, A, B, and Z forms. From an analysis the authors found that the guanine ring breathing vibration is sensitive to its local conformation. Examination of nine crystals of guanosine residues in which the local conformations are well established revealed that a guanosine residue with a C3'endo-anti gives a strong line at 666+-2 cm/sup -1/, O4'endo-anti at 682 cm/sup -1/, C1'exo-anti at 673 cm/sup -1/, C2'endo-anti at 677 cm/sup -1/ and syn-forms around 625 cm/sup -1/. Using this characteristic line, they were able to obtain the local conformations of guanosine moieties in poly(dG-dC). Such a sequence derived variation is suggested to be recognized by sequence specific proteins such as restriction enzymes. The authors found a correlation between sequence dependent DNA conformation and a mode of action of restriction enzymes. The cutting mode of restriction enzymes is classified into three groups. The classification of whether the products have blunt ends, two-base-long cohesive ends, or four-base-long cohesive ends depends primarily on the substrate, not on the enzyme. It is suggested that sequence dependent DNA conformation causes such a classification by the use of the Calladine-Dickerson analysis. In the recognition of restriction enzymes, the methyl group in a certain sequence is considered to play an important role by changing the local conformation of DNA

  1. Microfluidics-Enabled Enzyme Activity Measurement in Single Cells.

    Science.gov (United States)

    Tesauro, Cinzia; Frøhlich, Rikke; Stougaard, Magnus; Ho, Yi-Ping; Knudsen, Birgitta R

    2015-01-01

    Cellular heterogeneity has presented a significant challenge in the studies of biology. While most of our understanding is based on the analysis of ensemble average, individual cells may process information and respond to perturbations very differently. Presented here is a highly sensitive platform capable of measuring enzymatic activity at the single-cell level. The strategy innovatively combines a rolling circle-enhanced enzyme activity detection (REEAD) assay with droplet microfluidics. The single-molecule sensitivity of REEAD allows highly sensitive detection of enzymatic activities, i.e. at the single catalytic event level, whereas the microfluidics enables isolation of single cells. Further, confined reactions in picoliter-sized droplets significantly improve enzyme extraction from human cells or microorganisms and result in faster reaction kinetics. Taken together, the described protocol is expected to open up new possibilities in the single-cell research, particularly for the elucidation of heterogeneity in a population of cells.

  2. Phylogenomics and sequence-structure-function relationships in the GmrSD family of Type IV restriction enzymes.

    Science.gov (United States)

    Machnicka, Magdalena A; Kaminska, Katarzyna H; Dunin-Horkawicz, Stanislaw; Bujnicki, Janusz M

    2015-10-23

    GmrSD is a modification-dependent restriction endonuclease that specifically targets and cleaves glucosylated hydroxymethylcytosine (glc-HMC) modified DNA. It is encoded either as two separate single-domain GmrS and GmrD proteins or as a single protein carrying both domains. Previous studies suggested that GmrS acts as endonuclease and NTPase whereas GmrD binds DNA. In this work we applied homology detection, sequence conservation analysis, fold recognition and homology modeling methods to study sequence-structure-function relationships in the GmrSD restriction endonucleases family. We also analyzed the phylogeny and genomic context of the family members. Results of our comparative genomics study show that GmrS exhibits similarity to proteins from the ParB/Srx fold which can have both NTPase and nuclease activity. In contrast to the previous studies though, we attribute the nuclease activity also to GmrD as we found it to contain the HNH endonuclease motif. We revealed residues potentially important for structure and function in both domains. Moreover, we found that GmrSD systems exist predominantly as a fused, double-domain form rather than as a heterodimer and that their homologs are often encoded in regions enriched in defense and gene mobility-related elements. Finally, phylogenetic reconstructions of GmrS and GmrD domains revealed that they coevolved and only few GmrSD systems appear to be assembled from distantly related GmrS and GmrD components. Our study provides insight into sequence-structure-function relationships in the yet poorly characterized family of Type IV restriction enzymes. Comparative genomics allowed to propose possible role of GmrD domain in the function of the GmrSD enzyme and possible active sites of both GmrS and GmrD domains. Presented results can guide further experimental characterization of these enzymes.

  3. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E

    2000-01-01

    of decameric pcPNAs block an access of RNA polymerase to the corresponding promoter. Here, we show that this type of PNAs protects selected DNA sites containing all four nucleobases from the action of restriction enzymes and DNA methyltransferases. We have found that pcPNAs as short as octamers form stable......I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...

  4. From Agrobacterium to viral vectors: genome modification of plant cells by rare cutting restriction enzymes.

    Science.gov (United States)

    Marton, Ira; Honig, Arik; Omid, Ayelet; De Costa, Noam; Marhevka, Elena; Cohen, Barry; Zuker, Amir; Vainstein, Alexander

    2013-01-01

    Researchers and biotechnologists require methods to accurately modify the genome of higher eukaryotic cells. Such modifications include, but are not limited to, site-specific mutagenesis, site-specific insertion of foreign DNA, and replacement and deletion of native sequences. Accurate genome modifications in plant species have been rather limited, with only a handful of plant species and genes being modified through the use of early genome-editing techniques. The development of rare-cutting restriction enzymes as a tool for the induction of site-specific genomic double-strand breaks and their introduction as a reliable tool for genome modification in animals, animal cells and human cell lines have paved the way for the adaptation of rare-cutting restriction enzymes to genome editing in plant cells. Indeed, the number of plant species and genes which have been successfully edited using zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and engineered homing endonucleases is on the rise. In our review, we discuss the basics of rare-cutting restriction enzyme-mediated genome-editing technology with an emphasis on its application in plant species.

  5. Genome modifications in plant cells by custom-made restriction enzymes.

    Science.gov (United States)

    Tzfira, Tzvi; Weinthal, Dan; Marton, Ira; Zeevi, Vardit; Zuker, Amir; Vainstein, Alexander

    2012-05-01

    Genome editing, i.e. the ability to mutagenize, insert, delete and replace sequences, in living cells is a powerful and highly desirable method that could potentially revolutionize plant basic research and applied biotechnology. Indeed, various research groups from academia and industry are in a race to devise methods and develop tools that will enable not only site-specific mutagenesis but also controlled foreign DNA integration and replacement of native and transgene sequences by foreign DNA, in living plant cells. In recent years, much of the progress seen in gene targeting in plant cells has been attributed to the development of zinc finger nucleases and other novel restriction enzymes for use as molecular DNA scissors. The induction of double-strand breaks at specific genomic locations by zinc finger nucleases and other novel restriction enzymes results in a wide variety of genetic changes, which range from gene addition to the replacement, deletion and site-specific mutagenesis of endogenous and heterologous genes in living plant cells. In this review, we discuss the principles and tools for restriction enzyme-mediated gene targeting in plant cells, as well as their current and prospective use for gene targeting in model and crop plants. © 2012 The Authors. Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  6. An investigation of the structural requirements for ATP hydrolysis and DNA cleavage by the EcoKI Type I DNA restriction and modification enzyme

    Science.gov (United States)

    Roberts, Gareth A.; Cooper, Laurie P.; White, John H.; Su, Tsueu-Ju; Zipprich, Jakob T.; Geary, Paul; Kennedy, Cowan; Dryden, David T. F.

    2011-01-01

    Type I DNA restriction/modification systems are oligomeric enzymes capable of switching between a methyltransferase function on hemimethylated host DNA and an endonuclease function on unmethylated foreign DNA. They have long been believed to not turnover as endonucleases with the enzyme becoming inactive after cleavage. Cleavage is preceded and followed by extensive ATP hydrolysis and DNA translocation. A role for dissociation of subunits to allow their reuse has been proposed for the EcoR124I enzyme. The EcoKI enzyme is a stable assembly in the absence of DNA, so recycling was thought impossible. Here, we demonstrate that EcoKI becomes unstable on long unmethylated DNA; reuse of the methyltransferase subunits is possible so that restriction proceeds until the restriction subunits have been depleted. We observed that RecBCD exonuclease halts restriction and does not assist recycling. We examined the DNA structure required to initiate ATP hydrolysis by EcoKI and find that a 21-bp duplex with single-stranded extensions of 12 bases on either side of the target sequence is sufficient to support hydrolysis. Lastly, we discuss whether turnover is an evolutionary requirement for restriction, show that the ATP hydrolysis is not deleterious to the host cell and discuss how foreign DNA occasionally becomes fully methylated by these systems. PMID:21685455

  7. Preliminary neutron scattering studies of the Type I restriction-modification enzyme M.Ahdl

    Energy Technology Data Exchange (ETDEWEB)

    Callow, Philip [Deuteration Laboratory, ILL, Grenoble, France/Keele University (United Kingdom)]. E-mail: callow@ill.fr; Timmins, Peter [Large Scale Structures Group, ILL, Grenoble (France); Kneale, Geoff [Biophysics Laboratories, Portsmouth University (United Kingdom)

    2006-11-15

    Type I restriction-modification (R-M) systems encode multisubunit/multidomain enzymes. Two genes (M and S) are required to form the 160 kDa methyltransferase that methylates a specific base within the recognition sequence and protects DNA from cleavage by the endonuclease. Small angle neutron scattering (SANS) revealed an unusually large structural change in the EcoR124I methyltransferase following DNA binding; this involves a major repositioning of the subunits of the enzyme, resulting in a 60 A reduction in the dimensions of the enzyme on forming a complex with DNA. The related methyltransferase M.Ahdl, with stoichiometry M{sub 2}S{sub 2} has been prepared in two protonated/deuterated states (S and M subunits protonated, S deuterated and M protonated) for which SANS data have been collected in a number of H:D solvent contrasts. The contrast match point of the selectively deuterated enzyme confirms the successful reconstitution of the enzyme with deuterated S subunits. Ab initio shape determination using this contrast matched data is in progress to determine the subunit organization of M.Ahdl and the large change in structure that occurs on DNA binding.

  8. Overcoming Intrinsic Restriction Enzyme Barriers Enhances Transformation Efficiency in Arthrospira platensis C1.

    Science.gov (United States)

    Jeamton, Wattana; Dulsawat, Sudarat; Tanticharoen, Morakot; Vonshak, Avigad; Cheevadhanarak, Supapon

    2017-04-01

    The development of a reliable genetic transformation system for Arthrospira platensis has been a long-term goal, mainly for those trying either to improve its performance in large-scale cultivation systems or to enhance its value as food and feed additives. However, so far, most of the attempts to develop such a transformation system have had limited success. In this study, an efficient and stable transformation system for A. platensis C1 was successfully developed. Based on electroporation and transposon techniques, exogenous DNA could be transferred to and stably maintained in the A. platensis C1 genome. Most strains of Arthrospira possess strong restriction barriers, hampering the development of a gene transfer system for this group of cyanobacteria. By using a type I restriction inhibitor and liposomes to protect the DNA from nuclease digestion, the transformation efficiency was significantly improved. The transformants were able to grow on a selective medium for more than eight passages, and the transformed DNA could be detected from the stable transformants. We propose that the intrinsic endonuclease enzymes, particularly the type I restriction enzyme, in A. platensis C1 play an important role in the transformation efficiency of this industrial important cyanobacterium. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Re-evaluating the kinetics of ATP hydrolysis during initiation of DNA sliding by Type III restriction enzymes.

    Science.gov (United States)

    Tóth, Júlia; Bollins, Jack; Szczelkun, Mark D

    2015-12-15

    DNA cleavage by the Type III restriction enzymes requires long-range protein communication between recognition sites facilitated by thermally-driven 1D diffusion. This 'DNA sliding' is initiated by hydrolysis of multiple ATPs catalysed by a helicase-like domain. Two distinct ATPase phases were observed using short oligoduplex substrates; the rapid consumption of ∼10 ATPs coupled to a protein conformation switch followed by a slower phase, the duration of which was dictated by the rate of dissociation from the recognition site. Here, we show that the second ATPase phase is both variable and only observable when DNA ends are proximal to the recognition site. On DNA with sites more distant from the ends, a single ATPase phase coupled to the conformation switch was observed and subsequent site dissociation required little or no further ATP hydrolysis. The overall DNA dissociation kinetics (encompassing site release, DNA sliding and escape via a DNA end) were not influenced by the second phase. Although the data simplifies the ATP hydrolysis scheme for Type III restriction enzymes, questions remain as to why multiple ATPs are hydrolysed to prepare for DNA sliding. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. REBASE--a database for DNA restriction and modification: enzymes, genes and genomes.

    Science.gov (United States)

    Roberts, Richard J; Vincze, Tamas; Posfai, Janos; Macelis, Dana

    2015-01-01

    REBASE is a comprehensive and fully curated database of information about the components of restriction-modification (RM) systems. It contains fully referenced information about recognition and cleavage sites for both restriction enzymes and methyltransferases as well as commercial availability, methylation sensitivity, crystal and sequence data. All genomes that are completely sequenced are analyzed for RM system components, and with the advent of PacBio sequencing, the recognition sequences of DNA methyltransferases (MTases) are appearing rapidly. Thus, Type I and Type III systems can now be characterized in terms of recognition specificity merely by DNA sequencing. The contents of REBASE may be browsed from the web http://rebase.neb.com and selected compilations can be downloaded by FTP (ftp.neb.com). Monthly updates are also available via email. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Purification, crystallization, X-ray diffraction analysis and phasing of an engineered single-chain PvuII restriction endonuclease

    Energy Technology Data Exchange (ETDEWEB)

    Meramveliotaki, Chrysi [Department of Science, Agricultural University of Athens, Athens (Greece); Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Kotsifaki, Dina [Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Androulaki, Maria [Department of Science, Agricultural University of Athens, Athens (Greece); Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Hountas, Athanasios [Department of Science, Agricultural University of Athens, Athens (Greece); Eliopoulos, Elias [Department of Agricultural Biotechnology, Agricultural University of Athens, Athens (Greece); Kokkinidis, Michael, E-mail: kokkinid@imbb.forth.gr [Department of Biology, University of Crete, PO Box 2208, GR-71110 Heraklion, Crete (Greece); Institute of Molecular Biology and Biotechnology (IMBB), PO Box 1527, GR-71110 Heraklion, Crete (Greece); Department of Science, Agricultural University of Athens, Athens (Greece)

    2007-10-01

    PvuII is the first type II restriction endonuclease to be converted from its wild-type homodimeric form into an enzymatically active single-chain variant. The enzyme was crystallized and phasing was successfully performed by molecular replacement. The restriction endonuclease PvuII from Proteus vulgaris has been converted from its wild-type homodimeric form into the enzymatically active single-chain variant scPvuII by tandemly joining the two subunits through the peptide linker Gly-Ser-Gly-Gly. scPvuII, which is suitable for the development of programmed restriction endonucleases for highly specific DNA cleavage, was purified and crystallized. The crystals diffract to a resolution of 2.35 Å and belong to space group P4{sub 2}, with unit-cell parameters a = b = 101.92, c = 100.28 Å and two molecules per asymmetric unit. Phasing was successfully performed by molecular replacement.

  12. Atomic force microscopy of the EcoKI Type I DNA restriction enzyme bound to DNA shows enzyme dimerization and DNA looping

    Science.gov (United States)

    Neaves, Kelly J.; Cooper, Laurie P.; White, John H.; Carnally, Stewart M.; Dryden, David T. F.; Edwardson, J. Michael; Henderson, Robert M.

    2009-01-01

    Atomic force microscopy (AFM) allows the study of single protein–DNA interactions such as those observed with the Type I Restriction–Modification systems. The mechanisms employed by these systems are complicated and understanding them has proved problematic. It has been known for years that these enzymes translocate DNA during the restriction reaction, but more recent AFM work suggested that the archetypal EcoKI protein went through an additional dimerization stage before the onset of translocation. The results presented here extend earlier findings confirming the dimerization. Dimerization is particularly common if the DNA molecule contains two EcoKI recognition sites. DNA loops with dimers at their apex form if the DNA is sufficiently long, and also form in the presence of ATPγS, a non-hydrolysable analogue of the ATP required for translocation, indicating that the looping is on the reaction pathway of the enzyme. Visualization of specific DNA loops in the protein–DNA constructs was achieved by improved sample preparation and analysis techniques. The reported dimerization and looping mechanism is unlikely to be exclusive to EcoKI, and offers greater insight into the detailed functioning of this and other higher order assemblies of proteins operating by bringing distant sites on DNA into close proximity via DNA looping. PMID:19223329

  13. Electrochemical biosensor modified with dsDNA monolayer for restriction enzyme activity determination.

    Science.gov (United States)

    Zajda, Joanna; Górski, Łukasz; Malinowska, Elżbieta

    2016-06-01

    A simple and cost effective method for the determination of restriction endonuclease activity is presented. dsDNA immobilized at a gold electrode surface is used as the enzymatic substrate, and an external cationic redox probe is employed in voltammetric measurements for analytical signal generation. The assessment of enzyme activity is based on a decrease of a current signal derived from reduction of methylene blue which is present in the sample solution. For this reason, the covalent attachment of the label molecule is not required which significantly reduces costs of the analysis and simplifies the entire determination procedure. The influence of buffer components on utilized dsDNA/MCH monolayer stability and integrity is also verified. Electrochemical impedance spectroscopy measurements reveal that due to pinhole formation during enzyme activity measurement the presence of any surfactants should be avoided. Additionally, it is shown that the sensitivity of the electrochemical biosensor can be tuned by changing the restriction site location along the DNA length. Under optimal conditions the proposed biosensor exhibits a linear response toward PvuII activity within a range from 0.25 to 1.50 U/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Maternal protein restriction affects gene expression and enzyme activity of intestinal disaccharidases in adult rat offspring

    Energy Technology Data Exchange (ETDEWEB)

    Pinheiro, D.F.; Pacheco, P.D.G.; Alvarenga, P.V.; Buratini, J. Jr; Castilho, A.C.S.; Lima, P.F.; Sartori, D.R.S.; Vicentini-Paulino, M.L.M. [Departamento de Fisiologia, Instituto de Biociências, Universidade Estadual Paulista, Botucatu, SP (Brazil)

    2013-03-15

    This study investigated the consequences of intrauterine protein restriction on the gastrointestinal tract and particularly on the gene expression and activity of intestinal disaccharidases in the adult offspring. Wistar rat dams were fed isocaloric diets containing 6% protein (restricted, n = 8) or 17% protein (control, n = 8) throughout gestation. Male offspring (n = 5-8 in each group) were evaluated at 3 or 16 weeks of age. Maternal protein restriction during pregnancy produced offspring with growth restriction from birth (5.7 ± 0.1 vs 6.3 ± 0.1 g; mean ± SE) to weaning (42.4 ± 1.3 vs 49.1 ± 1.6 g), although at 16 weeks of age their body weight was similar to control (421.7 ± 8.9 and 428.5 ± 8.5 g). Maternal protein restriction also increased lactase activity in the proximal (0.23 ± 0.02 vs 0.15 ± 0.02), medial (0.30 ± 0.06 vs 0.14 ± 0.01) and distal (0.43 ± 0.07 vs 0.07 ± 0.02 U·g{sup -1}·min{sup -1}) small intestine, and mRNA lactase abundance in the proximal intestine (7.96 ± 1.11 vs 2.38 ± 0.47 relative units) of 3-week-old offspring rats. In addition, maternal protein restriction increased sucrase activity (1.20 ± 0.02 vs 0.91 ± 0.02 U·g{sup -1}·min{sup -1}) and sucrase mRNA abundance (4.48 ± 0.51 vs 1.95 ± 0.17 relative units) in the duodenum of 16-week-old rats. In conclusion, the present study shows for the first time that intrauterine protein restriction affects gene expression of intestinal enzymes in offspring.

  15. Restriction enzymes do not play a significant role in Haemophilus homospecific or heterospecific transformation

    Energy Technology Data Exchange (ETDEWEB)

    Stuy, J.H.

    1976-10-01

    Competent Haemophilus influenzae Rd recipients, either as phage HP1 restricting (r/sup +/) or nonrestricting (r/sup -/) nonlysogens or defective lysogens, were exposed to deoxyribonucleic acids from various wild-type phage HP1 lysogenic H. influenzae serotype strains (non-encapsulated derivatives of serotypes a, b, c, d, and e), to DNA from lysogenic Haemophilus parahaemolyticus, and to DNA from modified and nonmodified phage HP1. Transformation of antibiotic resistance markers and of prophage markers in homospecific crosses were observed to be unaffected by the recipient restriction phenotype, whereas the transfection response was much reduced in r/sup +/ recipients. Heterospecific transformation of prophage markers was reduced by only 80 to 90 percent, whereas antibiotic resistance marker tranformation was 1,000 to 10,000 times lower. Heterospecific transfection was at least 100 times lower than the homospecific transfection in both r/sup +/ and r/sup -/ recipients. The general conclusion is that neither class I nor class II restriction enzymes affect significantly the transformation efficiency in homospecific and heterospecific crosses. The efficiency of heterospecific transformation may depend mainly on the deoxyribonucleic acid homology in the genetic marker region.

  16. Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes.

    Science.gov (United States)

    Simons, Michelle; Szczelkun, Mark D

    2011-09-01

    The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5'-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can 'turnover' in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase-nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed.

  17. Krebs cycle enzymes from livers of old mice are differentially regulated by caloric restriction.

    Science.gov (United States)

    Hagopian, Kevork; Ramsey, Jon J; Weindruch, Richard

    2004-08-01

    Krebs cycle enzyme activities and levels of five metabolites were determined from livers of old mice (30 months) maintained either on control or on long-term caloric restriction (CR) diets (28 months). In CR mice, the cycle was divided into two major blocks, the first containing citrate synthase, aconitase and NAD-dependent isocitrate dehydrogenase which showed decreased activities, while the second block, containing the remaining enzymes, displayed increased activity (except for fumarase, which was unchanged). CR also resulted in decreased levels of citrate, glutamate and alpha-ketoglutarate, increased levels of malate, and unchanged levels of aspartate. The alpha-ketoglutarate/glutamate and malate/alpha-ketoglutarate ratios were higher in CR, in parallel with previously reported increases with CR in pyruvate carboxylase activity and glucagon levels, respectively. The results indicate that long-term CR induces a differential regulation of Krebs cycle in old mice and this regulation may be the result of changes in gene expression levels, as well as a complex interplay between enzymes, hormones and other effectors. Truncation of Krebs cycle by CR may be an important adaptation to utilize available substrates for the gluconeogenesis necessary to sustain glycolytic tissues, such as brain.

  18. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  19. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data.

    Science.gov (United States)

    Zhou, Sun; Ji, Guoli; Liu, Xiaolin; Li, Pei; Moler, James; Karro, John E; Liang, Chun

    2012-05-03

    Expressed Sequence Tag (EST) sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be "unclean". Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3'-end terminal structures in designated 5'-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/) using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are "unclean" or abnormal, all of which could be cleaned or filtered by AFST. cDNA terminal pattern analysis, as

  20. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  1. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    Science.gov (United States)

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  2. An efficient method for multiple site-directed mutagenesis using type IIs restriction enzymes.

    Science.gov (United States)

    Zhang, Zhiqiang; Xu, Kun; Xin, Ying; Zhang, Zhiying

    2015-05-01

    Site-directed mutagenesis (SDM) methods are very important in modern molecular biology, biochemistry, and protein engineering. Here, we present a novel SDM method that can be used for multiple mutation generation using type IIs restriction enzymes. This approach is faster and more convenient than the overlap polymerase chain reaction (PCR) method due to its having fewer reaction steps and being cheaper than, but as convenient as, enzymatic assembly. We illustrate the usefulness of our method by introducing three mutations into the bacterial Streptococcus thermophilus Cas9 (bStCas9) gene, converting the humanized S. thermophilus Cas9 (hStCas9) gene into nuclease dead or H847A nickase mutants and generating sunnyTALEN mutagenesis from a wild-type TALEN backbone. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Exploring both sequence detection and restriction endonuclease cleavage kinetics by recognition site via single-molecule microfluidic trapping.

    Science.gov (United States)

    Xu, Weilin; Muller, Susan J

    2011-02-07

    We demonstrate the feasibility of a single-molecule microfluidic approach to both sequence detection and obtaining kinetic information for restriction endonucleases on dsDNA. In this method, a microfluidic stagnation point flow is designed to trap, hold, and linearize double-stranded (ds) genomic DNA to which a restriction endonuclease has been pre-bound sequence-specifically. By introducing the cofactor magnesium, we determine the binding location of the enzyme by the cleavage process of dsDNA as in optical restriction mapping, however here the DNA need not be immobilized on a surface. We note that no special labeling of the enzyme is required, which makes it simpler than our previous scheme using stagnation point flows for sequence detection. Our accuracy in determining the location of the recognition site is comparable to or better than other single molecule techniques due to the fidelity with which we can control the linearization of the DNA molecules. In addition, since the cleavage process can be followed in real time, information about the cleavage kinetics, and subtle differences in binding and cleavage frequencies among the recognition sites, may also be obtained. Data for the five recognition sites for the type II restriction endonuclease EcoRI on λ-DNA are presented as a model system. While the roles of the varying fluid velocity and tension along the chain backbone on the measured kinetics remain to be determined, we believe this new method holds promise for a broad range of studies of DNA-protein interactions, including the kinetics of other DNA cleavage processes, the dissociation of a restriction enzyme from the cleaved substrate, and other macromolecular cleavage processes.

  4. Restriction enzyme cleavage of ultraviolet-damaged Simian virus 40 and pBR322 DNA

    International Nuclear Information System (INIS)

    Cleaver, J.E.

    1983-01-01

    Cleavage of specific DNA sequences by the restriction enzymes EcoRI, HindIII and TaqI was prevented when the DNA was irradiated with ultraviolet light. Most of the effects were attributed to cyclobutane pyrimidine dimers in the recognition sequences; the effectiveness of irradiation was directly proportional to the number of potential dimer sites in the DNA. Combining EcoRI with dimer-specific endonuclease digestion revealed that pyrimidine dimers blocked cleavage within one base-pair on the strand opposite to the dimer but did not block cleavage three to four base-pairs away on the same strand. These are the probable limits for the range of influence of pyrimidine dimers along the DNA, at least for this enzyme. The effect of irradiation on cleavage by TaqI seemed far greater than expected for the cyclobutane dimer yield, possibly because of effects from photoproducts flanking the tetranucleotide recognition sequence and the effect of non-cyclobutane (6-4)pyrimidine photoproducts involving adjacent T and C bases. (author)

  5. DNA cleavage by Type ISP Restriction-Modification enzymes is initially targeted to the 3'-5' strand.

    Science.gov (United States)

    van Aelst, Kara; Šišáková, Eva; Szczelkun, Mark D

    2013-01-01

    The mechanism by which a double-stranded DNA break is produced following collision of two translocating Type I Restriction-Modification enzymes is not fully understood. Here, we demonstrate that the related Type ISP Restriction-Modification enzymes LlaGI and LlaBIII can cooperate to cleave DNA following convergent translocation and collision. When one of these enzymes is a mutant protein that lacks endonuclease activity, DNA cleavage of the 3'-5' strand relative to the wild-type enzyme still occurs, with the same kinetics and at the same collision loci as for a reaction between two wild-type enzymes. The DNA nicking activity of the wild-type enzyme is still activated by a protein variant entirely lacking the Mrr nuclease domain and by a helicase mutant that cannot translocate. However, the helicase mutant cannot cleave the DNA despite the presence of an intact nuclease domain. Cleavage by the wild-type enzyme is not activated by unrelated protein roadblocks. We suggest that the nuclease activity of the Type ISP enzymes is activated following collision with another Type ISP enzyme and requires adenosine triphosphate binding/hydrolysis but, surprisingly, does not require interaction between the nuclease domains. Following the initial rapid endonuclease activity, additional DNA cleavage events then occur more slowly, leading to further processing of the initial double-stranded DNA break.

  6. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  7. Interdomain communication in the endonuclease/motor subunit of type I restriction-modification enzyme EcoR124I

    Czech Academy of Sciences Publication Activity Database

    Sinha, Dhiraj; Shamayeva, Katerina; Ramasubramani, V.; Řeha, David; Bialevich, V.; Khabiri, Morteza; Guzanová, Alena; Milbar, N.; Weiserová, Marie; Cséfalvay, Eva; Carey, J.; Ettrich, Rüdiger

    2014-01-01

    Roč. 20, č. 7 (2014), s. 2334 ISSN 1610-2940 R&D Projects: GA ČR GAP207/12/2323 Institutional support: RVO:67179843 ; RVO:61388971 Keywords : DNA restriction enzymes * Molecular modeling * QM/MM calculations * principal components analysis * E. coli * Multisubunit enzyme complex * Correlated loop motions Subject RIV: EH - Ecology, Behaviour; EE - Microbiology, Virology (MBU-M) Impact factor: 1.736, year: 2014

  8. A restriction enzyme-powered autonomous DNA walking machine: its application for a highly sensitive electrochemiluminescence assay of DNA

    Science.gov (United States)

    Chen, Ying; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-12-01

    The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the nanostructure tracks and the Nt.AlwI-assisted cleavage of the overhang sequences in the presence of the walker are verified by using polyacrylamide gel electrophoresis analysis and cyclic voltammetry. The successive movement of the walker on the nanostructure tracks leads to continuous removal of massive ECL labels from the sensing electrode, which results in a significantly amplified suppression of the ECL emission for highly sensitive detection of sequence-specific DNA down to 0.19 pM. Results show that this DNA walking machine can also offer single-base mismatch discrimination capability. The successful application of the DNA walking machine for sequence-specific DNA detection can thus offer new opportunities for molecular machines in biosensing applications.The construction of a restriction enzyme (Nt.AlwI)-powered DNA walking machine and its application for highly sensitive detection of DNA are described. DNA nanostructure tracks containing four overhang sequences with electrochemiluminescence (ECL) labels and complementary to the walker (target DNA) are self-assembled on the sensing electrode. The walker hybridizes with the complementary sequences on the tracks and forms specific recognition sites for Nt.AlwI, which cleaves the overhang sequences, releases the ECL labels and enables directional movement of the walker along the tracks. The formation of the

  9. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    Science.gov (United States)

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  10. Fusaric Acid Production in Fusarium oxysporum Transformants Generated by Restriction Enzyme-Mediated Integration Procedure

    Directory of Open Access Journals (Sweden)

    Theresa Lee

    2013-12-01

    Full Text Available Fusaric acid (FA is a mycotoxin produced by Fusarium species. Its toxicity is relatively low but often associated with other mycotoxins, thus enhancing total toxicity. To date, biosynthetic genes or enzymes for FA have not been identified in F. oxysporum. In order to explore the genetic element(s for FA biosynthesis, restriction enzyme mediated integration (REMI procedure as an insertional mutagenesis was employed using FA producing-F. oxysporum strains. Genetic transformation of two F. oxysporum strains by REMI yielded more than 7,100 transformants with efficiency of average 3.2 transformants/μg DNA. To develop a screening system using phytotoxicity of FA, eleven various grains and vegetable seeds were tested for germination in cultures containing FA: Kimchi cabbage seed was selected as the most sensitive host. Screening for FA non-producer of F. oxysporum was done by growing each fungal REMI transformant in Czapek-Dox broth for 3 weeks at 25oC then observing if the Kimchi cabbage seeds germinated in the culture filtrate. Of more than 5,000 REMI transformants screened, fifty-three made the seeds germinated, indicating that they produced little or fewer FA. Among them, twenty-six were analyzed for FA production by HPLC and two turned out to produce less than 1% of FA produced by a wild type strain. Sequencing of genomic DNA regions (252 bp flanking the vector insertion site revealed an uncharacterized genomic region homologous (93% to the F. fujikuroi genome. Further study is necessary to determine if the vector insertion sites in FA-deficient mutants are associated with FA production.

  11. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  12. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family.

    Science.gov (United States)

    Zylicz-Stachula, Agnieszka; Bujnicki, Janusz M; Skowron, Piotr M

    2009-05-29

    Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases), however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family - TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase) and methyltransferase (MTase) activities of wild type (wt) TspGWI (either recombinant or isolated from Thermus sp.) are dependent on the presence of divalent cations. TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/E)XK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module of the HsdR subunit and the additional domains that

  13. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family

    Directory of Open Access Journals (Sweden)

    Zylicz-Stachula Agnieszka

    2009-05-01

    Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module

  14. DNA of a circular minichromosome linearized by restriction enzymes or other reagents is resistant to further cleavage: an influence of chromatin topology on the accessibility of DNA.

    Science.gov (United States)

    Kumala, Sławomir; Hadj-Sahraoui, Yasmina; Rzeszowska-Wolny, Joanna; Hancock, Ronald

    2012-10-01

    The accessibility of DNA in chromatin is an essential factor in regulating its activities. We studied the accessibility of the DNA in a ∼170 kb circular minichromosome to DNA-cleaving reagents using pulsed-field gel electrophoresis and fibre-fluorescence in situ hybridization on combed DNA molecules. Only one of several potential sites in the minichromosome DNA was accessible to restriction enzymes in permeabilized cells, and in growing cells only a single site at an essentially random position was cut by poisoned topoisomerase II, neocarzinostatin and γ-radiation, which have multiple potential cleavage sites; further sites were then inaccessible in the linearized minichromosomes. Sequential exposure to combinations of these reagents also resulted in cleavage at only a single site. Minichromosome DNA containing single-strand breaks created by a nicking endonuclease to relax any unconstrained superhelicity was also cut at only a single position by a restriction enzyme. Further sites became accessible after ≥95% of histones H2A, H2B and H1, and most non-histone proteins were extracted. These observations suggest that a global rearrangement of the three-dimensional packing and interactions of nucleosomes occurs when a circular minichromosome is linearized and results in its DNA becoming inaccessible to probes.

  15. Serotyping and ribotyping of Salmonella using restriction enzyme PvuII.

    Science.gov (United States)

    Bailey, J S; Fedorka-Cray, P J; Stern, N J; Craven, S E; Cox, N A; Cosby, D E

    2002-06-01

    The subtyping and identification of bacterial pathogens throughout food processing and production chains is useful to the new hazard analysis critical control point-based food safety plans. Traditional manual serotyping remains the primary means of subtyping Salmonella isolates. Molecular biology techniques, however, offer the promise of more rapid and sensitive subtyping of Salmonella. This study evaluates the potential of restriction enzyme PvuII, followed by probing with the rRNA operon from Escherichia coli, to generate serotype-specific DNA fingerprints. A total of 32 identified serotypes were found with an overall agreement in 208 of the 259 (80%) isolates tested between U.S. Department of Agriculture serotype identification and riboprint serotype identification. Many of the isolates that did not correlate were serotype identified as Salmonella Montevideo, which indicates that for this serotype, there are multiple ribotypes. When Salmonella Montevideo isolates were not included, the ribotype identification agreed with serotyping in 207 of the 231 (90%) isolates. The primary outcome of any ribotyping procedure is to give distinct ribotype patterns. This extensive poultry epidemiological study demonstrates that, in addition to ribotype patterns, the identification of isolates to known serotypes provides the investigator with additional information that can be more useful than traditional epidemiology and isolate identification studies.

  16. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Mohamed Awad

    2015-01-01

    Full Text Available Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available.

  17. FN-Identify: Novel Restriction Enzymes-Based Method for Bacterial Identification in Absence of Genome Sequencing.

    Science.gov (United States)

    Awad, Mohamed; Ouda, Osama; El-Refy, Ali; El-Feky, Fawzy A; Mosa, Kareem A; Helmy, Mohamed

    2015-01-01

    Sequencing and restriction analysis of genes like 16S rRNA and HSP60 are intensively used for molecular identification in the microbial communities. With aid of the rapid progress in bioinformatics, genome sequencing became the method of choice for bacterial identification. However, the genome sequencing technology is still out of reach in the developing countries. In this paper, we propose FN-Identify, a sequencing-free method for bacterial identification. FN-Identify exploits the gene sequences data available in GenBank and other databases and the two algorithms that we developed, CreateScheme and GeneIdentify, to create a restriction enzyme-based identification scheme. FN-Identify was tested using three different and diverse bacterial populations (members of Lactobacillus, Pseudomonas, and Mycobacterium groups) in an in silico analysis using restriction enzymes and sequences of 16S rRNA gene. The analysis of the restriction maps of the members of three groups using the fragment numbers information only or along with fragments sizes successfully identified all of the members of the three groups using a minimum of four and maximum of eight restriction enzymes. Our results demonstrate the utility and accuracy of FN-Identify method and its two algorithms as an alternative method that uses the standard microbiology laboratories techniques when the genome sequencing is not available.

  18. Parallel versus Off-Pathway Michaelis-Menten Mechanism for Single-Enzyme Kinetics of a Fluctuating Enzyme.

    Science.gov (United States)

    Kumar, Ashutosh; Maity, Hiranmay; Dua, Arti

    2015-07-09

    Recent fluorescence spectroscopy measurements of the turnover time distribution of single-enzyme turnover kinetics of β-galactosidase provide evidence of Michaelis-Menten kinetics at low substrate concentration. However, at high substrate concentrations, the dimensionless variance of the turnover time distribution shows systematic deviations from the Michaelis-Menten prediction. This difference is attributed to conformational fluctuations in both the enzyme and the enzyme-substrate complex and to the possibility of both parallel- and off-pathway kinetics. Here, we use the chemical master equation to model the kinetics of a single fluctuating enzyme that can yield a product through either parallel- or off-pathway mechanisms. An exact expression is obtained for the turnover time distribution from which the mean turnover time and randomness parameters are calculated. The parallel- and off-pathway mechanisms yield strikingly different dependences of the mean turnover time and the randomness parameter on the substrate concentration. In the parallel mechanism, the distinct contributions of enzyme and enzyme-substrate fluctuations are clearly discerned from the variation of the randomness parameter with substrate concentration. From these general results, we conclude that an off-pathway mechanism, with substantial enzyme-substrate fluctuations, is needed to rationalize the experimental findings of single-enzyme turnover kinetics of β-galactosidase.

  19. Sulfonation of polyvinylidene difluoride resin and its application in extraction of restriction enzymes from DNA digestion solutions.

    Science.gov (United States)

    Yang, Jing; Dong, Chunxia; Huang, Xu; Zhao, Jindong

    2003-11-01

    Sulfonation of polyvinylidene difluoride (PVDF) resin was achieved by incubation of the resin with sulfuric acid at a moderately high temperature. The sulfonated PVDF (SPVDF) resin was studied for its ability to extract restriction enzymes from DNA digestion solutions. The SPVDF resin was effective in adsorbing restriction enzymes such as EcoRI and BamHI and the extraction procedure was easy and simple to perform. The adsorption depended upon the amount of the resin added. We found that 1 mg of the SPVDF resin could completely remove all restriction enzyme activity routinely used in DNA digestion within 2 min after its addition. Treatment of a digestion solution with the SPVDF resin did not change the reaction solution and the same digestion buffer could be used for another digestion of the same DNA with other enzymes. We also found that, in comparison with normal PVDF, the SPVDF resin adsorbed less DNA, resulting in less loss of DNA in the extraction step. The potential application of the SPVDF resin in other procedures of molecular cloning and enzyme purification is discussed.

  20. Interdomain communication in the endonuclease/motor subunit of type I restriction-modification enzyme EcoR124I.

    Science.gov (United States)

    Sinha, Dhiraj; Shamayeva, Katsiaryna; Ramasubramani, Vyas; Řeha, David; Bialevich, Vitali; Khabiri, Morteza; Guzanová, Alena; Milbar, Niv; Weiserová, Marie; Csefalvay, Eva; Carey, Jannette; Ettrich, Rüdiger

    2014-07-01

    Restriction-modification systems protect bacteria from foreign DNA. Type I restriction-modification enzymes are multifunctional heteromeric complexes with DNA-cleavage and ATP-dependent DNA translocation activities located on endonuclease/motor subunit HsdR. The recent structure of the first intact motor subunit of the type I restriction enzyme from plasmid EcoR124I suggested a mechanism by which stalled translocation triggers DNA cleavage via a lysine residue on the endonuclease domain that contacts ATP bound between the two helicase domains. In the present work, molecular dynamics simulations are used to explore this proposal. Molecular dynamics simulations suggest that the Lys-ATP contact alternates with a contact with a nearby loop housing the conserved QxxxY motif that had been implicated in DNA cleavage. This model is tested here using in vivo and in vitro experiments. The results indicate how local interactions are transduced to domain motions within the endonuclease/motor subunit.

  1. Differential dependence on DNA ligase of type II restriction enzymes: a practical way toward ligase-free DNA automaton.

    Science.gov (United States)

    Chen, Peng; Li, Jing; Zhao, Jian; He, Lin; Zhang, Zhizhou

    2007-02-16

    DNA computing study is a new paradigm in computer science and biological computing fields. As one of DNA computing approaches, DNA automaton is composed of the hardware, input DNA molecule and state transition molecules. By now restriction enzymes are key hardware for DNA computing automaton. It has been found that DNA computing efficiency may be independent on DNA ligases when type IIS restriction enzymes like FokI are used as hardware. In this study, we compared FokI with four other distinct enzymes HgaI, BsmFI, BbsI, and BseMII, and found their differential independence on T4 DNA ligase when performing automaton reactions. Since DNA automaton is a potential powerful tool to tackle gene relationship in genomic network scale, the feasible ligase-free DNA automaton may set an initial base to develop functional DNA automata for various DNA technology development and implications in genetics study in the near future.

  2. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes.

    Science.gov (United States)

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-04-07

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV) in 12 plant species showed 1.7-6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0-16.7% missing observations) than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications. Copyright © 2016 Fu et al.

  3. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2016-04-01

    Full Text Available Genotyping-by-sequencing (GBS has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV in 12 plant species showed 1.7–6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0–16.7% missing observations than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications.

  4. Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

    Science.gov (United States)

    Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

    2017-12-01

    Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

  5. Detection of a single enzyme molecule based on a solid-state nanopore sensor.

    Science.gov (United States)

    Tan, ShengWei; Gu, DeJian; Liu, Hang; Liu, QuanJun

    2016-04-15

    The nanopore sensor as a high-throughput and low-cost technology can detect a single molecule in a solution. In the present study, relatively large silicon nitride (Si3N4) nanopores with diameters of ∼28 and ∼88 nm were fabricated successfully using a focused Ga ion beam. We have used solid-state nanopores with various sizes to detect the single horseradish peroxidase (HRP) molecule and for the first time analyzed single HRP molecular translocation events. In addition, a real-time monitored single enzyme molecular biochemical reaction and a translocation of the product of enzyme catalysis substrates were investigated by using a Si3N4 nanopore. Our nanopore system showed a high sensitivity in detecting single enzyme molecules and a real-time monitored single enzyme molecular biochemical reaction. This method could also be significant for studying gene expression or enzyme dynamics at the single-molecule level.

  6. The Cloning of the Human Tumor Supressor Gene INGI: DNA Cloning into Plasmid Vector and DNA Analysis by Restriction Enzymes

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-11-01

    Full Text Available DNA cloning is one of the most important techniques In the field of molecular biology, with a critical role in analyzing the structure and function of genes and their adjacent regulatory regions. DNA cloning is helpful in learning fundamental molecular biological techniques, since DNA cloning involves a series of them, such as polymerase chain reaction (PCR, DNA ligation, bacterial transformation, bacterial culture, plasmid DNA extraction, DNA digestion with restriction enzymes and agarose gel electrophoresis. In this paper the cloning of the human tumor suppressor gene INGI has been used to illustrate the methodology. The gene was amplified by PCR, cloned into a TA-cloning vectore, and restriction enzyme mapping was used to distinguish the sense INGI construct from the antisense INGI construct.

  7. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    OpenAIRE

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-01-01

    Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder...

  8. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes

    OpenAIRE

    Yong-Bi Fu; Gregory W. Peterson; Yibo Dong

    2016-01-01

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and ...

  9. Multiplexed and Sensitive DNA Methylation Testing Using Methylation-Sensitive Restriction Enzymes "MSRE-qPCR".

    Science.gov (United States)

    Beikircher, Gabriel; Pulverer, Walter; Hofner, Manuela; Noehammer, Christa; Weinhaeusel, Andreas

    2018-01-01

    DNA methylation is a chemically stable key-player in epigenetics. In the vertebrate genome the 5-methyl cytosine (5mC) has been found almost exclusively in the CpG dinucleotide context. CpG dinucleotides are enriched in CpG islands very frequently located within or close to gene promoters. Analyses of DNA methylation changes in human diagnostics have been conducted classically using methylation-sensitive restriction enzymes (MSRE). Since the discovery of bisulfite conversion-based sequencing and PCR assays, MSRE-based PCR assays have been less frequently used, although especially in the field of cancer epigenetics MSRE-based genome-wide discovery and targeted screening applications have been and are still performed successfully. Even though epigenome-wide discovery of altered DNA methylation patterns has found its way into various fields of human disease and molecular genetics research, the validation of findings upon discovery is still a bottleneck. Usually several multiples of 10 up to 100 candidate biomarkers from discovery have to be confirmed or are of interest for further work. In particular, bisulfite PCR assays are often limited in the number of candidates which can be analyzed, due to their low multiplexing capability, especially, if only small amounts of DNA are available from for example clinical specimens. In clinical research and diagnostics a similar situation arises for the analyses of cell-free DNA (cfDNA) in body fluids or circulating tumor cells (CTCs). Although tissue- or disease- (e.g., cancer) specific DNA methylation patterns can be deduced very efficiently in a genome-wide manner if around 100 ng of DNA are available, confirming these candidates and selecting target-sequences for studying methylation changes in liquid biopsies using cfDNA or CTCs remains a big challenge. Along these lines we have developed MSRE-qPCR and introduce here method details, which have been found very suitable for the efficient confirmation and testing of DNA

  10. Handling and Sensing of Single Enzyme Molecules: From Fluorescence Detection towards Nanoscale Electrical Measurements

    DEFF Research Database (Denmark)

    Mathwig, Klaus; Chi, Qijin; Lemay, Serge G.

    2016-01-01

    advances in all-electrical single enzyme studies with a focus on recent micro- and nanofluidic tools, which offer new ways of handling and studying small numbers of molecules or even single enzyme molecules. We particularly emphasize nanofluidic devices, which enable the integration of electrochemical...

  11. Toward Single Enzyme Analysis in a Droplet-based Micro and Nanofluidic Systems

    NARCIS (Netherlands)

    Arayanarakool, Rerngchai

    2012-01-01

    In this thesis, we demonstrate the application of a micro- and nanofluidic device for the single-enzyme analysis by encapsulating single enzymes into the generated aqueous droplets in oil. This thesis consists of the introduction (chapter 1), a review of the generation and manipulation of droplets

  12. Toward single enzyme analysis in a droplet-based micro and nanofluidic system

    NARCIS (Netherlands)

    Arayanarakool, Rerngchai

    2012-01-01

    In this thesis, we have demonstrated the application of micro- and nanofluidic devices to generate an array of aqueous droplets in oil phase for single-enzyme encapsulation and activity measurement. We chose droplet-based microfluidics for this purpose of monitoring single-enzyme reactions since the

  13. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites

    Directory of Open Access Journals (Sweden)

    Stafford Phillip

    2009-09-01

    Full Text Available Abstract Background Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. Results ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. Conclusion ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  14. ICRPfinder: a fast pattern design algorithm for coding sequences and its application in finding potential restriction enzyme recognition sites.

    Science.gov (United States)

    Li, Chao; Li, Yuhua; Zhang, Xiangmin; Stafford, Phillip; Dinu, Valentin

    2009-09-11

    Restriction enzymes can produce easily definable segments from DNA sequences by using a variety of cut patterns. There are, however, no software tools that can aid in gene building -- that is, modifying wild-type DNA sequences to express the same wild-type amino acid sequences but with enhanced codons, specific cut sites, unique post-translational modifications, and other engineered-in components for recombinant applications. A fast DNA pattern design algorithm, ICRPfinder, is provided in this paper and applied to find or create potential recognition sites in target coding sequences. ICRPfinder is applied to find or create restriction enzyme recognition sites by introducing silent mutations. The algorithm is shown capable of mapping existing cut-sites but importantly it also can generate specified new unique cut-sites within a specified region that are guaranteed not to be present elsewhere in the DNA sequence. ICRPfinder is a powerful tool for finding or creating specific DNA patterns in a given target coding sequence. ICRPfinder finds or creates patterns, which can include restriction enzyme recognition sites, without changing the translated protein sequence. ICRPfinder is a browser-based JavaScript application and it can run on any platform, in on-line or off-line mode.

  15. Dissociation from DNA of Type III Restriction-Modification enzymes during helicase-dependent motion and following endonuclease activity.

    Science.gov (United States)

    Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D

    2012-08-01

    DNA cleavage by the Type III Restriction-Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼ 200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can 'turnover', albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. 'DNA sliding').

  16. [THE EFFECT OF DIETARY RESTRICTION DURING DEVELOPMENT OF DROSOPHILA MELANOGASTER ON THE ACTIVITY OF ANTIOXIDANT SYSTEM ENZYMES].

    Science.gov (United States)

    Zabuga, O G; Koliada, A K; Kukharskyy, V M; Bazhynova, A I; Vaiserman, A M

    2015-01-01

    In the previous study we demonstrated that dietary restriction only at the development stage of Drosophila melanogaster may impact the life span of adult flies. It was important that we didn't use qualitative (restriction of proteins or other macro- or microelements) and not a calorie restriction as well, but quantitative dietary restriction that was the proportional reduction of all food components in the larval medium. In the situations when the larvae were reared in the medium types, that contained protein and carbohydrate components in concentrations of 90-10% of food components compared to the standard one (100%), the males were characterised with the significant increase in the maximum life span. The average life span was also increased, but only in those male individuals that developed in the medium types, that contained 50% and 60% of food components compared to controls. Such an effect we haven't detected in the female flies. To study the biochemical changes associated with the physiological effects we have determined the activity of the antioxidant enzymes--superoxide dismutase (SOD) and catalase. In the male flies the 50% dietary restriction implemented during the development has led to the significant increase in a SOD and catalase activity. Also the flies of both sexes reared in the medium with the 50% of food components have been characterised with the reduction in the accumulation of glycation end products. According to these results, we suggest that the changes in the activity of antioxidant enzymes may play a role in the increase of the flies life span caused by the dietary restriction during the development.

  17. Serum biochemical and liver enzymes changes in dogs with single ...

    African Journals Online (AJOL)

    The liver enzymes: aspartate aminotransferase (AST) and alanine aminotransferase (ALT) showed significant increase in the infected groups, while alkaline phosphatase (ALP) showed a significant decrease (P < 0.05). These biochemical changes were in all cases more profound in the conjunct infection, and could thus be ...

  18. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  19. Characterization of the restriction enzyme-like endonuclease encoded by the Entamoeba histolytica non-long terminal repeat retrotransposon EhLINE1.

    Science.gov (United States)

    Yadav, Vijay Pal; Mandal, Prabhat Kumar; Rao, Desirazu N; Bhattacharya, Sudha

    2009-12-01

    The genome of the human pathogen Entamoeba histolytica, a primitive protist, contains non-long terminal repeat retrotransposable elements called EhLINEs. These encode reverse transcriptase and endonuclease required for retrotransposition. The endonuclease shows sequence similarity with bacterial restriction endonucleases. Here we report the salient enzymatic features of one such endonuclease. The kinetics of an EhLINE1-encoded endonuclease catalyzed reaction, determined under steady-state and single-turnover conditions, revealed a significant burst phase followed by a slower steady-state phase, indicating that release of product could be the slower step in this reaction. For circular supercoiled DNA the K(m) was 2.6 x 10(-8) M and the k(cat) was 1.6 x 10(-2) sec(-1). For linear E. histolytica DNA substrate the K(m) and k(cat) values were 1.3 x 10(-8) M and 2.2 x 10(-4) sec(-1) respectively. Single-turnover reaction kinetics suggested a noncooperative mode of hydrolysis. The enzyme behaved as a monomer. While Mg(2+) was required for activity, 60% activity was seen with Mn(2+) and none with other divalent metal ions. Substitution of PDX(12-14)D (a metal-binding motif) with PAX(12-14)D caused local conformational change in the protein tertiary structure, which could contribute to reduced enzyme activity in the mutated protein. The protein underwent conformational change upon the addition of DNA, which is consistent with the known behavior of restriction endonucleases. The similarities with bacterial restriction endonucleases suggest that the EhLINE1-encoded endonuclease was possibly acquired from bacteria through horizontal gene transfer. The loss of strict sequence specificity for nicking may have been subsequently selected to facilitate spread of the retrotransposon to intergenic regions of the E. histolytica genome.

  20. Adult-onset calorie restriction delays the accumulation of mitochondrial enzyme abnormalities in aging rat kidney tubular epithelial cells.

    Science.gov (United States)

    McKiernan, Susan H; Tuen, Victoria C; Baldwin, Katherine; Wanagat, Jonathan; Djamali, Arjang; Aiken, Judd M

    2007-06-01

    Adult-onset calorie restriction (A-CR) is an experimental model of life extension and healthy aging less explored, compared with calorie restriction begun at early ages, but one more realistic for human application. We examined the effect of A-CR on the aging rat kidney with respect to common structural age-dependent changes and the accumulation of mitochondrial enzyme abnormalities in tubular epithelial cells. A 40% calorie restriction was initiated in middle-aged rats, before the onset of significant age-related changes in the Fischer x Brown Norway rat kidney. This dietary intervention effectively reduced glomerulosclerosis and tubular atrophy within 6 mo and changed the rate of interstitial fibrosis formation within 1 yr and vascular wall thickening and the expression cytochrome c oxidase (COX)-deficient tubular epithelial cells in 18 mo compared with age-matched ad libitum-fed rats. Our histological approach (histochemical staining for mitochondrial enzyme activity and laser capture microdissection) coupled with mitochondrial DNA (mtDNA) PCR analyses demonstrated that COX-deficient renal tubular epithelial cells accumulated mtDNA deletion mutations and that these cells contained unique, clonally expanded mtDNA deletion mutations. Renal tubular epithelial cells with mitochondrial abnormalities presented cellular characteristics indicative of physiological dysfunction.

  1. Rational Design of Thermally Stable Novel Biocatalytic Nanomaterials: Enzyme Stability in Restricted Spatial Dimensions

    Science.gov (United States)

    Mudhivarthi, Vamsi K.

    Enzyme stability is of intense interest in bio-materials science as biocatalysts, and as sensing platforms. This is essentially because the unique properties of DNA, RNA, PAA can be coupled with the interesting and novel properties of proteins to produce systems with unprecedented control over their properties. In this article, the very first examples of enzyme/NA/inorganic hybrid nanomaterials and enzyme-Polyacrylic acid conjugates will be presented. The basic principles of design, synthesis and control of properties of these hybrid materials will be presented first, and this will be followed by a discussion of selected examples from our recent research findings. Data show that key properties of biological catalysts are improved by the inorganic framework especially when the catalyst is co-embedded with DNA. Several examples of such studies with various enzymes and proteins, including horseradish peroxidase (HRP), glucose oxidase (GO), cytochrome c (Cyt c), met-hemoglobin (Hb) and met-myoglobin (Mb) will be discussed. Additionally, key insights obtained by the standard methods of materials science including XRD, SEM and TEM as well as biochemical, calorimetric and spectroscopic methods will be discussed. Furthermore, improved structure and enhanced activities of the biocatalysts in specific cases will be demonstrated along with the potential stabilization mechanisms. Our hypothesis is that nucleic acids provide an excellent control over the enzyme-solid interactions as well as rational assembly of nanomaterials. These novel nanobiohybrid materials may aid in engineering more effective synthetic materials for gene-delivery, RNA-delivery and drug delivery applications.

  2. Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

    Science.gov (United States)

    Kovermann, Michael; Ådén, Jörgen; Grundström, Christin; Elisabeth Sauer-Eriksson, A.; Sauer, Uwe H.; Wolf-Watz, Magnus

    2015-07-01

    An emerging paradigm in enzymology is that transient high-energy structural states play crucial roles in enzymatic reaction cycles. Generally, these high-energy or `invisible' states cannot be studied directly at atomic resolution using existing structural and spectroscopic techniques owing to their low populations or short residence times. Here we report the direct NMR-based detection of the molecular topology and conformational dynamics of a catalytically indispensable high-energy state of an adenylate kinase variant. On the basis of matching energy barriers for conformational dynamics and catalytic turnover, it was found that the enzyme's catalytic activity is governed by its dynamic interconversion between the high-energy state and a ground state structure that was determined by X-ray crystallography. Our results show that it is possible to rationally tune enzymes' conformational dynamics and hence their catalytic power--a key aspect in rational design of enzymes catalysing novel reactions.

  3. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    Science.gov (United States)

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Transcript profiling of the ruminant liver indicates a unique program of transcriptional regulation of ketogenic enzymes during food restriction.

    Science.gov (United States)

    Doelman, John; Cao, Honghe; Purdie, Norman G; Kim, Julie J M; Swanson, Kendall C; Osborne, Vernon R; Tey, Jasper; Ali, Ayesha; Feng, Zeny; Karrow, Niel A; Cant, John P

    2012-09-01

    Ruminants absorb little glucose and rely on hepatic gluconeogenesis and ketogenesis in the fed state to convert short-chain fatty acids produced during digestion into glucose and ketone bodies, respectively. In contrast to the non-ruminant response, fluxes through gluconeogenic and ketogenic pathways decrease during food restriction. Transcriptional regulation responsible for these unique food restriction responses has not been established. To determine the hepatic transcriptional response of ruminants to an acute drop in dietary nutrient supply, 102 yearling heifers were assigned to either ad libitum feeding or 24 h of food withdrawal in a randomized block design. Liver biopsies were obtained for microarray and quantitative real-time PCR analyses of gene expression. Plasma concentrations of non-esterified fatty acids were higher in food restricted heifers, while levels of β-hydroxybutyrate, triacylglycerol, and glucose were decreased. Despite a decline in substrate supply and a lower hepatic production of glucose, expression of the key gluconeogenic enzymes pyruvate carboxylase, phosphoenolpyruvate carboxykinase and fructose-1,6-bisphosphatase was upregulated as in non-ruminants. Downregulation of cholesterolgenic genes and upregulation of fatty acid oxidative genes were consistent with SREBP-2 and PPARα control, respectively. Ketogenesis from short-chain fatty acids was downregulated, contrary to the non-ruminant response to food restriction. Short-chain fatty acids may exert transcriptional control in the ruminant liver similar to that demonstrated in the large intestine of non-ruminants. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Sequence-specific protection of duplex DNA against restriction and methylation enzymes by pseudocomplementary PNAs

    DEFF Research Database (Denmark)

    Izvolsky, K I; Demidov, V V; Nielsen, P E

    2000-01-01

    I restriction endonuclease and dam methylase. The pcPNA-assisted protection against enzymatic methylation is more efficient when the PNA-binding site embodies the methylase-recognition site rather than overlaps it. We conclude that pcPNAs may provide the robust tools allowing to sequence-specifically manipulate...... DNA duplexes in a virtually sequence-unrestricted manner....

  6. Inquiry-Based Experiments for Large-Scale Introduction to PCR and Restriction Enzyme Digests

    Science.gov (United States)

    Johanson, Kelly E.; Watt, Terry J.

    2015-01-01

    Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are…

  7. Single-enzyme analysis in a droplet-based micro- and nanofluidic system

    NARCIS (Netherlands)

    Arayanarakool, Rerngchai; Shui, Lingling; Kengen, Servé W.M.; van den Berg, Albert; Eijkel, Jan C.T.

    2013-01-01

    The kinetic activity of individual enzyme molecules was determined in aqueous droplets generated in a nano- and microfluidic device. To avoid high background noise, the enzyme and substrate solution was confined into femtoliter carriers, achieving high product concentrations from single-molecule

  8. The Impact of Single-Container Malt Liquor Sales Restrictions on Urban Crime.

    Science.gov (United States)

    McKee, Patricia; Erickson, Darin J; Toomey, Traci; Nelson, Toben; Less, Elyse Levine; Joshi, Spruha; Jones-Webb, Rhonda

    2017-04-01

    Many US cities have adopted legal restrictions on high-alcohol malt liquor sales in response to reports of crime and nuisance behaviors around retail alcohol outlets. We assessed whether these policies are effective in reducing crime in urban areas. We used a rigorous interrupted time-series design with comparison groups to examine monthly crime rates in areas surrounding alcohol outlets in the 3 years before and after adoption of malt liquor sales restrictions in two US cities. Crime rates in matched comparison areas not subject to restrictions served as covariates. Novel methods for matching target and comparison areas using virtual neighborhood audits conducted in Google Street View are described. In Minneapolis, Minnesota, sales of single containers of 16 oz or less were prohibited in individual liquor stores (n = 6). In Washington, D.C., the sale of single containers of any size were prohibited in all retail alcohol outlets within full or partial wards (n = 6). Policy adoption was associated with modest reductions in crime, particularly assaults and vandalism, in both cities. All significant outcomes were in the hypothesized direction. Our results provide evidence that retail malt liquor sales restrictions, even relatively weak ones, can have modest effects on a range of crimes. Policy success may depend on community support and concurrent restrictions on malt liquor substitutes.

  9. Comparison of the accuracy and mechanism of data mining identification of the intestinal microbiota with 7 restriction enzymes.

    Science.gov (United States)

    Kobayashi, Toshio; Fujiwara, Kenji

    2013-01-01

    The intestinal microbiota compositions of 92 Japanese men were identified following consumption of identical meals for 3 days, and collected feces were analyzed through terminal restriction fragment length polymorphism. The obtained operational taxonomic units (OTUs) and subjects' smoking and drinking habits, which had 2 nominal partitions, yes or no, were analyzed by Data mining software. Identification of subjects for each habit was successfully performed and reported previously, but the identification accuracy was closely dependent on the species of the applied restriction enzymes for PCR. For the sake of better selection of enzymes and understanding the mechanisms of Data mining analysis, 516f-BslI and 516f-HaeIII, 27f-MspI and 27f-AluI and 35f-HhaI, 35f-MspI and 35f-AluI, altogether 7 enzymes, were examined comparatively. Data mining analysis provides a Decision tree for identification of subjects and their dividing pathways that is produced using a limited number of OTUs, which affects the accuracy of the results. The present report discusses not only a global comparison of accuracies for characteristics, but also the detailed mechanisms that result in better or worse results and the practical roles and functions of OTUs. The OTU at the 1st step of the constructed Decision tree was the most important for any identification, and for all cases, the combination of subsequent OTUs, which formed later in the Decision tree, was also unignorable. Detailed dividing pathways were traced and compared for the 7 enzymes and the future supporting ideas were provided for better Data mining analysis of the human intestinal microbiota.

  10. Use of a restriction enzyme-digested PCR product as substrate for helicase assays.

    Science.gov (United States)

    Shin, Jae-Ho; Reeve, John N; Kelman, Zvi

    2005-01-13

    DNA helicases play essential roles in many cellular processes. The currently available techniques to generate substrates for helicase assays are fairly complicated and need some expertise not available in all laboratories. Here, a PCR-based method to generate a substrate for a helicase assay is described, and its application for several archaeal, bacterial and viral enzymes is demonstrated.

  11. Highlights of the DNA cutters:a short history of the restriction enzymes

    OpenAIRE

    Loenen, Wil A M; Dryden, David T F; Raleigh, Elisabeth A; Wilson, Geoffrey G; Murray, Noreen E

    2013-01-01

    In the early 1950?s, ?host-controlled variation in bacterial viruses? was reported as a non-hereditary phenomenon: one cycle of viral growth on certain bacterial hosts affected the ability of progeny virus to grow on other hosts by either restricting or enlarging their host range. Unlike mutation, this change was reversible, and one cycle of growth in the previous host returned the virus to its original form. These simple observations heralded the discovery of the endonuclease and methyltrans...

  12. Functional Coupling of Duplex Translocation to DNA Cleavage in a Type I Restriction Enzyme

    Czech Academy of Sciences Publication Activity Database

    Cséfalvay, Eva; Lapkouski, Mikalai; Guzanová, Alena; Cséfalvay, Ladislav; Baikova, T.; Shevelev, Igor; Bialevich, V.; Shamayeva, Katerina; Janščák, Pavel; Kutá-Smatanová, Ivana; Panjikar, S.; Carey, J.; Weiserová, Marie; Ettrich, Rüdiger

    2015-01-01

    Roč. 10, č. 6 (2015), e0128700 E-ISSN 1932-6203 R&D Projects: GA ČR GAP207/12/2323; GA ČR GAP305/10/0281 Institutional support: RVO:67179843 ; RVO:61388971 ; RVO:68378050 Keywords : Escherichia - Coli * Endonuclease ecor1241 * HSDR subunit * RECBCD enzyme * proteins * genes * helicase * sequence * family * domain Subject RIV: CE - Biochemistry Impact factor: 3.057, year: 2015

  13. Restriction of anti-peptide antibody specificity by enzyme-modified Sepharose-peptide immunoadsorbents.

    Science.gov (United States)

    Trinca, M L; Muratti, E; Camera, M; Chersi, A

    1988-06-01

    Sepharose-peptide immunoadsorbents, employed for the isolation of specific antibodies from the sera of rabbits immunized with carrier protein-peptide conjugates, were digested with suitable proteolytic enzymes, in order to obtain the splitting of a part of the peptide bound to the gel. This new modified immunoadsorbent can be advantageously used for the isolation of antibody subsets, that do not cross-react with related peptides exhibiting high sequence homology with the immunogens.

  14. A multiplex restriction enzyme-PCR for unequivocal identification and differentiation of Trichostrongylus species in human samples.

    Science.gov (United States)

    Mizani, Azadeh; Gill, Pooria; Daryani, Ahmad; Sarvi, Shahabeddin; Amouei, Afsaneh; Katrimi, Ali Bakooie; Soleymani, Eissa; Mirshafiee, Siavash; Gholami, Sara; Hosseini, Seyed Abdollah; Gholami, Shirzad; Rahimi, Mohammad-Taghi; Hashemi-Soteh, Mohammad Bagher; Sharif, Mehdi

    2017-09-01

    Trichostrongylus species remain one of the major health challenges in the tropical and summer rainfall regions worldwide. Identification of strongylid species diagnostic methods is vital for obtaining a deep understanding of the epidemiology, population biology, anthelmintic treatment efficacy, and drug resistance in order to design effective parasite control strategies. We evaluated a multiplex RE-PCR for the diagnosis of key Trichostrongylus spp. Genomic DNA amplification of Trichostrongylus colubriformis, Trichostrongylus axei and Trichostrongylus vitrinus was achieved as standard sample using specific primers located in the second internal transcribed spacer (ITSII) of nuclear ribosomal DNA (rDNA). The mentioned method was based on isolation of Trichostrongylus ova from human fecal samples using Willis method, the extraction of ova genomic DNA samples, followed by rDNA ITSII PCR and one-step multiplex RE-PCR using three restriction enzymes of HinfI, DraI, and MseI. The multiplex RE-PCR technique provides a useful tool for discriminating all Trichostrongylus spp., being useful for diagnostic, epidemiological, ecological studies, and control programs. This method is rapid, especially when numerous restriction enzymes are required for species differentiation or identification. Copyright © 2017. Published by Elsevier B.V.

  15. Technical Aspects of Nominal Partitions on Accuracy of Data Mining Classification of Intestinal Microbiota - Comparison between 7 Restriction Enzymes.

    Science.gov (United States)

    Kobayashi, Toshio; Fujiwara, Kenji

    2014-01-01

    The application of data mining analyses (DM) is effective for the quantitative classification of human intestinal microbiota (HIM). However, there remain various technical problems that must be overcome. This paper deals with the number of nominal partitions (NP) of the target dataset, which is a major technical problem. We used here terminal restriction fragment length polymorphism data, which was obtained from the feces of 92 Japanese men. Data comprised operational taxonomic units (OTUs) and subject smoking and drinking habits, which were effectively classified by two NP (2-NP; Yes or No). Using the same OTU data, 3-NP and 5-NP were examined here and results were obtained, focusing on the accuracies of prediction, and the reliability of the selected OTUs by DM were compared to the former 2-NP. Restriction enzymes for PCR were further affected by the accuracy and were compared with 7 enzymes. There were subjects who possess HIM at the border zones of partitions, and the greater the number of partitions, the lower the obtained DM accuracy. The application of balance nodes boosted and duplicated the data, and was able to improve accuracy. More accurate and reliable DM operations are applicable to the classification of unknown subjects for identifying various characteristics, including disease.

  16. Interrogating the activities of conformational deformed enzyme by single-molecule fluorescence-magnetic tweezers microscopy

    Science.gov (United States)

    Guo, Qing; He, Yufan; Lu, H. Peter

    2015-01-01

    Characterizing the impact of fluctuating enzyme conformation on enzymatic activity is critical in understanding the structure–function relationship and enzymatic reaction dynamics. Different from studying enzyme conformations under a denaturing condition, it is highly informative to manipulate the conformation of an enzyme under an enzymatic reaction condition while monitoring the real-time enzymatic activity changes simultaneously. By perturbing conformation of horseradish peroxidase (HRP) molecules using our home-developed single-molecule total internal reflection magnetic tweezers, we successfully manipulated the enzymatic conformation and probed the enzymatic activity changes of HRP in a catalyzed H2O2–amplex red reaction. We also observed a significant tolerance of the enzyme activity to the enzyme conformational perturbation. Our results provide a further understanding of the relation between enzyme behavior and enzymatic conformational fluctuation, enzyme–substrate interactions, enzyme–substrate active complex formation, and protein folding–binding interactions. PMID:26512103

  17. The restriction enzyme SgrAI: structure solution via combination of poor MIRAS and MR phases

    Energy Technology Data Exchange (ETDEWEB)

    Dunten, Pete W., E-mail: pete@slac.stanford.edu [Stanford Synchrotron Radiation Laboratory, Stanford University, Menlo Park, CA 94025 (United States); Little, Elizabeth J.; Horton, Nancy C. [Department of Biochemistry and Molecular Biophysics, University of Arizona, Tucson, AZ 85721 (United States); Stanford Synchrotron Radiation Laboratory, Stanford University, Menlo Park, CA 94025 (United States)

    2009-04-01

    Phase information from both MIRAS and MR was used to produce an interpretable electron-density map of the novel type II restriction endonuclease SgrAI bound to DNA. The MR solution corrected an instructive error in the initially chosen averaging transformation. Uninterpretable electron-density maps were obtained using either MIRAS phases or MR phases in attempts to determine the structure of the type II restriction endonuclease SgrAI bound to DNA. While neither solution strategy was particularly promising (map correlation coefficients of 0.29 and 0.22 with the final model, respectively, for the MIRAS and MR phases and Phaser Z scores of 4.0 and 4.3 for the rotation and translation searches), phase combination followed by density modification gave a readily interpretable map. MR with a distantly related model located a dimer in the asymmetric unit and provided the correct transformation to use in averaging electron density between SgrAI subunits. MIRAS data sets with low substitution and MR solutions from only distantly related models should not be ignored, as poor-quality starting phases can be significantly improved. The bootstrapping strategy employed to improve the initial MIRAS phases is described.

  18. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  19. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations.

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-12-02

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Development of restriction enzyme analyses to distinguish winter moth from bruce spanworm and hybrids between them

    Science.gov (United States)

    Marinko Sremac; Joseph Elkinton; Adam. Porter

    2011-01-01

    Elkinton et. al. recently completed a survey of northeastern North America for the newly invasive winter moth, Operophtera brumata L. The survey used traps baited with the winter moth pheromone, which consists of a single compound also used by Bruce spanworm, O. bruceata (Hulst), the North American congener of winter moth. Our...

  1. Direct subcloning of target region from BAC insert using restriction enzymes that produce non-identical cohesive ends.

    Science.gov (United States)

    Ohmi, Yuhsuke; Sato, Masahiro; Ohtsuka, Masato

    2004-01-01

    Type IIS or interrupted palindrome restriction endonuclease digestion produces unique cohesive ends. Utilization of this feature of BglI, SfiI and BstXI has led to direct subcloning of 28.5-kb and 22.9-kb regions, which contains candidate genes for medaka Double anal fin (Da) mutant, from a 229-kb BAC insert. This method does not contain gel-fractionation of the fragments and time-consuming screening process using hybridization. Non-recombinant backgrounds were distinguished from recombinant clones by introducing GFPuv gene into the subcloning vector. This strategy was successfully applicable even when the target region was cut into three fragments by these enzymes.

  2. Characterizing restriction enzyme-associated loci in historic ragweed (Ambrosia artemisiifolia) voucher specimens using custom-designed RNA probes

    DEFF Research Database (Denmark)

    Sanchez Barreiro, Fatima; Garrett Vieira, Filipe Jorge; Martin, Michael David

    2017-01-01

    , samples with degraded DNA are generally unsuitable for RRL methods. Given that ancient and historic specimens can provide key temporal perspectives to evolutionary questions, we explored how custom-designed RNA probes could enrich for RRL loci (Restriction Enzyme-Associated Loci baits, or REALbaits......). Starting with Genotyping-by-Sequencing (GBS) data generated on modern common ragweed (Ambrosia artemisiifolia L.) specimens, we designed 20,000 RNA probes to target well-characterized genomic loci in herbarium voucher specimens dating from 1835-1913. Compared to shotgun sequencing, we observed enrichment...... of the targeted loci at 19-151-fold. Using our GBS capture pipeline on a dataset of 38 herbarium samples, we discovered 22,813 SNPs, providing sufficient genomic resolution to distinguish geographic populations. For these samples, we found that dilution of REALbaits to 10% of their original concentration still...

  3. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  4. A novel whole genome amplification method using type IIS restriction enzymes to create overhangs with random sequences.

    Science.gov (United States)

    Pan, Xiaoming; Wan, Baihui; Li, Chunchuan; Liu, Yu; Wang, Jing; Mou, Haijin; Liang, Xingguo

    2014-08-20

    Ligation-mediated polymerase chain reaction (LM-PCR) is a whole genome amplification (WGA) method, for which genomic DNA is cleaved into numerous fragments and then all of the fragments are amplified by PCR after attaching a universal end sequence. However, the self-ligation of these fragments could happen and may cause biased amplification and restriction of its application. To decrease the self-ligation probability, here we use type IIS restriction enzymes to digest genomic DNA into fragments with 4-5nt long overhangs with random sequences. After ligation to an adapter with random end sequences to above fragments, PCR is carried out and almost all present DNA sequences are amplified. In this study, whole genome of Vibrio parahaemolyticus was amplified and the amplification efficiency was evaluated by quantitative PCR. The results suggested that our approach could provide sufficient genomic DNA with good quality to meet requirements of various genetic analyses. Copyright © 2014. Published by Elsevier B.V.

  5. Induction of DNA double-strand breaks by restriction enzymes in X-ray-sensitive mutant Chinese hamster ovary cells measured by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kinashi, Yuko; Nagasawa, Hatsumi; Little, J.B.; Okayasu, Ryuichi; Iliakis, G.E.

    1995-01-01

    This investigation was designed to determine whether the cytotoxic effects of different restriction endonucleases are related to the number and type of DNA double-strand breaks (DSBs) they produce. Chinese hamster ovary (CHO) K1 and xrs-5 cells, a radiosensitive mutant of CHO K1, were exposed to restriction endonucleases HaeIII, HinfI, PvuII and BamHI by electroporation. These enzymes represent both blunt and sticky end cutters with differing recognition sequence lengths. The number of DSBs was measured by pulsed-field gel electrophoresis (PFGE). Two forms of PFGE were employed: asymmetric field-inversion gel electrophoresis (AFIGE) for measuring the kinetics of DNA breaks by enzyme digestion and clamped homogeneous gel electrophoresis (CHEF) for examining the size distributions of damaged DNA. The amount of DNA damage induced by exposure to all four restriction enzymes was significantly greater in xrs-5 compared to CHO K1 cells, consistent with the reported DSB repair deficiency in these cells. Since restriction endonucleases produce DSBs alone as opposed to the various types of DNA damage induced by X rays, these results confirm that the repair defect in this mutant involves the rejoining of DSBs. Although the cutting frequency was directly related to the length of the recognition sequence for four restriction enzymes, there was no simple correlation between the cytotoxic effect and the amount of DNA damage produced by each enzyme in either cell line. This finding suggests that the type or nature of the cutting sequence itself may play a role in restriction enzyme-induced cell killing. 32 refs., 6 figs., 3 tabs

  6. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  7. Single lipid vesicle assay for characterizing single-enzyme kinetics of phospholipid hydrolysis in a complex biological fluid.

    Science.gov (United States)

    Tabaei, Seyed R; Rabe, Michael; Zetterberg, Henrik; Zhdanov, Vladimir P; Höök, Fredrik

    2013-09-25

    Imaging of individual lipid vesicles is used to track single-enzyme kinetics of phospholipid hydrolysis. The method is employed to quantify the catalytic activity of phospholipase A2 (PLA2) in both pure and complex biological fluids. The measurements are demonstrated to offer a subpicomolar limit of detection (LOD) of human secretory PLA2 (sPLA2) in up to 1000-fold-diluted cerebrospinal fluid (CSF). An additional new feature provided by the single-enzyme sensitivity is that information about both relative concentration variations of active sPLA2 in CSF and the specific enzymatic activity can be simultaneously obtained. When CSF samples from healthy controls and individuals diagnosed with Alzheimer's disease (AD) are analyzed, the specific enzymatic activity is found to be preserved within 7% in the different CSF samples whereas the enzyme concentration differs by up to 56%. This suggests that the previously reported difference in PLA2 activity in CSF samples from healthy and AD individuals originates from differences in the PLA2 expression level rather than from the enzyme activity. Conventional ensemble averaging methods used to probe sPLA2 activity do not allow one to obtain such information. Together with an improvement in the LOD of at least 1 order of magnitude compared to that of conventional assays, this suggests that the method will become useful in furthering our understanding of the role of PLA2 in health and disease and in detecting the pharmacodynamic effects of PLA2-targeting drug candidates.

  8. Engineering BspQI nicking enzymes and application of N.BspQI in DNA labeling and production of single-strand DNA.

    Science.gov (United States)

    Zhang, Penghua; Too, Priscilla Hiu-Mei; Samuelson, James C; Chan, Siu-Hong; Vincze, Tamas; Doucette, Stephanie; Bäckström, Stefan; Potamousis, Konstantinos D; Schramm, Timothy M; Forrest, Dan; Schwartz, David C; Xu, Shuang-yong

    2010-02-01

    BspQI is a thermostable Type IIS restriction endonuclease (REase) with the recognition sequence 5'GCTCTTC N1/N4 3'. Here we report the cloning and expression of the bspQIR gene for the BspQI restriction enzyme in Escherichia coli. Alanine scanning of the BspQI charged residues identified a number of DNA nicking variants. After sampling combinations of different amino acid substitutions, an Nt.BspQI triple mutant (E172A/E248A/E255K) was constructed with predominantly top-strand DNA nicking activity. Furthermore, a triple mutant of BspQI (Nb.BspQI, N235A/K331A/R428A) was engineered to create a bottom-strand nicking enzyme. In addition, we demonstrated the application of Nt.BspQI in optical mapping of single DNA molecules. Nt or Nb.BspQI-nicked dsDNA can be further digested by E. coli exonuclease III to create ssDNA for downstream applications. BspQI contains two potential catalytic sites: a top-strand catalytic site (Ct) with a D-H-N-K motif found in the HNH endonuclease family and a bottom-strand catalytic site (Cb) with three scattered Glu residues. BlastP analysis of proteins in GenBank indicated a putative restriction enzyme with significant amino acid sequence identity to BspQI from the sequenced bacterial genome Croceibacter atlanticus HTCC2559. This restriction gene was amplified by PCR and cloned into a T7 expression vector. Restriction mapping and run-off DNA sequencing of digested products from the partially purified enzyme indicated that it is an EarI isoschizomer with 6-bp recognition, which we named CatHI (CTCTTC N1/N4).

  9. The role of the methyltransferase domain of bifunctional restriction enzyme RM.BpuSI in cleavage activity.

    Directory of Open Access Journals (Sweden)

    Arthur Sarrade-Loucheur

    Full Text Available Restriction enzyme (REase RM.BpuSI can be described as a Type IIS/C/G REase for its cleavage site outside of the recognition sequence (Type IIS, bifunctional polypeptide possessing both methyltransferase (MTase and endonuclease activities (Type IIC and endonuclease activity stimulated by S-adenosyl-L-methionine (SAM (Type IIG. The stimulatory effect of SAM on cleavage activity presents a major paradox: a co-factor of the MTase activity that renders the substrate unsusceptible to cleavage enhances the cleavage activity. Here we show that the RM.BpuSI MTase activity modifies both cleavage substrate and product only when they are unmethylated. The MTase activity is, however, much lower than that of M1.BpuSI and is thought not to be the major MTase for host DNA protection. SAM and sinefungin (SIN increase the Vmax of the RM.BpuSI cleavage activity with a proportional change in Km, suggesting the presence of an energetically more favorable pathway is taken. We further showed that RM.BpuSI undergoes substantial conformational changes in the presence of Ca(2+, SIN, cleavage substrate and/or product. Distinct conformers are inferred as the pre-cleavage/cleavage state (in the presence of Ca(2+, substrate or both and MTase state (in the presence of SIN and substrate, SIN and product or product alone. Interestingly, RM.BpuSI adopts a unique conformation when only SIN is present. This SIN-bound state is inferred as a branch point for cleavage and MTase activity and an intermediate to an energetically favorable pathway for cleavage, probably through increasing the binding affinity of the substrate to the enzyme under cleavage conditions. Mutation of a SAM-binding residue resulted in altered conformational changes in the presence of substrate or Ca(2+ and eliminated cleavage activity. The present study underscores the role of the MTase domain as facilitator of efficient cleavage activity for RM.BpuSI.

  10. Structure, Mechanism, and Specificity of a Eukaryal tRNA Restriction Enzyme Involved in Self-Nonself Discrimination

    Directory of Open Access Journals (Sweden)

    Anupam K. Chakravarty

    2014-04-01

    Full Text Available tRNA restriction by anticodon nucleases underlies cellular stress responses and self-nonself discrimination in a wide range of taxa. Anticodon breakage inhibits protein synthesis, which, in turn, results in growth arrest or cell death. The eukaryal ribotoxin PaT secreted by Pichia acaciae inhibits growth of Saccharomyces cerevisiae via cleavage of tRNAGln(UUG. We find that recombinant PaT incises a synthetic tRNAGln(UUG stem-loop RNA by transesterification at a single site 3′ of the wobble uridine, yielding 2′,3′-cyclic phosphate and 5′-OH ends. Incision is suppressed by replacement of the wobble nucleobase with adenine or guanine. The crystal structure of PaT reveals a distinctive fold and active site, essential components of which are demonstrated by mutagenesis. Pichia acaciae evades self-toxicity via a distinctive intracellular immunity protein, ImmPaT, which binds PaT and blocks nuclease activity. Our results highlight the evolutionary diversity of tRNA restriction and immunity systems.

  11. Random amplified polymorphic DNA and restriction enzyme analysis of PCR amplified rDNA in taxonomy: Two identification techniques for food-borne yeasts

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Vogels, J.T.W.E.; Hofstra, H.; Veld, J.H.J. Huis in't; Vossen, J.M.B.M. van der

    1995-01-01

    The random amplified polymorphic DNA (RAPD) assay and the restriction enzyme analysis of PCR amplified rDNA are compared for the identification of the common spoilage yeasts Zygosaccharomyces bailii, Z. rouxii, Saccharomyces cerevisiae, Candida valida and C. lipolytica. Both techniques proved to be

  12. The univector plasmid-fusion system, a method for rapid construction of recombinant DNA without restriction enzymes.

    Science.gov (United States)

    Liu, Q; Li, M Z; Leibham, D; Cortez, D; Elledge, S J

    1998-12-03

    . Modern biological research is highly dependent upon recombinant DNA technology. Conventional cloning methods are time-consuming and lack uniformity. Thus, biological research is in great need of new techniques to rapidly, systematically and uniformly manipulate the large sets of genes currently available from genome projects. . We describe a series of new cloning methods that facilitate the rapid and systematic construction of recombinant DNA molecules. The central cloning method is named the univector plasmid-fusion system (UPS). The UPS uses Cre-lox site-specific recombination to catalyze plasmid fusion between the univector - a plasmid containing the gene of interest - and host vectors containing regulatory information. Fusion events are genetically selected and place the gene under the control of new regulatory elements. A second UPS-related method allows for the precise transfer of coding sequences only from the univector into a host vector. The UPS eliminates the need for restriction enzymes, DNA ligases and many in vitro manipulations required for subcloning, and allows for the rapid construction of multiple constructs for expression in multiple organisms. We demonstrate that UPS can also be used to transfer whole libraries into new vectors. Additional adaptations are described, including directional PCR cloning and the generation of 3' end gene fusions using homologous recombination in Escherichia coli. . Together, these recombination-based cloning methods constitute a new comprehensive approach for the rapid and efficient generation of recombinant DNA that can be used for parallel processing of large gene sets, a feature that will facilitate future genomic analysis.

  13. Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

    Science.gov (United States)

    Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

    2016-09-01

    A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

    DEFF Research Database (Denmark)

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside...... into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes......-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression...

  15. Enhancement of PCR Detection Limit by Single-Tube Restriction Endonuclease-PCR (RE-PCR).

    Science.gov (United States)

    Datta, Sibnarayan; Budhauliya, Raghvendra; Chatterjee, Soumya; Vanlalhmuaka; Veer, Vijay; Chakravarty, Runu

    2016-06-01

    Polymerase chain reaction (PCR) is widely used in biological research and diagnostics because of its high sensitivity and specificity. However, the sensitivity of PCR is strongly influenced by topological characteristics of the template. Supercoiled templates are known to inhibit PCR, whereas linearized forms of the same supercoiled templates facilitate PCR. This study was conducted to compare the PCR efficiency of circular supercoiled DNA templates to their restriction endonuclease (RE)-mediated linearized forms. Additionally, we also evaluated the possibility of RE digestion of the circular supercoiled templates within the complete PCR buffer. Following a systematic approach, we demonstrated that circular supercoiled templates could be efficiently linearized by RE in the complete PCR buffer itself. This allowed linearization of circular supercoiled templates and their subsequent amplification in the PCR buffer in a single-tube format. Using this extremely simple RE-PCR approach, we documented up to tenfold increases in detection efficiency of PCR with two different circular supercoiled templates of clinical origin, including an international calibration standard. This inexpensive and easy approach to increasing PCR sensitivity can be easily adapted to any standard PCR protocol aimed at amplifying circular supercoiled genomes. Apart from its application in the development of sensitive clinical diagnostic PCR assays for a large number of organisms, this method could also prove to be very useful in simplifying the existing protocols for other applications where pre-PCR restriction digestion is required, such as mutation detection, genotyping, and selective template amplification.

  16. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes.

    Science.gov (United States)

    Rand, Keith N; Young, Graeme P; Ho, Thu; Molloy, Peter L

    2013-01-07

    We have developed a novel technique for specific amplification of rare methylated DNA fragments in a high background of unmethylated sequences that avoids the need of bisulphite conversion. The methylation-dependent restriction enzyme GlaI is used to selectively cut methylated DNA. Then targeted fragments are tagged using specially designed 'helper' oligonucleotides that are also used to maintain selection in subsequent amplification cycles in a process called 'helper-dependent chain reaction'. The process uses disabled primers called 'drivers' that can only prime on each cycle if the helpers recognize specific sequences within the target amplicon. In this way, selection for the sequence of interest is maintained throughout the amplification, preventing amplification of unwanted sequences. Here we show how the method can be applied to methylated Septin 9, a promising biomarker for early diagnosis of colorectal cancer. The GlaI digestion and subsequent amplification can all be done in a single tube. A detection sensitivity of 0.1% methylated DNA in a background of unmethylated DNA was achieved, which was similar to the well-established Heavy Methyl method that requires bisulphite-treated DNA.

  17. [Controlling arachidonic acid metabolic network: from single- to multi-target inhibitors of key enzymes].

    Science.gov (United States)

    Liu, Ying; Chen, Zheng; Shang, Er-chang; Yang, Kun; Wei, Deng-guo; Zhou, Lu; Jiang, Xiao-lu; He, Chong; Lai, Lu-hua

    2009-03-01

    Inflammatory diseases are common medical conditions seen in disorders of human immune system. There is a great demand for anti-inflammatory drugs. There are major inflammatory mediators in arachidonic acid metabolic network. Several enzymes in this network have been used as key targets for the development of anti-inflammatory drugs. However, specific single-target inhibitors can not sufficiently control the network balance and may cause side effects at the same time. Most inflammation induced diseases come from the complicated coupling of inflammatory cascades involving multiple targets. In order to treat these complicated diseases, drugs that can intervene multi-targets at the same time attracted much attention. The goal of this review is mainly focused on the key enzymes in arachidonic acid metabolic network, such as phospholipase A2, cyclooxygenase, 5-lipoxygenase and eukotriene A4 hydrolase. Advance in single target and multi-targe inhibitors is summarized.

  18. Novel restriction enzyme SSiI for the detection of mutation in GyrA gene of Salmonella enterica serovar Typhi

    Directory of Open Access Journals (Sweden)

    Agrawal Parul

    2010-07-01

    Full Text Available Aim: Enteric fever is an ongoing problem in the developing nations. Resistance and reduced susceptibility to ciprofloxacin narrows the therapeutic options in enteric fever. The present study was carried out with the objective of determining molecular basis of resistance to fluoroquinolone among the clinical isolates of Salmonella enterica serovar Typhi from different parts of India. Materials and Methods: A total of 60 S.Typhi clinical isolates were subjected to antimicrobial susceptibility testing and determination of minimum inhibitory concentration (MIC to ciprofloxacin and nalidixic acid. Polymerase chain reaction (PCR for GyrA gene followed by restriction fragment length polymorphism (RFLP with restriction enzyme (RE SSiI was performed to detect mutation at position Ser83. Further confirmation of mutation was done by nucleotide sequencing of GyrA gene. Results: Isolates showed 100% sensitivity to first-line drugs ampicillin, chloramphenicol, and cotrimoxazole. Twelve of the 60 isolates (18% were susceptible to nalidixic acid (NASST and the remaining 48 (82% were resistant to nalidixic acid (NARST. Of these 48 NARST strains, 46 (97.5% had reduced susceptibility to ciprofloxacin (MIC 0.25-1.0 μg/mL, whereas 2 strains (2.75% were resistant to ciprofloxacin (MIC 4.0 μg/mL. In RFLP analysis, all the NASST strains showed 3 fragments, whereas all the NARST strains showed 2 fragments due to the loss of 1 restriction site as a result of mutation. All the NARST strains with reduced susceptibility to ciprofloxacin (n = 46 had a single mutation in gyrA gene (Ser 83→Tyr or Ser 83→Phe, whereas double mutations (Ser 83→Phe and Asp 87→Asn were found in each of the 2 ciprofloxacin-resistant strains. None of the NASST strains (n = 12 revealed any mutation. Conclusion: Our study exemplifies the correlation between nalidixic acid screening test, MIC values, and the detection of mutation in GyrA gene by PCR-RFLP with a novel RE SSiI.This was further

  19. Development of Colletotrichum gloeosporioides Restriction Enzyme-Mediated Integration Mutants as Biocontrol Agents Against Anthracnose Disease in Avocado Fruits.

    Science.gov (United States)

    Yakoby, N; Zhou, R; Kobiler, I; Dinoor, A; Prusky, D

    2001-02-01

    ABSTRACT Reduced-pathogenicity mutants of the avocado fruit pathogen Colletotrichum gloeosporioides isolate Cg-14 (teleomorph: Glomerella cingulata) were generated by insertional mutagenesis by restriction enzyme-mediated integration (REMI) transformation. Following seven transformations, 3,500 hygromycin-resistant isolates were subjected to a virulence assay by inoculation on mesocarp and pericarp of cv. Fuerte avocado fruits. Fourteen isolates showed a reduced degree of virulence relative compared with wild-type Cg-14. Two isolates, Cg-M-142 and Cg-M-1150, were further characterized. Cg-M-142 produced appressoria on avocado pericarp similar to Cg-14, but caused reduced symptom development on the fruit's pericarp and mesocarp. Isolate Cg-M-1150 did not produce appressoria; it caused much reduced maceration on the mesocarp and no symptoms on the pericarp. Southern blot analysis of Cg-M-142 and Cg-M-1150 showed REMI at different XbaI sites of the fungal genome. Pre-inoculation of avocado fruit with Cg-M-142 delayed symptom development by the wild-type isolate. Induced resistance was accompanied by an increase in the levels of preformed antifungal diene, from 760 to 1,200 mug/g fresh weight 9 days after inoculation, whereas pre-inoculation with Cg-M-1150 did not affect the level of antifungal diene, nor did it delay the appearance of decay symptoms. The results presented here show that reduced-pathogenicity isolates can be used for the biological control of anthracnose caused by C. gloeosporioides attack.

  20. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  1. Identification of the EcoKI and EcoR124I Type I restriction--modification enzyme subunits by non-equilibrium pH gradient two-dimensional gel electrophoresis.

    Science.gov (United States)

    Nguyen, L D; Cajthamlová, K; Nguyen, H T; Weiser, J; Holubová, I; Weiserová, M

    2002-01-01

    Effectively optimized and reproducible procedure for monitoring the composition of type I restriction-modification endonucleases EcoKI and EcoR124I by non-equilibrium pH gradient two-dimensional (2-D) gel electrophoresis is described. Three subunits of the enzyme complex, which widely differ from one another in their isoelectric points and molar mass, were identified in crude cell extracts of E. coli. For the first time all three subunits of both EcoKI and EcoR124I were detected as distinct spots on a single 2-D gel. A sensitive immunoblotting procedure was suggested suitable for routine use in determining the identity of individual subunits. Potential application of this method for detailed studies of regulation of the function and stoichiometry of the enzyme complexes is discussed.

  2. Single-stranded DNA cleavage by divergent CRISPR-Cas9 enzymes

    Science.gov (United States)

    Ma, Enbo; Harrington, Lucas B.; O’Connell, Mitchell R.; Zhou, Kaihong; Doudna, Jennifer A.

    2015-01-01

    Summary Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of type II CRISPR-Cas immune systems. Cas9–guide RNA complexes recognize 20-base-pair sequences in DNA and generate a site-specific double-strand break, a robust activity harnessed for genome editing. DNA recognition by all studied Cas9 enzymes requires a protospacer adjacent motif (PAM) next to the target site. We show that Cas9 enzymes from evolutionarily divergent bacteria can recognize and cleave single-stranded DNA (ssDNA) by an RNA-guided, PAM-independent recognition mechanism. Comparative analysis shows that in contrast to the type II-A S. pyogenes Cas9 that is widely used for genome engineering, the smaller type II-C Cas9 proteins have limited dsDNA binding and unwinding activity and promiscuous guide-RNA specificity. These results indicate that inefficiency of type II-C Cas9 enzymes for genome editing results from a limited ability to cleave dsDNA, and suggest that ssDNA cleavage was an ancestral function of the Cas9 enzyme family. PMID:26545076

  3. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

    Science.gov (United States)

    Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  4. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

    Science.gov (United States)

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-06-19

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.

  5. Kinetics of Single-Enzyme Reactions on Vesicles: Role of Substrate Aggregation

    Science.gov (United States)

    Zhdanov, Vladimir P.

    2015-03-01

    Enzymatic reactions occurring in vivo on lipid membranes can be influenced by various factors including macromolecular crowding in general and substrate aggregation in particular. In academic studies, the role of these factors can experimentally be clarified by tracking single-enzyme kinetics occurring on individual lipid vesicles. To extend the conceptual basis for such experiments, we analyze herein the corresponding kinetics mathematically with emphasis on the role of substrate aggregation. In general, the aggregation may occur on different length scales. Small aggregates may e.g. contain a few proteins or peptides while large aggregates may be mesoscopic as in the case of lipid domains which can be formed in the membranes composed of different lipids. We present a kinetic model describing comprehensively the effect of aggregation of the former type on the dependence of the reaction rate on substrate membrane concentration. The results obtained with physically reasonable parameters indicate that the aggregation-related deviations from the conventional Michaelis-Menten kinetics may be appreciable. Special Issue Comments: This theoretical article is focused on single-enzyme reactions occurring in parallel with substrate aggregation on individual vesicles. This subject is related to a few Special Issue articles concerning enzyme dynamics6,7 and function8 and mathematical aspects of stochastic kinetics.9

  6. In silico enhanced restriction enzyme based methylation analysis of the human glioblastoma genome using Agilent 244K CpG Island microarrays

    Directory of Open Access Journals (Sweden)

    Anh Tran

    2010-01-01

    Full Text Available Genome wide methylation profiling of gliomas is likely to provide important clues to improving treatment outcomes. Restriction enzyme based approaches have been widely utilized for methylation profiling of cancer genomes and will continue to have importance in combination with higher density microarrays. With the availability of the human genome sequence and microarray probe sequences, these approaches can be readily characterized and optimized via in silico modeling. We adapted the previously described HpaII/MspI based Methylation Sensitive Restriction Enzyme (MSRE assay for use with two-color Agilent 244K CpG island microarrays. In this assay, fragmented genomic DNA is digested in separate reactions with isoschizomeric HpaII (methylation-sensitive and MspI (methylation-insensitive restriction enzymes. Using in silico hybridization, we found that genomic fragmentation with BfaI was superior to MseI, providing a maximum effective coverage of 22,362 CpG islands in the human genome. In addition, we confirmed the presence of an internal control group of fragments lacking HpaII/MspI sites which enable separation of methylated and unmethylated fragments. We used this method on genomic DNA isolated from normal brain, U87MG cells, and a glioblastoma patient tumor sample and confirmed selected differentially methylated CpG islands using bisulfite sequencing. Along with additional validation points, we performed a receiver operating characteristics (ROC analysis to determine the optimal threshold (p ≤ 0.001. Based on this threshold, we identified ~2400 CpG islands common to all three samples and 145 CpG islands unique to glioblastoma. These data provide more general guidance to individuals seeking to maximize effective coverage using restriction enzyme based methylation profiling approaches.

  7. H-2 restriction: Independent recognition of H-2 and foreign antigen by a single receptor

    Science.gov (United States)

    Siliciano, Robert F.; Zacharchuk, Charles M.; Shin, Hyun S.

    1980-01-01

    We describe two situations in which the recognition of hapten can compensate for the lack of recognition of appropriate H-2 gene products in hapten-specific, H-2 restricted, T lymphocyte-mediated cytolysis. First, we show that although recognition of appropriate H-2 gene products is essential for the lysis of target cells bearing a low hapten density, significant hapten-specific lysis of H-2 inappropriate target cells is observed at high levels of target cell derivatization. Secondly, we show that hapten-conjugated anti-H-2 antibody inhibits cytolysis poorly even though its binding to target cell H-2 antigens is equivalent to that of underivatized antibody. These results suggest that hapten and H-2 are recognized independently and are therefore inconsistent with the altered-self model. Although our data do not exclude the dual-recognition model, we prefer to interpret them within the framework of a single-receptor model in which hapten and H-2 are recognized independently by receptors of identical idiotype on the T cell. We postulate that the affinity of these receptors for the relevant H-2 gene product is low enough so that the T cell is not activated by encounters with normal-self cells expressing that H-2 gene product. However, when self cells express in addition a foreign antigen that can also be recognized by the same receptor, then the force of T cell-target cell interaction may be increased sufficiently to activate T cell effector function. PMID:6966404

  8. Effects of realimentation after nutrient restriction during mid- to late gestation on pancreatic digestive enzymes, serum insulin and glucose levels, and insulin-containing cell cluster morphology.

    Science.gov (United States)

    Keomanivong, F E; Camacho, L E; Lemley, C O; Kuemper, E A; Yunusova, R D; Borowicz, P P; Kirsch, J D; Vonnahme, K A; Caton, J S; Swanson, K C

    2017-06-01

    This study examined effects of stage of gestation and nutrient restriction with subsequent realimentation on maternal and foetal bovine pancreatic function. Dietary treatments were assigned on day 30 of pregnancy and included: control (CON; 100% requirements; n = 18) and restricted (R; 60% requirements; n = 30). On day 85, cows were slaughtered (CON, n = 6; R, n = 6), remained on control (CC; n = 12) and restricted (RR; n = 12), or realimented to control (RC; n = 11). On day 140, cows were slaughtered (CC, n = 6; RR, n = 6; RC, n = 5), remained on control (CCC, n = 6; RCC, n = 5) or realimented to control (RRC, n = 6). On day 254, the remaining cows were slaughtered and serum samples were collected from the maternal jugular vein and umbilical cord to determine insulin and glucose concentrations. Pancreases from cows and foetuses were removed, weighed, and subsampled for enzyme and histological analysis. As gestation progressed, maternal pancreatic α-amylase activity decreased and serum insulin concentrations increased (p ≤ 0.03). Foetal pancreatic trypsin activity increased (p enzymes are influenced by nutrient restriction and there is a potential for programming of increased foetal digestive enzyme production resulting from previous maternal nutrient restriction. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  9. Identification and characterization of CbeI, a novel thermostable restriction enzyme from Caldicellulosiruptor bescii DSM 6725 and a member of a new subfamily of HaeIII-like enzymes.

    Science.gov (United States)

    Chung, Dae-Hwan; Huddleston, Jennifer R; Farkas, Joel; Westpheling, Janet

    2011-11-01

    Potent HaeIII-like DNA restriction activity was detected in cell-free extracts of Caldicellulosiruptor bescii DSM 6725 using plasmid DNA isolated from Escherichia coli as substrate. Incubation of the plasmid DNA in vitro with HaeIII methyltransferase protected it from cleavage by HaeIII nuclease as well as cell-free extracts of C. bescii. The gene encoding the putative restriction enzyme was cloned and expressed in E. coli with a His-tag at the C-terminus. The purified protein was 38 kDa as predicted by the 981-bp nucleic acid sequence, was optimally active at temperatures between 75°C and 85°C, and was stable for more than 1 week when stored at 35°C. The cleavage sequence was determined to be 5'-GG/CC-3', indicating that CbeI is an isoschizomer of HaeIII. A search of the C. bescii genome sequence revealed the presence of both a HaeIII-like restriction endonuclease (Athe 2438) and DNA methyltransferase (Athe 2437). Preliminary analysis of other Caldicellulosiruptor species suggested that this restriction/modification activity is widespread in this genus. A phylogenetic analysis based on sequence alignment and conserved motif searches identified features of CbeI distinct from other members of this group and classified CbeI as a member of a novel subfamily of HaeIII-like enzymes.

  10. Applying Data Mining to Classify Age by Intestinal Microbiota in 92 Healthy Men Using a Combination of Several Restriction Enzymes for T-RFLP Experiments.

    Science.gov (United States)

    Kobayashi, Toshio; Osaki, Takako; Oikawa, Shinya

    2014-01-01

    The composition of the intestinal microbiota was measured following consumption of identical meals for 3 days in 92 Japanese men, and terminal restriction fragment length polymorphism (T-RFLP) was used to analyze their feces. The obtained operational taxonomic units (OTUs) and the subjects' ages were classified by using Data mining (DM) software that compared these data with continuous data and for 5 partitions for age divided at 5 years intervals between the ages of 30 and 50. The DM provided Decision trees in which the selected OTUs were closely related to the ages of the subjects. DM was also used to compare the OTUs from the T-RFLP data with seven restriction enzymes (two enzymes of 516f-BslI and 516f-HaeIII, two enzymes of 27f-MspI and 27f-AluI, three enzymes of 35f-HhaI, 35f-MspI and 35f-AluI) and their various combinations. The OTUs delivered from the five enzyme-digested partitions were analyzed to classify their age clusters. For use in future DM processing, we discussed the enzymes that were effective for accurate classification. We selected two OTUs (HA624 and HA995) that were useful for classifying the subject's ages. Depending on the 16S rRNA sequences of the OTUs, Ruminicoccus obeum clones 1-4 were present in 18 of 36 bacterial candidates in the older age group-related OTU (HA624). On the other hand, Ruminicoccus obeum clones 1-33 were present in 65 of 269 candidates in the younger age group-related OUT (HA995).

  11. Identifying sequential substrate binding at the single-molecule level by enzyme mechanical stabilization.

    Science.gov (United States)

    Rivas-Pardo, Jaime Andrés; Alegre-Cebollada, Jorge; Ramírez-Sarmiento, César A; Fernandez, Julio M; Guixé, Victoria

    2015-01-01

    Enzyme-substrate binding is a dynamic process intimately coupled to protein structural changes, which in turn changes the unfolding energy landscape. By the use of single-molecule force spectroscopy (SMFS), we characterize the open-to-closed conformational transition experienced by the hyperthermophilic adenine diphosphate (ADP)-dependent glucokinase from Thermococcus litoralis triggered by the sequential binding of substrates. In the absence of substrates, the mechanical unfolding of TlGK shows an intermediate 1, which is stabilized in the presence of Mg·ADP(-), the first substrate to bind to the enzyme. However, in the presence of this substrate, an additional unfolding event is observed, intermediate 1*. Finally, in the presence of both substrates, the unfolding force of intermediates 1 and 1* increases as a consequence of the domain closure. These results show that SMFS can be used as a powerful experimental tool to investigate binding mechanisms of different enzymes with more than one ligand, expanding the repertoire of protocols traditionally used in enzymology.

  12. Design of a single-chain multi-enzyme fusion protein establishing the polyhydroxybutyrate biosynthesis pathway.

    Science.gov (United States)

    Mullaney, Jane A; Rehm, Bernd H A

    2010-05-03

    Polyhydroxyalkanoates are biodegradable biocompatible polymers naturally produced by various bacteria and archaea. Biotechnological production in transgenic plants has already been demonstrated with efficient polyhydroxybutyrate production requiring targeting of the enzymes to the chloroplasts. Three enzymes are required to establish the polyhydroxybutyrate biosynthesis pathway in non-naturally producing microorganisms or plants. To facilitate production of biopolyesters in plants, a gene encoding a translational fusion of the polyhydroxybutyrate biosynthesis enzymes PhaA (beta-ketothiolase), PhaB (acetoacetyl-CoA reductase) and PhaC (PHA synthase) was constructed. Escherichia coli harboring a plasmid encoding this fusion protein (PhaA-PhaB-PhaC) under control of the lac promoter accumulated polyhydroxybutyrate contributing to 0.4% (w/w) of cellular dry weight. Insertion of an extended linker between PhaA and PhaB increased polyhydroxybutyrate accumulation to 3.9% (w/w) of cellular dry weight. Introduction of a second plasmid encoding PhaA and PhaB restored polyhydroxybutyrate accumulation to wildtype levels of about 35% (w/w) of cellular dry weight suggesting that the functions of PhaA and/or PhaB were limiting factors. Deletion of PhaA in trans led to significantly reduced polyhydroxybutyrate production suggesting that the PhaA activity in the fusion protein is reduced. This study showed that a single-chain translational fusion protein comprising the three enzymes essential for polyhydroxybutyrate synthesis can be engineered which will strongly facilitate the establishment of recombinant polyhydroxybutyrate production organisms particularly requiring targeting to sub-cellular compartments such as the chloroplasts in plants. 2010 Elsevier B.V. All rights reserved.

  13. Detection of restriction enzyme-digested target DNA by PCR amplification using a stem-loop primer: application to the detection of hypomethylated fetal DNA in maternal plasma.

    Science.gov (United States)

    Tong, Yu K; Chiu, Rossa W K; Leung, Tak Y; Ding, Chunming; Lau, Tze K; Leung, Tse N; Lo, Y M Dennis

    2007-11-01

    The discovery of cell-free fetal DNA in maternal plasma has opened up new possibilities for noninvasive prenatal diagnosis and monitoring. Among the fetal markers that have been described, methylation markers are sex and polymorphism independent. Methylation-sensitive restriction endonucleases are commonly used to digest hypomethylated DNA molecules, and the hypermethylated molecules remain intact for detection. The positive detection of the cleaved hypomethylated molecules would be useful for certain targets but has not been reported. The use of a stem-loop primer in microRNA detection has previously been described. In this study, DNA assays were designed and performed on maternal plasma, which contained the hypomethylated placental serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5; maspin) gene in an excess background of hypermethylated maternal SERPINB5. Detection of the enzyme-digested placenta-derived hypomethylated SERPINB5 molecules was achieved by performing stem-loop extension followed by real-time PCR on maternal plasma. The placental origin of the stem-loop-extended SERPINB5 molecules was confirmed by genotyping. From the real-time PCR results on maternal plasma, stem-loop-extended SERPINB5 promoter sequences were detectable in all 11 enzyme-digested predelivery maternal plasma samples. Postpartum clearance was demonstrated. In 9 cases in which the fetal and maternal SERPINB5 genotypes were distinguishable, the placental-specific genotypes were detected in all predelivery maternal plasma samples. Detection of restriction enzyme-digested hypomethylated placental DNA molecules in maternal plasma by the use of a stem-loop primer represents a novel approach in fetal epigenetic marker detection. The analytical approach may also be generally applicable to the detection of restriction enzyme-digested nucleic acid fragments.

  14. Single-Walled Carbon Nanotubes Inhibit the Cytochrome P450 Enzyme, CYP3A4

    Science.gov (United States)

    El-Sayed, Ramy; Bhattacharya, Kunal; Gu, Zonglin; Yang, Zaixing; Weber, Jeffrey K.; Li, Hu; Leifer, Klaus; Zhao, Yichen; Toprak, Muhammet S.; Zhou, Ruhong; Fadeel, Bengt

    2016-02-01

    We report a detailed computational and experimental study of the interaction of single-walled carbon nanotubes (SWCNTs) with the drug-metabolizing cytochrome P450 enzyme, CYP3A4. Dose-dependent inhibition of CYP3A4-mediated conversion of the model compound, testosterone, to its major metabolite, 6β-hydroxy testosterone was noted. Evidence for a direct interaction between SWCNTs and CYP3A4 was also provided. The inhibition of enzyme activity was alleviated when SWCNTs were pre-coated with bovine serum albumin. Furthermore, covalent functionalization of SWCNTs with polyethylene glycol (PEG) chains mitigated the inhibition of CYP3A4 enzymatic activity. Molecular dynamics simulations suggested that inhibition of the catalytic activity of CYP3A4 is mainly due to blocking of the exit channel for substrates/products through a complex binding mechanism. This work suggests that SWCNTs could interfere with metabolism of drugs and other xenobiotics and provides a molecular mechanism for this toxicity. Our study also suggests means to reduce this toxicity, eg., by surface modification.

  15. DNA double-strand break measurement in mammalian cells by pulsed-field gel electrophoresis: an approach using restriction enzymes and gene probing

    International Nuclear Information System (INIS)

    Loebrich, M.; Ikpeme, S.; Kiefer, J.

    1994-01-01

    DNA samples prepared from human SP 3 cells, which had not been exposed to various doses of X-ray, were treated with NotI restriction endonuclease before being run in a contour-clamped homogeneous electrophoresis system. The restriction enzyme cuts the DNA at defined positions delivering DNA sizes which can be resolved by pulsed-field gel electrophoresis (PFGE). In order to investigate only one of the DNA fragments, a human lactoferrin cDNA, pHL-41, was hybridized to the DNA separated by PFGE. As a result, only the DNA fragment which contains the hybridized gene was detected resulting in a one-band pattern. The decrease of this band was found to be exponential with increasing radiation dose. From the slope, a double-strand break induction rate of (6.3±0.7) x 10 -3 /Mbp/Gy was deduced for 80 kV X-rays. (Author)

  16. Phosphorylation of Type IA restriction-modification complex enzyme EcoKI on the HsdR subunit

    Czech Academy of Sciences Publication Activity Database

    Cajthamlová, Kamila; Šišáková, Eva; Weiser, Jaroslav; Weiserová, Marie

    2007-01-01

    Roč. 270, - (2007), s. 171-177 ISSN 0378-1097 R&D Projects: GA ČR GA204/07/0325; GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : protein phosphorylation * restriction-modification * subcellular fraction Subject RIV: EE - Microbiology, Virology Impact factor: 2.274, year: 2007

  17. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    Science.gov (United States)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.; Cooper, Laurie P.; White, John H.; Dryden, David T.F.

    2010-01-01

    We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Förster resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI. PMID:20599730

  18. The Type ISP Restriction-Modification enzymes LlaBIII and LlaGI use a translocation-collision mechanism to cleave non-specific DNA distant from their recognition sites.

    Science.gov (United States)

    Šišáková, Eva; van Aelst, Kara; Diffin, Fiona M; Szczelkun, Mark D

    2013-01-01

    The Type ISP Restriction-Modification (RM) enzyme LlaBIII is encoded on plasmid pJW566 and can protect Lactococcus lactis strains against bacteriophage infections in milk fermentations. It is a single polypeptide RM enzyme comprising Mrr endonuclease, DNA helicase, adenine methyltransferase and target-recognition domains. LlaBIII shares >95% amino acid sequence homology across its first three protein domains with the Type ISP enzyme LlaGI. Here, we determine the recognition sequence of LlaBIII (5'-TnAGCC-3', where the adenine complementary to the underlined base is methylated), and characterize its enzyme activities. LlaBIII shares key enzymatic features with LlaGI; namely, adenosine triphosphate-dependent DNA translocation (∼309 bp/s at 25°C) and a requirement for DNA cleavage of two recognition sites in an inverted head-to-head repeat. However, LlaBIII requires K(+) ions to prevent non-specific DNA cleavage, conditions which affect the translocation and cleavage properties of LlaGI. By identifying the locations of the non-specific dsDNA breaks introduced by LlaGI or LlaBIII under different buffer conditions, we validate that the Type ISP RM enzymes use a common translocation-collision mechanism to trigger endonuclease activity. In their favoured in vitro buffer, both LlaGI and LlaBIII produce a normal distribution of random cleavage loci centred midway between the sites. In contrast, LlaGI in K(+) ions produces a far more distributive cleavage profile.

  19. Influence of nutrient restriction and melatonin supplementation of pregnant ewes on maternal and fetal pancreatic digestive enzymes and insulin-containing clusters.

    Science.gov (United States)

    Keomanivong, F E; Lemley, C O; Camacho, L E; Yunusova, R; Borowicz, P P; Caton, J S; Meyer, A M; Vonnahme, K A; Swanson, K C

    2016-03-01

    Primiparous ewes (n=32) were assigned to dietary treatments in a 2×2 factorial arrangement to determine effects of nutrient restriction and melatonin supplementation on maternal and fetal pancreatic weight, digestive enzyme activity, concentration of insulin-containing clusters and plasma insulin concentrations. Treatments consisted of nutrient intake with 60% (RES) or 100% (ADQ) of requirements and melatonin supplementation at 0 (CON) or 5 mg/day (MEL). Treatments began on day 50 of gestation and continued until day 130. On day 130, blood was collected under general anesthesia from the uterine artery, uterine vein, umbilical artery and umbilical vein for plasma insulin analysis. Ewes were then euthanized and the pancreas removed from the ewe and fetus, trimmed of mesentery and fat, weighed and snap-frozen until enzyme analysis. In addition, samples of pancreatic tissue were fixed in 10% formalin solution for histological examination including quantitative characterization of size and distribution of insulin-containing cell clusters. Nutrient restriction decreased (P⩽0.001) maternal pancreatic mass (g) and α-amylase activity (U/g, kU/pancreas, U/kg BW). Ewes supplemented with melatonin had increased pancreatic mass (P=0.03) and α-amylase content (kU/pancreas and U/kg BW). Melatonin supplementation decreased (P=0.002) maternal pancreatic insulin-positive tissue area (relative to section of tissue), and size of the largest insulin-containing cell cluster (P=0.04). Nutrient restriction decreased pancreatic insulin-positive tissue area (P=0.03) and percent of large (32 001 to 512 000 µm2) and giant (⩾512 001 µm2) insulin-containing cell clusters (P=0.04) in the fetus. Insulin concentrations in plasma from the uterine vein, umbilical artery and umbilical vein were greater (P⩽0.01) in animals receiving 100% requirements. When comparing ewes to fetuses, ewes had a greater percentage of medium insulin-containing cell clusters (2001 to 32 000 µm2) while fetuses

  20. Technical Aspects of Nominal Partitions on Accuracy of Data Mining Classification of Intestinal Microbiota — Comparison between 7 Restriction Enzymes

    OpenAIRE

    KOBAYASHI, Toshio; FUJIWARA, Kenji

    2014-01-01

    The application of data mining analyses (DM) is effective for the quantitative classification of human intestinal microbiota (HIM). However, there remain various technical problems that must be overcome. This paper deals with the number of nominal partitions (NP) of the target dataset, which is a major technical problem. We used here terminal restriction fragment length polymorphism data, which was obtained from the feces of 92 Japanese men. Data comprised operational taxonomic units (OTUs) a...

  1. Comparison of time-restricted and ad libitum self-feeding on the growth, feeding behavior and daily digestive enzyme profiles of Atlantic salmon

    Science.gov (United States)

    Shi, Ce; Liu, Ying; Yi, Mengmeng; Zheng, Jimeng; Tian, Huiqin; Du, Yishuai; Li, Xian; Sun, Guoxiang

    2017-07-01

    Although it has been hypothesized that a predictable feeding regime in animals allows physiological variables to be adjusted to maximize nutrient utilization and, hence, better growth performance, the assumption has rarely been tested. This study compares the effects of time-restricted versus free access self-feeding on the growth, feeding behavior and daily digestive enzyme rhythms of Atlantic salmon ( Salmo salar). In an experiment that lasted 6 weeks, fish (109.9 g) were divided into two groups: group 1 had free access to a self-feeder (FA); group 2 received three meals per day (2 h per meal) at dawn, midday and dusk via a time-restricted self-feeder (TR). At the end of the experiment, the fish were sampled every 3 h over a 24-h period. The results showed that the TR fish quickly synchronized their feeding behavior to the feeding window and their blood glucose showed a significant postprandial increase, while FA fish displayed no statistically significant rhythms ( P>0.05). Pepsin activity of TR fish also showed a significant daily rhythm ( P0.05). In conclusion, the study failed to confirm a link between the entrainment of daily digestive enzyme profiles and growth performance, with the TR group showing comparatively poor blood glucose regulation.

  2. Use of T-RFLP and seven restriction enzymes to compare the faecal microbiota of obese and lean Japanese healthy men.

    Science.gov (United States)

    Kobayashi, T; Osaki, T; Oikawa, S

    2015-01-01

    The composition of the intestinal microbiota of 92 healthy Japanese men was measured following consumption of identical meals for 3 days; terminal restriction fragment length polymorphisms were then used to analyse the DNA content of their faeces. The obtained operational taxonomic units (OTUs) were further analysed using seven restriction enzymes: 516f-BslI and -HaeIII, 27f-MspI and -AluI, and 35f-HhaI, -MspI and -AluI. Subjects were classified by their body mass index (BMI) as lean (25.0). OTUs were then analysed using data mining software. Pearson correlation coefficients on data mining results indicated only a weak relationship between BMI and OTU diversity. Specific OTUs attributed to lean and obese subjects were further examined by data mining with six groups of enzymes and closely related accession numbers for lean and obese subjects were successfully narrowed down. 16S rRNA sequences showed Bacillus spp., Erysipelothrix spp. and Holdemania spp. to be present among 30 bacterial candidates related to the lean group. Fifteen candidates were classified Firmicutes, one was classified as Chloroflexi, and the others were not classified. 45 Microbacteriaceae, 11 uncultured Actinobacterium, and 3 other families were present among the 119 candidate OTUs related to obesity. We conclude that the presence of Firmicutes and Actinobacteria may be related to the BMI of the subject.

  3. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review

    Directory of Open Access Journals (Sweden)

    Shadi Rezai

    2017-01-01

    Full Text Available Introduction. Hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT or magnetic resonance imaging (MRI and a multidisciplinary management approach are required to improve perinatal outcome. Case. A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension presented at 26 weeks and 6 days of gestational age. She was noted to have hemolysis, elevated liver enzymes, and low platelets (HELLP syndrome accompanied by fetal growth restriction (FGR, during ultrasound evaluation, warranting premature delivery. The infant was delivered in stable condition suffering no permanent neurological deficit. Conclusion. HELLP syndrome is an uncommon and traumatic obstetric event which can lead to neurological deficits if not managed in a responsive and rapid manner. The central aggravating factor seems to be hypertension induced preeclamptic or eclamptic episode and complications thereof. The syndrome itself is manifested by hemolytic anemia, increased liver enzymes, and decreasing platelet counts with a majority of neurological defects resulting from hemorrhagic stroke or subarachnoid hemorrhage (SAH. To minimize adverse perinatal outcomes, obstetric management of this medical complication must include rapid clinical assessment, diagnostic examination, and neurosurgery consultation.

  4. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.; Cooper, Laurie P.; White, John H. [School of Chemistry, University of Edinburgh, The King' s Buildings, Edinburgh, EH9 3JJ (United Kingdom); Dryden, David T.F., E-mail: david.dryden@ed.ac.uk [School of Chemistry, University of Edinburgh, The King' s Buildings, Edinburgh, EH9 3JJ (United Kingdom)

    2010-07-23

    Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerster resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.

  5. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review.

    Science.gov (United States)

    Rezai, Shadi; Faye, Justin; Hughes, Alexander; Cheung, Mon-Lai; Cohen, Joel R; Kaia, Judy A; Fuller, Paul N; Henderson, Cassandra E

    2017-01-01

    Introduction . Hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT) or magnetic resonance imaging (MRI) and a multidisciplinary management approach are required to improve perinatal outcome. Case . A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension presented at 26 weeks and 6 days of gestational age. She was noted to have hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome accompanied by fetal growth restriction (FGR), during ultrasound evaluation, warranting premature delivery. The infant was delivered in stable condition suffering no permanent neurological deficit. Conclusion . HELLP syndrome is an uncommon and traumatic obstetric event which can lead to neurological deficits if not managed in a responsive and rapid manner. The central aggravating factor seems to be hypertension induced preeclamptic or eclamptic episode and complications thereof. The syndrome itself is manifested by hemolytic anemia, increased liver enzymes, and decreasing platelet counts with a majority of neurological defects resulting from hemorrhagic stroke or subarachnoid hemorrhage (SAH). To minimize adverse perinatal outcomes, obstetric management of this medical complication must include rapid clinical assessment, diagnostic examination, and neurosurgery consultation.

  6. [Liver enzymes elevation: etiologic study and efficiency of a single-act office visit].

    Science.gov (United States)

    Bendezú García, Rogger Álvaro; Casado Martín, Marta; Lázaro Sáez, Marta; Patrón Román, Gustavo Óliver; Gálvez Miras, Alejandra; Rodríguez Laiz, Gonzalo P; González Sánchez, Mercedes; Vega Sáenz, José Luis

    2013-01-01

    Liver enzyme (LE) elevation is a common finding in routine blood analysis. There is very little information on the most prevalent causes of these alterations in our population. In addition, a number of tests and several visits to the specialist are required to reach a diagnosis. For these reasons, we designed a protocol to streamline the evaluation of patients with LE elevations in a single-act office visit. From March 2008 until June 2010, we studied all patients with incidental LE elevation (isolated transaminase elevation, combined elevation of alkaline phosphatase [FA] and gamma-glutamyl transpeptidase [GGT], or isolated elevation of GGT) who were referred by their primary care physicians. At the time of referral, a complete biochemistry analysis was performed (LE, viral serology, autoantibodies, ceruloplasmin, iron metabolism, alpha-1-antitrypsin and thyroid hormones) and the patients underwent an abdominal ultrasound scan on the day of the office evaluation by the hepatologist. A total of 427 patients were included in our study. The most common cause of transaminase elevation was non-alcoholic fatty liver disease (NAFLD) (40%), followed by alcohol intake (17%), and hepatitis C virus infection (13%). Elevated GGT levels were most commonly related to NAFLD (30%), closely followed by alcohol intake (27%), and hepatotoxicity (8%). Combined elevation of GGT and FA was associated with NAFLD (21%), alcohol (17%), and hepatotoxicity (11%). Self-limited elevation was seen in 9% of the patients and we could not identify a definite cause in 11%. A definitive diagnosis was reached in 79% of the patients. The single-act office visit has proven to be efficient, yielding a diagnosis in most of the patients. The most common cause of elevated LE was NAFLD. Transaminase elevation must be confirmed before a more thorough work-up is started. Copyright © 2013 Elsevier España, S.L. and AEEH y AEG. All rights reserved.

  7. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice.

    Science.gov (United States)

    Fu, Zidong Donna; Klaassen, Curtis D

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Brief report: enzyme inducers reduce elimination half-life after a single dose of nevirapine in healthy women.

    NARCIS (Netherlands)

    L'homme, R.F.A.; Dijkema, T.; Ven, A.J.A.M. van der; Burger, D.M.

    2006-01-01

    OBJECTIVE: Single-dose nevirapine (SD-NVP) to prevent mother-to-child transmission (MTCT) of HIV is associated with development of NVP resistance, probably because of its long half-life in combination with a low genetic barrier to resistance. The objective of this study was to find enzyme inducers

  9. Effect of L-arginine supplementation on the hepatic phosphatidylinositol 3-kinase signaling pathway and gluconeogenic enzymes in early intrauterine growth-restricted rats.

    Science.gov (United States)

    Luo, Kaiju; Chen, Pingyang; Li, Suping; Li, Wen; He, Mingfeng; Wang, Tao; Chen, Juncao

    2017-09-01

    The present study aimed to investigate the response of the phosphatidylinositol 3-kinase (PI3K) signaling pathway and gluconeogenic enzymes in intrauterine growth-restricted rats to dietary L-arginine (L-Arg) supplementation during the lactation period early in life. Pregnant Sprague-Dawley rats were randomly divided into a control group (CON), an intrauterine growth restriction group (IUGR) and an L-Arg group (LA). The pregnant rats in the CON group were fed a 21% protein diet, and those in the IUGR and LA groups were fed a 10% low protein diet, and all rats were fed a 21% protein diet after delivery. Water was available ad libitum to the pregnant rats during the 21-day lactation period, and the water provided to the LA group included 200 mg/kg/day L-Arg. Blood glucose, serum insulin, homeostasis model of assessment for insulin resistance (HOMA-IR), PI3K and protein kinase B (PKB) protein expression, and phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G-6-Pase) mRNA expression in the offspring rats were measured postnatally at 1, 3 and 8 weeks. No significant difference in blood glucose, serum insulin and HOMA-IR were identified at any time point among the three groups. PI3K and PKB expression was lower in the IUGR group offspring compared with that in the CON group offspring, but both were increased by dietary L-Arg supplementation. PEPCK mRNA and G-6-Pase mRNA expression levels in the offspring of the IUGR group were higher compared with those in the CON group but were downregulated following L-Arg supplementation. These results suggest that dietary L-Arg supplementation during the early lactation period promoted catch-up growth and reversed abnormalities in hepatic insulin signaling and gene expression of gluconeogenic enzymes in IUGR offspring rats.

  10. Comparative evaluation of Polymerase Chain Reaction-Restriction Enzyme Analysis (PRA) and sequencing of heat shock protein 65 (hsp65) gene for identification of aquatic mycobacteria.

    Science.gov (United States)

    Pourahmad, F; Thompson, K D; Adams, A; Richards, R H

    2009-02-01

    Traditional identification of mycobacteria based on cultural and biochemical tests can take several weeks and may fail to provide a precise identification. Polymerase Chain Reaction-Restriction Enzyme Analysis (PRA) of the gene encoding heat shock protein 65 kDa (hsp65) gene has been proposed as a rapid and inexpensive alternative approach. Despite being widely used for differentiation of mammalian mycobacteria, this method has only been applied in the identification of a small number of aquatic mycobacteria. The present study aimed to evaluate the potential use of PRA of hsp65 for the identification of aquatic mycobacteria compared with sequence analysis. Seventy one mycobacterial isolates including, 10 type/reference strains and the remainder field isolates, were subjected to PRA of a 441 bp fragment of this gene. For 68 representative isolates, sequence analysis was performed. All rapidly and slowly growing mycobacteria had best matches with 99.3% to 100% similarity with their corresponding species in the databanks. PRA proved to be a simple and rapid method for identifying aquatic mycobacteria. However, the incidence of similar or identical restriction patterns for some species of mycobacteria, and in particular, identification of new species of mycobacteria is a major problem using such a method. In contrast, the nucleic acid sequencing of the hsp65 gene yielded unambiguous results.

  11. Genetic relationships between clinical and non-clinical strains of Yersinia enterocolitica biovar 1A as revealed by multilocus enzyme electrophoresis and multilocus restriction typing

    Science.gov (United States)

    2010-01-01

    Background Genetic relationships among 81 strains of Y. enterocolitica biovar 1A isolated from clinical and non-clinical sources were discerned by multilocus enzyme electrophoresis (MLEE) and multilocus restriction typing (MLRT) using six loci each. Such studies may reveal associations between the genotypes of the strains and their sources of isolation. Results All loci were polymorphic and generated 62 electrophoretic types (ETs) and 12 restriction types (RTs). The mean genetic diversity (H) of the strains by MLEE and MLRT was 0.566 and 0.441 respectively. MLEE (DI = 0.98) was more discriminatory and clustered Y. enterocolitica biovar 1A strains into four groups, while MLRT (DI = 0.77) identified two distinct groups. BURST (Based Upon Related Sequence Types) analysis of the MLRT data suggested aquatic serotype O:6,30-6,31 isolates to be the ancestral strains from which, clinical O:6,30-6,31 strains might have originated by host adaptation and genetic change. Conclusion MLEE revealed greater genetic diversity among strains of Y. enterocolitica biovar 1A and clustered strains in four groups, while MLRT grouped the strains into two groups. BURST analysis of MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from aquatic strains. PMID:20509911

  12. Genetic relationships between clinical and non-clinical strains of Yersinia enterocolitica biovar 1A as revealed by multilocus enzyme electrophoresis and multilocus restriction typing

    Directory of Open Access Journals (Sweden)

    Virdi Jugsharan S

    2010-05-01

    Full Text Available Abstract Background Genetic relationships among 81 strains of Y. enterocolitica biovar 1A isolated from clinical and non-clinical sources were discerned by multilocus enzyme electrophoresis (MLEE and multilocus restriction typing (MLRT using six loci each. Such studies may reveal associations between the genotypes of the strains and their sources of isolation. Results All loci were polymorphic and generated 62 electrophoretic types (ETs and 12 restriction types (RTs. The mean genetic diversity (H of the strains by MLEE and MLRT was 0.566 and 0.441 respectively. MLEE (DI = 0.98 was more discriminatory and clustered Y. enterocolitica biovar 1A strains into four groups, while MLRT (DI = 0.77 identified two distinct groups. BURST (Based Upon Related Sequence Types analysis of the MLRT data suggested aquatic serotype O:6,30-6,31 isolates to be the ancestral strains from which, clinical O:6,30-6,31 strains might have originated by host adaptation and genetic change. Conclusion MLEE revealed greater genetic diversity among strains of Y. enterocolitica biovar 1A and clustered strains in four groups, while MLRT grouped the strains into two groups. BURST analysis of MLRT data nevertheless provided newer insights into the probable evolution of clinical strains from aquatic strains.

  13. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Zidong Donna [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS 66160 (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66160 (United States)

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. - Highlights: • Utilized a graded CR model in male mice • The mRNA profiles of xenobiotic processing genes (XPGs) in liver were investigated. • CR up-regulates many phase-II enzymes. • CR tends to feminize the mRNA profiles of XPGs.

  14. Short-term calorie restriction feminizes the mRNA profiles of drug metabolizing enzymes and transporters in livers of mice

    International Nuclear Information System (INIS)

    Fu, Zidong Donna; Klaassen, Curtis D.

    2014-01-01

    Calorie restriction (CR) is one of the most effective anti-aging interventions in mammals. A modern theory suggests that aging results from a decline in detoxification capabilities and thus accumulation of damaged macromolecules. The present study aimed to determine how short-term CR alters mRNA profiles of genes that encode metabolism and detoxification machinery in the liver. Male C57BL/6 mice were fed CR (0, 15, 30, or 40%) diets for one month, followed by mRNA quantification of 98 xenobiotic processing genes (XPGs) in the liver, including 7 uptake transporters, 39 phase-I enzymes, 37 phase-II enzymes, 10 efflux transporters, and 5 transcription factors. In general, 15% CR did not alter mRNAs of most XPGs, whereas 30 and 40% CR altered over half of the XPGs (32 increased and 29 decreased). CR up-regulated some phase-I enzymes (fold increase), such as Cyp4a14 (12), Por (2.3), Nqo1 (1.4), Fmo2 (5.4), and Fmo3 (346), and numerous number of phase-II enzymes, such as Sult1a1 (1.2), Sult1d1 (2.0), Sult1e1 (33), Sult3a1 (2.2), Gsta4 (1.3), Gstm2 (1.3), Gstm3 (1.7), and Mgst3 (2.2). CR feminized the mRNA profiles of 32 XPGs in livers of male mice. For instance, CR decreased the male-predominantly expressed Oatp1a1 (97%) and increased the female-predominantly expressed Oatp1a4 (11). In conclusion, short-term CR alters the mRNA levels of over half of the 98 XPGs quantified in livers of male mice, and over half of these alterations appear to be due to feminization of the liver. - Highlights: • Utilized a graded CR model in male mice • The mRNA profiles of xenobiotic processing genes (XPGs) in liver were investigated. • CR up-regulates many phase-II enzymes. • CR tends to feminize the mRNA profiles of XPGs

  15. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  16. Effectiveness of Annealing Blocking Primers versus Restriction Enzymes for Characterization of Generalist Diets: Unexpected Prey Revealed in the Gut Contents of Two Coral Reef Fish Species

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C.; Meyer, Christopher P.

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet. PMID:23579925

  17. Comparative characterization of the PvuRts1I family of restriction enzymes and their application in mapping genomic 5-hydroxymethylcytosine.

    Science.gov (United States)

    Wang, Hua; Guan, Shengxi; Quimby, Aine; Cohen-Karni, Devora; Pradhan, Sriharsa; Wilson, Geoffrey; Roberts, Richard J; Zhu, Zhenyu; Zheng, Yu

    2011-11-01

    PvuRts1I is a modification-dependent restriction endonuclease that recognizes 5-hydroxymethylcytosine (5hmC) as well as 5-glucosylhydroxymethylcytosine (5ghmC) in double-stranded DNA. Using PvuRts1I as the founding member, we define a family of homologous proteins with similar DNA modification-dependent recognition properties. At the sequence level, these proteins share a few uniquely conserved features. We show that these enzymes introduce a double-stranded cleavage at the 3'-side away from the recognized modified cytosine. The distances between the cleavage sites and the modified cytosine are fixed within a narrow range, with the majority being 11-13 nt away in the top strand and 9-10 nt away in the bottom strand. The recognition sites of these enzymes generally require two cytosines on opposite strand around the cleavage sites, i.e. 5'-CN(11-13)↓N(9-10)G-3'/3'-GN(9-10)↓N(11-13)C-5', with at least one cytosine being modified for efficient cleavage. As one potential application for these enzymes is to provide useful tools for selectively mapping 5hmC sites, we have compared the relative selectivity of a few PvuRts1I family members towards different forms of modified cytosines. Our results show that the inherently different relative selectivity towards modified cytosines can have practical implications for their application. By using AbaSDFI, a PvuRts1I homolog with the highest relative selectivity towards 5ghmC, to analyze rat brain DNA, we show it is feasible to map genomic 5hmC sites close to base resolution. Our study offers unique tools for determining more accurate hydroxymethylomes in mammalian cells.

  18. Single phase and two-phase flow pressure losses through restrictions, expansions and inserts

    International Nuclear Information System (INIS)

    Glenat, P.; Solignac, P.

    1984-11-01

    We give a selection of methods to predict pressure losses through retrictions, expansions and inserts. In single phase flow, we give the classical method based on the one-dimensional momentum and mass balances. In two-phase flow, we propose the method given by Harshe et al. and an empirical approach suggested by Chisholm. We notice the distinction between long and short inserts depends upon wether or not the vena contracta lies within insert. Finally, we propose three correlations to calculate void fraction through the singularities which have been considered [fr

  19. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  20. Identification of Two Novel Mycobacterium avium Allelic Variants in Pig and Human Isolates from Brazil by PCR-Restriction Enzyme Analysis

    Science.gov (United States)

    Leão, Sylvia Cardoso; Briones, Marcelo R. S.; Sircili, Marcelo Palma; Balian, Simone Carvalho; Mores, Nelson; Ferreira-Neto, José Soares

    1999-01-01

    Mycobacterium avium complex (MAC) is composed of environmental mycobacteria found widely in soil, water, and aerosols that can cause disease in animals and humans, especially disseminated infections in AIDS patients. MAC consists of two closely related species, M. avium and M. intracellulare, and may also include other, less-defined groups. The precise differentiation of MAC species is a fundamental step in epidemiological studies and for the evaluation of possible reservoirs for MAC infection in humans and animals. In this study, which included 111 pig and 26 clinical MAC isolates, two novel allelic M. avium PCR-restriction enzyme analysis (PRA) variants were identified, differing from the M. avium PRA prototype in the HaeIII digestion pattern. Mutations in HaeIII sites were confirmed by DNA sequencing. Identification of these isolates as M. avium was confirmed by PCR with DT1-DT6 and IS1245 primers, nucleic acid hybridization with the AccuProbe system, 16S ribosomal DNA sequencing, and biochemical tests. The characterization of M. avium PRA variants can be useful in the elucidation of factors involved in mycobacterial virulence and routes of infection and also has diagnostic significance, since they can be misidentified as M. simiae II and M. kansasii I if the PRA method is used in the clinical laboratory for identification of mycobacteria. PMID:10405407

  1. Effects of membrane curvature and pH on proton pumping activity of single cytochrome bo3enzymes.

    Science.gov (United States)

    Li, Mengqiu; Khan, Sanobar; Rong, Honglin; Tuma, Roman; Hatzakis, Nikos S; Jeuken, Lars J C

    2017-09-01

    The molecular mechanism of proton pumping by heme-copper oxidases (HCO) has intrigued the scientific community since it was first proposed. We have recently reported a novel technology that enables the continuous characterisation of proton transport activity of a HCO and ubiquinol oxidase from Escherichia coli, cytochrome bo 3 , for hundreds of seconds on the single enzyme level (Li et al. J Am Chem Soc 137 (2015) 16055-16063). Here, we have extended these studies by additional experiments and analyses of the proton transfer rate as a function of proteoliposome size and pH at the N- and P-side of single HCOs. Proton transport activity of cytochrome bo 3 was found to decrease with increased curvature of the membrane. Furthermore, proton uptake at the N-side (proton entrance) was insensitive to pH between pH6.4-8.4, while proton release at the P-side had an optimum pH of ~7.4, suggesting that the pH optimum is related to proton release from the proton exit site. Our previous single-enzyme experiments identified rare, long-lived conformation states of cytochrome bo 3 where protons leak back under turn-over conditions. Here, we analyzed and found that ~23% of cytochrome bo 3 proteoliposomes show ΔpH half-lives below 50s after stopping turnover, while only ~5% of the proteoliposomes containing a non-pumping mutant, E286C cytochrome bo 3 exhibit such fast decays. These single-enzyme results confirm our model in which HCO exhibit heterogeneous pumping rates and can adopt rare leak states in which protons are able to rapidly flow back. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Mixed-substrate (glycerol tributyrate and fibrin) zymography for simultaneous detection of lipolytic and proteolytic enzymes on a single gel.

    Science.gov (United States)

    Choi, Nack-Shick; Choi, Jong Hyun; Kim, Bo-Hye; Han, Yun-Jon; Kim, Joong Su; Lee, Seung-Goo; Song, Jae Jun

    2009-06-01

    A new zymography method for simultaneous detection of two different enzymatic activities (lipolytic and proteolytic) using a single SDS-containing or native-conformation gel and a mixed-substrate (glycerol tributyrate and fibrin) (MS)(1) gel was developed. After routine electrophoresis, SDS in the gel was removed by treatment with Triton X-100. Gel proteins were electrotransferred to the MS gel. To visualize lipolytic activity, the MS gel was incubated at 37 degrees C (for 6 or 24 h) until clear bands against an opaque background were observed. To detect proteolytic activity, the same MS gel was stained with Coomassie brilliant blue. Using this method, we show that six lipolytic enzymes from Staphylococcus pasteuri NJ-1 and four proteolytic enzymes from two Bacillus strains, B. licheniformis DJ-2 and B. licheniformis NJ-5, isolated from soil, can be simultaneously detected.

  3. Replacing a suite of commercial pectinases with a single enzyme, pectate lyase B, in Saccharomyces cerevisiae fermentations of cull peaches.

    Science.gov (United States)

    Edwards, M C; Williams, T; Pattathil, S; Hahn, M G; Doran-Peterson, J

    2014-04-01

    Fermentation of pectin-rich biomass with low concentrations of polysaccharides requires some treatment of the pectin, but does not need complete degradation of the polysaccharide to reach maximum ethanol yields. Cull peaches, whole rotten fruits that are not suitable for sale, contain high concentrations of glucose (27.7% dw) and fructose (29.3% dw) and low amounts of cellulose (2.8% dw), hemicellulose (4.5% dw) and pectin (5.6% dw). Amounts of commercial saccharification enzymes, cellulase and cellobiase can be significantly decreased and commercial pectinase mixtures can be replaced completely with a single enzyme, pectate lyase (PelB), while maintaining ethanol yields above 90% of the theoretical maximum. PelB does not completely degrade pectin; it only releases short chain oligogalacturonides. However, the activity of PelB is sufficient for the fermentation process, and its addition to fermentations without commercial pectinase increases ethanol production by ~12%.

  4. Effects of membrane curvature and pH on proton pumping activity of single cytochrome bo3 enzymes

    DEFF Research Database (Denmark)

    Li, Mengqiu; Khan, Sanobar; Rong, Honglin

    2017-01-01

    Escherichia coli, cytochrome bo3, for hundreds of seconds on the single enzyme level (Li et al. J Am Chem Soc 137 (2015) 16055–16063). Here, we have extended these studies by additional experiments and analyses of the proton transfer rate as a function of proteoliposome size and pH at the N- and P...... that the pH optimum is related to proton release from the proton exit site. Our previous single-enzyme experiments identified rare, long-lived conformation states of cytochrome bo3 where protons leak back under turn-over conditions. Here, we analyzed and found that ~ 23% of cytochrome bo3 proteoliposomes......-side of single HCOs. Proton transport activity of cytochrome bo3 was found to decrease with increased curvature of the membrane. Furthermore, proton uptake at the N-side (proton entrance) was insensitive to pH between pH 6.4–8.4, while proton release at the P-side had an optimum pH of ~ 7.4, suggesting...

  5. Restriction enzyme improves the efficiency of genetic transformations in Moniliophthora perniciosa, the causal agent of witches’ broom disease in Theobroma cacao

    Directory of Open Access Journals (Sweden)

    Francis Julio Fagundes Lopes

    2008-02-01

    Full Text Available The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular, the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-linearized plasmid did not increase the transformation efficiency in comparison with the circular plasmid. However, the frequency of multi-copy transformants increased significantly. The transformation procedure here reported resulted in better production of protoplasts and transformation efficiency. In addition, the time necessary for the detection of the first transformants and the number of insertions were reduced.A presença de enzima de restrição na mistura de transformação aumentou a eficiência da transformação em Moniliophthora perniciosa. A influência da forma do vetor (linear ou circular, o padrão de integração do plasmídeo nos sítios genômicos e a influência do promotor usado para expressar o gene marcador foram também analisados. A adição de BamHI ou NotI aumentou o número de transformantes 3-10 vezes e 3 vezes, respectivamente, em relação ao controle sem a adição da enzima. O uso de plasmídeos pré-linearizados não aumentou a eficiência da transformação quando comparado à eficiência obtida com plasmídeos circulares. No entanto, a freqüência de transformantes multi-cópias aumentou significativamente. Juntos os procedimentos reportados aqui resultaram em processos mais eficientes de produção de protoplastos e transformação, onde o tempo necessário para o aparecimento dos transformantes e o número de inserções múltiplas foi reduzido.

  6. Angiotensin Converting Enzyme Inhibitors Mitigate Collagen Synthesis Induced by a Single Dose of Radiation to the Whole Thorax

    OpenAIRE

    Kma, Lakhan; Gao, Feng; Fish, Brian L.; Moulder, John E.; Jacobs, Elizabeth R.; Medhora, Meetha

    2012-01-01

    Our long-term goal is to use angiotensin converting enzyme (ACE) inhibitors to mitigate the increase in lung collagen synthesis that is induced by irradiation to the lung, which could result from accidental exposure or radiological terrorism. Rats (WAG/RijCmcr) were given a single dose of 13 Gy (dose rate of 1.43 Gy/min) of X-irradiation to the thorax. Three structurally-different ACE inhibitors, captopril, enalapril and fosinopril were provided in drinking water beginning 1 week after irradi...

  7. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine.

    Science.gov (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke

    2002-01-01

    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  8. Dynamics of a Birth-Pulse Single-Species Model with Restricted Toxin Input and Pulse Harvesting

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2010-01-01

    Full Text Available We consider a birth-pulses single-species model with restricted toxin input and pulse harvesting in a polluted environment. Pollution accumulates as a slowly decaying stock and is assumed to affect the growth of the renewable resource population. Firstly, by using the discrete dynamical system determined by the stroboscopic map, we obtain an exact 1-period solution of system whose birth function is Ricker function or Beverton-Holt function and obtain the threshold conditions for their stability. Furthermore, we show that the timing of harvesting has a strong impact on the maximum annual sustainable yield. The best timing of harvesting is immediately after the birth pulses. Finally, we investigate the effect of the amount of toxin input on the stable resource population size. We find that when the birth rate is comparatively lower, the population size is decreasing with the increase of toxin input; that when the birth rate is high, the population size may begin to rise and then drop with the increase of toxin input.

  9. A restriction enzyme based cloning method to assess the in vitro replication capacity of HIV-1 subtype C Gag-MJ4 chimeric viruses.

    Science.gov (United States)

    Claiborne, Daniel T; Prince, Jessica L; Hunter, Eric

    2014-08-31

    The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

  10. Sulfur isotopic constraints from a single enzyme on the cellular to global sulfur cycles

    Science.gov (United States)

    Sim, M. S.; Adkins, J. F.; Sessions, A. L.; Orphan, V. J.; McGlynn, S.

    2017-12-01

    Since first reported more than a half century ago, sulfur isotope fractionation between sulfate and sulfide has been used as a diagnostic indicator of microbial sulfate reduction, giving added dimensions to the microbial ecological and geochemical studies of the sulfur cycle. A wide range of fractionation has attracted particular attention because it may serve as a potential indicator of environmental or physiological variables such as substrate concentrations or specific respiration rates. In theory, the magnitude of isotope fractionation depends upon the sulfur isotope effect imparted by the involved enzymes and the relative rate of each enzymatic reaction. The former defines the possible range of fractionation quantitatively, while the latter responds to environmental stimuli, providing an underlying rationale for the varying fractionations. The experimental efforts so far have concentrated largely on the latter, the factors affecting the size of fractionation. Recently, however, the direct assessment of intracellular processes emerges as a promising means for the quantitative analysis of microbial sulfur isotope fractionation as a function of environmental or physiological variables. Here, we experimentally determined for the first time the sulfur isotope fractionation during APS reduction, the first reductive step in the dissimilatory sulfate reduction pathway, using the enzyme purified from Desulfovibrio vulgaris Miyazaki. APS reductase carried out the one-step, two-electron reduction of APS to sulfite, without the production of other metabolic intermediates. Nearly identical isotope effects were obtained at two different temperatures, while the rate of APS reduction more than quadrupled with a temperature increase from 20 to 32°C. When placed in context of the linear network model for microbial sulfur isotope fractionation, our finding could provide a new, semi-quantitative constraint on the sulfur cycle at levels from cellular to global.

  11. Zinc Biochemistry: From a Single Zinc Enzyme to a Key Element of Life12

    Science.gov (United States)

    Maret, Wolfgang

    2013-01-01

    The nutritional essentiality of zinc for the growth of living organisms had been recognized long before zinc biochemistry began with the discovery of zinc in carbonic anhydrase in 1939. Painstaking analytical work then demonstrated the presence of zinc as a catalytic and structural cofactor in a few hundred enzymes. In the 1980s, the field again gained momentum with the new principle of “zinc finger” proteins, in which zinc has structural functions in domains that interact with other biomolecules. Advances in structural biology and a rapid increase in the availability of gene/protein databases now made it possible to predict zinc-binding sites from metal-binding motifs detected in sequences. This procedure resulted in the definition of zinc proteomes and the remarkable estimate that the human genome encodes ∼3000 zinc proteins. More recent developments focus on the regulatory functions of zinc(II) ions in intra- and intercellular information transfer and have tantalizing implications for yet additional functions of zinc in signal transduction and cellular control. At least three dozen proteins homeostatically control the vesicular storage and subcellular distribution of zinc and the concentrations of zinc(II) ions. Novel principles emerge from quantitative investigations on how strongly zinc interacts with proteins and how it is buffered to control the remarkably low cellular and subcellular concentrations of free zinc(II) ions. It is fair to conclude that the impact of zinc for health and disease will be at least as far-reaching as that of iron. PMID:23319127

  12. Characteristic single glucosinolates from Moringa oleifera: Induction of detoxifying enzymes and lack of genotoxic activity in various model systems.

    Science.gov (United States)

    Förster, Nadja; Mewis, Inga; Glatt, Hansruedi; Haack, Michael; Brigelius-Flohé, Regina; Schreiner, Monika; Ulrichs, Christian

    2016-11-09

    Leaves of Moringa oleifera are used by tribes as biological cancer medicine. Scientific investigations with M. oleifera conducted so far have almost exclusively used total plant extracts. Studies on the activity of single compounds are missing. Therefore, the biological effects of the two main aromatic multi-glycosylated glucosinolates of M. oleifera were investigated in the present study. The cytotoxic effects of M. oleifera glucosinolates were identified for HepG2 cells (NRU assay), for V79-MZ cells (HPRT assay, SCE assay), and for two Salmonella typhimurium strains (Ames test). Genotoxic effects of these glucosinolates were not observed (Ames test, HPRT assay, and SCE assay). Reporter gene assays revealed a significant increase in the ARE-dependent promoter activity of NQO1 and GPx2 indicating an activation of the Nrf2 pathway by M. oleifera glucosinolates. Since both enzymes can also be induced via activation of the AhR, plasmids containing promoters of both enzymes mutated in the respective binding sites (pGL3enh-hNQO1-ARE, pGL3enh-hNQO1-XRE, pGL3bas-hGPX2-mutARE, pGL3bas-hGPX2-mutXRE) were transfected. Analyses revealed that the majority of the stimulating effects was mediated by the ARE motif, whereas the XRE motif played only a minor role. The stimulating effects of M. oleifera glucosinolates could be demonstrated both at the transcriptional (reporter gene assay, real time-PCR) and translational levels (enzyme activity) making them interesting compounds for further investigation.

  13. Use of bioelectrode containing DNA-wrapped single-walled carbon nanotubes for enzyme-based biofuel cell

    Science.gov (United States)

    Lee, Jin Young; Shin, Hyun Yong; Kang, Seong Woo; Park, Chulhwan; Kim, Seung Wook

    Biofuel cells that utilize enzymes are attractive alternatives to metal catalyst-based cells because they are environmentally friendly, renewable and operate well at room temperature. Glucose oxidase (GOD)/laccase based biofuel cells have been evaluated to determine if they are useful power supplies that can be implanted in vivo. However, the usefulness of GOD/laccase systems is limited because they produce low level of electrical power. The effects of DNA-wrapped single-wall carbon nanotubes (SWNTs) on the electrical properties of a fuel cell are evaluated under ambient conditions in an attempt to increase the electrical power of an enzyme-based biofuel cell (EFC). The anode (GOD) and cathode (laccase) system in the EFC is composed of gold electrodes that are modified with DNA-wrapped SWNTs. Glucose (for anode) and O 2 (for cathode) are used as the substrates. The anodic electrical properties increase significantly with a bioelectrode that contains DNA-wrapped SWNTs as an electron-transfer mediator. Furthermore, the modified bioelectrode results in increased activities and stabilities of GOD and laccase, which enhance power production (442 μW cm -2 at 0.46 V) compared with a basic EFC.

  14. Single Enzyme Direct Biomineralization of CdSe and CdSe-CdS Core-Shell Quantum Dots.

    Science.gov (United States)

    Yang, Zhou; Lu, Li; Kiely, Christopher J; Berger, Bryan W; McIntosh, Steven

    2017-04-19

    Biomineralization is the process by which biological systems synthesize inorganic materials. Herein, we demonstrate an engineered cystathionine γ-lyase enzyme, smCSE that is active for the direct aqueous phase biomineralization of CdSe and CdSe-CdS core-shell nanocrystals. The nanocrystals are formed in an otherwise unreactive buffered solution of Cd acetate and selenocystine through enzymatic turnover of the selenocystine to form a reactive precursor, likely H 2 Se. The particle size of the CdSe core nanocrystals can be tuned by varying the incubation time to generated particle sizes between 2.74 ± 0.63 nm and 4.78 ± 1.16 nm formed after 20 min and 24 h of incubation, respectively. Subsequent purification and introduction of l-cysteine as a sulfur source facilitates the biomineralization of a CdS shell onto the CdSe cores. The quantum yield of the resulting CdSe-CdS core-shell particles is up to 12% in the aqueous phase; comparable to that reported for more traditional chemical synthesis routes for core-shell particles of similar size with similar shell coverage. This single-enzyme route to functional nanocrystals synthesis reveals the powerful potential of biomineralization processes.

  15. Differential regulation of renal angiotensin-converting enzyme (ACE) and ACE2 during ACE inhibition and dietary sodium restriction in healthy rats

    NARCIS (Netherlands)

    Hamming, I.; van Goor, H.; Turner, A. J.; Rushworth, C. A.; Michaud, A. A.; Corvol, P.; Navis, G.

    2008-01-01

    Angiotensin-converting enzyme (ACE) 2 is thought to counterbalance ACE by breakdown of angiotensin (Ang) II and formation of Ang(1-7). Both enzymes are highly expressed in the kidney, but reports on their regulation differ. To enhance our understanding of the regulation of renal ACE and ACE2, we

  16. Single Enzyme Studies Reveal the Existence of Discrete Functional States for Monomeric Enzymes and How They Are “Selected” upon Allosteric Regulation

    DEFF Research Database (Denmark)

    Hatzakis, Nikos S.; Wei, Li; Jørgensen, Sune Klamer

    2012-01-01

    Allosteric regulation of enzymatic activity forms the basis for controlling a plethora of vital cellular processes. While the mechanism underlying regulation of multimeric enzymes is generally well understood and proposed to primarily operate via conformational selection, the mechanism underlying...

  17. Evolution and function of the Mycoplasma hyopneumoniae peroxiredoxin, a 2-Cys-like enzyme with a single Cys residue.

    Science.gov (United States)

    Gonchoroski, Taylor; Virginio, Veridiana G; Thompson, Claudia E; Paes, Jéssica A; Machado, Cláudio X; Ferreira, Henrique B

    2017-04-01

    The minimal genome of the mollicute Mycoplasma hyopneumoniae, the etiological agent of porcine enzootic pneumonia, encodes a limited repertoire of antioxidant enzymes that include a single and atypical peroxiredoxin (MhPrx), whose evolution and function were studied here. MhPrx has only one catalytic cysteine, in contrast with some of its possible ancestors (2-Cys peroxiredoxins), which have two. Although it is more similar to 2-Cys orthologs, MhPrx can still function with a single peroxidatic cysteine (Cys P ), using non-thiolic electron donors to reduce it. Therefore, MhPrx could be a representative of a possible group of 2-Cys peroxiredoxins, which have lost the resolving cysteine (Cys R ) residue without losing their catalytic properties. To further investigate MhPrx evolution, we performed a comprehensive phylogenetic analysis in the context of several bacterial families, including Prxs belonging to Tpx and AhpE families, shedding light on the evolutionary history of Mycoplasmataceae Prxs and giving support to the hypothesis of a relatively recent loss of the Cys R within this family. Moreover, mutational analyses provided insights into MhPrx function with one, two, or without catalytic cysteines. While removal of the MhPrx putative Cys P caused complete activity loss, confirming its catalytic role, the introduction of a second cysteine in a site correspondent to that of the Cys R of a 2-Cys orthologue, as in the MhPrx supposed ancestral form, was compatible with enzyme activity. Overall, our phylogenetic and mutational studies support that MhPrx recently diverged from a 2-Cys Prx ancestor and pave the way for future studies addressing structural, functional, and evolutive aspects of peroxiredoxin subfamilies in Mollicutes and other bacteria.

  18. Engineering strand-specific DNA nicking enzymes from the type IIS restriction endonucleases BsaI, BsmBI, and BsmAI.

    Science.gov (United States)

    Zhu, Zhenyu; Samuelson, James C; Zhou, Jing; Dore, Andrew; Xu, Shuang-Yong

    2004-03-26

    More than 80 type IIA/IIS restriction endonucleases with different recognition specificities are now known. In contrast, only a limited number of strand-specific nicking endonucleases are currently available. To overcome this limitation, a novel genetic screening method was devised to convert type IIS restriction endonucleases into strand-specific nicking endonucleases. The genetic screen consisted of four steps: (1) random mutagenesis to create a plasmid library, each bearing an inactivated endonuclease gene; (2) restriction digestion of plasmids containing the wild-type and the mutagenized endonuclease gene; (3) back-crosses with the wild-type gene by ligation to the wild-type N-terminal or C-terminal fragment; (4) transformation of the ligated DNA into a pre-modified host and screening for nicking endonuclease activity in total cell culture or cell extracts of the transformants. Nt.BsaI and Nb.BsaI nicking endonucleases were isolated from BsaI using this genetic screen. In addition, site-directed mutagenesis was carried out to isolate BsaI nicking variants with minimal double-stranded DNA cleavage activity. The equivalent amino acid substitutions were introduced into BsmBI and BsmAI restriction endonucleases with similar recognition sequence and significant amino acid sequence identity and their nicking variants were successfully isolated. This work provides strong evidence that some type IIS restriction endonucleases carry two separate active sites. When one of the active sites is inactivated, the type IIS restriction endonuclease may nick only one strand.

  19. Use of Multiplex PCR and PCR Restriction Enzyme Analysis for Detection and Exploration of the Variability in the Free-Living Amoeba Naegleria in the Environment

    Science.gov (United States)

    Pélandakis, Michel; Pernin, Pierre

    2002-01-01

    A multiplex PCR was developed to simultaneously detect Naegleria fowleri and other Naegleria species in the environment. Multiplex PCR was also capable of identifying N. fowleri isolates with internal transcribed spacers of different sizes. In addition, restriction fragment length polymorphism analysis of the PCR product distinguished the main thermophilic Naegleria species from the sampling sites. PMID:11916734

  20. Massively parallel characterization of restriction endonucleases.

    Science.gov (United States)

    Kamps-Hughes, Nick; Quimby, Aine; Zhu, Zhenyu; Johnson, Eric A

    2013-06-01

    Restriction endonucleases are highly specific in recognizing the particular DNA sequence they act on. However, their activity is affected by sequence context, enzyme concentration and buffer composition. Changes in these factors may lead to either ineffective cleavage at the cognate restriction site or relaxed specificity allowing cleavage of degenerate 'star' sites. Additionally, uncharacterized restriction endonucleases and engineered variants present novel activities. Traditionally, restriction endonuclease activity is assayed on simple substrates such as plasmids and synthesized oligonucleotides. We present and use high-throughput Illumina sequencing-based strategies to assay the sequence specificity and flanking sequence preference of restriction endonucleases. The techniques use fragmented DNA from sequenced genomes to quantify restriction endonuclease cleavage on a complex genomic DNA substrate in a single reaction. By mapping millions of restriction site-flanking reads back to the Escherichia coli and Drosophila melanogaster genomes we were able to quantitatively characterize the cognate and star site activity of EcoRI and MfeI and demonstrate genome-wide decreases in star activity with engineered high-fidelity variants EcoRI-HF and MfeI-HF, as well as quantify the influence on MfeI cleavage conferred by flanking nucleotides. The methods presented are readily applicable to all type II restriction endonucleases that cleave both strands of double-stranded DNA.

  1. Oxidized Base Damage and Single-Strand Break Repair in Mammalian Genomes: Role of Disordered Regions and Posttranslational Modifications in Early Enzymes

    OpenAIRE

    Hegde, Muralidhar L.; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic ...

  2. Developments in Analytical Chemistry: Acoustically Levitated Drop Reactors for Enzyme Reaction Kinetics and Single-Walled Carbon Nanotube-Based Sensors for Detection of Toxic Organic Phosphonates

    Science.gov (United States)

    Field, Christopher Ryan

    2009-01-01

    Developments in analytical chemistry were made using acoustically levitated small volumes of liquid to study enzyme reaction kinetics and by detecting volatile organic compounds in the gas phase using single-walled carbon nanotubes. Experience gained in engineering, electronics, automation, and software development from the design and…

  3. GROWTH HORMONE GENE GENOTYPING BY Msp I RESTRICTION ENZYME AND PCR-RFLP METHODS IN ACEH CATTLE BREED AT INDRAPURI DISTRICT OF ACEH PROVINCE

    Directory of Open Access Journals (Sweden)

    W.P.B. Putra

    2014-10-01

    Full Text Available The objective of this research was to identify growth hormone (GH genes genotype in selectedAceh cattle at Indrapuri’s Breeding and Forage Centre (IBFC of Aceh Cattle. Fourty one cattleconsisting of 21 male and 20 female cattle were used in this study. The genomic DNA was extractedfrom blood using Sambrook et al. (1989 methods. Polymerase Chain Reaction - Restriction FragmentLength Polymorphism (PCR-RFLP and mehod of sequencing was used to detect MspI site on GH gene.Based on sequencing results, it can be concluded that all cattle were monomorphism. The frequency ofTT genotype were 1.00 and same as T allele frequency. The transition of C (cytosine into T (thymineon 1548 bp caused the lost of restriction site.

  4. Hemolysis, Elevated Liver Enzymes, and Low Platelets, Severe Fetal Growth Restriction, Postpartum Subarachnoid Hemorrhage, and Craniotomy: A Rare Case Report and Systematic Review

    OpenAIRE

    Rezai, Shadi; Faye, Justin; Hughes, Alexander; Cheung, Mon-Lai; Cohen, Joel R.; Kaia, Judy A.; Fuller, Paul N.; Henderson, Cassandra E.

    2017-01-01

    Introduction. Hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome is a relatively uncommon but traumatic condition occurring in the later stage of pregnancy as a complication of severe preeclampsia or eclampsia. Prompt brain computed tomography (CT) or magnetic resonance imaging (MRI) and a multidisciplinary management approach are required to improve perinatal outcome. Case. A 37-year-old, Gravida 6, Para 1-0-4-1, Hispanic female with a history of chronic hypertension prese...

  5. Acetobacter turbidans α-Amino Acid Ester Hydrolase. How a Single Mutation Improves an Antibiotic-Producing Enzyme

    NARCIS (Netherlands)

    Barends, Thomas R.M.; Polderman-Tijmes, Jolanda J.; Jekel, Peter A.; Williams, Christopher; Wybenga, Gjalt; Janssen, Dick B.; Dijkstra, Bauke W.

    2006-01-01

    The α-amino acid ester hydrolase (AEH) from Acetobacter turbidans is a bacterial enzyme catalyzing the hydrolysis and synthesis of β-lactam antibiotics. The crystal structures of the native enzyme, both unliganded and in complex with the hydrolysis product D-phenylglycine are reported, as well as

  6. Angiotensin converting enzyme inhibitors mitigate collagen synthesis induced by a single dose of radiation to the whole thorax.

    Science.gov (United States)

    Kma, Lakhan; Gao, Feng; Fish, Brian L; Moulder, John E; Jacobs, Elizabeth R; Medhora, Meetha

    2012-01-01

    Our long-term goal is to use angiotensin converting enzyme (ACE) inhibitors to mitigate the increase in lung collagen synthesis that is induced by irradiation to the lung, which could result from accidental exposure or radiological terrorism. Rats (WAG/RijCmcr) were given a single dose of 13 Gy (dose rate of 1.43 Gy/min) of X-irradiation to the thorax. Three structurally-different ACE inhibitors, captopril, enalapril and fosinopril were provided in drinking water beginning 1 week after irradiation. Rats that survived acute pneumonitis (at 6-12 weeks) were evaluated monthly for synthesis of lung collagen. Other endpoints included breathing rate, wet to dry lung weight ratio, and analysis of lung structure. Treatment with captopril (145-207 mg/m(2)/day) or enalapril (19-28 mg/m(2)/day), but not fosinopril (19-28 mg/m(2)/day), decreased morbidity from acute pneumonitis. Lung collagen in the surviving irradiated rats was increased over that of controls by 7 months after irradiation. This increase in collagen synthesis was not observed in rats treated with any of the three ACE inhibitors. Analysis of the lung morphology at 7 months supports the efficacy of ACE inhibitors against radiation-induced fibrosis. The effectiveness of fosinopril against fibrosis, but not against acute pneumonitis, suggests that pulmonary fibrosis may not be a simple consequence of injury during acute pneumonitis. In summary, three structurally-different ACE inhibitors mitigate the increase in collagen synthesis 7 months following irradiation of the whole thorax and do so, even when therapy is started one week after irradiation.

  7. EcoBLMcrX, a classical modification-dependent restriction enzyme in Escherichia coli B: Characterization in vivo and in vitro with a new approach to cleavage site determination.

    Directory of Open Access Journals (Sweden)

    Alexey Fomenkov

    Full Text Available Here we characterize the modification-dependent restriction enzyme (MDE EcoBLMcrX in vivo, in vitro and in its genomic environment. MDE cleavage of modified DNAs protects prokaryote populations from lethal infection by bacteriophage with highly modified DNA, and also stabilizes lineages by reducing gene import when sparse modification occurs in the wrong context. The function and distribution of MDE families are thus important. Here we describe the properties of EcoBLMcrX, an enzyme of the E. coli B lineage, in vivo and in vitro. Restriction in vivo and the genome location of its gene, ecoBLmcrX, were determined during construction and sequencing of a B/K-12 hybrid, ER2566. In classical restriction literature, this B system was named r6 or rglAB. Like many genome defense functions, ecoBLmcrX is found within a genomic island, where gene content is variable among natural E. coli isolates. In vitro, EcoBLMcrX was compared with two related enzymes, BceYI and NhoI. All three degrade fully cytosine-modified phage DNA, as expected for EcoBLMcrX from classical T4 genetic data. A new method of characterizing MDE specificity was developed to better understand action on fully-modified targets such as the phage that provide major evolutionary pressure for MDE maintenance. These enzymes also cleave plasmids with m5C in particular motifs, consistent with a role in lineage-stabilization. The recognition sites were characterized using a site-ranking approach that allows visualization of preferred cleavage sites when fully-modified substrates are digested. A technical constraint on the method is that ligation of one-nucleotide 5' extensions favors G:C over A:T approximately five-fold. Taking this bias into account, we conclude that EcoBLMcrX can cleave 3' to the modified base in the motif Rm5C|. This is compatible with, but less specific than, the site reported by others. Highly-modified site contexts, such as those found in base-substituted virulent phages, are

  8. EcoBLMcrX, a classical modification-dependent restriction enzyme in Escherichia coli B: Characterization in vivo and in vitro with a new approach to cleavage site determination.

    Science.gov (United States)

    Fomenkov, Alexey; Sun, Zhiyi; Dila, Deborah K; Anton, Brian P; Roberts, Richard J; Raleigh, Elisabeth A

    2017-01-01

    Here we characterize the modification-dependent restriction enzyme (MDE) EcoBLMcrX in vivo, in vitro and in its genomic environment. MDE cleavage of modified DNAs protects prokaryote populations from lethal infection by bacteriophage with highly modified DNA, and also stabilizes lineages by reducing gene import when sparse modification occurs in the wrong context. The function and distribution of MDE families are thus important. Here we describe the properties of EcoBLMcrX, an enzyme of the E. coli B lineage, in vivo and in vitro. Restriction in vivo and the genome location of its gene, ecoBLmcrX, were determined during construction and sequencing of a B/K-12 hybrid, ER2566. In classical restriction literature, this B system was named r6 or rglAB. Like many genome defense functions, ecoBLmcrX is found within a genomic island, where gene content is variable among natural E. coli isolates. In vitro, EcoBLMcrX was compared with two related enzymes, BceYI and NhoI. All three degrade fully cytosine-modified phage DNA, as expected for EcoBLMcrX from classical T4 genetic data. A new method of characterizing MDE specificity was developed to better understand action on fully-modified targets such as the phage that provide major evolutionary pressure for MDE maintenance. These enzymes also cleave plasmids with m5C in particular motifs, consistent with a role in lineage-stabilization. The recognition sites were characterized using a site-ranking approach that allows visualization of preferred cleavage sites when fully-modified substrates are digested. A technical constraint on the method is that ligation of one-nucleotide 5' extensions favors G:C over A:T approximately five-fold. Taking this bias into account, we conclude that EcoBLMcrX can cleave 3' to the modified base in the motif Rm5C|. This is compatible with, but less specific than, the site reported by others. Highly-modified site contexts, such as those found in base-substituted virulent phages, are strongly preferred.

  9. A restricted test of single word intelligibility in 3-year-old children with and without cleft palate

    DEFF Research Database (Denmark)

    Willadsen, Elisabeth; Poulsen, Mads

    2012-01-01

    listeners to understand. The error of retraction/backing of alveolar target consonants to velar place of articulation occurred frequently and most often in the HPU group and was found to have a negative effect on intelligibility. Key words: intelligibility, cleft palate, naïve listeners, error types, single...

  10. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

    Science.gov (United States)

    Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

    2011-01-01

    DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

  11. Ligation-mediated PCR amplification of specific fragments from a class-II restriction endonuclease total digest.

    OpenAIRE

    Guilfoyle, R A; Leeck, C L; Kroening, K D; Smith, L M; Guo, Z

    1997-01-01

    A method is described which permits the ligation- mediated PCR amplification of specific fragments from a Class-II restriction endonuclease total digest. Feasibility was tested using Bcl I and phage lambda DNA as a model enzyme and amplicon system, respectively. Bcl I is one of many widely used restriction enzymes which cleave at palindromic recognition sequences and leave 5'-protruding ends of defined sequence. Using a single pair of universal primers, a given fragment can be specifically am...

  12. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  13. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations

    Science.gov (United States)

    Roberts, Gareth A.; Houston, Patrick J.; White, John H.; Chen, Kai; Stephanou, Augoustinos S.; Cooper, Laurie P.; Dryden, David T.F.; Lindsay, Jodi A.

    2013-01-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA. PMID:23771140

  14. Impact of target site distribution for Type I restriction enzymes on the evolution of methicillin-resistant Staphylococcus aureus (MRSA) populations.

    Science.gov (United States)

    Roberts, Gareth A; Houston, Patrick J; White, John H; Chen, Kai; Stephanou, Augoustinos S; Cooper, Laurie P; Dryden, David T F; Lindsay, Jodi A

    2013-08-01

    A limited number of Methicillin-resistant Staphylococcus aureus (MRSA) clones are responsible for MRSA infections worldwide, and those of different lineages carry unique Type I restriction-modification (RM) variants. We have identified the specific DNA sequence targets for the dominant MRSA lineages CC1, CC5, CC8 and ST239. We experimentally demonstrate that this RM system is sufficient to block horizontal gene transfer between clinically important MRSA, confirming the bioinformatic evidence that each lineage is evolving independently. Target sites are distributed randomly in S. aureus genomes, except in a set of large conjugative plasmids encoding resistance genes that show evidence of spreading between two successful MRSA lineages. This analysis of the identification and distribution of target sites explains evolutionary patterns in a pathogenic bacterium. We show that a lack of specific target sites enables plasmids to evade the Type I RM system thereby contributing to the evolution of increasingly resistant community and hospital MRSA.

  15. Sodium restriction potentiates the renoprotective effects of combined vitamin D receptor activation and angiotensin-converting enzyme inhibition in established proteinuric nephropathy.

    Science.gov (United States)

    Mirkovic, Katarina; Frenay, Anne-Roos S; van den Born, Jacob; van Goor, Harry; Navis, Gerjan; de Borst, Martin H

    2017-08-01

    Renin-angiotensin-aldosterone system (RAAS) blockade provides renoprotective effects in chronic kidney disease (CKD); yet progressive renal function loss remains common. Dietary sodium restriction potentiates the renoprotective effects of RAAS blockade. Vitamin D receptor activator (VDRA) treatment reduces proteinuria, inflammation and fibrosis, but whether these effects depend on sodium intake has not been studied. We hypothesized that the renoprotective effects of VDRA treatment, with or without RAAS blockade, are modulated by sodium intake. Six weeks after the induction of adriamycin nephrosis in Wistar rats, i.e. with established proteinuria, animals were treated with the VDRA paricalcitol, lisinopril, the combination, or vehicle; each treatment was given during either a high- (2% NaCl) or a low-sodium (0.05% NaCl) diet for 6 weeks. We assessed proteinuria, blood pressure, renal macrophage accumulation and renal expression of the pre-fibrotic marker alpha-smooth muscle actin (α-SMA) at the end of the treatment. Both paricalcitol and lisinopril individually, as well as in combination, reduced proteinuria and glomerular and interstitial inflammation during a low-sodium diet, but not during a high-sodium diet. All interventions also reduced focal glomerulosclerosis and interstitial expression of α-SMA during the low-sodium diet, while similar trends were observed during the high-sodium diet. The renoprotective effects of paricalcitol were not accompanied by blood pressure reduction. As proteinuria was already abolished by lisinopril during the low-sodium diet, the addition of paricalcitol had no further effect on proteinuria or downstream inflammatory or pre-fibrotic changes. The renoprotective effects of the VDRA paricalcitol are blood pressure independent but do depend on dietary sodium status. The combination of RAAS blockade, dietary sodium restriction and VDRA may be a promising intervention to further retard renal function loss in CKD.

  16. MethylRAD: a simple and scalable method for genome-wide DNA methylation profiling using methylation-dependent restriction enzymes.

    Science.gov (United States)

    Wang, Shi; Lv, Jia; Zhang, Lingling; Dou, Jinzhuang; Sun, Yan; Li, Xue; Fu, Xiaoteng; Dou, Huaiqian; Mao, Junxia; Hu, Xiaoli; Bao, Zhenmin

    2015-11-01

    Characterization of dynamic DNA methylomes in diverse phylogenetic groups has attracted growing interest for a better understanding of the evolution of DNA methylation as well as its function and biological significance in eukaryotes. Sequencing-based methods are promising in fulfilling this task. However, none of the currently available methods offers the 'perfect solution', and they have limitations that prevent their application in the less studied phylogenetic groups. The recently discovered Mrr-like enzymes are appealing for new method development, owing to their ability to collect 32-bp methylated DNA fragments from the whole genome for high-throughput sequencing. Here, we have developed a simple and scalable DNA methylation profiling method (called MethylRAD) using Mrr-like enzymes. MethylRAD allows for de novo (reference-free) methylation analysis, extremely low DNA input (e.g. 1 ng) and adjustment of tag density, all of which are still unattainable for most widely used methylation profiling methods such as RRBS and MeDIP. We performed extensive analyses to validate the power and accuracy of our method in both model (plant Arabidopsis thaliana) and non-model (scallop Patinopecten yessoensis) species. We further demonstrated its great utility in identification of a gene (LPCAT1) that is potentially crucial for carotenoid accumulation in scallop adductor muscle. MethylRAD has several advantages over existing tools and fills a void in the current epigenomic toolkit by providing a universal tool that can be used for diverse research applications, e.g. from model to non-model species, from ordinary to precious samples and from small to large genomes, but at an affordable cost. © 2015 The Authors.

  17. Effect of single and binary combinations of plant-derived molluscicides on different enzyme activities in the nervous tissue of Achatina fulica.

    Science.gov (United States)

    Rao, I G; Singh, Amrita; Singh, V K; Singh, D K

    2003-01-01

    Effect of single and binary treatments of plant-derived molluscicides on different enzymes--acetylcholinesterase (AChE), lactic dehydrogenase (LDH) and acid/alkaline phosphatase (ACP/ALP)--in the nervous tissue of the harmful terrestrial snail Achatina fulica were studied. Sublethal in vivo 24-h exposure to 40% and 80% LC(50) of Azadirachta indica oil, Cedrus deodara oil, Allium sativum bulb powder, Nerium indicum bark powder and binary combinations of A. sativum (AS) + C. deodara (CD) and CD + A. indica (AI) oils significantly altered the activity of these enzymes in the nervous tissue of Achatina fulica. The binary treatment of AS + CD was more effective against AChE, LDH, and ALP than the single ones. However, binary treatment of AI + CD was more effective against ALP. Copyright 2003 John Wiley & Sons, Ltd.

  18. Dietary Methionine Restriction: Novel Treatment for Hormone Independent Prostate Cancer

    National Research Council Canada - National Science Library

    Epner, Daniel

    2003-01-01

    .... We used Southern blot analysis with methylation-sensitive restriction enzymes, western blot analysis, and RT-PCR to determine whether methionine restriction restored expression of growth inhibitory...

  19. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  20. A restricted test of single word intelligibility in 3-year-old children with and without cleft palate

    DEFF Research Database (Denmark)

    Willadsen, Elisabeth; Poulsen, Mads

    2012-01-01

    Abstract Objective: In a previous study, children with cleft palate with hard palate closure at 12 months of age showed more typical phonological development than children with an unrepaired hard palate at 36 months of age. This finding was based on narrow transcription of word initial target...... listeners to understand. The error of retraction/backing of alveolar target consonants to velar place of articulation occurred frequently and most often in the HPU group and was found to have a negative effect on intelligibility. Key words: intelligibility, cleft palate, naïve listeners, error types, single...... hard palate closure at either12 months (HPR (hard palate repaired)) or 36 months (HPU (hard palate unrepaired)), were compared to data obtained from 14 age-matched, typically developing, control children. Methods: Video recordings of the children naming target words were shown to 84 naïve listeners...

  1. Effects of Calorie Restriction and Fiber Type on Glucose Uptake and Abundance of Electron Transport Chain and Oxidative Phosphorylation Proteins in Single Fibers from Old Rats.

    Science.gov (United States)

    Wang, Haiyan; Arias, Edward B; Yu, Carmen S; Verkerke, Anthony R P; Cartee, Gregory D

    2017-11-09

    Calorie restriction (CR; reducing calorie intake by ~40% below ad libitum) can increase glucose uptake by insulin-stimulated muscle. Because skeletal muscle is comprised of multiple, heterogeneous fiber types, our primary aim was to determine the effects of CR (initiated at 14 weeks old) and fiber type on insulin-stimulated glucose uptake by single fibers of diverse fiber types in 23-26-month-old rats. Isolated epitrochlearis muscles from AL and CR rats were incubated with [3H]-2-deoxyglucose ± insulin. Glucose uptake and fiber type were determined for single fibers dissected from the muscles. We also determined CR-effects on abundance of several key metabolic proteins in single fibers. CR resulted in: (a) significantly (p glucose uptake by insulin-stimulated type I, IIA, IIB, IIBX, and IIX fibers; (b) significantly (p glucose uptake in each fiber type of rat skeletal muscle in the absence of upregulation of the abundance of hexokinase II or key mitochondrial ETC and OxPhos proteins. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Restriction enzyme analysis of the human cytomegalovirus genome in specimens collected from immunodeficient patients in Belém, State of Pará, Brazil

    Directory of Open Access Journals (Sweden)

    Dorotéa Lobato da Silva

    2011-10-01

    Full Text Available INTRODUCTION: Human cytomegalovirus is an opportunistic betaherpesvirus that causes persistent and serious infections in immunodeficient patients. Recurrent infections occur due to the presence of the virus in a latent state in some cell types. It is possible to examine the virus using molecular methods to aid in the immunological diagnosis and to generate a molecular viral profile in immunodeficient patients. The objective of this study was to characterize cytomegalovirus genotypes and to generate the epidemiological and molecular viral profile in immunodeficient patients. METHODS: A total of 105 samples were collected from immunodeficient patients from the City of Belém, including newborns, hemodialysis patients, transplant recipients and HIV+ patients. An IgG and IgM antibody study was completed using ELISA, and enzymatic analysis by restriction fragment length polymorphism (RFLP was performed to characterize viral genotypes. RESULTS: It was observed that 100% of the patients had IgG antibodies, 87% of which were IgG+/IgM-, consistent with a prior infection profile, 13% were IgG+/IgM+, suggestive of recent infection. The newborn group had the highest frequency (27% of the IgG+/IgM+ profile. By RFLP analysis, only one genotype was observed, gB2, which corresponded to the standard AD169 strain. CONCLUSIONS: The presence of IgM antibodies in new borns indicates that HCMV continues to be an important cause of congenital infection. The low observed genotypic diversity could be attributed to the small sample size because newborns were excluded from the RFLP analysis. This study will be continued including samples from newborns to extend the knowledge of the general and molecular epidemiology of HCMV in immunodeficient patients.

  3. The Type I Restriction Enzymes as Barriers to Horizontal Gene Transfer: Determination of the DNA Target Sequences Recognised by Livestock-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complexes 133/ST771 and 398.

    Science.gov (United States)

    Chen, Kai; Stephanou, Augoustinos S; Roberts, Gareth A; White, John H; Cooper, Laurie P; Houston, Patrick J; Lindsay, Jodi A; Dryden, David T F

    2016-01-01

    The Type I DNA restriction-modification (RM) systems of Staphylococcus aureus are known to act as a significant barrier to horizontal gene transfer between S. aureus strains belonging to different clonal complexes. The livestock-associated clonal complexes CC133/771 and CC398 contain Type I RM systems not found in human MRSA strains as yet but at some point transfer will occur. When this does take place, horizontal gene transfer of resistance will happen more easily between these strains. The reservoir of antibiotic resistance, virulence and host-adaptation genes present in livestock-associated MRSA will then potentially contribute to the development of newly evolving MRSA clones. The target sites recognised by the Type I RM systems of CC133/771 and CC398 were identified as CAG(N)5RTGA and ACC(N)5RTGA, respectively. Assuming that these enzymes recognise the methylation state of adenine, the underlined A and T bases indicate the unique positions of methylation. Target methylation points for enzymes from CC1 were also identified. The methylation points for CC1-1 are CCAY(N)5TTAA and those for CC1-2 are CCAY(N)6 TGT with the underline indicating the adenine methylation site thus clearing up the ambiguity noted previously (Roberts et al. 2013, Nucleic Acids Res 41:7472-7484) for the half sites containing two adenine bases.

  4. Relationship of Physical Function to Single Muscle Fiber Contractility in Older Adults: Effects of Resistance Training with and without Caloric Restriction.

    Science.gov (United States)

    Wang, Zhong-Min; Leng, Xiaoyan; Messi, María Laura; Choi, Seung J; Marsh, Anthony P; Nicklas, Barbara; Delbono, Osvaldo

    2018-03-13

    Previous studies support beneficial effects of both resistance exercise training (RT) and caloric restriction (CR) on skeletal muscle strength and physical performance. The goal of this study was to determine the effects of adding CR to RT on single-muscle fiber contractility responses to RT in older overweight and obese adults. We analyzed contractile properties in 1,253 single myofiber from muscle biopsies of the vastus lateralis, as well as physical performance and thigh muscle volume, in 31 older (65-80 yrs), overweight or obese (body mass index= 27-35 kg/m2) men (n=19) and women (n=12) who were randomly assigned to a standardized, progressive RT intervention with CR (RT+CR; n=15) or without CR (RT; n=16) for 5 months. Both interventions evoked an increase in force normalized to CSA, in type-I and type-II fibers and knee extensor quality. However, these improvements were not different between intervention groups. In the RT group, changes in total thigh fat volume inversely correlated with changes in type-II fiber force (r = -0.691; p=0.019). Within the RT+CR group, changes in gait speed correlated positively with changes in type-I fiber CSA (r=0.561; p=0.030). In addition, increases in type-I normalized fiber force were related to decreases in thigh intermuscular fat volume (r= -0.539; p= 0.038). Single muscle fiber force and knee extensor quality improve with RT and RT+CR; however, CR does not enhance improvements in single muscle fiber contractility or whole muscle in response to RT in older overweight and obese men and women.

  5. Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system

    Science.gov (United States)

    Morozova, Natalia; Sabantsev, Anton; Bogdanova, Ekaterina; Fedorova, Yana; Maikova, Anna; Vedyaykin, Alexey; Rodic, Andjela; Djordjevic, Marko; Khodorkovskii, Mikhail; Severinov, Konstantin

    2016-01-01

    Type II restriction-modification (R-M) systems encode a restriction endonuclease that cleaves DNA at specific sites, and a methyltransferase that modifies same sites protecting them from restriction endonuclease cleavage. Type II R-M systems benefit bacteria by protecting them from bacteriophages. Many type II R-M systems are plasmid-based and thus capable of horizontal transfer. Upon the entry of such plasmids into a naïve host with unmodified genomic recognition sites, methyltransferase should be synthesized first and given sufficient time to methylate recognition sites in the bacterial genome before the toxic restriction endonuclease activity appears. Here, we directly demonstrate a delay in restriction endonuclease synthesis after transformation of Escherichia coli cells with a plasmid carrying the Esp1396I type II R-M system, using single-cell microscopy. We further demonstrate that before the appearance of the Esp1396I restriction endonuclease the intracellular concentration of Esp1396I methyltransferase undergoes a sharp peak, which should allow rapid methylation of host genome recognition sites. A mathematical model that satisfactorily describes the observed dynamics of both Esp1396I enzymes is presented. The results reported here were obtained using a functional Esp1396I type II R-M system encoding both enzymes fused to fluorescent proteins. Similar approaches should be applicable to the studies of other R-M systems at single-cell level. PMID:26687717

  6. Temporal dynamics of methyltransferase and restriction endonuclease accumulation in individual cells after introducing a restriction-modification system.

    Science.gov (United States)

    Morozova, Natalia; Sabantsev, Anton; Bogdanova, Ekaterina; Fedorova, Yana; Maikova, Anna; Vedyaykin, Alexey; Rodic, Andjela; Djordjevic, Marko; Khodorkovskii, Mikhail; Severinov, Konstantin

    2016-01-29

    Type II restriction-modification (R-M) systems encode a restriction endonuclease that cleaves DNA at specific sites, and a methyltransferase that modifies same sites protecting them from restriction endonuclease cleavage. Type II R-M systems benefit bacteria by protecting them from bacteriophages. Many type II R-M systems are plasmid-based and thus capable of horizontal transfer. Upon the entry of such plasmids into a naïve host with unmodified genomic recognition sites, methyltransferase should be synthesized first and given sufficient time to methylate recognition sites in the bacterial genome before the toxic restriction endonuclease activity appears. Here, we directly demonstrate a delay in restriction endonuclease synthesis after transformation of Escherichia coli cells with a plasmid carrying the Esp1396I type II R-M system, using single-cell microscopy. We further demonstrate that before the appearance of the Esp1396I restriction endonuclease the intracellular concentration of Esp1396I methyltransferase undergoes a sharp peak, which should allow rapid methylation of host genome recognition sites. A mathematical model that satisfactorily describes the observed dynamics of both Esp1396I enzymes is presented. The results reported here were obtained using a functional Esp1396I type II R-M system encoding both enzymes fused to fluorescent proteins. Similar approaches should be applicable to the studies of other R-M systems at single-cell level. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. A rapid, ratiometric, enzyme-free, and sensitive single-step miRNA detection using three-way junction based FRET probes

    Science.gov (United States)

    Luo, Qingying; Liu, Lin; Yang, Cai; Yuan, Jing; Feng, Hongtao; Chen, Yan; Zhao, Peng; Yu, Zhiqiang; Jin, Zongwen

    2018-03-01

    MicroRNAs (miRNAs) are single stranded endogenous molecules composed of only 18-24 nucleotides which are critical for gene expression regulating the translation of messenger RNAs. Conventional methods based on enzyme-assisted nucleic acid amplification techniques have many problems, such as easy contamination, high cost, susceptibility to false amplification, and tendency to have sequence mismatches. Here we report a rapid, ratiometric, enzyme-free, sensitive, and highly selective single-step miRNA detection using three-way junction assembled (or self-assembled) FRET probes. The developed strategy can be operated within the linear range from subnanomolar to hundred nanomolar concentrations of miRNAs. In comparison with the traditional approaches, our method showed high sensitivity for the miRNA detection and extreme selectivity for the efficient discrimination of single-base mismatches. The results reveal that the strategy paved a new avenue for the design of novel highly specific probes applicable in diagnostics and potentially in microscopic imaging of miRNAs in real biological environments.

  8. Radiobiological restrictions and tolerance doses of repeated single-fraction hdr-irradiation of intersecting small liver volumes for recurrent hepatic metastases

    Directory of Open Access Journals (Sweden)

    Wust Peter

    2010-05-01

    Full Text Available Abstract Background To assess radiobiological restrictions and tolerance doses as well as other toxic effects derived from repeated applications of single-fraction high dose rate irradiation of small liver volumes in clinical practice. Methods Twenty patients with liver metastases were treated repeatedly (2 - 4 times at identical or intersecting locations by CT-guided interstitial brachytherapy with varying time intervals. Magnetic resonance imaging using the hepatocyte selective contrast media Gd-BOPTA was performed before and after treatment to determine the volume of hepatocyte function loss (called pseudolesion, and the last acquired MRI data set was merged with the dose distributions of all administered brachytherapies. We calculated the BED (biologically equivalent dose for a single dose d = 2 Gy for different α/β values (2, 3, 10, 20, 100 based on the linear-quadratic model and estimated the tolerance dose for liver parenchyma D90 as the BED exposing 90% of the pseudolesion in MRI. Results The tolerance doses D90 after repeated brachytherapy sessions were found between 22 - 24 Gy and proved only slightly dependent on α/β in the clinically relevant range of α/β = 2 - 10 Gy. Variance analysis showed a significant dependency of D90 with respect to the intervals between the first irradiation and the MRI control (p 90 and the pseudolesion's volume. No symptoms of liver dysfunction or other toxic effects such as abscess formation occurred during the follow-up time, neither acute nor on the long-term. Conclusions Inactivation of liver parenchyma occurs at a BED of approx. 22 - 24 Gy corresponding to a single dose of ~10 Gy (α/β ~ 5 Gy. This tolerance dose is consistent with the large potential to treat oligotopic and/or recurrent liver metastases by CT-guided HDR brachytherapy without radiation-induced liver disease (RILD. Repeated small volume irradiation may be applied safely within the limits of this study.

  9. Betaine improved restriction digestion.

    Science.gov (United States)

    Sugimoto, Keiki; Makihara, Tohru; Saito, Aya; Ohishi, Nobuya; Nagase, Takahide; Takai, Daiya

    2005-12-02

    Here we report that supplementation of a common compound betaine (1-carboxy-N,N,N-trimethylmethanaminium inner salt) enhances restriction digestion of DNA molecules being resistant to digestion despite the existence of recognition sites. A previous study reported total isostabilization of DNA was achieved in the presence of 5.2M of betaine, however, we have observed the enhancement of restriction kinetics at 0.3M of betaine, therefore, it likely provided some catalytic proficiency to restriction enzymes rather than the induction of DNA conformational changes. Betaine also enhances catalytic efficiency of PCR, and our result of restriction digestion, taken together, suggests potential application of betaine in other enzymatic reactions in an aqueous solution.

  10. Enzyme-mediated site-specific bioconjugation of metal complexes to proteins: sortase-mediated coupling of copper-64 to a single-chain antibody.

    Science.gov (United States)

    Paterson, Brett M; Alt, Karen; Jeffery, Charmaine M; Price, Roger I; Jagdale, Shweta; Rigby, Sheena; Williams, Charlotte C; Peter, Karlheinz; Hagemeyer, Christoph E; Donnelly, Paul S

    2014-06-10

    The enzyme-mediated site-specific bioconjugation of a radioactive metal complex to a single-chain antibody using the transpeptidase sortase A is reported. Cage amine sarcophagine ligands that were designed to function as substrates for the sortase A mediated bioconjugation to antibodies were synthesized and enzymatically conjugated to a single-chain variable fragment. The antibody fragment scFv(anti-LIBS) targets ligand-induced binding sites (LIBS) on the glycoprotein receptor GPIIb/IIIa, which is present on activated platelets. The immunoconjugates were radiolabeled with the positron-emitting isotope (64)Cu. The new radiolabeled conjugates were shown to bind selectively to activated platelets. The diagnostic potential of the most promising conjugate was demonstrated in an in vivo model of carotid artery thrombosis using positron emission tomography. This approach gives homogeneous products through site-specific enzyme-mediated conjugation and should be broadly applicable to other metal complexes and proteins. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Oxidized base damage and single-strand break repair in mammalian genomes: role of disordered regions and posttranslational modifications in early enzymes.

    Science.gov (United States)

    Hegde, Muralidhar L; Izumi, Tadahide; Mitra, Sankar

    2012-01-01

    Oxidative genome damage induced by reactive oxygen species includes oxidized bases, abasic (AP) sites, and single-strand breaks, all of which are repaired via the evolutionarily conserved base excision repair/single-strand break repair (BER/SSBR) pathway. BER/SSBR in mammalian cells is complex, with preferred and backup sub-pathways, and is linked to genome replication and transcription. The early BER/SSBR enzymes, namely, DNA glycosylases (DGs) and the end-processing proteins such as abasic endonuclease 1 (APE1), form complexes with downstream repair (and other noncanonical) proteins via pairwise interactions. Furthermore, a unique feature of mammalian early BER/SSBR enzymes is the presence of a disordered terminal extension that is absent in their Escherichia coli prototypes. These nonconserved segments usually contain organelle-targeting signals, common interaction interfaces, and sites of posttranslational modifications that may be involved in regulating their repair function including lesion scanning. Finally, the linkage of BER/SSBR deficiency to cancer, aging, and human neurodegenerative diseases, and therapeutic targeting of BER/SSBR are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Electrochemical monitoring of intracellular enzyme activity of single living mammalian cells by using a double-mediator system

    International Nuclear Information System (INIS)

    Matsumae, Yoshiharu; Takahashi, Yasufumi; Ino, Kosuke; Shiku, Hitoshi; Matsue, Tomokazu

    2014-01-01

    Graphical abstract: NAD(P)H:quinone oxidoreductase (NQO) activity of single HeLa cells were evaluated by using the menadione–ferrocyanide double mediator system combined with scanning electrochemical microscopy (SECM). - Highlights: • NAD(P)H:quinone oxidoreductase activity of single cells were evaluated with SECM. • Fe(CN) 6 3− /menadione concentrations were optimized for long-term SECM monitoring. • Menadione affect the intracellular levels of reactive oxygen species and GSH. • At 100 μM menadione, the Fe(CN) 6 3− generation rate decreased rapidly within 30 min. - Abstract: We evaluated the intracellular NAD(P)H:quinone oxidoreductase (NQO) activity of single HeLa cells by using the menadione–ferrocyanide double-mediator system combined with scanning electrochemical microscopy (SECM). The double-mediator system was used to amplify the current response from the intracellular NQO activity and to reduce menadione-induced cell damage. The electron shuttle between the electrode and menadione was mediated by the ferrocyanide/ferricyanide redox couple. Generation of ferrocyanide was observed immediately after the addition of a lower concentration (10 μM) of menadione. The ferrocyanide generation rate was constant for 120 min. At a higher menadione concentration (100 μM), the ferrocyanide generation rate decreased within 30 min because of the cytotoxic effect of menadione. We also investigated the relationship between intracellular reactive oxygen species or glutathione levels and exposure to different menadione concentrations to determine the optimal condition for SECM with minimal invasiveness. The present study clearly demonstrates that SECM is useful for the analysis of intracellular enzymatic activities in single cells with a double-mediator system

  13. Electrochemical monitoring of intracellular enzyme activity of single living mammalian cells by using a double-mediator system

    Energy Technology Data Exchange (ETDEWEB)

    Matsumae, Yoshiharu [Graduate School of Environmental Studies, Tohoku University, Aramaki 6-6-11-605, Aoba, Sendai 980-8579 (Japan); Takahashi, Yasufumi [Advanced Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba, Sendai 980-8577 (Japan); Ino, Kosuke [Graduate School of Environmental Studies, Tohoku University, Aramaki 6-6-11-605, Aoba, Sendai 980-8579 (Japan); Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, Aramaki 6-6-11-605, Aoba, Sendai 980-8579 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, Aramaki 6-6-11-605, Aoba, Sendai 980-8579 (Japan); Advanced Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba, Sendai 980-8577 (Japan)

    2014-09-09

    Graphical abstract: NAD(P)H:quinone oxidoreductase (NQO) activity of single HeLa cells were evaluated by using the menadione–ferrocyanide double mediator system combined with scanning electrochemical microscopy (SECM). - Highlights: • NAD(P)H:quinone oxidoreductase activity of single cells were evaluated with SECM. • Fe(CN){sub 6}{sup 3−}/menadione concentrations were optimized for long-term SECM monitoring. • Menadione affect the intracellular levels of reactive oxygen species and GSH. • At 100 μM menadione, the Fe(CN){sub 6}{sup 3−} generation rate decreased rapidly within 30 min. - Abstract: We evaluated the intracellular NAD(P)H:quinone oxidoreductase (NQO) activity of single HeLa cells by using the menadione–ferrocyanide double-mediator system combined with scanning electrochemical microscopy (SECM). The double-mediator system was used to amplify the current response from the intracellular NQO activity and to reduce menadione-induced cell damage. The electron shuttle between the electrode and menadione was mediated by the ferrocyanide/ferricyanide redox couple. Generation of ferrocyanide was observed immediately after the addition of a lower concentration (10 μM) of menadione. The ferrocyanide generation rate was constant for 120 min. At a higher menadione concentration (100 μM), the ferrocyanide generation rate decreased within 30 min because of the cytotoxic effect of menadione. We also investigated the relationship between intracellular reactive oxygen species or glutathione levels and exposure to different menadione concentrations to determine the optimal condition for SECM with minimal invasiveness. The present study clearly demonstrates that SECM is useful for the analysis of intracellular enzymatic activities in single cells with a double-mediator system.

  14. Restriction glycosylases: involvement of endonuclease activities in the restriction process.

    Science.gov (United States)

    Zhang, Yingbiao; Matsuzaka, Tomoyuki; Yano, Hirokazu; Furuta, Yoshikazu; Nakano, Toshiaki; Ishikawa, Ken; Fukuyo, Masaki; Takahashi, Noriko; Suzuki, Yutaka; Sugano, Sumio; Ide, Hiroshi; Kobayashi, Ichizo

    2017-02-17

    All restriction enzymes examined are phosphodiesterases generating 3΄-OH and 5΄-P ends, but one restriction enzyme (restriction glycosylase) excises unmethylated bases from its recognition sequence. Whether its restriction activity involves endonucleolytic cleavage remains unclear. One report on this enzyme, R.PabI from a hyperthermophile, ascribed the breakage to high temperature while another showed its weak AP lyase activity generates atypical ends. Here, we addressed this issue in mesophiles. We purified R.PabI homologs from Campylobacter coli (R.CcoLI) and Helicobacter pylori (R.HpyAXII) and demonstrated their DNA cleavage, DNA glycosylase and AP lyase activities in vitro at 37°C. The AP lyase activity is more coupled with glycosylase activity in R.CcoLI than in R.PabI. R.CcoLI/R.PabI expression caused restriction of incoming bacteriophage/plasmid DNA and endogenous chromosomal DNA within Escherichia coli at 37°C. The R.PabI-mediated restriction was promoted by AP endonuclease action in vivo or in vitro. These results reveal the role of endonucleolytic DNA cleavage in restriction and yet point to diversity among the endonucleases. The cleaved ends are difficult to repair in vivo, which may indicate their biological significance. These results support generalization of the concept of restriction–modification system to the concept of self-recognizing epigenetic system, which combines any epigenetic labeling and any DNA damaging.

  15. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  16. Fabrication of enzyme-degradable and size-controlled protein nanowires using single particle nano-fabrication technique

    Science.gov (United States)

    Omichi, Masaaki; Asano, Atsushi; Tsukuda, Satoshi; Takano, Katsuyoshi; Sugimoto, Masaki; Saeki, Akinori; Sakamaki, Daisuke; Onoda, Akira; Hayashi, Takashi; Seki, Shu

    2014-04-01

    Protein nanowires exhibiting specific biological activities hold promise for interacting with living cells and controlling and predicting biological responses such as apoptosis, endocytosis and cell adhesion. Here we report the result of the interaction of a single high-energy charged particle with protein molecules, giving size-controlled protein nanowires with an ultra-high aspect ratio of over 1,000. Degradation of the human serum albumin nanowires was examined using trypsin. The biotinylated human serum albumin nanowires bound avidin, demonstrating the high affinity of the nanowires. Human serum albumin-avidin hybrid nanowires were also fabricated from a solid state mixture and exhibited good mechanical strength in phosphate-buffered saline. The biotinylated human serum albumin nanowires can be transformed into nanowires exhibiting a biological function such as avidin-biotinyl interactions and peroxidase activity. The present technique is a versatile platform for functionalizing the surface of any protein molecule with an extremely large surface area.

  17. Restrictive Cardiomyopathy

    Science.gov (United States)

    ... can be mistaken for a condition called constrictive pericarditis. This condition causes the sac-like membrane around ... inflamed and thickened. Surgery can usually correct constrictive pericarditis. On the other hand, restrictive cardiomyopathy cannot be ...

  18. Propensity approach to nonequilibrium thermodynamics of a chemical reaction network: controlling single E-coli β-galactosidase enzyme catalysis through the elementary reaction steps.

    Science.gov (United States)

    Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

    2013-12-28

    In this work, we develop an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the elementary reaction propensities. The method is akin to the microscopic formulation of the dissipation function in terms of the Kullback-Leibler distance of phase space trajectories in Hamiltonian system. The formalism is applied to a single oligomeric enzyme kinetics at chemiostatic condition that leads the reaction system to a nonequilibrium steady state, characterized by a positive total entropy production rate. Analytical expressions are derived, relating the individual reaction contributions towards the total entropy production rate with experimentally measurable reaction velocity. Taking a real case of Escherichia coli β-galactosidase enzyme obeying Michaelis-Menten kinetics, we thoroughly analyze the temporal as well as the steady state behavior of various thermodynamic quantities for each elementary reaction. This gives a useful insight in the relative magnitudes of various energy terms and the dissipated heat to sustain a steady state of the reaction system operating far-from-equilibrium. It is also observed that, the reaction is entropy-driven at low substrate concentration and becomes energy-driven as the substrate concentration rises.

  19. Plasma Catecholamines (CA) and Gene Expression of CA Biosynthetic Enzymes in Adrenal Medulla and Sympathetic Ganglia of Rats Exposed to Single or Repeated Hypergravity

    Science.gov (United States)

    Petrak, J.; Jurani, M.; Baranovska, M.; Hapala, I.; Frollo, I.; Kvetnansky, R.

    2008-06-01

    The aim of this study was to evaluate plasma epinephrine (EPI) and norepinephrine (NE) levels in blood collected directly during a single or 8-times repeated centrifugation at hypergravity 4G, using remote controlled equipment. Plasma EPI levels showed a huge hypergravity-induced increase. After the last blood collection during hypergravity, the centrifuge was turned off and another blood sampling was performed immediately after the centrifuge decelerated and stopped (10 min). In these samples plasma EPI showed significantly lower levels compared to centrifugation intervals. Plasma NE levels showed none or small changes. Repeated exposure to hypergravity 4G (8 days for 60 min) eliminated the increase in plasma EPI levels at the 15 min interval but did not markedly affect plasma NE levels. To explain these findings we measured mRNA levels of CA biosynthetic enzymes tyrosine hydroxylase (TH), dopamine-β-hydroxylase (DBH) and phenylethanolamine N-methyltransferase (PNMT) in the adrenal medulla (AM) and stellate ganglia (SG) of rats exposed to continuous hypergravity (2G) up to 6 days. In AM, TH, DBH and PNMT mRNA levels were significantly increased in intervals up to 3 days, however, after 6 day hypergravity exposure, no significant elevation was found. In SG, no significant changes in gene expression of CA enzymes were seen both after a single or repeated hypergravity. Thus, our data show that hypergravity highly activates the adrenomedullary system, whereas the sympathoneural system is not significantly changed. In conclusion, our results demonstrate that during repeated or continuous exposure of the organism to hypergravity the adrenomedullary system is adapted, whereas sympathoneural system is not affected.

  20. [Application of double created restriction site PCR-RFLP to identify MGMT gene polymorphisms].

    Science.gov (United States)

    Wang, Wei; Miao, Wenbin; Qiu, Yulan; Xia, Zhaolin

    2008-01-01

    To develop a proper assay for identifying single nucleotide polymorphisms( SNPs) of the MGMT gene. PCR primers were designed by create restriction site (CRS) method, then polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was adopted to identify four SNPs in MGMT gene. By PCR, one primer pair yielded target products containing MGMT84 SNP site, and the other primer pair yielded target products containing MGMT143, 160, 178 SNP sites. Four restriction enzymes were adopted to identify the four SNPs, respectively. The effects of PCR and RFLP were good. The methods for four SNPs of MGMT determinated by CRS-PCR-RFLP theory could be facility, economy, and rapidness.

  1. cuRRBS: simple and robust evaluation of enzyme combinations for reduced representation approaches.

    Science.gov (United States)

    Martin-Herranz, Daniel E; Ribeiro, António J M; Krueger, Felix; Thornton, Janet M; Reik, Wolf; Stubbs, Thomas M

    2017-11-16

    DNA methylation is an important epigenetic modification in many species that is critical for development, and implicated in ageing and many complex diseases, such as cancer. Many cost-effective genome-wide analyses of DNA modifications rely on restriction enzymes capable of digesting genomic DNA at defined sequence motifs. There are hundreds of restriction enzyme families but few are used to date, because no tool is available for the systematic evaluation of restriction enzyme combinations that can enrich for certain sites of interest in a genome. Herein, we present customised Reduced Representation Bisulfite Sequencing (cuRRBS), a novel and easy-to-use computational method that solves this problem. By computing the optimal enzymatic digestions and size selection steps required, cuRRBS generalises the traditional MspI-based Reduced Representation Bisulfite Sequencing (RRBS) protocol to all restriction enzyme combinations. In addition, cuRRBS estimates the fold-reduction in sequencing costs and provides a robustness value for the personalised RRBS protocol, allowing users to tailor the protocol to their experimental needs. Moreover, we show in silico that cuRRBS-defined restriction enzymes consistently out-perform MspI digestion in many biological systems, considering both CpG and CHG contexts. Finally, we have validated the accuracy of cuRRBS predictions for single and double enzyme digestions using two independent experimental datasets. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Preparation and characterization of room temperature ionic liquid/single-walled carbon nanotube nanocomposites and their application to the direct electrochemistry of heme-containing proteins/enzymes

    International Nuclear Information System (INIS)

    Du, Pan; Liu, Shuna; Wu, Ping; Cai, Chenxin

    2007-01-01

    This work describes the formation and possible electrochemical application of a novel nanocomposite based on single-walled carbon nanotubes (SWNTs) and imidazolium-based room-temperature ionic liquids (RTILs) of 1-butyl-3-methylimidazolium tetrafluoroborate ([bmim]BF 4 , a hydrophilic RTIL) and 1-butyl-3-methylimidazolium hexafluorophosphate ([bmim]PF 6 , a hydrophobic RTIL). The nanocomposites ([bmim]BF 4 -SWNTs, and [bmim]PF 6 -SWNTs) were formed by simply grinding the SWNTs with the respective RTIL. The results of the X-ray photoelectron spectroscopy (XPS) and Raman spectroscopy indicated that the nanocomposites were formed by adsorption of an imidazolium ion on the surface of SWNTs via the 'cation-π' interaction. SEM images showed that [bmim]BF 4 -SWNTs (or [bmim]PF 6 -SWNTs) nanocomposites could uniformly cover the surface of a glassy carbon (GC) electrode resulting in a RTILs-SWNTs/GC modified electrode with a high stability. The RTILs-SWNTs composite could be readily used as a matrix to immobilize heme-containing proteins/enzymes (myoglobin, cytochrome c, and horseradish peroxidase) without undergoing denaturation, as was verified by UV-vis and circular dichroic (CD) spectroscopic results. The voltammetric results showed that heme-containing proteins/enzymes entrapped in RTILs-SWNTs composites displayed a pair of well-defined, stable redox peaks, which were ascribed to their direct electron-transfer reactions. The results of controlled experiments showed that the positive charged imidazolium ion played a significant effect on the electrochemical parameters, such as the redox peak separation and the value of the formal potentials, etc., of the electron-transfer reaction of non-neutral species dissolved in solution or immobilized on the electrode surface. Further results demonstrated that the heme-containing proteins/enzymes entrapped in RTILs-SWNTs composites could still retain their bioelectrocatalytic activity toward the reduction of oxygen and hydrogen

  3. A Restricted Open Configuration Interaction with Singles Method To Calculate Valence-to-Core Resonant X-ray Emission Spectra: A Case Study.

    Science.gov (United States)

    Maganas, Dimitrios; DeBeer, Serena; Neese, Frank

    2017-10-02

    In this work, a new protocol for the calculation of valence-to-core resonant X-ray emission (VtC RXES) spectra is introduced. The approach is based on the previously developed restricted open configuration interaction with singles (ROCIS) method and its parametrized version, based on a ground-state Kohn-Sham determinant (DFT/ROCIS) method. The ROCIS approach has the following features: (1) In the first step approximation, many-particle eigenstates are calculated in which the total spin is retained as a good quantum number. (2) The ground state with total spin S and excited states with spin S' = S, S ± 1, are obtained. (3) These states have a qualitatively correct multiplet structure. (4) Quasi-degenerate perturbation theory is used to treat the spin-orbit coupling operator variationally at the many-particle level. (5) Transition moments are obtained between the relativistic many-particle states. The method has shown great potential in the field of X-ray spectroscopy, in particular in the field of transition-metal L-edge, which cannot be described correctly with particle-hole theories. In this work, the method is extended to the calculation of resonant VtC RXES [alternatively referred to as 1s-VtC resonant inelastic X-ray scattering (RIXS)] spectra. The complete Kramers-Dirac-Heisenerg equation is taken into account. Thus, state interference effects are treated naturally within this protocol. As a first application of this protocol, a computational study on the previously reported VtC RXES plane on a molecular managanese(V) complex is performed. Starting from conventional X-ray absorption spectra (XAS), we present a systematic study that involves calculations and electronic structure analysis of both the XAS and non-resonant and resonant VtC XES spectra. The very good agreement between theory and experiment, observed in all cases, allows us to unravel the complicated intensity mechanism of these spectroscopic techniques as a synergic function of state polarization

  4. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  5. A single serum dilution enzyme-linked immunosorbent assay for determining anti-human papillomavirus (HPV) antibody titres in humans immunised with prophylactic HPV vaccines.

    Science.gov (United States)

    Jin, Yingji; Kim, Hyoung Jin; Yim, Ga Won; Kim, Young Tae; Chang, Don Yong; Kim, Hong-Jin

    2012-07-01

    Two types of prophylactic human papillomavirus (HPV) vaccines are currently available. However, there is no simple monitoring system for assessing acquired immunity that can cope simultaneously with large numbers of serum samples. Approximately 30% of women with normal cytology are known to be seropositive for HPV types 16 and 18 because of the high prevalence of these HPV types. Therefore, to be useful the monitoring system has to discriminate clearly between vaccine recipients and other serology groups. However, there has never been any focus on developing a method to satisfy this condition. In this study, we developed a high-throughput single-serum-dilution enzyme-linked immunoassay (ELISA) system for determining anti-HPV antibody titres following vaccination. We optimised the conditions for each ELISA step to increase its accuracy and precision and to avoid the high background of non-specific reactions that is a major problem for serology assays. The new ELISA system has superior linearity, accuracy and reproducibility. Moreover, it clearly discriminated between antibody levels in vaccine recipients and those in other serology groups such as individuals with normal cervical cytology and those with cervical cancer. Therefore, this single-serum-dilution ELISA should be very useful for assessing the acquired immunity of HPV vaccine recipients. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Children with single-ventricle physiology do not benefit from higher hemoglobin levels post cavopulmonary connection: results of a prospective, randomized, controlled trial of a restrictive versus liberal red-cell transfusion strategy.

    Science.gov (United States)

    Cholette, Jill M; Rubenstein, Jeffrey S; Alfieris, George M; Powers, Karen S; Eaton, Michael; Lerner, Norma B

    2011-01-01

    To examine the impact of a restrictive vs. liberal transfusion strategy on arterial lactate and oxygen content differences in children with single-ventricle physiology post cavopulmonary connection. Children with single-ventricle physiology are routinely transfused postoperatively to increase systemic oxygen delivery, and transfusion thresholds in this population have not been studied. Prospective, randomized, controlled, clinical trial. Pediatric cardiac intensive care unit in a teaching hospital. Infants and children (n = 60) with variations of single-ventricle physiology presenting for cavopulmonary connection. Subjects were randomized to a restrictive (hemoglobin of liberal (hemoglobin of ≥ 13.0 g/dL) transfusion strategy for 48 hrs post operation. Primary outcome measures were mean and peak arterial lactate. Secondary end points were arteriovenous (C(a-v)o2) and arteriocerebral oxygen content (C(a-c)o2) differences and clinical outcomes. A total of 30 children were in each group. There were no significant preoperative differences. Mean hemoglobin in the restrictive and liberal groups were 11 ± 1.3 g/dL and 13.9 ± 0.5 g/dL, respectively (p Liberal]) or peak (3.1 ± 1.5 mmol/L [Restrictive] vs. 3.2 ± 1.3 mmol/L [Liberal]) lactate between groups were found. Mean number of red blood cell transfusions were 0.43 ± 0.6 and 2.1 ± 1.2 (p liberal transfusion strategy after cavopulmonary connection. A restrictive red blood cell transfusion strategy decreases the number of transfusions, donor exposures, and potential risks in these children. Larger studies with clinical outcome measures are needed to determine the transfusion threshold for children post cardiac repair or palliation for congenital heart disease.

  7. Nonclassical Kinetics of Clonal yet Heterogeneous Enzymes.

    Science.gov (United States)

    Park, Seong Jun; Song, Sanggeun; Jeong, In-Chun; Koh, Hye Ran; Kim, Ji-Hyun; Sung, Jaeyoung

    2017-07-06

    Enzyme-to-enzyme variation in the catalytic rate is ubiquitous among single enzymes created from the same genetic information, which persists over the lifetimes of living cells. Despite advances in single-enzyme technologies, the lack of an enzyme reaction model accounting for the heterogeneous activity of single enzymes has hindered a quantitative understanding of the nonclassical stochastic outcome of single enzyme systems. Here we present a new statistical kinetics and exactly solvable models for clonal yet heterogeneous enzymes with possibly nonergodic state dynamics and state-dependent reactivity, which enable a quantitative understanding of modern single-enzyme experimental results for the mean and fluctuation in the number of product molecules created by single enzymes. We also propose a new experimental measure of the heterogeneity and nonergodicity for a system of enzymes.

  8. Production of recombinant Ig molecules from antigen-selected single B cells and restricted usage of Ig-gene segments by anti-D antibodies

    NARCIS (Netherlands)

    Dohmen, Serge E.; Mulder, Arend; Verhagen, Onno J. H. M.; Eijsink, Chantal; Franke-van Dijk, Marry E. I.; van der Schoot, C. Ellen

    2005-01-01

    The Ig-genes of the heavy chains in anti-D-specific hybridomas and Fab/scFv-fragments selected from phage-display libraries are restricted to a group of closely related genes (IGHV3s genes). We analyzed the Ig-gene repertoire in anti-D-specific B cells of two hyperimmunized donors using a completely

  9. Comparison of hepatic and renal drug-metabolising enzyme activities in sheep given single or two-fold challenge infections with Fasciola hepatica.

    Science.gov (United States)

    Calléja, C; Bigot, K; Eeckhoutte, C; Sibille, P; Boulard, C; Galtier, P

    2000-07-01

    The activity of drug-metabolising enzymes was compared in liver and kidneys of adult sheep given single or two-fold fluke infection. Fascioliasis was induced by oral administration of 200 metacercariae of Fasciola hepatica to female sheep either 10 or 20 weeks (mono-infections) or 10 and 20 weeks (bi-infection) before killing. The parasitic pathology was ascertained at autopsy and by clinical observation of animals. In the liver of both mono- and bi-infected animals, significant decreases (P<0.05) (17-44%) were observed in the microsomal content of cytochrome P450 and in the two measured P450-dependent monooxygenase activities, benzphetamine and ethylmorphine N-demethylations. Moreover, Western blot analysis of microsomes demonstrated a decrease in the expression of cytochrome P4503A subfamily correlative with that of its presumed corresponding activity ethylmorphine N-demethylase. By contrast, the conjugation of chloro-dinitrobenzene to glutathione remained unchanged in liver cytosolic fractions prepared from all these animals. In kidneys, a significant decrease (P<0.05) (30%) in microsomal cytochrome P450 level of 10-week mono-infected sheep was observed whereas there was no change in the other groups of animals. The inflammatory origin and the consequences in terms of pathology and animal productivity of the fascioliasis-induced decreases in tissue-oxidative drug metabolism are discussed, particularly in the case of adult sheep suffering repetitive infections.

  10. Effect of enzyme therapy and prognostic factors in 69 adults with Pompe disease: an open-label single-center study

    Directory of Open Access Journals (Sweden)

    de Vries Juna M

    2012-09-01

    Full Text Available Abstract Background Enzyme replacement therapy (ERT in adults with Pompe disease, a progressive neuromuscular disorder, is of promising but variable efficacy. We investigated whether it alters the course of disease, and also identified potential prognostic factors. Methods Patients in this open-label single-center study were treated biweekly with 20 mg/kg alglucosidase alfa. Muscle strength, muscle function, and pulmonary function were assessed every 3–6 months and analyzed using repeated-measures ANOVA. Results Sixty-nine patients (median age 52.1 years were followed for a median of 23 months. Muscle strength increased after start of ERT (manual muscle testing 1.4 percentage points per year (pp/y; hand-held dynamometry 4.0 pp/y; both p Relative to the pre-treatment period (49 patients with 14 months pre-ERT and 22 months ERT median follow-up, ERT affected muscle strength positively (manual muscle testing +3.3 pp/y, p Conclusions We conclude that ERT positively alters the natural course of Pompe disease in adult patients; muscle strength increased and upright FVC stabilized. Functional outcome is probably best when ERT intervention is timely.

  11. Development of a single-chain variable fragment-alkaline phosphatase fusion protein and a sensitive direct competitive chemiluminescent enzyme immunoassay for detection of ractopamine in pork

    Energy Technology Data Exchange (ETDEWEB)

    Dong Jiexian; Li Zhenfeng; Lei Hongtao; Sun Yuanming [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Ducancel, Frederic [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Xu Zhenlin [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Boulain, Jean-Claude [CEA, iBiTec-S, Service de Pharmacologie et d' Immnoanalyse (SPI), CEA Saclay, F-91191 Gif sur Yvette (France); Yang Jinyi; Shen Yudong [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China); Wang Hong, E-mail: gzwhongd@63.com [Guangdong Provincial Key Laboratory of Food Quality and Safety, South China Agricultural University, Guangzhou 510642 (China)

    2012-07-29

    Graphical abstract: Detection model of dc-CLEIA based on anti-RAC scFv-AP fusion protein. Highlights: Black-Right-Pointing-Pointer The scFv-AP fusion protein against ractopamine (RAC) was produced. Black-Right-Pointing-Pointer A dc-CLEIA for RAC was developed based on the purified scFv-AP fusion protein. Black-Right-Pointing-Pointer The sensitivity of dc-CLEIA was 10 times as sensitive as dc-ELISA for RAC. Black-Right-Pointing-Pointer Recovery tests from pork samples were studied. Black-Right-Pointing-Pointer Good accuracy was obtained. - Abstract: A rapid, sensitive chemiluminescent enzyme immunoassay (CLEIA) for ractopamine (RAC) based on a single-chain variable fragment (scFv)-alkaline phosphatase (AP) fusion protein was developed. The scFv gene was prepared by cloning the heavy- and light-chain variable region genes (V{sub H} and V{sub L}) from hybridoma cell line AC2, which secretes antibodies against RAC, and assembling V{sub H} and V{sub L} genes with a linker by means of splicing overlap extension polymerase chain reaction. The resulting scFv gene was inserted into the expression vector pLIP6/GN containing AP to produce the fusion protein in Escherichia coli strain BL21. The purified scFv-AP fusion protein was used to develop a direct competitive CLEIA (dcCLEIA) protocol for detection of RAC. The average concentration required for 50% inhibition of binding and the limit of detection of the assay were 0.25 {+-} 0.03 and 0.02 {+-} 0.004 ng mL{sup -1}, respectively, and the linear response range extended from 0.05 to 1.45 ng mL{sup -1}. The assay was 10 times as sensitive as the corresponding enzyme-linked immunosorbent assay based on the same fusion protein. Cross-reactivity studies showed that the fusion protein did not cross react with RAC analogs. DcCLEIA was used to analyze RAC spiked pork samples, and the validation was confirmed by high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS). The results showed a good correlation between

  12. Importance and benefits of dietary sodium restriction in the management of chronic kidney disease patients: experience from a single Chinese center.

    Science.gov (United States)

    Yu, Wang; Luying, Sun; Haiyan, Wang; Xiaomei, Li

    2012-04-01

    Several studies have suggested that sodium intake may affect blood pressure (BP), proteinuria, and intrarenal transforming growth factor-β1 (TGF-β1) production in patients and animal models with chronic kidney disease (CKD). The Chinese population has a high prevalence of CKD and is well known for consuming salty foods. This study will investigate the role of dietary sodium intake on BP control among non-dialysis Chinese CKD patients. A cross-sectional study was carried out in a cohort of 176 non-dialysis hypertensive CKD patients to investigate their sodium intake and its effect on BP control by measuring 24-h urine sodium excretion (24-h UNa). A total of 20 patients with immunoglobulin A nephropathy (IgAN) participated in a 7-day sodium restriction study (100 mmol/day). Their changes in BP, proteinuria, and urinary TGF-β1 excretion were subsequently analyzed. Another 23 IgAN patients without salt restriction were included as controls. The average 24-h UNa of the study cohort was 149.0 ± 66.4 mmol/day. Only 31.8% patients had a 24-h UNa less than 100 mmol/day. The OR for each 17 mmol increment in 24-h UNa (salt 1 g/day) for BP > 130/80 mmHg was 1.26 (95% CI 1.10-1.44, P = 0.001). The sodium restriction group achieved significantly more reduction in SBP (-11.1 mmHg vs. -5.0 mmHg, P = 0.022), DBP (-9.4 mmHg vs. -2.1 mmHg, P = 0.009), and urine protein excretion [-465 (-855 to -340) mg/day vs. -150 (-570 to 40) mg/day, P = 0.024]. A positive correlation was observed between the change of 24-h UNa and the change of SBP (r = 0.450, P = 0.047) in the sodium restriction group. The change of 24-h UNa was also correlated with the 24-h TGF-β1 excretion (r = 0.558, P = 0.011) in these patients. Dietary sodium intake restriction should be monitored and intensified in the treatment of Chinese CKD patients.

  13. Construction and characterization of a fusion protein of single-chain anti-CD20 antibody and human beta-glucuronidase for antibody-directed enzyme prodrug therapy

    NARCIS (Netherlands)

    Haisma, HJ; Sernee, MF; Hooijberg, E; Brakenhoff, RH; van den Meulen-Mulleman, IH; Pinedo, HM; Boven, E

    1998-01-01

    The CD20 antigen is an attractive target for specific treatment of B-cell lymphoma. Antibody-directed enzyme prodrug therapy (ADEPT) aims at the specific activation of a nontoxic prodrug at the tumor site by an enzyme targeted by a tumor-specific antibody such as anti-CD20. We constructed a fusion

  14. Definitive differentiation between single and mixed mycobacterial infections in red deer (Cervus elaphus) by a combination of duplex amplification of p34 and f57 sequences and Hpy188I enzymatic restriction of duplex amplicons.

    Science.gov (United States)

    Godfroid, Jacques; Delcorps, Cathy; Irenge, Leonid M; Walravens, Karl; Marché, Sylvie; Gala, Jean-Luc

    2005-09-01

    Severe emaciation and mortalities suggestive of mycobacterial infections were recently reported for both adult and young wild red deer (Cervus elaphus) in the southeastern part of Belgium. In deer, tuberculous lesions are not pathognomonic of Mycobacterium bovis infection due to gross and microscopic similarities with lesions caused by Mycobacterium avium subsp. paratuberculosis or M. avium subsp. avium. The aim of this study was to improve molecular methods for the species-specific identification of M. bovis, M. avium subsp. avium, and M. avium subsp. paratuberculosis in mycobacterial infections of deer. DNA banding patterns were assessed prior to and after Hpy188I restriction of f57-upstream (us)-p34 duplex amplicons. The duplex f57-us-p34 PCR differentiated M. bovis from M. avium subsp. paratuberculosis and M. avium subsp. avium infections, whereas the restriction step differentiated single M. avium subsp. paratuberculosis or M. avium subsp. avium infections from mixed M. avium subsp. paratuberculosis/M. avium subsp. avium infections. The endonuclease Hpy188I cleaves DNA between nucleotides N and G in the unique TCNGA sequence. This restriction site was found at position 168 upstream of the us-p34 initiation codon in all M. avium subsp. avium strains tested, regardless of their origin and the results of IS901 PCR. In contrast, the restriction site was abrogated in all M. avium subsp. paratuberculosis strains tested, independent of their origin, Mycobactin J dependency, and IS900 PCR results. Consequently, a two-step strategy, i.e., duplex us-p34-f57 PCR and Hpy188I restriction, allowed us to exclude M. bovis infection and to identify single (M. avium subsp. paratuberculosis or M. avium subsp. avium) or mixed (M. avium subsp. paratuberculosis/M. avium subsp. avium) infections in wild red deer in Belgium. Accordingly, we propose to integrate, in a functional molecular definition of M. avium subsp. paratuberculosis, the absence of the Hpy188I restriction site from

  15. Suppression of APOBEC3-mediated restriction of HIV-1 by Vif

    Science.gov (United States)

    Feng, Yuqing; Baig, Tayyba T.; Love, Robin P.; Chelico, Linda

    2014-01-01

    The APOBEC3 restriction factors are a family of deoxycytidine deaminases that are able to suppress replication of viruses with a single-stranded DNA intermediate by inducing mutagenesis and functional inactivation of the virus. Of the seven human APOBEC3 enzymes, only APOBEC3-D, -F, -G, and -H appear relevant to restriction of HIV-1 in CD4+ T cells and will be the focus of this review. The restriction of HIV-1 occurs most potently in the absence of HIV-1 Vif that induces polyubiquitination and degradation of APOBEC3 enzymes through the proteasome pathway. To restrict HIV-1, APOBEC3 enzymes must be encapsidated into budding virions. Upon infection of the target cell during reverse transcription of the HIV-1 RNA into (-)DNA, APOBEC3 enzymes deaminate cytosines to form uracils in single-stranded (-)DNA regions. Upon replication of the (-)DNA to (+)DNA, the HIV-1 reverse transcriptase incorporates adenines opposite to the uracils thereby inducing C/G to T/A mutations that can functionally inactivate HIV-1. APOBEC3G is the most studied APOBEC3 enzyme and it is known that Vif attempts to thwart APOBEC3 function not only by inducing its proteasomal degradation but also by several degradation-independent mechanisms, such as inhibiting APOBEC3G virion encapsidation, mRNA translation, and for those APOBEC3G molecules that still become virion encapsidated, Vif can inhibit APOBEC3G mutagenic activity. Although most Vif variants can induce efficient degradation of APOBEC3-D, -F, and -G, there appears to be differential sensitivity to Vif-mediated degradation for APOBEC3H. This review examines APOBEC3-mediated HIV restriction mechanisms, how Vif acts as a substrate receptor for a Cullin5 ubiquitin ligase complex to induce degradation of APOBEC3s, and the determinants and functional consequences of the APOBEC3 and Vif interaction from a biological and biochemical perspective. PMID:25206352

  16. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...... the SNPs of dhfr, dhps, and Pfcrt with high specificity. The SSOP-ELISA compared well with a standard PCR-restriction fragment length polymorphism procedure, and gave identical positive results in more than 90% of the P. falciparum slide-positive samples tested. The SSOP-ELISA of all dhfr, dhps, or Pfcrt...

  17. Chicken single-chain antibody fused to alkaline phosphatase detects Aspergillus pathogens and their presence in natural samples by direct sandwich enzyme-linked immunosorbent assay.

    Science.gov (United States)

    Xue, Sheng; Li, He-Ping; Zhang, Jing-Bo; Liu, Jin-Long; Hu, Zu-Quan; Gong, An-Dong; Huang, Tao; Liao, Yu-Cai

    2013-11-19

    A sensitive and specific analytical method to detect ubiquitous aflatoxigenic Aspergillus pathogens is essential for monitoring and controlling aflatoxins. Four highly reactive chicken single-chain variable fragments (scFvs) against soluble cell wall proteins (SCWPs) from Aspergillus flavus were isolated by phage display. The scFv antibody AfSA4 displayed the highest activity toward both A. flavus and A. parasiticus and specifically recognized a surface target of their cell walls as revealed by immunofluorescence localization. Molecular modeling revealed a unique compact motif on the antibody surface mainly involving L-CDR2 and H-CDR3. As measured by surface plasmon resonance, AfSA4 fused to alkaline phosphatase had a higher binding capability and 6-fold higher affinity compared with AfSA4 alone. Immunoblot analyses showed that the fusion had good binding capacity to SCWP components from the two fungal species. Direct sandwich enzyme-linked immunosorbent assays with mouse antiaspergillus monoclonal antibody mAb2A8 generated in parallel as a capture antibody revealed that the detection limit of the two fungi was as low as 10(-3) μg/mL, 1000-fold more sensitive than that reported previously (1 μg/mL). The fusion protein was able to detect fungal concentrations below 1 μg/g of maize and peanut grains in both artificially and naturally contaminated samples, with at least 10-fold more sensitivity than that reported (10 μg/g) thus far. Thus, the fusion can be applied in rapid, simple, and specific diagnosis of Aspergillus contamination in field and stored food/feed commodities.

  18. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... and stratification mechanisms. In conclusion the article therefore suggests that future urban research and planning also needs a mobile understanding of spaces in the cities and how different mobility systems play an important role to sustain the exclusiveness that often characterises the private/public spaces...

  19. Enzyme Informatics

    Science.gov (United States)

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  20. Single administration of recombinant IL-6 restores the gene expression of lipogenic enzymes in liver of fasting IL-6-deficient mice

    DEFF Research Database (Denmark)

    Gavito, A L; Cabello, R; Suarez, J

    2016-01-01

    lipogenic enzymes. EXPERIMENTAL APPROACH: Gene and protein expression of lipogenic enzymes were examined in livers of wild-type (WT) and IL-6-deficient (IL-6(-/-) ) mice during fasting and re-feeding conditions. Effects of exogenous IL-6 administration on gene expression of these enzymes were evaluated...... in vivo. The involvement of STAT3 in mediating these IL-6 responses was investigated by using siRNA in human HepG2 cells. KEY RESULTS: During feeding, the up-regulation in the hepatic expression of lipogenic genes presented similar time kinetics in WT and IL-6(-/-) mice. During fasting, expression...... of lipogenic genes decreased gradually over time in both strains, although the initial drop was more marked in IL-6(-/-) mice. Protein levels of hepatic lipogenic enzymes were lower in IL-6(-/-) than in WT mice at the end of the fasting period. In WT, circulating IL-6 levels paralleled gene expression...

  1. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    Science.gov (United States)

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  2. Changes in ground reaction force during a rebound-jump task after hip strength training for single-sided ankle dorsiflexion restriction.

    Science.gov (United States)

    Kondo, Hitoshi; Someya, Fujiko

    2016-01-01

    [Purpose] Lateral ankle sprains are common injuries suffered while playing sports, and abnormal forward- and inward-directed ground reaction force occurs during a jumping task. However, the influence of hip muscle strength training on jumping performance after ankle injuries has not been fully examined. This study thus examined changes in ground reaction force during a rebound-jump task after training to strengthen hip muscles. [Subjects and Methods] Ten of 30 female high school basketball players were assigned as subjects who showed a difference of 7 or more degrees in dorsiflexion ranges between the bilateral ankles. The subjects underwent 12 weeks of training to strengthen hip abductors and external rotators. Comparisons between before and after training were made regarding ground reaction force components, hip and knee joint angles, percentage of maximum voluntary contraction in leg muscles, and muscle strength of hip muscles during the rebound-jump task. [Results] After training, the subjects showed increased strength of external rotator muscles, increased percentage of maximum voluntary contraction in the gluteus medius muscle, decreased inward ground reaction force, and increased flexion angles of the hip and knee joints. [Conclusion] This study suggests that training to strengthen hip muscles may ameliorate the inward ground reaction force in athletes with ankle dorsiflexion restriction.

  3. Enzyme molecules in solitary confinement.

    Science.gov (United States)

    Liebherr, Raphaela B; Gorris, Hans H

    2014-09-12

    Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  4. Enzyme assays.

    Science.gov (United States)

    Brodelius, P E

    1991-02-01

    The past year or so has seen the development of new enzyme assays, as well as the improvement of existing ones. Assays are becoming more rapid and sensitive as a result of modifications such as amplification of the enzyme product(s). Recombinant DNA technology is now being recognized as a particularly useful tool in the search for improved assay systems.

  5. Effect of alteration of translation error rate on enzyme microheterogeneity as assessed by variation in single molecule electrophoretic mobility and catalytic activity.

    Science.gov (United States)

    Nichols, Ellert R; Shadabi, Elnaz; Craig, Douglas B

    2009-06-01

    The role of translation error for Escherichia coli individual beta-galactosidase molecule catalytic and electrophoretic heterogeneity was investigated using CE-LIF. An E. coli rpsL mutant with a hyperaccurate translation phenotype produced enzyme molecules that exhibited significantly less catalytic heterogeneity but no reduction of electrophoretic heterogeneity. Enzyme expressed with streptomycin-induced translation error had increased thermolability, lower activity, and no significant change to catalytic or electrophoretic heterogeneity. Modeling of the electrophoretic behaviour of beta-galactosidase suggested that variation of the hydrodynamic radius may be the most significant contributor to electrophoretic heterogeneity.

  6. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    . In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...... fractionation, such as removal of a side activity from the main enzyme activity. As a proof-of-concept, amino acids were used as model solution to test the feasibility of EMF in the application of amphoteric molecule separation. A single amino acid was used to illustrate the effect of an electric field...... on the separation performance were very small in the investigated range. The mass transport of each enzyme can be well explained by the Extended-Nernst-Planck equation. Better separation was observed at lower feed concentration, higher solution pH in the investigated range and with a polysulfone (PS) MF membrane...

  7. Fused eco29kIR- and M genes coding for a fully functional hybrid polypeptide as a model of molecular evolution of restriction-modification systems

    Directory of Open Access Journals (Sweden)

    Solonin Alexander S

    2011-02-01

    Full Text Available Abstract Background The discovery of restriction endonucleases and modification DNA methyltransferases, key instruments of genetic engineering, opened a new era of molecular biology through development of the recombinant DNA technology. Today, the number of potential proteins assigned to type II restriction enzymes alone is beyond 6000, which probably reflects the high diversity of evolutionary pathways. Here we present experimental evidence that a new type IIC restriction and modification enzymes carrying both activities in a single polypeptide could result from fusion of the appropriate genes from preexisting bipartite restriction-modification systems. Results Fusion of eco29kIR and M ORFs gave a novel gene encoding for a fully functional hybrid polypeptide that carried both restriction endonuclease and DNA methyltransferase activities. It has been placed into a subclass of type II restriction and modification enzymes - type IIC. Its MTase activity, 80% that of the M.Eco29kI enzyme, remained almost unchanged, while its REase activity decreased by three times, concurrently with changed reaction optima, which presumably can be caused by increased steric hindrance in interaction with the substrate. In vitro the enzyme preferentially cuts DNA, with only a low level of DNA modification detected. In vivo new RMS can provide a 102-fold less protection of host cells against phage invasion. Conclusions We propose a molecular mechanism of appearing of type IIC restriction-modification and M.SsoII-related enzymes, as well as other multifunctional proteins. As shown, gene fusion could play an important role in evolution of restriction-modification systems and be responsible for the enzyme subclass interconversion. Based on the proposed approach, hundreds of new type IIC enzymes can be generated using head-to-tail oriented type I, II, and III restriction and modification genes. These bifunctional polypeptides can serve a basis for enzymes with altered

  8. The oxidative fermentation of ethanol in Gluconacetobacter diazotrophicus is a two-step pathway catalyzed by a single enzyme: alcohol-aldehyde Dehydrogenase (ADHa).

    Science.gov (United States)

    Gómez-Manzo, Saúl; Escamilla, José E; González-Valdez, Abigail; López-Velázquez, Gabriel; Vanoye-Carlo, América; Marcial-Quino, Jaime; de la Mora-de la Mora, Ignacio; Garcia-Torres, Itzhel; Enríquez-Flores, Sergio; Contreras-Zentella, Martha Lucinda; Arreguín-Espinosa, Roberto; Kroneck, Peter M H; Sosa-Torres, Martha Elena

    2015-01-07

    Gluconacetobacter diazotrophicus is a N2-fixing bacterium endophyte from sugar cane. The oxidation of ethanol to acetic acid of this organism takes place in the periplasmic space, and this reaction is catalyzed by two membrane-bound enzymes complexes: the alcohol dehydrogenase (ADH) and the aldehyde dehydrogenase (ALDH). We present strong evidence showing that the well-known membrane-bound Alcohol dehydrogenase (ADHa) of Ga. diazotrophicus is indeed a double function enzyme, which is able to use primary alcohols (C2-C6) and its respective aldehydes as alternate substrates. Moreover, the enzyme utilizes ethanol as a substrate in a reaction mechanism where this is subjected to a two-step oxidation process to produce acetic acid without releasing the acetaldehyde intermediary to the media. Moreover, we propose a mechanism that, under physiological conditions, might permit a massive conversion of ethanol to acetic acid, as usually occurs in the acetic acid bacteria, but without the transient accumulation of the highly toxic acetaldehyde.

  9. The Oxidative Fermentation of Ethanol in Gluconacetobacter diazotrophicus Is a Two-Step Pathway Catalyzed by a Single Enzyme: Alcohol-Aldehyde Dehydrogenase (ADHa

    Directory of Open Access Journals (Sweden)

    Saúl Gómez-Manzo

    2015-01-01

    Full Text Available Gluconacetobacter diazotrophicus is a N2-fixing bacterium endophyte from sugar cane. The oxidation of ethanol to acetic acid of this organism takes place in the periplasmic space, and this reaction is catalyzed by two membrane-bound enzymes complexes: the alcohol dehydrogenase (ADH and the aldehyde dehydrogenase (ALDH. We present strong evidence showing that the well-known membrane-bound Alcohol dehydrogenase (ADHa of Ga. diazotrophicus is indeed a double function enzyme, which is able to use primary alcohols (C2–C6 and its respective aldehydes as alternate substrates. Moreover, the enzyme utilizes ethanol as a substrate in a reaction mechanism where this is subjected to a two-step oxidation process to produce acetic acid without releasing the acetaldehyde intermediary to the media. Moreover, we propose a mechanism that, under physiological conditions, might permit a massive conversion of ethanol to acetic acid, as usually occurs in the acetic acid bacteria, but without the transient accumulation of the highly toxic acetaldehyde.

  10. C allele of the rs2209972 single nucleotide polymorphism of the insulin degrading enzyme gene and Alzheimer's disease in type 2 diabetes, a case control study.

    Science.gov (United States)

    Gutiérrez-Hermosillo, Hugo; Díaz De León-González, Enrique; Palacios-Corona, Rebeca; Cedillo-Rodríguez, Javier Armando; Camacho-Luis, Abelardo; Reyes-Romero, Miguel Arturo; Medina-Chávez, Juan Humberto; Blandón, Pedro A

    2015-02-20

    In the last few decades we have witnessed an interesting transformation of the population pyramids throughout the world. As the population's life expectancy increases, there are more chronic diseases such as diabetes mellitus and dementias, and both of them have shown an association. To determine the association between Alzheimer's disease in diabetic patients and the insulin degrading enzyme in outpatients of a second level Hospital in Monterrey, Mexico. This was a case control study in which we included outpatients from the Geriatrics Clinic of a Hospital in Northeastern Mexico. Cases were patients with a Mini Mental Score Exam (MMSE) below 24 and DSM-IV criteria for Dementia. Controls were patients who had MMSE scores greater than 24. Data from 97 patients were analyzed. Regarding physical examination and the results of laboratory tests, there were no differences between the two groups (p>0.05). A 98% prevalence of the insulin degrading enzyme was documented in the sample studied. We found an association between a homozygous status for the CC genotype and Dementia with an estimated Odds Ratio (OR) of 2.5 (CI 95% 1.6-3.3) on the bivariate test, while, on the multivariate analysis, the OR was estimated 3.3 (CI 95% 1.3-8.2). Evidence shows that cognitive impairment is more frequent among those exposed to the C allele of the rs2209972 SNP of the insulin degrading enzyme gene. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  11. The Oxidative Fermentation of Ethanol in Gluconacetobacter diazotrophicus Is a Two-Step Pathway Catalyzed by a Single Enzyme: Alcohol-Aldehyde Dehydrogenase (ADHa)

    Science.gov (United States)

    Gómez-Manzo, Saúl; Escamilla, José E.; González-Valdez, Abigail; López-Velázquez, Gabriel; Vanoye-Carlo, América; Marcial-Quino, Jaime; de la Mora-de la Mora, Ignacio; Garcia-Torres, Itzhel; Enríquez-Flores, Sergio; Contreras-Zentella, Martha Lucinda; Arreguín-Espinosa, Roberto; Kroneck, Peter M. H.; Sosa-Torres, Martha Elena

    2015-01-01

    Gluconacetobacter diazotrophicus is a N2-fixing bacterium endophyte from sugar cane. The oxidation of ethanol to acetic acid of this organism takes place in the periplasmic space, and this reaction is catalyzed by two membrane-bound enzymes complexes: the alcohol dehydrogenase (ADH) and the aldehyde dehydrogenase (ALDH). We present strong evidence showing that the well-known membrane-bound Alcohol dehydrogenase (ADHa) of Ga. diazotrophicus is indeed a double function enzyme, which is able to use primary alcohols (C2–C6) and its respective aldehydes as alternate substrates. Moreover, the enzyme utilizes ethanol as a substrate in a reaction mechanism where this is subjected to a two-step oxidation process to produce acetic acid without releasing the acetaldehyde intermediary to the media. Moreover, we propose a mechanism that, under physiological conditions, might permit a massive conversion of ethanol to acetic acid, as usually occurs in the acetic acid bacteria, but without the transient accumulation of the highly toxic acetaldehyde. PMID:25574602

  12. [Application of created restriction site PCR-RFLP to identify alcohol dehydrogenase 2 gene polymorphism].

    Science.gov (United States)

    Jiao, Jie; Wang, Wei; Liu, Jing; Xia, Zhaolin

    2009-01-01

    To develop a appropriate assay for identifying single nucleotide polymorphism (SNP) of alcohol dehydrogenase 2 (ADH2) gene. According to base substitution situation of one single base mutational site, we designed the present study primers. One of the primers was designed on the basis of neighbourhood sequence of the mutational site, that is, we made one mismatch base to let product a new enzyme site between the 3' end of the primer and the single base mutation type after the PCR amplification. Then PCR-RFLP was adopted to identify the SNP in ADH2 gene. One primer pair can get target products containing ADH2 SNP site by PCR, restriction enzymes Bsh1236I were adopted to identify the SNP site. The expected results were reached. It suggested that the method of detecting the SNP of ADH2 based on CRS-PCR-RFLP theory is facilitated, economic, and rapid.

  13. Preferential role restrictions

    CSIR Research Space (South Africa)

    Britz, K

    2013-07-01

    Full Text Available We extend the Description Logic ALC with preferential role restrictions as class constructs, and argue that preferential universal restriction represents a defeasible version of standard universal restriction. The resulting DL is more expressive...

  14. REMA: A computer-based mapping tool for analysis of restriction sites in multiple DNA sequences.

    Science.gov (United States)

    Szubert, Jan; Reiff, Caroline; Thorburn, Andrew; Singh, Brajesh K

    2007-05-01

    REMA is an interactive web-based program which predicts endonuclease cut sites in DNA sequences. It analyses multiple sequences simultaneously and predicts the number and size of fragments as well as provides restriction maps. The users can select single or paired combinations of all commercially available enzymes. Additionally, REMA permits prediction of multiple sequence terminal fragment sizes and suggests suitable restriction enzymes for maximally discriminatory results. REMA is an easy to use, web based program which will have a wide application in molecular biology research. REMA is written in Perl and is freely available for non-commercial use. Detailed information on installation can be obtained from Jan Szubert (jan.szubert@gmail.com) and the web based application is accessible on the internet at the URL http://www.macaulay.ac.uk/rema b.singh@macaulay.ac.uk.

  15. Evolution of Enzyme Kinetic Mechanisms.

    Science.gov (United States)

    Ulusu, Nuriye Nuray

    2015-06-01

    This review paper discusses the reciprocal kinetic behaviours of enzymes and the evolution of structure-function dichotomy. Kinetic mechanisms have evolved in response to alterations in ecological and metabolic conditions. The kinetic mechanisms of single-substrate mono-substrate enzyme reactions are easier to understand and much simpler than those of bi-bi substrate enzyme reactions. The increasing complexities of kinetic mechanisms, as well as the increasing number of enzyme subunits, can be used to shed light on the evolution of kinetic mechanisms. Enzymes with heterogeneous kinetic mechanisms attempt to achieve specific products to subsist. In many organisms, kinetic mechanisms have evolved to aid survival in response to changing environmental factors. Enzyme promiscuity is defined as adaptation to changing environmental conditions, such as the introduction of a toxin or a new carbon source. Enzyme promiscuity is defined as adaptation to changing environmental conditions, such as the introduction of a toxin or a new carbon source. Enzymes with broad substrate specificity and promiscuous properties are believed to be more evolved than single-substrate enzymes. This group of enzymes can adapt to changing environmental substrate conditions and adjust catalysing mechanisms according to the substrate's properties, and their kinetic mechanisms have evolved in response to substrate variability.

  16. Single molecule transcription profiling with AFM

    Science.gov (United States)

    Reed, Jason; Mishra, Bud; Pittenger, Bede; Magonov, Sergei; Troke, Joshua; Teitell, Michael A.; Gimzewski, James K.

    2007-01-01

    Established techniques for global gene expression profiling, such as microarrays, face fundamental sensitivity constraints. Due to greatly increasing interest in examining minute samples from micro-dissected tissues, including single cells, unorthodox approaches, including molecular nanotechnologies, are being explored in this application. Here, we examine the use of single molecule, ordered restriction mapping, combined with AFM, to measure gene transcription levels from very low abundance samples. We frame the problem mathematically, using coding theory, and present an analysis of the critical error sources that may serve as a guide to designing future studies. We follow with experiments detailing the construction of high density, single molecule, ordered restriction maps from plasmids and from cDNA molecules, using two different enzymes, a result not previously reported. We discuss these results in the context of our calculations. Based on invited talk at the International Conference on Nanoscience and Technology 2006.

  17. Single molecule transcription profiling with AFM

    International Nuclear Information System (INIS)

    Reed, Jason; Mishra, Bud; Pittenger, Bede; Magonov, Sergei; Troke, Joshua; Teitell, Michael A; Gimzewski, James K

    2007-01-01

    Established techniques for global gene expression profiling, such as microarrays, face fundamental sensitivity constraints. Due to greatly increasing interest in examining minute samples from micro-dissected tissues, including single cells, unorthodox approaches, including molecular nanotechnologies, are being explored in this application. Here, we examine the use of single molecule, ordered restriction mapping, combined with AFM, to measure gene transcription levels from very low abundance samples. We frame the problem mathematically, using coding theory, and present an analysis of the critical error sources that may serve as a guide to designing future studies. We follow with experiments detailing the construction of high density, single molecule, ordered restriction maps from plasmids and from cDNA molecules, using two different enzymes, a result not previously reported. We discuss these results in the context of our calculations

  18. Detection of single nucleotide polymorphisms in p53 mutation hotspots and expression of mutant p53 in human cell lines using an enzyme-linked electrochemical assay

    Czech Academy of Sciences Publication Activity Database

    Horáková Brázdilová, Petra; Šimková, Eva; Vychodilová, Zdenka; Brázdová, Marie; Fojta, Miroslav

    2009-01-01

    Roč. 21, č. 15 (2009), s. 1723-1729 ISSN 1040-0397 R&D Projects: GA ČR(CZ) GA203/07/1195; GA AV ČR(CZ) IAA400040901; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : enzyme-linked electrochemical assay * SNP typing * p53 mutation Subject RIV: AQ - Safety, Health Protection, Human - Machine Impact factor: 2.630, year: 2009

  19. Effects of short-term, single and combined exposure to low-level NO sub 2 and O sub 3 on lung tissue enzyme activities in rats

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.S.; Mustafa, M.G.; Afifi, A.A. (Univ. of California, Los Angeles (USA))

    1990-01-01

    To examine the pulmonary effects of relatively low levels of NO{sub 2} and O{sub 3}, and test for any possible interaction in their effects, we exposed 3-mo-old male Sprague-Dawley rats, free of specific pathogens, to either filtered room air (control) or 1.20 ppm (2256 micrograms/m3) NO{sub 2}, 0.30 ppm (588 micrograms/m3) O{sub 3}, or a combination of the two oxidants continuously for 3 d. We studied a series of parameters in the lung, including lung weight, and enzyme activities related to NADPH generation, sulfhydryl metabolism, and cellular detoxification. The results showed that relative to control, exposure to NO2 caused small but nonsignificant changes in all the parameters; O{sub 3} caused significant increases in all the parameters except for superoxide dismutase; and a combination of NO{sub 2} and O{sub 3} caused increases in all the parameters, and the increases were greater than those caused by NO{sub 2} or O{sub 3} alone. Statistical analysis of the data showed that the effects of combined exposure were synergistic for 6-phosphogluconate dehydrogenase, isocitrate dehydrogenase, glutathione reductase, and superoxide dismutase activities, and additive for glutathione peroxidase and disulfide reductase activities, but indifferent from those of O{sub 3} exposure for other enzyme activities.

  20. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  1. Computer simulation of heterogeneous single nucleotide polymorphisms in the catalase gene indicates structural changes in the enzyme active site, NADPH-binding and tetramerization domains: a genetic predisposition for an altered catalase in patients with vitiligo?

    Science.gov (United States)

    Wood, John M; Gibbons, Nicholas C J; Chavan, Bhaven; Schallreuter, Karin U

    2008-04-01

    Patients with vitiligo have low levels/activities of catalase in their lesional and non-lesional epidermis as well as in their epidermal melanocytes under in vitro conditions while the levels of catalase mRNA are unaltered. This defect leads to a build-up of hydrogen peroxide (H(2)O(2)) in the 10(-3) m range in the epidermis of these patients. In this context, it was realized that 10(-3) m H(2)O(2) deactivates catalase. Along this line, it was also suspected that catalase in patients with vitiligo possesses a special sensitivity to this reactive oxygen species (ROS), and indeed several heterozygous single nucleotide polymorphisms (SNPs) have been documented in the cat gene of these patients. Based on the 3D structure of human catalase monomer, we have modelled the influence of three selected SNPs on the enzyme active site, on the NADPH- as well as the tetramerization-binding domains. Our results show that these SNPs severely alter catalase structurally, which in turn should make the enzyme more susceptible to ROS compared with wild-type enzyme. Taken together, the work presented herein together with the earlier results on SNPs in the cat gene suggests a genetic predisposition for an altered catalase in patients with vitiligo.

  2. Reliable identification of mycobacterial species by PCR-restriction enzyme analysis (PRA)-hsp65 in a reference laboratory and elaboration of a sequence-based extended algorithm of PRA-hsp65 patterns.

    Science.gov (United States)

    Chimara, Erica; Ferrazoli, Lucilaine; Ueky, Suely Yoko Misuka; Martins, Maria Conceição; Durham, Alan Mitchel; Arbeit, Robert D; Leão, Sylvia Cardoso

    2008-03-20

    Identification of nontuberculous mycobacteria (NTM) based on phenotypic tests is time-consuming, labor-intensive, expensive and often provides erroneous or inconclusive results. In the molecular method referred to as PRA-hsp65, a fragment of the hsp65 gene is amplified by PCR and then analyzed by restriction digest; this rapid approach offers the promise of accurate, cost-effective species identification. The aim of this study was to determine whether species identification of NTM using PRA-hsp65 is sufficiently reliable to serve as the routine methodology in a reference laboratory. A total of 434 NTM isolates were obtained from 5019 cultures submitted to the Institute Adolpho Lutz, Sao Paulo Brazil, between January 2000 and January 2001. Species identification was performed for all isolates using conventional phenotypic methods and PRA-hsp65. For isolates for which these methods gave discordant results, definitive species identification was obtained by sequencing a 441 bp fragment of hsp65. Phenotypic evaluation and PRA-hsp65 were concordant for 321 (74%) isolates. These assignments were presumed to be correct. For the remaining 113 discordant isolates, definitive identification was based on sequencing a 441 bp fragment of hsp65. PRA-hsp65 identified 30 isolates with hsp65 alleles representing 13 previously unreported PRA-hsp65 patterns. Overall, species identification by PRA-hsp65 was significantly more accurate than by phenotype methods (392 (90.3%) vs. 338 (77.9%), respectively; p PRA-hsp65 provided an incorrect result for only 1.2%. PRA-hsp65 is a rapid and highly reliable method and deserves consideration by any clinical microbiology laboratory charged with performing species identification of NTM.

  3. Computer systems for annotation of single molecule fragments

    Science.gov (United States)

    Schwartz, David Charles; Severin, Jessica

    2016-07-19

    There are provided computer systems for visualizing and annotating single molecule images. Annotation systems in accordance with this disclosure allow a user to mark and annotate single molecules of interest and their restriction enzyme cut sites thereby determining the restriction fragments of single nucleic acid molecules. The markings and annotations may be automatically generated by the system in certain embodiments and they may be overlaid translucently onto the single molecule images. An image caching system may be implemented in the computer annotation systems to reduce image processing time. The annotation systems include one or more connectors connecting to one or more databases capable of storing single molecule data as well as other biomedical data. Such diverse array of data can be retrieved and used to validate the markings and annotations. The annotation systems may be implemented and deployed over a computer network. They may be ergonomically optimized to facilitate user interactions.

  4. Influence of the exposure way and the time of sacrifice on the effects induced by a single dose of pure Cylindrospermopsin on the activity and transcription of glutathione peroxidase and glutathione-S-transferase enzymes in Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Gutiérrez-Praena, Daniel; Jos, Angeles; Pichardo, Silvia; Puerto, María; Cameán, Ana M

    2013-01-01

    Cylindrospermopsin is a cyanobacterial toxin frequently implicated in cyanobacterial blooms that is approaching an almost cosmopolitan distribution pattern. Moreover, the predominant extracellular availability of this cyanotoxin makes it particularly likely to be taken up by a variety of aquatic organisms including fish. Recently, Cylindrospermopsin has shown to alter the activity and gene expression of some of the glutathione related enzymes in tilapias (Oreochromis niloticus), but little is known about the influence of the route of exposure and the time of sacrifice after a single exposure to Cylindrospermopsin on these biomarkers. With this aim, tilapias were exposed by gavage or by intraperitoneal injection to a single dose of 200 μg kg(-1) bw of pure Cylindrospermopsin and after 24h or 5d they were sacrificed. The activity and relative mRNA expression by real-time PCR of antioxidant enzymes glutathione peroxidase and soluble glutathione-S-transferases (sGST) and the sGST protein abundance by Western blot analysis were evaluated in liver and kidney. Results showed differential responses in dependence on the variables considered with a higher toxicity with the intraperitoneal exposure and with 5d as time of sacrifice. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-01-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C → U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics. PMID:26465508

  6. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  7. Determination of genotype differences through restriction ...

    African Journals Online (AJOL)

    Tyrosinase gene or C locus has long been implicated in the coat colour determination. This gene a copper-containing enzyme located on chromosome 11q14.3 is expressed in melanocytes and controls the major steps in pigment production. In camel, C locus a restriction site provoked by the T variant of the mutation was ...

  8. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  9. Mechanistic insight into Type I restriction endonucleases.

    Science.gov (United States)

    Youell, James; Firman, Keith

    2012-06-01

    Restriction and modification are two opposing activities that are used to protect bacteria from cellular invasion by DNA (e.g. bacteriophage infection). Restriction activity involves cleavage of the DNA; while modification activity is the mechanism used to "mark" host DNA and involves DNA methylation. The study of Type I restriction enzymes has often been seen as an esoteric exercise and this reflects some of their more unusual properties - non-stoichiometric (non-catalytic) cleavage of the DNA substrate, random cleavage of DNA, a massive ATPase activity, and the ability to both cleave DNA and methylate DNA. Yet these enzymes have been found in many bacteria and are very efficient as a means of protecting bacteria against bacteriophage infection, indicating they are successful enzymes. In this review, we summarise recent work on the mechanisms of action, describe switching of function and review their mechanism of action. We also discuss structural rearrangements and cellular localisation, which provide powerful mechanisms for controlling the enzyme activity. Finally, we speculate as to their involvement in recombination and discuss their relationship to helicase enzymes.

  10. A partial digest approach to restriction site mapping.

    Science.gov (United States)

    Skiena, S S; Sundaram, G

    1994-03-01

    We present a new, practical algorithm to resolve the experimental data in restriction site analysis, which is a common technique for mapping DNA. Specifically, we assert that multiple digestions with a single restriction enzyme can provide sufficient information to identify the positions of the restriction sites with high probability. The motivation for the new approach comes from combinatorial results on the number of mutually homeometric sets in one dimension, where two sets of n points are homeometric if the multiset of n(n-1)/2 distances they determine are the same. Since experimental data contain errors, we propose algorithms for reconstructing sets from noisy interpoint distances, including the possibility of missing fragments. We analyse the performance of these algorithms under a reasonable probability distribution, establishing a relative error limit of r = theta(1/n2) beyond which our technique becomes infeasible. Through simulations, we establish that our technique is robust enough to reconstruct data with relative errors of up to 7.0% in the measured fragment lengths for typical problems, which appears sufficient for certain biological applications.

  11. Internal restriction sites: quality assurance aids in genotyping.

    Science.gov (United States)

    O'Rourke, Brendon A; Dennis, Julie A; Healy, Peter J

    2006-03-01

    Improvements to restriction fragment length polymorphism (RFLP)-based genotyping assays currently used for detection of mutations responsible for bovine ferrochelatase and myophosphorylase deficiencies, and equine hyperkalemic periodic paralysis (HYPP) are described. Reports of sporadic inhibition of restriction enzyme activity suggest a critical factor in RFLP-based genotyping assays should be assurance that restriction enzymes perform to specification with every sample. The RFLP genotyping assays that use either a mismatched recognition sequence in one or both of the oligonucleotides, or incorporate a second native site within the PCR amplicon, provide the mechanism by which efficiency of restriction enzymes can be assessed with every sample. The outcome is confirmation of the activity of the discriminating enzyme regardless of genotype.

  12. Conversion of Human Steroid 5[beta]-Reductase (AKR1D1) into 3[beta]-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: Example of Perfect Enzyme Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mo; Drury, Jason E.; Christianson, David W.; Penning, Trevor M. (UPENN)

    2012-10-10

    Human aldo-keto reductase 1D1 (AKR1D1) and AKR1C enzymes are essential for bile acid biosynthesis and steroid hormone metabolism. AKR1D1 catalyzes the 5{beta}-reduction of {Delta}{sup 4}-3-ketosteroids, whereas AKR1C enzymes are hydroxysteroid dehydrogenases (HSDs). These enzymes share high sequence identity and catalyze 4-pro-(R)-hydride transfer from NADPH to an electrophilic carbon but differ in that one residue in the conserved AKR catalytic tetrad, His120 (AKR1D1 numbering), is substituted by a glutamate in AKR1D1. We find that the AKR1D1 E120H mutant abolishes 5{beta}-reductase activity and introduces HSD activity. However, the E120H mutant unexpectedly favors dihydrosteroids with the 5{alpha}-configuration and, unlike most of the AKR1C enzymes, shows a dominant stereochemical preference to act as a 3{beta}-HSD as opposed to a 3{alpha}-HSD. The catalytic efficiency achieved for 3{beta}-HSD activity is higher than that observed for any AKR to date. High resolution crystal structures of the E120H mutant in complex with epiandrosterone, 5{beta}-dihydrotestosterone, and {Delta}{sup 4}-androstene-3,17-dione elucidated the structural basis for this functional change. The glutamate-histidine substitution prevents a 3-ketosteroid from penetrating the active site so that hydride transfer is directed toward the C3 carbonyl group rather than the {Delta}{sup 4}-double bond and confers 3{beta}-HSD activity on the 5{beta}-reductase. Structures indicate that stereospecificity of HSD activity is achieved because the steroid flips over to present its {alpha}-face to the A-face of NADPH. This is in contrast to the AKR1C enzymes, which can invert stereochemistry when the steroid swings across the binding pocket. These studies show how a single point mutation in AKR1D1 can introduce HSD activity with unexpected configurational and stereochemical preference.

  13. Assaying multiple restriction endonucleases functionalities and inhibitions on DNA microarray with multifunctional gold nanoparticle probes.

    Science.gov (United States)

    Ma, Lan; Zhu, Zhijun; Li, Tao; Wang, Zhenxin

    2014-02-15

    Herein, a double-stranded (ds) DNA microarray-based resonance light scattering (RLS) assay with multifunctional gold nanoparticle (GNP) probes has been developed for studying restriction endonuclease functionality and inhibition. Because of decreasing significantly melting temperature, the enzyme-cleaved dsDNAs easily unwind to form single-stranded (ss) DNAs. The ssDNAs are hybridized with multiplex complementary ssDNAs functionalized GNP probes followed by silver enhancement and RLS detection. Three restriction endonucleases (EcoRI, BamHI and EcoRV) and three potential inhibitors (doxorubicin hydrochloride (DOX), ethidium bromide (EB) and an EcoRI-derived helical peptide (α4)) were selected to demonstrate capability of the assay. Enzyme activities of restriction endonucleases are detected simultaneously with high specificity down to the limits of 2.0 × 10(-2)U/mL for EcoRI, 1.1 × 10(-2)U/mL for BamHI and 1.6 × 10(-2)U/mL for EcoRV, respectively. More importantly, the inhibitory potencies of three inhibitors are showed quantitatively, indicating that our approach has great promise for high-throughput screening of restriction endonuclease inhibitors. © 2013 Elsevier B.V. All rights reserved.

  14. Restriction endonucleases: classification, properties, and applications.

    Science.gov (United States)

    Williams, Raymond J

    2003-03-01

    Restriction endonucleases have become a fundamental tool of molecular biology with many commercial vendors and extensive product lines. While a significant amount has been learned about restriction enzyme diversity, genomic organization, and mechanism, these continue to be active areas of research and assist in classification efforts. More recently, one focus has been their exquisite specificity for the proper recognition sequence and the lack of homology among enzymes recognizing the same DNA sequence. Some questions also remain regarding in vivo function. Site-directed mutagenesis and fusion proteins based on known endonucleases show promise for custom-designed cleavage. An understanding of the enzymes and their properties can improve their productive application by maintaining critical digest parameters and enhancing or avoiding alternative activities.

  15. Enzyme changes associated with mitochondrial malic enzyme deficiency in mice

    Energy Technology Data Exchange (ETDEWEB)

    Mohrenweiser, H.W.; Erickson, R.P.

    1979-01-01

    A genetically determined absence of mitochondrial malic enzyme (EC 1.1.1.40) in c/sup 3H//c/sup 6H/ mice is accompanied by a four-fold increase in liver glucose-6-phosphate dehydrogenase and a two-fold increase for 6-phosphogluconate dehydrogenase activity. Smaller increases in the activity of serine dehydratase and glutamic oxaloacetic transaminase are observed while the level of glutamic pyruvate transaminase activity is reduced in the liver of deficient mice. Unexpectedly, the level of activity of total malic enzyme in the livers of mitochrondrial malic enzyme-deficient mice is increased approximately 50% compared to littermate controls. No similar increase in solublle malic enzyme activity is observed in heart of kidney tissue of mutant mice and the levels of total malic enzyme in these tissues are in accord with expected levels of activity in mitochondrial malic enzyme-deficient mice. The divergence in levels of enzyme activity between mutant and wild-type mice begins at 19 to 21 days of age. Immunoinactivation experiments with monospecific antisera to the soluble malic enzyme and glucose-6-phosphate dehydrogenase demonstrate that the activity increases represent increases in the amount of enzyme protein. The alterations are not consistent with a single hormonal response.

  16. Identification of leptospiral isolates by bacterial restriction endonuclease analysis (Brenda

    Directory of Open Access Journals (Sweden)

    Venkatesha M

    2001-01-01

    Full Text Available DNA samples from 19 reference serovars belonging to 19 different serogroups of Leptospira interrogans and two serovars belonging to Leptospira biflexa were examined by bacterial restriction endonuclease analysis using EcoR I and Hae III enzymes. All the serovars gave unique restriction patterns that differed from each other. DNA from 10 local isolates digested with these enzymes produced patterns which on comparison with the standard patterns produced by reference strains could be identified to serovar level.

  17. The SUMOylation Pathway Restricts Gene Transduction by Adeno-Associated Viruses.

    Directory of Open Access Journals (Sweden)

    Christina Hölscher

    2015-12-01

    Full Text Available Adeno-associated viruses are members of the genus dependoviruses of the parvoviridae family. AAV vectors are considered promising vectors for gene therapy and genetic vaccination as they can be easily produced, are highly stable and non-pathogenic. Nevertheless, transduction of cells in vitro and in vivo by AAV in the absence of a helper virus is comparatively inefficient requiring high multiplicity of infection. Several bottlenecks for AAV transduction have previously been described, including release from endosomes, nuclear transport and conversion of the single stranded DNA into a double stranded molecule. We hypothesized that the bottlenecks in AAV transduction are, in part, due to the presence of host cell restriction factors acting directly or indirectly on the AAV-mediated gene transduction. In order to identify such factors we performed a whole genome siRNA screen which identified a number of putative genes interfering with AAV gene transduction. A number of factors, yielding the highest scores, were identified as members of the SUMOylation pathway. We identified Ubc9, the E2 conjugating enzyme as well as Sae1 and Sae2, enzymes responsible for activating E1, as factors involved in restricting AAV. The restriction effect, mediated by these factors, was validated and reproduced independently. Our data indicate that SUMOylation targets entry of AAV capsids and not downstream processes of uncoating, including DNA single strand conversion or DNA damage signaling. We suggest that transiently targeting SUMOylation will enhance application of AAV in vitro and in vivo.

  18. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  19. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A physical map of human Alu repeats cleavage by restriction endonucleases

    Directory of Open Access Journals (Sweden)

    Chernukhin Valery A

    2008-06-01

    Full Text Available Abstract Background Alu repetitive elements are the abundant sequences in human genome. Diversity of DNA sequences of these elements makes difficult the construction of theoretical patterns of Alu repeats cleavage by restriction endonucleases. We have proposed a method of restriction analysis of Alu repeats sequences in silico. Results Simple software to analyze Alu repeats database has been suggested and Alu repeats digestion patterns for several restriction enzymes' recognition sites have been constructed. Restriction maps of Alu repeats cleavage for corresponding restriction enzymes have been calculated and plotted. Theoretical data have been compared with experimental results on DNA hydrolysis with restriction enzymes, which we obtained earlier. Conclusion Alu repeats digestions provide the main contribution to the patterns of human chromosomal DNA cleavage. This corresponds to the experimental data on total human DNA hydrolysis with restriction enzymes.

  1. Comparison of immunofluorescence and enzyme-linked immunosorbent assay and immunoglobulin G avidity techniques for screening of anti: Toxoplasma antibodies among single serum sample pregnant women in Tabriz, Iran

    Directory of Open Access Journals (Sweden)

    Mehrangiz Rajaii

    2015-01-01

    Full Text Available Background: Congenital toxoplasmosis is that pregnant women acquire the infection during gestation; diagnosis of the acute infection during pregnancy is a complex subject of maternal toxoplasmosis. Thus, the presence of immunoglobulin G (IgG and/or IgM Toxoplasma antibodies in a single serum sample drawn during gestation cannot be used to define whether the infection was recently acquired or chronic. Materials and Methods: At this cross-sectional descriptive study, sera of 391 pregnant women examined and compared. They were in an age range of 21-35 years, referred by gynecologists and infectious disease specialists, during March 2012-April 2013. They have referred, 215 (54.98%, 102 (26%, 74 (18.92% in the first, second and third trimesters of gestation, respectively. For each of them, a questionnaire was completed and serum samples were prepared in an equal condition, examined according to the procedures of indirect immunofluorescence (IIF, enzyme-linked immunosorbent assay (ELISA and IgG Avidity techniques. Results: We have found 111 (28.38% seronegative and 280 (71.61% seropositive cases by IIF and 124 (31.70% seronegative, 267 (68.28% seropositive cases by ELISA. The IgG avidity test confirmed 45 (69.23% and 7 (10.76% doubtful cases of IgM test in IIF and ELISA techniques. Conclusions: This study highlights how to manage pregnant women with toxoplasmosis, especially in a single serum sample condition.

  2. RestrictionDigest: A powerful Perl module for simulating genomic restriction digests

    Directory of Open Access Journals (Sweden)

    Jinpeng Wang

    2016-05-01

    Conclusions: RestrictionDigest is an easy-to-use Perl module with flexible parameter settings. With the help of the information produced by the module, researchers can easily determine the most appropriate enzymes to construct the reduced-representation libraries to meet their experimental requirements.

  3. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    Science.gov (United States)

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history.

  4. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...... against host country restrictions, but which is often not recognised to the same extent by national law, and 3) the importance of also identifying and recognising an exit restriction, so that it is possible to achieve the required test of appropriateness and proportionality in relation to the rule...

  5. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  6. Exact multi-restricted Schur polynomial correlators

    International Nuclear Information System (INIS)

    Bhattacharyya, Rajsekhar; Koch, Robert de Mello; Stephanou, Michael

    2008-01-01

    We derive a product rule satisfied by restricted Schur polynomials. We focus mostly on the case that the restricted Schur polynomial is built using two matrices, although our analysis easily extends to more than two matrices. This product rule allows us to compute exact multi-point correlation functions of restricted Schur polynomials, in the free field theory limit. As an example of the use of our formulas, we compute two point functions of certain single trace operators built using two matrices and three point functions of certain restricted Schur polynomials, exactly, in the free field theory limit. Our results suggest that gravitons become strongly coupled at sufficiently high energy, while the restricted Schur polynomials for totally antisymmetric representations remain weakly interacting at these energies. This is in perfect accord with the half-BPS (single matrix) results of hep-th/0512312. Finally, by studying the interaction of two restricted Schur polynomials we suggest a physical interpretation for the labels of the restricted Schur polynomial: the composite operator χ R,(r n ,r m ) (Z,X) is constructed from the half BPS 'partons' χ r n (Z) and χ r m (X).

  7. Application of Created Restriction Site PCR-RFLP to Identify POT1 Gene Polymorphism.

    Science.gov (United States)

    Wang, Tuanwei; Wang, Sihua; Duan, Xiaoran; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Feng, Feifei; Yu, Songcheng; Wu, Yiming; Wang, Wei

    2016-06-01

    Protection of telomeres protein 1 (POT1) plays pivotal roles in protection of chromosome ends and regulation of telomere length with other telomere binding proteins; its genetic polymorphisms are associated with many diseases. In this study, we explored a novel PCR-RFLP method for typing the single nucleotide polymorphism (SNP) rs1034794 of the human POT1 gene. A new restriction enzyme site was introduced into a POT1 gene amplification product by created restriction site PCR (CRS-PCR). One primer was designed based on changed sequence; after PCR amplification, a new restriction enzyme site for AluI was introduced into the PCR products. One hundred and seventy eight samples from Han Chinese individuals were tested to evaluate this new method. The 3'-end of the forward primer was next to the polymorphic site, and the third base from the 3'-end was the mismatched base A. The final PCR product contained the AGCT sequence (AluI recognition site) when the ancestral POT1 alleles were amplified. The data obtained with the new method perfectly matched those obtained with the sequencing method. Thus, CRS-PCR is a new low-cost and high-efficiency alternative for rs1034794 typing.

  8. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...

  9. Functional significance of protein assemblies predicted by the crystal structure of the restriction endonuclease BsaWI.

    Science.gov (United States)

    Tamulaitis, Gintautas; Rutkauskas, Marius; Zaremba, Mindaugas; Grazulis, Saulius; Tamulaitiene, Giedre; Siksnys, Virginijus

    2015-09-18

    Type II restriction endonuclease BsaWI recognizes a degenerated sequence 5'-W/CCGGW-3' (W stands for A or T, '/' denotes the cleavage site). It belongs to a large family of restriction enzymes that contain a conserved CCGG tetranucleotide in their target sites. These enzymes are arranged as dimers or tetramers, and require binding of one, two or three DNA targets for their optimal catalytic activity. Here, we present a crystal structure and biochemical characterization of the restriction endonuclease BsaWI. BsaWI is arranged as an 'open' configuration dimer and binds a single DNA copy through a minor groove contacts. In the crystal primary BsaWI dimers form an indefinite linear chain via the C-terminal domain contacts implying possible higher order aggregates. We show that in solution BsaWI protein exists in a dimer-tetramer-oligomer equilibrium, but in the presence of specific DNA forms a tetramer bound to two target sites. Site-directed mutagenesis and kinetic experiments show that BsaWI is active as a tetramer and requires two target sites for optimal activity. We propose BsaWI mechanism that shares common features both with dimeric Ecl18kI/SgrAI and bona fide tetrameric NgoMIV/SfiI enzymes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Do Angiotensin-Converting Enzyme Inhibitors Reduce the Risk of Symptomatic Radiation Pneumonitis in Patients With Non-Small Cell Lung Cancer After Definitive Radiation Therapy? Analysis of a Single-Institution Database

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hongmei [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong Province, P.R. of China (China); Liao, Zhongxing, E-mail: zliao@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zhuang, Yan; Xu, Ting; Nguyen, Quynh-Nhu; Levy, Lawrence B.; O' Reilly, Michael [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gold, Kathryn A. [Department of Thoracic Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gomez, Daniel R. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2013-12-01

    Purpose: Preclinical studies have suggested that angiotensin-converting enzyme inhibitors (ACEIs) can mitigate radiation-induced lung injury. We sought here to investigate possible associations between ACEI use and the risk of symptomatic radiation pneumonitis (RP) among patients undergoing radiation therapy (RT) for non–small cell lung cancer (NSCLC). Methods and Materials: We retrospectively identified patients who received definitive radiation therapy for stages I to III NSCLC between 2004 and 2010 at a single tertiary cancer center. Patients must have received a radiation dose of at least 60 Gy for a single primary lung tumor and have had imaging and dosimetric data available for analysis. RP was quantified according to Common Terminology Criteria for Adverse Events, version 3.0. A Cox proportional hazard model was used to assess potential associations between ACEI use and risk of symptomatic RP. Results: Of 413 patients analyzed, 65 were using ACEIs during RT. In univariate analysis, the rate of RP grade ≥2 seemed lower in ACEI users than in nonusers (34% vs 46%), but this apparent difference was not statistically significant (P=.06). In multivariate analysis of all patients, ACEI use was not associated with the risk of symptomatic RP (hazard ratio [HR] = 0.66; P=.07) after adjustment for sex, smoking status, mean lung dose (MLD), and concurrent carboplatin and paclitaxel chemotherapy. Subgroup analysis showed that ACEI use did have a protective effect from RP grade ≥2 among patients who received a low (≤20-Gy) MLD (P<.01) or were male (P=.04). Conclusions: A trend toward reduction in symptomatic RP among patients taking ACEIs during RT for NSCLC was not statistically significant on univariate or multivariate analyses, although certain subgroups may benefit from use (ie, male patients and those receiving low MLD). The evidence at this point is insufficient to establish whether the use of ACEIs does or does not reduce the risk of RP.

  11. Elevated Liver Enzymes

    Science.gov (United States)

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

  12. DNA Modification Methylase Activity of Escherichia coli Restriction Endonucleases K and P

    Science.gov (United States)

    Haberman, Allan; Heywood, Janet; Meselson, Matthew

    1972-01-01

    The highly purified restriction endonucleases of E. coli K and coliphage P1 transfer methyl groups from S-adenosylmethionine to adenine residues of unmodified DNA. Incubation of unmodified DNA with endonucleases K or P and S-adenosylmethionine renders the DNA resistant to restriction. The enzymes, therefore, have both restriction endonuclease and modification methylase activities. PMID:4564204

  13. Mining for Restriction Endonucleases in Nicaragua

    Directory of Open Access Journals (Sweden)

    Suyén S. Espinoza-Miranda

    2012-12-01

    Full Text Available The Molecular Biology Center at the University of Central America in Nicaragua (CBM-UCA was founded in 1999 to strengthen biotechnology research capacity and education in Nicaragua and the Central American region. One of the first projects launched by the CBM-UCA was bio-prospecting for key industrial enzymes. This ongoing study seeks to discover and characterize restriction enzymes (RE in bacteria, and to create a database of microorganisms isolated and identified by 16S rDNA sequencing methodology. In this paper we highlight the importance of studying the extreme environmental conditions for building knowledge of Nicaraguan biodiversity through modern molecular biology techniques such as metagenomics. The isolation of prototype enzymes such as EcoRV and ClaI is presented as an update and extension of previously undertaken work.

  14. Multi-enzyme catalyzed processes: Next generation biocatalysis

    DEFF Research Database (Denmark)

    Andrade Santacoloma, Paloma de Gracia; Sin, Gürkan; Gernaey, Krist

    2011-01-01

    Biocatalysis has been attracting increasing interest in recent years. Nevertheless, most studies concerning biocatalysis have been carried out using single enzymes (soluble or immobilized). Currently, multiple enzyme mixtures are attractive for the production of many compounds at an industrial...

  15. Energy restriction and potential energy restriction mimetics.

    Science.gov (United States)

    Nikolai, Sibylle; Pallauf, Kathrin; Huebbe, Patricia; Rimbach, Gerald

    2015-12-01

    Energy restriction (ER; also known as caloric restriction) is the only nutritional intervention that has repeatedly been shown to increase lifespan in model organisms and may delay ageing in humans. In the present review we discuss current scientific literature on ER and its molecular, metabolic and hormonal effects. Moreover, criteria for the classification of substances that might induce positive ER-like changes without having to reduce energy intake are summarised. Additionally, the putative ER mimetics (ERM) 2-deoxy-d-glucose, metformin, rapamycin, resveratrol, spermidine and lipoic acid and their suggested molecular targets are discussed. While there are reports on these ERM candidates that describe lifespan extension in model organisms, data on longevity-inducing effects in higher organisms such as mice remain controversial or are missing. Furthermore, some of these candidates produce detrimental side effects such as immunosuppression or lactic acidosis, or have not been tested for safety in long-term studies. Up to now, there are no known ERM that could be recommended without limitations for use in humans.

  16. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  17. Enzyme loading dependence of cellulose hydrolysis of sugarcane bagasse

    Directory of Open Access Journals (Sweden)

    Carlos Martín

    2012-01-01

    Full Text Available The enzymatic hydrolysis of steam-pretreated sugarcane bagasse, either delignified or non-delignified, was studied as a function of enzyme loading. Hydrolysis experiments were carried out using five enzyme loadings (2.5 to 20 FPU/g cellulose and the concentration of solids was 2% for both materials. Alkaline delignification improved cellulose hydrolysis by increasing surface area. For both materials, glucose concentrations increased with enzyme loading. On the other hand, enzyme loadings higher than 15 FPU/g did not result in any increase in the initial rate, since the excess of enzyme adsorbed onto the substrate restricted the diffusion process through the structure.

  18. Thermodynamic DNA Looping by a Two-Site Restriction Endonuclease Studied using Optical Tweezers

    Science.gov (United States)

    Gemmen, Gregory J.

    2005-03-01

    Many enzyme-DNA interactions involve multimeric protein complexes that bind at two distant sites such that the DNA is looped. An example is the type IIe restriction enzyme Sau3AI, which requires two recognition sites to cleave the DNA. Here we study this process at the single DNA level using force measuring optical tweezers. We characterize cleavage rates of single DNA molecules in the presence of Sau3AI as a function of enzyme concentration, incubation time, and the fractional extension of the DNA molecule. Activity is completely inhibited by tensions of a few picoNewtons. By replacing Mg^2+ with Ca^2+, the Sau3AI dimers form but do not cleave the DNA, thus trapping DNA loops. We are able to pull apart these loops, measuring the force needed and the length of DNA released for each. We also characterize the number and length distributions of these loops as a function of incubation time and DNA fractional extension. The results of these studies are discussed in the context of a Brownian dynamics model of DNA looping.

  19. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, ß-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... metabolite and hormone concentrations in restricted ewes suggest that maternal tissues were being mobilised. Despite the ewes' adaptations their lambs weighed significantly less at birth. Furthermore, colostrum and milk yields were markedly reduced up until the latest measurement at 3 weeks post partum...... despite adlibitum access to feed. Reduced milk yields coincided with reduced plasma IGF-1 concentration pre partum in nutrient restricted ewes indicating, that mammary gland development may have been compromised. The present data suggest that leptin is not involved in the regulation of early lactation...

  20. Protein restriction and cancer.

    Science.gov (United States)

    Yin, Jie; Ren, Wenkai; Huang, Xingguo; Li, Tiejun; Yin, Yulong

    2018-03-26

    Protein restriction without malnutrition is currently an effective nutritional intervention known to prevent diseases and promote health span from yeast to human. Recently, low protein diets are reported to be associated with lowered cancer incidence and mortality risk of cancers in human. In murine models, protein restriction inhibits tumor growth via mTOR signaling pathway. IGF-1, amino acid metabolic programing, FGF21, and autophagy may also serve as potential mechanisms of protein restriction mediated cancer prevention. Together, dietary intervention aimed at reducing protein intake can be beneficial and has the potential to be widely adopted and effective in preventing and treating cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Caracterization of Aujeszky's disease virus isolated from South Brazil in the last twenty years by restriction enzyme analysis Caracterização de amostras do vírus de Aujeszky isoladas na região Sul do Brasil nos últimos vinte anos através de análise de restrição enzimática

    Directory of Open Access Journals (Sweden)

    Rejane Schaefer

    2006-09-01

    Full Text Available Aujeszky's disease virus (ADV belongs to Herpesviridae family and is an important etiological agent which infects pigs causing economic losses in swine producing countries worldwide and international trade restrictions to products of swine origin. An eradication program for ADV was established in Santa Catarina State since 2001. The last outbreak was reported in July 2004 and since then none has been reported. The disease has been controlled with the use of a genetic modified vaccine and elimination of seropositives. Aiming the characterization of ADV isolated in the South of Brazil in the last twenty years (1983-2003, a retrospective study based on the genomic analysis of the isolates through a digestion of viral genomic DNA with restriction enzyme Bam HI was done. Thirty-seven ADV samples isolated from swine from the States of Santa Catarina, Parana and Rio Grande do Sul were analyzed. These isolates were compared to the reference strains NIA-4, Bartha and Begonia. The most predominant genomic arrangement was type II found in 33 samples isolated in Santa Catarina State and in one isolate from Rio Grande do Sul State. Genomic arrangement type I, characteristic of vaccine strains was identified in 2 isolates from Parana State and in 1 isolate from Rio Grande do Sul State.O vírus da doença de Aujeszky (VDA pertencente à família Herpesviridae é um importante agente etiológico que infecta suínos causando perdas na produção de suínos no mundo inteiro e restrições para o comércio internacional de suínos ou de seus subprodutos. No estado de Santa Catarina, Brasil, foi instituído em 2001 um programa de erradicação da doença de Aujeszky (DA. O último surto da DA foi reportado em julho de 2004 e desde então não foram notificados mais casos. A doença tem sido controlada com o uso de uma vacina geneticamente modificada e eliminação de animais soropositivos para o VDA. Visando caracterizar amostras do VDA isoladas nos últimos vinte

  2. Analytical workflow of double-digest restriction site-associated DNA sequencing based on empirical and in silico optimization in tomato.

    Science.gov (United States)

    Shirasawa, Kenta; Hirakawa, Hideki; Isobe, Sachiko

    2016-04-01

    Double-digest restriction site-associated DNA sequencing (ddRAD-Seq) enables high-throughput genome-wide genotyping with next-generation sequencing technology. Consequently, this method has become popular in plant genetics and breeding. Although computational in silico prediction of restriction sites from the genome sequence is recognized as an effective approach for choosing the restriction enzymes to be used, few reports have evaluated the in silico predictions in actual experimental data. In this study, we designed and demonstrated a workflow for in silico and empirical ddRAD-Seq analysis in tomato, as follows: (i)in silico prediction of optimum restriction enzymes from the reference genome, (ii) verification of the prediction by actual ddRAD-Seq data of four restriction enzyme combinations, (iii) establishment of a computational data processing pipeline for high-confidence single nucleotide polymorphism (SNP) calling, and (iv) validation of SNP accuracy by construction of genetic linkage maps. The quality of SNPs based on de novo assembly reference of the ddRAD-Seq reads was comparable with that of SNPs obtained using the published reference genome of tomato. Comparisons of SNP calls in diverse tomato lines revealed that SNP density in the genome influenced the detectability of SNPs by ddRAD-Seq. In silico prediction prior to actual analysis contributed to optimization of the experimental conditions for ddRAD-Seq, e.g. choices of enzymes and plant materials. Following optimization, this ddRAD-Seq pipeline could help accelerate genetics, genomics, and molecular breeding in both model and non-model plants, including crops. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. Solitary restriction endonucleases in prokaryotic genomes.

    Science.gov (United States)

    Ershova, Anna S; Karyagina, Anna S; Vasiliev, Mikhail O; Lyashchuk, Alexander M; Lunin, Vladimir G; Spirin, Sergey A; Alexeevski, Andrei V

    2012-11-01

    Prokaryotic restriction-modification (R-M) systems defend the host cell from the invasion of a foreign DNA. They comprise two enzymatic activities: specific DNA cleavage activity and DNA methylation activity preventing cleavage. Typically, these activities are provided by two separate enzymes: a DNA methyltransferase (MTase) and a restriction endonuclease (RE). In the absence of a corresponding MTase, an RE of Type II R-M system is highly toxic for the cell. Genes of the R-M system are linked in the genome in the vast majority of annotated cases. There are only a few reported cases in which the genes of MTase and RE from one R-M system are not linked. Nevertheless, a few hundreds solitary RE genes are present in the Restriction Enzyme Database (http://rebase.neb.com) annotations. Using the comparative genomic approach, we analysed 272 solitary RE genes. For 57 solitary RE genes we predicted corresponding MTase genes located distantly in a genome. Of the 272 solitary RE genes, 99 are likely to be fragments of RE genes. Various explanations for the existence of the remaining 116 solitary RE genes are also discussed.

  4. Variation in Antiviral 2', 5'-Oligoadenylate Synthetase (2'5'AS) Enzyme Activity is controlled by a Single-Nucleotide Polymorphism at a Splice-Acceptor Site in the OAS1 Gene

    DEFF Research Database (Denmark)

    Bonnevie-Nielsen, V.; Leigh, F.L.; Lu, S.

    2005-01-01

    It is likely that human genetic differences mediate susceptibility to viral infection and virus-triggered disorders. OAS genes encoding the antiviral enzyme 2',5'-oligoadenylate synthetase (2'5'AS) are critical components of the innate immune response to viruses. This enzyme uses adenosine......, and AA genotypes (tested by analysis of variance; P=1 x 10(-14)). Allele G generates the previously described p46 enzyme isoform, whereas allele A ablates the splice site and generates a dual-function antiviral/proapoptotic p48 isoform and a novel p52 isoform. This genetic polymorphism makes OAS1...

  5. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...

  6. AQUA Cloning: A Versatile and Simple Enzyme-Free Cloning Approach.

    Directory of Open Access Journals (Sweden)

    Hannes M Beyer

    Full Text Available Assembly cloning is increasingly replacing conventional restriction enzyme and DNA-ligase-dependent cloning methods for reasons of efficiency and performance. Here, we describe AQUA (advanced quick assembly, a simple and versatile seamless assembly cloning approach. We demonstrate the applicability and versatility of AQUA Cloning in selected proof-of-principle applications including targeted insertion-, deletion- and site-directed point-mutagenesis, and combinatorial cloning. Furthermore, we show the one pot de novo assembly of multiple DNA fragments into a single circular plasmid encoding a complex light- and chemically-regulated Boolean A NIMPLY B logic operation. AQUA Cloning harnesses intrinsic in vivo processing of linear DNA fragments with short regions of homology of 16 to 32 bp mediated by Escherichia coli. It does not require any kits, enzymes or preparations of reagents and is the simplest assembly cloning protocol to date.

  7. Laparoscopic sleeve gastrectomy: more than a restrictive bariatric surgery procedure?

    OpenAIRE

    Benaiges Foix, David; Más-Lorenzo, Antonio; Goday Arno, Alberto; Ramón Moros, José Manuel; Chillarón Jordan, Juan José; Pedro-Botet, Juan Carlos; Flores-Le-Roux, Juana Antonia

    2015-01-01

    Sleeve gastrectomy (SG) is a restrictive bariatric surgery technique that was first used as part of restrictive horizontal gastrectomy in the original Scopinaro type biliopancreatic diversion. Its good results as a single technique have led to a rise in its use, and it is currently the second most performed technique worldwide. SG achieves clearly better results than other restrictive techniques and is comparable in some aspects to the Roux-en-Y gastric bypass, the current gold standard in ba...

  8. The ENZYME data bank.

    Science.gov (United States)

    Bairoch, A

    1994-09-01

    The ENZYME data bank is a repository of information relative to the nomenclature of enzymes. It is primarily based on the recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (IUBMB) and it contains the following data for each type of characterized enzyme for which an EC (Enzyme Commission) number has been provided: EC number Recommended name Alternative names (if any) Catalytic activity Cofactors (if any) Pointers to the SWISS-PROT protein sequence entrie(s) that correspond to the enzyme (if any) Pointers to human disease(s) associated with a deficiency of the enzyme (if any).

  9. Effect of dietary protein restriction on renal ammonia metabolism

    Science.gov (United States)

    Lee, Hyun-Wook; Osis, Gunars; Handlogten, Mary E.; Guo, Hui; Verlander, Jill W.

    2015-01-01

    Dietary protein restriction has multiple benefits in kidney disease. Because protein intake is a major determinant of endogenous acid production, it is important that net acid excretion change in parallel during protein restriction. Ammonia is the primary component of net acid excretion, and inappropriate ammonia excretion can lead to negative nitrogen balance. Accordingly, we examined ammonia excretion in response to protein restriction and then we determined the molecular mechanism of the changes observed. Wild-type C57Bl/6 mice fed a 20% protein diet and then changed to 6% protein developed an 85% reduction in ammonia excretion within 2 days, which persisted during a 10-day study. The expression of multiple proteins involved in renal ammonia metabolism was altered, including the ammonia-generating enzymes phosphate-dependent glutaminase (PDG) and phosphoenolpyruvate carboxykinase (PEPCK) and the ammonia-metabolizing enzyme glutamine synthetase. Rhbg, an ammonia transporter, increased in expression in the inner stripe of outer medullary collecting duct intercalated cell (OMCDis-IC). However, collecting duct-specific Rhbg deletion did not alter the response to protein restriction. Rhcg deletion did not alter ammonia excretion in response to dietary protein restriction. These results indicate 1) dietary protein restriction decreases renal ammonia excretion through coordinated regulation of multiple components of ammonia metabolism; 2) increased Rhbg expression in the OMCDis-IC may indicate a biological role in addition to ammonia transport; and 3) Rhcg expression is not necessary to decrease ammonia excretion during dietary protein restriction. PMID:25925252

  10. Malic enzymes of Trichomonas vaginalis: two enzyme families, two distinct origins.

    Science.gov (United States)

    Dolezal, Pavel; Vanácová, Stepánka; Tachezy, Jan; Hrdý, Ivan

    2004-03-31

    The cytosolic malic enzyme of the amitochondriate protist Trichomonas vaginalis was purified to homogeneity and characterized. The corresponding gene was sequenced and compared with its hydrogenosomal homologue from the same organism. The enzymes were found to differ in coenzyme specificity, molecular mass and physiological role. The cytosolic malic enzyme is a dimer consisting of two 42-kDa subunits with strict specificity for nicotinamide adenine dinucleotide phosphate (NADP(+)), and has a presumed function of pyruvate and NADPH production. The hydrogenosomal malic enzyme is a tetramer of 60-kDa subunits that preferentially utilizes nicotinamide adenine dinucleotide (NAD(+)) to NADP(+). The hydrogenosomal enzyme supplies the hydrogenosome with pyruvate for further catabolic processes linked with substrate-level phosphorylation. Phylogenetic analysis of malic enzymes showed the existence of two distinct families of these enzymes in nature, which differ in subunit size. The trichomonad cytosolic malic enzyme belongs to the small subunit-type family that occurs almost exclusively in prokaryotes. In contrast, the hydrogenosomal malic enzyme displays a close relationship with the large subunit-type family of the enzyme, which is found in mitochondria, plastids and the cytosol of eukaryotes. The eubacterial origin of trichomonad cytosolic malic enzyme suggests an occurrence of horizontal gene transfer from a eubacterium to the ancestor of T. vaginalis. The presence of both prokaryotic and eukaryotic type of malic enzyme in different compartments of a single eukaryotic cell appears to be unique in nature.

  11. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...

  12. Therapeutic effect of co-enzyme Q10 on idiopathic dilated cardiomyopathy: assessment by iodine-123 labelled 15-(p-iodophenyl)-3(R,S)-methylpentadecanoic acid myocardial single-photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yong-ih [Department of Internal Medicine, Nishiyodo Hospital, Nishiyodo (Japan); Sawada, Yoshihiro [Department of Internal Medicine, Nishiyodo Hospital, Nishiyodo (Japan); Fujiwara, Go [Department of Radiology, Nishiyodo Hospital, Nishiyodo (Japan); Chiba, Hiroshi [Department of Internal Medicine, Mimihara General Hospital, Mimihara (Japan); Nishimura, Tsunehiko [Division of Tracer Kinetics, Biomedical Research Center, Osaka University Medical School, Osaka (Japan)

    1997-06-10

    It has been reported that myocardial mitochondrial function can be improved by the administration of co-enzyme Q10 (CoQ10). Recently, iodine-123 labelled 15-(p-iodophenyl)-3-(R,S)-methylpentadecanoic acid (BMIPP) was developed for metabolic imaging using single-photon emission tomography (SPET). This study was conducted to determine whether the therapeutic effects of CoQ10 on idiopathic dilated cardiomyopathy can be evaluated by BMIPP myocardial SPET. Fifteen patients, comprising 14 men and one woman (mean age: 64{+-}12 years), were examined. CoQ10 was administered at 30 mg/day for a period of 35.7{+-}12.4 days. BMIPP myocardial SPET was carried out before and after CoQ10 treatment. The count ratio of the heart (H) to the upper mediastinum (M) (H/M ratio) was calculated using a region of interest method with anterior planar imaging. Representative short-axis tomograms were divided into 27 segments (three slices x nine segments). Each segmental score was analysed semiquantitatively using a four-point scoring system (normal=0, mild low uptake=1, severe low uptake=2, defect=3). The H/M ratio showed a significant improvement, from 2.39{+-}0.39 to 2.54{+-}0.47, after treatment (P<0.05). The BMIPP total defect score after CoQ10 treatment was significantly decreased to 10.1{+-}4.3, compared to 13.9{+-}4.5 without CoQ10 treatment (P<0.001). However, the percent fractional shortening measured using echocardiography was not significantly different before and after CoQ treatment (19.2{+-}8.1 vs 19.7{+-}7.1). BMIPP myocardial SPET was confirmed to be sensitive in evaluating the therapeutic effects of CoQ10 in patients with idiopathic dilated cardiomyopathy. This method is unique, since the therapeutic effects can be estimated from the perspective of metabolic SPET imaging. (orig.). With 5 figs., 1 tab.

  13. Stock discrimination in Great Lakes Walleye using mitochondrial DNA restriction analysis

    International Nuclear Information System (INIS)

    Billington, N.; Hebert, P.D.N.

    1986-01-01

    Over the past two years it has become evident that because of its strict maternal inheritance and rapid rate of evolutionary differentiation, mitochondrial (mt) DNA diversity offers exceptional promise in the discrimination of fish stocks. The current project aims to determine the extent of mt DNA variation among stocks of walleye (Stizostedion vitreum) from the Great Lakes. At this point, mt DNA has been isolated from 68 walleye representing the Thames River stock and a reef breeding stock from western Lake Erie, as well as from individuals of S. canadense, a species which hybridizes with S. vitreum. Mitochondrial DNA was extracted from livers of these fish, purified by CsCl density gradient centrifugation and digested using 20 endonucleases. Polymorphisms were detected with 8 of the enzymes. There was a great deal of variation among fish from both spawning populations, so much so that individual fish could be identified by this technique. No single enzyme allowed discrimination of the two stocks, but restriction pattern variation following Dde I digestion permitted separation of 50% of Lake Erie fish from Thames River stock. Comparison of mt DNA restriction patterns of walleye and sauger showed that two species are easily separable, setting the stage for a more detailed study of hybridization between the taxa

  14. Restricted and quasi-toral restricted Lie-Rinehart algebras

    Directory of Open Access Journals (Sweden)

    Sun Bing

    2015-09-01

    Full Text Available In this paper, we introduce the definition of restrictable Lie-Rinehart algebras, the concept of restrictability is by far more tractable than that of a restricted Lie-Rinehart algebra. Moreover, we obtain some properties of p-mappings and restrictable Lie-Rinehart algebras. Finally, we give some sufficient conditions for the commutativity of quasi-toral restricted Lie-Rinehart algebras and study how a quasi-toral restricted Lie-Rinehart algebra with zero center and of minimal dimension should be.

  15. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    Science.gov (United States)

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Enzyme inhibition by iminosugars

    DEFF Research Database (Denmark)

    López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

    2013-01-01

    Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

  17. Modeling of DNA single stage splicing language via Yusof-Goode approach: One string with two rules

    Science.gov (United States)

    Lim, Wen Li; Yusof, Yuhani; Mudaber, Mohammad Hassan

    2015-02-01

    Splicing system plays a pivotal role in attempts to recombine sets of double-stranded DNA molecules when acted by restriction enzymes and ligase. Traditional method of finding the result of DNA recombination through experiment is both time and money consuming. Hence, finding the number of patterns of DNA single stage splicing language through formalism of splicing system is a way to optimize the searching process. From the biological perspective, it predicts the number of types of molecules that will exist in the system under existence of restriction enzymes and ligase. In this paper, some theorems, corollaries and examples that lead to the predictions of single stage splicing languages involving one pattern string and two rules are presented via Yusof-Goode approach.

  18. The Restriction Endonuclease Cleavage Map of Rat Liver Mitochondrial DNA

    NARCIS (Netherlands)

    Bakker, H.; Holtrop, M.; Terpstra, P.

    1977-01-01

    Mitochondrial DNA from rat liver contains six sites for cleavage by the restriction endonucleases Hind III and EcoRI. A large stretch of DNA, comprising about 40% of the mitochondrial genome is not cleaved by either of the enzymes; eight cleavage sites are located on a DNA stretch of 35% of the

  19. Association between single nucleotide polymorphisms in the antioxidant genes CAT, GR and SOD1, erythrocyte enzyme activities, dietary and life style factors and breast cancer risk in a Danish, prospective cohort study

    DEFF Research Database (Denmark)

    Kopp, Tine Iskov; Vogel, Ulla; Dragsted, Lars Ove

    2017-01-01

    investigated in 703 breast cancer case-control pairs in the Danish, prospective "Diet, Cancer and Health" cohort together with gene-environment interactions between the polymorphisms, enzyme activities and intake of fruits and vegetables, alcohol and smoking in relation to breast cancer risk. Our results...... showed that genetically determined variations in the antioxidant enzyme activities of SOD1, CAT and GSR were not associated with risk of breast cancer per se. However, intake of alcohol, fruit and vegetables, and smoking status interacted with some of the polymorphisms in relation to breast cancer risk...

  20. Restrictions of anthelmintic usage

    DEFF Research Database (Denmark)

    Nielsen, Martin Krarup

    2009-01-01

    in 1966. The province of Quebec in Canada, and an increasing number of European countries, have implemented prescription-only restrictions on anthelmintic drugs. Denmark introduced this legislation ten years ago, and some evidence has been generated describing potential consequences. It is without dispute...... that Danish veterinarians are now deeply involved with parasite management in equine establishments. However, little is known about the impact on levels of anthelmintic resistance and the risk of parasitic disease under these circumstances. In addition, the legislation makes huge demands on diagnosis...

  1. Impact of Autoantibodies against Glycolytic Enzymes on Pathogenicity of Autoimmune Retinopathy and Other Autoimmune Disorders

    Directory of Open Access Journals (Sweden)

    Grazyna Adamus

    2017-04-01

    Full Text Available Autoantibodies (AAbs against glycolytic enzymes: aldolase, α-enolase, glyceraldehyde-3-phosphate dehydrogenase, and pyruvate kinase are prevalent in sera of patients with blinding retinal diseases, such as paraneoplastic [cancer-associated retinopathy (CAR] and non-paraneoplastic autoimmune retinopathies, as well as in many other autoimmune diseases. CAR is a degenerative disease of the retina characterized by sudden vision loss in patients with cancer and serum anti-retinal AAbs. In this review, we discuss the widespread serum presence of anti-glycolytic enzyme AAbs and their significance in autoimmune diseases. There are multiple mechanisms responsible for antibody generation, including the innate anti-microbial response, anti-tumor response, or autoimmune response against released self-antigens from damaged, inflamed tissue. AAbs against enolase, GADPH, and aldolase exist in a single patient in elevated titers, suggesting their participation in pathogenicity. The lack of restriction of AAbs to one disease may be related to an increased expression of glycolytic enzymes in various metabolically active tissues that triggers an autoimmune response and generation of AAbs with the same specificity in several chronic and autoimmune conditions. In CAR, the importance of serum anti-glycolytic enzyme AAbs had been previously dismissed, but the retina may be without pathological consequence until a failure of the blood–retinal barrier function, which would then allow pathogenic AAbs access to their retinal targets, ultimately leading to damaging effects.

  2. Enzyme-based antifouling coatings: a review

    DEFF Research Database (Denmark)

    Olsen, Stefan Møller; Pedersen, Leif Toudal; Laursen, M.H.

    2007-01-01

    to the use of enzymes to release an active biocide with AF activity. For direct AF, several patents have been granted, and a commercial product has been launched. However, the achievement of an efficient broad-spectrum AF coating based on a single or a few enzymes has not yet been achieved. An indirect AF...... for product registration purposes are also considered. The above question currently remains unanswered for technologies utilising indirect enzymatic AF....

  3. Steroid promiscuity: Diversity of enzyme action. Preface.

    Science.gov (United States)

    Lathe, Richard; Kotelevtsev, Yuri; Mason, J Ian

    2015-07-01

    This Special Issue on the topic of Steroid and Sterol Signaling: Promiscuity and Diversity, dwells on the growing realization that the 'one ligand, one binding site' and 'one enzyme, one reaction' concepts are out of date. Focusing on cytochromes P450 (CYP), hydroxysteroid dehydrogenases (HSDs), and related enzymes, the Special Issue highlights that a single enzyme can bind to diverse substrates, and in different conformations, and can catalyze multiple different conversions (and in different directions), thereby, generating an unexpectedly wide spectrum of ligands that can have subtly different biological actions. This article is part of a Special Issue entitled 'Steroid/Sterol Signaling' . Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Restriction-modification system with methyl-inhibited base excision and abasic-site cleavage activities.

    Science.gov (United States)

    Fukuyo, Masaki; Nakano, Toshiaki; Zhang, Yingbiao; Furuta, Yoshikazu; Ishikawa, Ken; Watanabe-Matsui, Miki; Yano, Hirokazu; Hamakawa, Takeshi; Ide, Hiroshi; Kobayashi, Ichizo

    2015-03-11

    The restriction-modification systems use epigenetic modification to distinguish between self and nonself DNA. A modification enzyme transfers a methyl group to a base in a specific DNA sequence while its cognate restriction enzyme introduces breaks in DNA lacking this methyl group. So far, all the restriction enzymes hydrolyze phosphodiester bonds linking the monomer units of DNA. We recently reported that a restriction enzyme (R.PabI) of the PabI superfamily with half-pipe fold has DNA glycosylase activity that excises an adenine base in the recognition sequence (5'-GTAC). We now found a second activity in this enzyme: at the resulting apurinic/apyrimidinic (AP) (abasic) site (5'-GT#C, # = AP), its AP lyase activity generates an atypical strand break. Although the lyase activity is weak and lacks sequence specificity, its covalent DNA-R.PabI reaction intermediates can be trapped by NaBH4 reduction. The base excision is not coupled with the strand breakage and yet causes restriction because the restriction enzyme action can impair transformation ability of unmethylated DNA even in the absence of strand breaks in vitro. The base excision of R.PabI is inhibited by methylation of the target adenine base. These findings expand our understanding of genetic and epigenetic processes linking those in prokaryotes and eukaryotes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Development of Transcriptomic Markers for Population Analysis Using Restriction Site Associated RNA Sequencing (RARseq.

    Directory of Open Access Journals (Sweden)

    Magdy S Alabady

    Full Text Available We describe restriction site associated RNA sequencing (RARseq, an RNAseq-based genotype by sequencing (GBS method. It includes the construction of RNAseq libraries from double stranded cDNA digested with selected restriction enzymes. To test this, we constructed six single- and six-dual-digested RARseq libraries from six F2 pitcher plant individuals and sequenced them on a half of a Miseq run. On average, the de novo approach of population genome analysis detected 544 and 570 RNA SNPs, whereas the reference transcriptome-based approach revealed an average of 1907 and 1876 RNA SNPs per individual, from single- and dual-digested RARseq data, respectively. The average numbers of RNA SNPs and alleles per loci are 1.89 and 2.17, respectively. Our results suggest that the RARseq protocol allows good depth of coverage per loci for detecting RNA SNPs and polymorphic loci for population genomics and mapping analyses. In non-model systems where complete genomes sequences are not always available, RARseq data can be analyzed in reference to the transcriptome. In addition to enriching for functional markers, this method may prove particularly useful in organisms where the genomes are not favorable for DNA GBS.

  6. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  7. Magnetically responsive enzyme powders

    Science.gov (United States)

    Pospiskova, Kristyna; Safarik, Ivo

    2015-04-01

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (-20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties.

  8. Enzymes in animal nutrition

    OpenAIRE

    Scientific Committee on Animal Nutrition

    2011-01-01

    This report brings overview of endogenous as well as exogenous enzymes and their role and importance in animal nutrition. Enzymes for animal nutrition have been systematically developed since 1980´s. Phytase, xylanase and β-glucanase are used in poultry-rising, pig breeding, aquaculture and begin to push to the ruminant nutrition. Phytase increase availability of P, Ca, Zn, digestibility of proteins and fats. Its positive effect on the environment is well described – enzymes decrease the cont...

  9. Profiling the orphan enzymes

    Science.gov (United States)

    2014-01-01

    The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new

  10. The EBI enzyme portal

    OpenAIRE

    Alc?ntara, Rafael; Onwubiko, Joseph; Cao, Hong; de Matos, Paula; Cham, Jennifer A.; Jacobsen, Jules; Holliday, Gemma L.; Fischer, Julia D.; Rahman, Syed Asad; Jassal, Bijay; Goujon, Mikael; Rowland, Francis; Velankar, Sameer; L?pez, Rodrigo; Overington, John P.

    2012-01-01

    The availability of comprehensive information about enzymes plays an important role in answering questions relevant to interdisciplinary fields such as biochemistry, enzymology, biofuels, bioengineering and drug discovery. At the EMBL European Bioinformatics Institute, we have developed an enzyme portal (http://www.ebi.ac.uk/enzymeportal) to provide this wealth of information on enzymes from multiple in-house resources addressing particular data classes: protein sequence and structure, reacti...

  11. Enzyme catalysed tandem reactions

    OpenAIRE

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-01-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a r...

  12. The dynamics of the monomeric restriction endonuclease BcnI during its interaction with DNA.

    Science.gov (United States)

    Kostiuk, Georgij; Dikic, Jasmina; Schwarz, Friedrich W; Sasnauskas, Giedrius; Seidel, Ralf; Siksnys, Virginijus

    2017-06-02

    Endonucleases that generate DNA double strand breaks often employ two independent subunits such that the active site from each subunit cuts either DNA strand. Restriction enzyme BcnI is a remarkable exception. It binds to the 5΄-CC/SGG-3΄ (where S = C or G, '/' designates the cleavage position) target as a monomer forming an asymmetric complex, where a single catalytic center approaches the scissile phosphodiester bond in one of DNA strands. Bulk kinetic measurements have previously shown that the same BcnI molecule cuts both DNA strands at the target site without dissociation from the DNA. Here, we analyse the BcnI DNA binding and target recognition steps at the single molecule level. We find, using FRET, that BcnI adopts either 'open' or 'closed' conformation in solution. Next, we directly demonstrate that BcnI slides over long distances on DNA using 1D diffusion and show that sliding is accompanied by occasional jumping events, where the enzyme leaves the DNA and rebinds immediately at a distant site. Furthermore, we quantify the dynamics of the BcnI interactions with cognate and non-cognate DNA, and determine the preferred binding orientation of BcnI to the target site. These results provide new insights into the intricate dynamics of BcnI-DNA interactions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Enzymes from extremophiles.

    Science.gov (United States)

    Demirjian, D C; Morís-Varas, F; Cassidy, C S

    2001-04-01

    The industrial application of enzymes that can withstand harsh conditions has greatly increased over the past decade. This is mainly a result of the discovery of novel enzymes from extremophilic microorganisms. Recent advances in the study of extremozymes point to the acceleration of this trend. In particular, enzymes from thermophilic organisms have found the most practical commercial use to date because of their overall inherent stability. This has also led to a greater understanding of stability factors involved in adaptation of these enzymes to their unusual environments.

  14. Artificial Enzymes, "Chemzymes"

    DEFF Research Database (Denmark)

    Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M

    2008-01-01

    "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well......Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...

  15. Análise de restrição enzimática do gene hsp65 de isolados clínicos de pacientes com suspeita de tuberculose pulmonar em Teresina, Piauí Restriction enzyme analysis of the hsp65 gene in clinical isolates from patients suspected of having pulmonary tuberculosis in Teresina, Brazil

    Directory of Open Access Journals (Sweden)

    Maria das Graças Motta e Bona

    2011-10-01

    suspected of having pulmonary tuberculosis and to determine the impact that the acquisition of this knowledge has on the therapeutic approach. METHODS: We evaluated 106 patients suspected of having pulmonary tuberculosis and referred to the pulmonology department of a public hospital in the city of Teresina, Brazil. Morning sputum specimens were evaluated for the presence of mycobacteria by sputum smear microscopy and culture. We used PCR and restriction enzyme analysis of the hsp65 gene (PRA-hsp65 to identify the strains of mycobacteria isolated in culture. RESULTS: A total of 206 sputum samples were analyzed. Patient ages ranged from 15 to 87 years, and 67% were male. There was cough in 100% of the cases. The predominant radiographic pattern was moderate disease, observed in 70%. Smear positivity was 76%, and isolation in culture occurred in 91% of the cultures. Traditional tests identified nontuberculous mycobacteria (NTM in 9% of the isolates. The PRA-hsp65 method confirmed these data, showing seven band patterns that were able to identify the isolated species of NTM: Mycobacterium kansasii; M. abscessus 1; M. abscessus 2; M. smegmatis; M. flavescens 1; M. gordonae 5; and M. gordonae 7. All of the patients with NTM were over 60 years of age, and bronchiectasis was seen in 88% of the X-rays. There were two cases of reinfection, initially attributed to M. abscessus and M. kansasii. CONCLUSIONS: In immunocompetent patients, NTM can infect the lungs. It is important to identify the specific NTM in order to establish the correct diagnosis and choose the most appropriate therapeutic regimen. The PRA-hsp65 method is useful in identifying NTM species and can be implemented in molecular biology laboratories that do not specialize in the identification of mycobacteria.

  16. The effects of dietary restriction on oxidative stress in rodents

    Science.gov (United States)

    Walsh, Michael E.; Shi, Yun; Van Remmen, Holly

    2013-01-01

    Oxidative stress is observed during aging and in numerous age-related diseases. Dietary restriction (DR) is a regimen that protects against disease and extends lifespan in multiple species. However, it is unknown how DR mediates its protective effects. One prominent and consistent effect of DR in a number of systems is the ability to reduce oxidative stress and damage. The purpose of this review is to comprehensively examine the hypothesis that dietary restriction reduces oxidative stress in rodents by decreasing reactive oxygen species (ROS) production and increasing antioxidant enzyme activity, leading to an overall reduction of oxidative damage to macromolecules. The literature reveals that the effects of DR on oxidative stress are complex and likely influenced by a variety of factors, including sex, species, tissue examined, types of ROS and antioxidant enzymes examined, and duration of DR. Here we present a comprehensive review of the existing literature on the effect of DR on mitochondrial ROS generation, antioxidant enzymes and oxidative damage. In a majority of studies, dietary restriction had little effect on mitochondrial ROS production or antioxidant activity. On the other hand, DR decreased oxidative damage in the majority of cases. Although the effects of DR on endogenous antioxidants are mixed, we find that glutathione levels are the most likely antioxidant to be increased by dietary restriction, which supports the emerging redox-stress hypothesis of aging. PMID:23743291

  17. Evolutionary Biology of Trillium and Related Genera (Trilliaceae) : I. Restriction Site Mapping and Variation of Chloroplast DNA and its Systematic Implications

    OpenAIRE

    HIDETOSHI, KATO; SHOICHI, KAWANO; RYOHEI, TERAUCHI; MASASHI, OHARA; FREDERICK H., UTECH; Department of Botany, Faculty of Science, Kyoto University; Department of Botany, Faculty of Science, Kyoto University; Department of Botany, Faculty of Science, Kyoto University; Laboratory of Plant Genetics and Education, Faculty of Agriculture, Hokkaido University; Section of Botany, Carnegie Museum of Natural History

    1995-01-01

    A physical map of chloroplast DNA (cpDNA) was constructed for Trillium kamtschaticum using three restriction enzymes, Apal, Pstl and Xhol. The chloroplast genome is 154.5 kbp in size with each portion of the inverted repeat 26.5 kbp in length, separated by large (82.7 kbp) and small (18.8 kbp) single copy regions. The cpDNA of T. kamtschaticum is similar in structure to the cpDNAs of most angiosperms thus far studied. Chloroplast DNA variation in 25 taxa of Trillium was investigated using 14 ...

  18. Regulation of malic enzyme expression and the molecular basis for a cytosolic malic enzyme null mutation

    International Nuclear Information System (INIS)

    Brown, M.L.

    1987-01-01

    In order to investigate the basis for the MOD-1 null mutation, a λgt 11 cDNA library was constructed using mRNA from the livers of induced MOD-1 null mice as a template. A recombinant phage with a 2kb insert was isolated by screening with wild type malic enzyme cDNA probes. The subcloned insert exhibited an atypical (non-wild type) restriction pattern and was subjected to sequence analysis. MOD-1 null malic enzyme cDNA contains an internal, tandemly-duplicated sequence that corresponds to nucleotides 1027-1548 in the coding region of wild type murine malic enzyme cDNA. An open reading frame is retained throughout the duplicated sequences. The discovery of a 522 nucleotide, in-frame duplication accounts for the increased size of MOD-1 null malic enzyme mRNAs. Western immunoblot analysis disclosed that MOD-1 null liver cytosol contains an 82 kDa protein that is recognized by anti malic enzyme antibodies. Under stringent conditions, an anti-sense 32 P-oligonucleotide that spans the abnormal junction between the reiterated sequences hybridized with the 2.5 and 3.6 kb MOD-1 null malic enzyme mRNAs, but failed to form stable complexes with wild type malic enzyme mRNAs

  19. Magnetically responsive enzyme powders

    International Nuclear Information System (INIS)

    Pospiskova, Kristyna; Safarik, Ivo

    2015-01-01

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction

  20. Enzymes in Fermented Fish.

    Science.gov (United States)

    Giyatmi; Irianto, H E

    Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.

  1. Enzyme Vs. Extremozyme -32 ...

    Indian Academy of Sciences (India)

    Enzyme Vs. Extremozyme. What Makes Extremozymes Function Under Harsh Conditions? Santosh Kumar is ... extremozymes to high temperature or pH so that enzymes from mesophiles can be engineered to behave .... alkalinity (above pH 10, soda lake) from which extremozymes have been isolated. F C Lowyer of the ...

  2. Industrial Enzymes and Biocatalysis

    Science.gov (United States)

    McAuliffe, Joseph C.; Aehle, Wolfgang; Whited, Gregory M.; Ward, Donald E.

    All life processes are the result of enzyme activity. In fact, life itself, whether plant or animal, involves a complex network of enzymatic reactions. An enzyme is a protein that is synthesized in a living cell. It catalyzes a thermodynamically possible reaction so that the rate of the reaction is compatible with the numerous biochemical processes essential for the growth and maintenance of a cell. The synthesis of an enzyme thus is under tight metabolic regulations and controls that can be genetically or environmentally manipulated sometimes to cause the overproduction of an enzyme by the cell. An enzyme, like chemical catalysts, in no way modifies the equilibrium constant or the free energy change of a reaction.

  3. Property Rights, Restrictions and Responsibilities

    DEFF Research Database (Denmark)

    Enemark, Stig

    more to a social, ethical commitment or attitude to environmental sustainability and good husbandry. This paper provides an overall understanding of the concept of land administration systems for dealing with rights, restrictions and responsibilities in future spatially enabled government. Finally......Land Administration Systems are the basis for conceptualizing rights, restrictions and responsibilities related to people, policies and places. Property rights are normally concerned with ownership and tenure whereas restrictions usually control use and activities on land. Responsibilities relate...

  4. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  5. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  6. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  7. Enzymic lactose hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.J.; Brand, J.C.

    1980-01-01

    Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

  8. Indicators: Sediment Enzymes

    Science.gov (United States)

    Sediment enzymes are proteins that are produced by microorganisms living in the sediment or soil. They are indicators of key ecosystem processes and can help determine which nutrients are affecting the biological community of a waterbody.

  9. Enzymes in Analytical Chemistry.

    Science.gov (United States)

    Fishman, Myer M.

    1980-01-01

    Presents tabular information concerning recent research in the field of enzymes in analytic chemistry, with methods, substrate or reaction catalyzed, assay, comments and references listed. The table refers to 128 references. Also listed are 13 general citations. (CS)

  10. Enzyme Vs. Extremozyme -32 ...

    Indian Academy of Sciences (India)

    Enzyme Vs. Extremozyme. What Makes Extremozymes Function Under Harsh Conditions? Santosh Kumar is doing his Ph D at Biotechnology. Centre, Indian Institute of. Technology, Bombay. His research interests include: enzymology, metabolism, metabolic regulation and metabolic engineering of a filamentous fungi,.

  11. Advances in enzyme immobilisation

    CSIR Research Space (South Africa)

    Brady, D

    2009-07-10

    Full Text Available improved protein binding capacity. Novel methods of enzyme self immobilisation have been developed (CLEC, CLEA, Spherezyme), as well as carrier materials (Dendrispheres), encapsulation (PEI Microspheres), and entrapment. Apart from retention, recovery...

  12. Enzyme catalysed tandem reactions.

    Science.gov (United States)

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-04-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a reversible process to become irreversible, to shift the equilibrium reaction in such a way that enantiopure compounds can be obtained from prochiral or racemic substrates, reduce or eliminate problems due to product inhibition or prevent the shortage of substrates by dilution or degradation in the bulk media, etc. In this review we want to illustrate the developments of recent studies involving in vitro multi-enzyme reactions for the synthesis of different classes of organic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Postnatal nutritional restriction affects growth and immune function of piglets with intra-uterine growth restriction.

    Science.gov (United States)

    Hu, Liang; Liu, Yan; Yan, Chuan; Peng, Xie; Xu, Qin; Xuan, Yue; Han, Fei; Tian, Gang; Fang, Zhengfeng; Lin, Yan; Xu, Shengyu; Zhang, Keying; Chen, Daiwen; Wu, De; Che, Lianqiang

    2015-07-14

    Postnatal rapid growth by excess intake of nutrients has been associated with an increased susceptibility to diseases in neonates with intra-uterine growth restricted (IUGR). The aim of the present study was to determine whether postnatal nutritional restriction could improve intestinal development and immune function of neonates with IUGR using piglets as model. A total of twelve pairs of normal-birth weight (NBW) and IUGR piglets (7 d old) were randomly assigned to receive adequate nutrient intake or restricted nutrient intake (RNI) by artificially liquid feeding for a period of 21 d. Blood samples and intestinal tissues were collected at necropsy and were analysed for morphology, digestive enzyme activities, immune cells and expression of innate immunity-related genes. The results indicated that both IUGR and postnatal nutritional restriction delayed the growth rate during the sucking period. Irrespective of nutrient intake, piglets with IUGR had a significantly lower villous height and crypt depth in the ileum than the NBW piglets. Moreover, IUGR decreased alkaline phosphatase activity while enhanced lactase activity in the jejunum and mRNA expressions of Toll-like receptor 9 (TLR-9) and DNA methyltransferase 1 (DNMT1) in the ileum of piglets. Irrespective of body weight, RNI significantly decreased the number and/or percentage of peripheral leucocytes, lymphocytes and monocytes of piglets, whereas the percentage of neutrophils and the ratio of CD4+ to CD8+ were increased. Furthermore, RNI markedly enhanced the mRNA expression of TLR-9 and DNMT1, but decreased the expression of NOD2 and TRAF-6 in the ileum of piglets. In summary, postnatal nutritional restriction led to abnormal cellular and innate immune response, as well as delayed the growth and intestinal development of IUGR piglets.

  14. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  15. Overproduction of ligninolytic enzymes

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  16. Measurement of enzyme activity.

    Science.gov (United States)

    Harris, T K; Keshwani, M M

    2009-01-01

    To study and understand the nature of living cells, scientists have continually employed traditional biochemical techniques aimed to fractionate and characterize a designated network of macromolecular components required to carry out a particular cellular function. At the most rudimentary level, cellular functions ultimately entail rapid chemical transformations that otherwise would not occur in the physiological environment of the cell. The term enzyme is used to singularly designate a macromolecular gene product that specifically and greatly enhances the rate of a chemical transformation. Purification and characterization of individual and collective groups of enzymes has been and will remain essential toward advancement of the molecular biological sciences; and developing and utilizing enzyme reaction assays is central to this mission. First, basic kinetic principles are described for understanding chemical reaction rates and the catalytic effects of enzymes on such rates. Then, a number of methods are described for measuring enzyme-catalyzed reaction rates, which mainly differ with regard to techniques used to detect and quantify concentration changes of given reactants or products. Finally, short commentary is given toward formulation of reaction mixtures used to measure enzyme activity. Whereas a comprehensive treatment of enzymatic reaction assays is not within the scope of this chapter, the very core principles that are presented should enable new researchers to better understand the logic and utility of any given enzymatic assay that becomes of interest.

  17. Aging, adiposity, and calorie restriction.

    Science.gov (United States)

    Fontana, Luigi; Klein, Samuel

    2007-03-07

    Excessive calorie intake and subsequent obesity increases the risk of developing chronic disease and decreases life expectancy. In rodent models, calorie restriction with adequate nutrient intake decreases the risk of developing chronic disease and extends maximum life span. To evaluate the physiological and clinical implications of calorie restriction with adequate nutrient intake. Search of PubMed (1966-December 2006) using terms encompassing various aspects of calorie restriction, dietary restriction, aging, longevity, life span, adiposity, and obesity; hand search of journals that focus on obesity, geriatrics, or aging; and search of reference lists of pertinent research and review articles and books. Reviewed reports (both basic science and clinical) included epidemiologic studies, case-control studies, and randomized controlled trials, with quality of data assessed by taking into account publication in a peer-reviewed journal, number of animals or individuals studied, objectivity of measurements, and techniques used to minimize bias. It is not known whether calorie restriction extends maximum life span or life expectancy in lean humans. However, calorie restriction in adult men and women causes many of the same metabolic adaptations that occur in calorie-restricted rodents and monkeys, including decreased metabolic, hormonal, and inflammatory risk factors for diabetes, cardiovascular disease, and possibly cancer. Excessive calorie restriction causes malnutrition and has adverse clinical effects. Calorie restriction in adult men and women causes beneficial metabolic, hormonal, and functional changes, but the precise amount of calorie intake or body fat mass associated with optimal health and maximum longevity in humans is not known. In addition, it is possible that even moderate calorie restriction may be harmful in specific patient populations, such as lean persons who have minimal amounts of body fat.

  18. Production and characterization of a single-chain variable fragment linked alkaline phosphatase fusion protein for detection of O,O-diethyl organophosphorus pesticides in a one-step enzyme-linked immunosorbent assay

    Science.gov (United States)

    A single-chain variable fragment (scFv) and alkaline phosphatase (AP) fusion protein for detection of O, O-diethyl organophosphorus pesticides (OPs) was produced and characterized. The scFv gene was prepared by cloning VL and VH genes from a hybridoma cell secreting monoclonal antibody with broad-s...

  19. Enzyme alterations in mediastine during and after radiotherapy. 2

    International Nuclear Information System (INIS)

    Alheit, H.D.; Alheit, C.; Herrmann, T.

    1986-01-01

    Results are presented estimating the serum activity of transaminases (ASAT and ALAT) in 72 patients after mediastinal irradiation. During and after mediastinal irradiation both enzymes showed essentially a parallel reaction. One day after irradiation a decrease of enzymes in patients who were irradiated with high single dosis (5 Gy) was observed, while patients irradiated with low or middle single dosis showed an increase of enzyme activity. A different temporal enzyme reaction is discussed to be the cause for this reaction in dependence on the applied single dose so that in patients with high single doses an initial enzyme increase caused by the radiation insult has changed into a following decrease under the starting level at the first control 24 hours later. Because patients without mediastinal tumors react in the same manner, the normal tissue surrounding the tumor is discussed to be the original place of enzyme secretion. Up to the end of irradiation a decrease of enzymes was observed in patients with high single dose or with high total dose (60 Gy) which is interpreted as an enzyme deficiency in tissue in consequence of destruction in formation places. In patients with middle total and low single doses an enzyme increase is registered with a still sufficient restoration capacity of the tissue discussed to be the cause of it. An enzyme increase, observed from the end of irradiation to the control date 3 to 6 months after irradiation, is mainly caused by a tumor progression (increased rate of liver metastases, especially in bronchial carcinoma) and can still be intensified by occurrence of pulmonal or cardiac radioreactions. (author)

  20. Restriction-modification systems in Mycoplasma spp

    Directory of Open Access Journals (Sweden)

    Marcelo Brocchi

    2007-01-01

    Full Text Available Restriction and Modification (R-M systems are present in all Mycoplasma species sequenced so far. The presence of these genes poses barriers to gene transfer and could protect the cell against phage infections. The number and types of R-M genes between different Mycoplasma species are variable, which is characteristic of a polymorphism. The majority of the CDSs code for Type III R-M systems and particularly for methyltransferase enzymes, which suggests that functions other than the protection against the invasion of heterologous DNA may exist. A possible function of these enzymes could be the protection against the invasion of other but similar R-M systems. In Mycoplasma hyopneumoniae strain J, three of the putative methyltransferase genes were clustered in a region forming a genomic island. Many R-M CDSs were mapped in the vicinity of transposable elements suggesting an association between these genes and reinforcing the idea of R-M systems as mobile selfish DNA. Also, many R-M genes present repeats within their coding sequences, indicating that their expression is under the control of phase variation mechanisms. Altogether, these data suggest that R-M systems are a remarkable characteristic of Mycoplasma species and are probably involved in the adaptation of these bacteria to different environmental conditions.

  1. Single and Multiple Dose Pharmacokinetics, Pharmacodynamics and Safety of the Novel Lipoprotein-Associated Phospholipase A2 Enzyme Inhibitor Darapladib in Healthy Chinese Subjects: An Open Label Phase-1 Clinical Trial.

    Directory of Open Access Journals (Sweden)

    Chaoying Hu

    Full Text Available Darapladib is a lipoprotein-associated phospholipase A2 (Lp-PLA2 inhibitor. This study evaluated the pharmacokinetics, pharmacodynamics and safety of darapladib in healthy Chinese subjects.Twenty-four subjects received darapladib 160 mg orally, approximately 1 hour after a standard breakfast, as a single dose and once daily for 28 days. Non-compartmental methods were used to determine the single and multiple dose pharmacokinetics of darapladib and its metabolite SB-553253. Repeat dose Lp-PLA2 activity and safety were evaluated.Systemic exposure (AUC(0-T, Cmax geometric mean (CVb% of darapladib was higher after multiple-dosing (519 ng.h/mL (33.3%, 34.4 ng/mL (49.9% compared to single-dose administration (153 ng.h/mL (69.0%, 17.9 ng/mL (55.2%. The steady-state accumulation ratio was less than unity (Rs = 0.80, indicating time-dependent pharmacokinetics of darapladib. Darapladib steady-state was reached by Day 14 of once daily dosing. Systemic exposure to SB-553253 was lower than darapladib with median (SB-553253: darapladib ratios for AUC(0-τ of 0.0786 for single dose and 0.0532 for multiple dose administration. On Day 28, pre-dose and maximum inhibition of Lp-PLA2 activity was approximately 70% and 75% relative to the baseline value, respectively and was dependent of darapladib concentration. The most common adverse events (≥ 21% subjects were abnormal faeces, abnormal urine odour, diarrhoea and nasopharyngitis.Darapladib 160 mg single and repeat doses were profiled in healthy Chinese subjects. Single dose systemic exposure to darapladib in healthy Chinese subjects was consistent with that observed previously in Western subjects whereas steady-state systemic exposure was approximately 65% higher in Chinese than Western subjects. The Lp-PLA2 activity and adverse event profile were similar in healthy Chinese and previous reports in Western subjects. Ethnic-specific dose adjustment of darapladib is not considered necessary for the Chinese

  2. Molecular bass for a malic enzyme null mutation

    International Nuclear Information System (INIS)

    Brown, M.L.; Wise, L.S.; Rubin, C.S.

    1987-01-01

    Many tissues from normal (wt) mice have cytosolic malic enzyme (ME) activity and express two mRNAs (2 and 3.1 kb) that code for a single ME polypeptide. Mod-1 null (M-n) mice lack cytosolic ME activity, but express 2.5 and 3.6 kb mRNAs that hybridize with wt ME cDNAs. To investigate the basis for the ME deficiency cDNAs corresponding to M-n ME RNA were cloned. A λgt11 library was prepared using M-n liver mRNA as a template. Wt ME cDNA probes hybridized with several recombinant phages and a 2kb insert with an atypical (non-wt) restriction pattern was subcloned in pGEM 1 and sequenced. The M-n ME cDNA contains an internal directly repeated sequence that corresponds to nts 1109-1617 in the coding region of wt ME cDNA. A restriction fragment from M-n ME cDNA that includes the first 204 bp of repeated sequence and 306 bp of contiguous 5' sequence was subcloned into pGEM 1 and used as a template for synthesizing 32 P-labeled anti-sense RNA. After hybridization with M-n liver RNA the 510 nt transcript was resistant to RNA digestion; after hybridization with wt RNA only fragments corresponding to the normally non-contiguous 204 bp and 306 bp segments of the insert were protected. Thus the partial duplication of coding sequence in M-n ME mRNA is confirmed. Analyses of intron-exon organization in the relevant regions of the wt and M-n ME genes will provide further insights into the mechanism underlying the ME null mutation

  3. Related bifunctional restriction endonuclease-methyltransferase triplets: TspDTI, Tth111II/TthHB27I and TsoI with distinct specificities.

    Science.gov (United States)

    Zylicz-Stachula, Agnieszka; Zolnierkiewicz, Olga; Lubys, Arvydas; Ramanauskaite, Danute; Mitkaite, Goda; Bujnicki, Janusz M; Skowron, Piotr M

    2012-04-10

    We previously defined a family of restriction endonucleases (REases) from Thermus sp., which share common biochemical and biophysical features, such as the fusion of both the nuclease and methyltransferase (MTase) activities in a single polypeptide, cleavage at a distance from the recognition site, large molecular size, modulation of activity by S-adenosylmethionine (SAM), and incomplete cleavage of the substrate DNA. Members include related thermophilic REases with five distinct specificities: TspGWI, TaqII, Tth111II/TthHB27I, TspDTI and TsoI. TspDTI, TsoI and isoschizomers Tth111II/TthHB27I recognize different, but related sequences: 5'-ATGAA-3', 5'-TARCCA-3' and 5'-CAARCA-3' respectively. Their amino acid sequences are similar, which is unusual among REases of different specificity. To gain insight into this group of REases, TspDTI, the prototype member of the Thermus sp. enzyme family, was cloned and characterized using a recently developed method for partially cleaving REases. TspDTI, TsoI and isoschizomers Tth111II/TthHB27I are closely related bifunctional enzymes. They comprise a tandem arrangement of Type I-like domains, like other Type IIC enzymes (those with a fusion of a REase and MTase domains), e.g. TspGWI, TaqII and MmeI, but their sequences are only remotely similar to these previously characterized enzymes. The characterization of TspDTI, a prototype member of this group, extends our understanding of sequence-function relationships among multifunctional restriction-modification enzymes.

  4. Sequence-dependent cleavage of mismatched DNA by Ban I restriction endonuclease.

    Science.gov (United States)

    Gao, Weimin; Zhu, Dan; Keohavong, Phouthone

    2017-10-01

    Restriction enzymes have previously shown the ability to cleave DNA substrates with mismatched base(s) in recognition sequences; in this study, Ban I endonuclease demonstrated this same ability. Single base substitutions were introduced, and fragments containing various types of unpaired base(s) (heteroduplex fragments) within the Ban I endonuclease recognition sequence, 5'-G|GPyPuCC-3', were generated. Each of the heteroduplex fragments was treated with Ban I endonuclease and analyzed by denaturing gradient gel electrophoresis. Our results showed that heteroduplex fragments containing mismatched bases at either the first or third position of the Ban I recognition sequence or, because of the symmetrical structure of the sequence, the sixth or fourth position on the opposite strand were cleaved by the enzyme. Furthermore, these cleaved fragments contained at least one strand corresponding to the original Ban I recognition sequence. Fragments with mismatches formed by an A (noncanonical, nc) opposite a purine (canonical, ca) or a T (nc) opposite a pyrimidine (ca) were cleaved more efficiently than other types of mismatched bases. These results may help elucidate the mechanisms by which DNA and protein interact during the process of DNA cleavage by Ban I endonuclease. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Identification of Acinetobacter baumannii via amplified ribosomal DNA restriction analysis

    Directory of Open Access Journals (Sweden)

    Delsuz Rezaei

    2014-02-01

    Full Text Available Background: Acinetobacter baumannii is a multi-resistant opportunistic nosocomial pathogen responsible for hospital outbreaks worldwide. In addition to common microscopic and biochemical methods, the Amplified Ribosomal DNA Restriction Analysis (ARDRA was tested to identify Acinetobacter genomic species (DNA groups. Methods: In this study, standard biochemical tests were used for identification of isolates. The genomic species of Acinetobacter spp. was confirmed by Amplified Ribosomal DNA Restriction Analysis (ARDRA. PCR products of 16S rRNA were digested with AluI, MboI and HhaI restriction enzymes. Results: ARDRA proved to be a rapid and reliable method for identification of Acinetobacter baumannii (genome species 2 of the Acinetobacter genomic species, including the closely related genomic species (genomic species 1 (A. calcoaceticus, 2 (A. baumannii, 3, and TU13. Conclusion: The results of this study suggested that ARDRA with AluI, MboI and HhaI restriction enzymes can be used for identificationof A. baumannii which may help to elucidate the ecology and clinical significance of different species of this genus. Since ARDRA is performed by universal primers of 16S rDNA gene, it is expected to be applicable to identifying most bacterial species.

  6. Frequent and recent retrotransposition of orthologous genes plays a role in the evolution of sperm glycolytic enzymes

    Directory of Open Access Journals (Sweden)

    de Villena Fernando

    2010-05-01

    Full Text Available Abstract Background The central metabolic pathway of glycolysis converts glucose to pyruvate, with the net production of 2 ATP and 2 NADH per glucose molecule. Each of the ten reactions in this pathway is typically catalyzed by multiple isozymes encoded by a multigene family. Several isozymes in this pathway are expressed only during spermatogenesis, and gene targeting studies indicate that they are essential for sperm function and male fertility in mouse. At least three of the novel glycolytic isozymes are encoded by retrogenes (Pgk2, Aldoart1, and Aldoart2. Their restricted expression profile suggests that retrotransposition may play a significant role in the evolution of sperm glycolytic enzymes. Results We conducted a comprehensive genomic analysis of glycolytic enzymes in the human and mouse genomes and identified several intronless copies for all enzymes in the pathway, except Pfk. Within each gene family, a single orthologous gene was typically retrotransposed frequently and independently in both species. Several retroposed sequences maintained open reading frames (ORFs and/or provided evidence of alternatively spliced exons. We analyzed expression of sequences with ORFs and Gpi1 transcript in mouse spermatogenic cells. Conclusions Our analysis detected frequent, recent, and lineage-specific retrotransposition of orthologous glycolytic enzymes in the human and mouse genomes. Retrotransposition events are associated with LINE/LTR and genomic integration is random. We found evidence for the alternative splicing of parent genes. Many retroposed sequences have maintained ORFs, suggesting a functional role for these genes.

  7. Enzyme recycling in lignocellulosic biorefineries

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Pinelo, Manuel

    2017-01-01

    platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...... for efficient hydrolysis, enzyme stability, and the detrimental interaction between enzyme and lignin. This review provides a comprehensive overview of the various methods for enzyme recovery and recycling, for example recycling of free enzymes, readsorption to fresh material, recycling of solids, membrane...

  8. Using Phage Lytic Enzymes to Destroy Pathogenic and BW Bacteria

    National Research Council Canada - National Science Library

    Fischetti, Vincent A

    2005-01-01

    .... In animal models, we pre-colonize mice with either streptococcal or pneumococcal species (orally or nasally) and remove them completely with a single dose of phage enzyme delivered to these sites...

  9. IS-linked movement of a restriction-modification system.

    Directory of Open Access Journals (Sweden)

    Noriko Takahashi

    Full Text Available Potential mobility of restriction-modification systems has been suggested by evolutionary/bioinformatic analysis of prokaryotic genomes. Here we demonstrate in vivo movement of a restriction-modification system within a genome under a laboratory condition. After blocking replication of a temperature-sensitive plasmid carrying a PaeR7I restriction-modification system in Escherichia coli cells, the plasmid was found integrated into the chromosome of the surviving cells. Sequence analysis revealed that, in the majority of products, the restriction-modification system was linked to chromosomal insertion sequences (ISs. Three types of products were: (I apparent co-integration of the plasmid and the chromosome at a chromosomal IS1 or IS5 copy (24/28 analyzed; (II de novo insertion of IS1 with the entire plasmid except for a 1-3 bp terminal deletion (2/28; and (III reciprocal crossing-over between the plasmid and the chromosome involving 1-3 bp of sequence identity (2/28. An R-negative mutation apparently decreased the efficiency of successful integration by two orders of magnitude. Reconstruction experiments demonstrated that the restriction-dependence was mainly due to selection against cells without proper integration: their growth was inhibited by the restriction enzyme action. These results demonstrate collaboration of a mobile element and a restriction-modification system for successful joint migration. This collaboration may have promoted the spread and, therefore, the long-term persistence of these complexes and restriction-modification systems in a wide range of prokaryotes.

  10. Trapping and manipulating single molecules of DNA

    Science.gov (United States)

    Shon, Min Ju

    This thesis presents the development and application of nanoscale techniques to trap and manipulate biomolecules, with a focus on DNA. These methods combine single-molecule microscopy and nano- and micro-fabrication to study biophysical properties of DNA and proteins. The Dimple Machine is a lab-on-a-chip device that can isolate and confine a small number of molecules from a bulk solution. It traps molecules in nanofabricated chambers, or "dimples", and the trapped molecules are then studied on a fluorescence microscope at the single-molecule level. The sampling of bulk solution by dimples is representative, reproducible, and automated, enabling highthroughput single-molecule experiments. The device was applied to study hybridization of oligonucleotides, particularly in the context of reaction thermodynamics and kinetics in nanoconfinement. The DNA Pulley is a system to study protein binding and the local mechanical properties of DNA. A molecule of DNA is tethered to a surface on one end, and a superparamagnetic bead is attached to the other. A magnet pulls the DNA taut, and a silicon nitride knife with a nanoscale blade scans the DNA along its contour. Information on the local properties of the DNA is extracted by tracking the bead with nanometer precision in a white-light microscope. The system can detect proteins bound to DNA and localize their recognition sites, as shown with a model protein, EcoRI restriction enzyme. Progress on the measurements of nano-mechanical properties of DNA is included.

  11. Angiotensin-converting enzyme

    DEFF Research Database (Denmark)

    Sørensen, P G; Rømer, F K; Cortes, D

    1984-01-01

    In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical or radiolog......In order to evaluate bleomycin-associated lung damage in humans, lung function parameters and serum levels of the endothelial-bound angiotensin-converting enzyme (ACE) were determined by serial measurements in 11 patients who were treated for testicular cancer. None developed clinical...

  12. The ENZYME database in 2000.

    Science.gov (United States)

    Bairoch, A

    2000-01-01

    The ENZYME database is a repository of information related to the nomenclature of enzymes. In recent years it has became an indispensable resource for the development of metabolic databases. The current version contains information on 3705 enzymes. It is available through the ExPASy WWW server (http://www.expasy.ch/enzyme/ ).

  13. Enzyme-Linked Immunospot Assay as a Complementary Method to Assess and Monitor Cytomegalovirus Infection in Kidney Transplant Recipients on Pre-emptive Antiviral Therapy: A Single-Center Experience.

    Science.gov (United States)

    Favi, E; Santangelo, R; Iesari, S; Morandi, M; Marcovecchio, G E; Trecarichi, E M; Salerno, M P; Ferraresso, M; Citterio, F; Romagnoli, J

    2017-10-01

    Cytomegalovirus (CMV) disease represents a major cause of post-transplantation morbidity and mortality. To estimate the risk of infection and monitor response to antiviral therapy, current guidelines suggest combination of viral load monitoring with direct assessment of CMV-specific immune response. We used enzyme-linked immunospot (ELISpot) for the evaluation of CMV-specific T-cell response in kidney transplant recipients with CMV viremia and investigated how information gained could help manage CMV infection. Seventeen patients on pre-emptive antiviral therapy and CMV quantitative polymerase chain reaction (qPCR) ≥500 copies/mL (first episode after transplantation) were assessed using ELISpot and divided into Weak (9 patients with baseline ELISpot antiviral therapy were prospectively recorded and compared between groups at 1, 2, and 24 months of follow-up. Demographic and transplant characteristics of Weak and Strong Responders were similar. No episodes of CMV disease were observed. Weak Responders were more likely to experience CMV syndrome (56% vs 36.5%) and late virus reactivation (56% vs 25%) than Strong Responders. Weak Responders showed higher baseline median viral loads (19,700 vs 9265 copies/mL) and needed antiviral therapy for longer (179 vs 59.5 days). T-cell response showed 2 main patterns: early and delayed. ELISpot provides prognostic information about infection severity, risk of late reactivation, and response to therapy. Randomized trials, evaluating the need for antiviral therapy in kidney transplant recipients with asymptomatic infection and effective virus-specific T-cell immune response, are warranted. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The surface science of enzymes

    DEFF Research Database (Denmark)

    Rod, Thomas Holm; Nørskov, Jens Kehlet

    2002-01-01

    One of the largest challenges to science in the coming years is to find the relation between enzyme structure and function. Can we predict which reactions an enzyme catalyzes from knowledge of its structure-or from its amino acid sequence? Can we use that knowledge to modify enzyme function......? To solve these problems we must understand in some detail how enzymes interact with reactants from its surroundings. These interactions take place at the surface of the enzyme and the question of enzyme function can be viewed as the surface science of enzymes. In this article we discuss how to describe...... catalysis by enzymes, and in particular the analogies between enzyme catalyzed reactions and surface catalyzed reactions. We do this by discussing two concrete examples of reactions catalyzed both in nature (by enzymes) and in industrial reactors (by inorganic materials), and show that although analogies...

  15. Magnetically responsive enzyme powders

    Czech Academy of Sciences Publication Activity Database

    Pospišková, K.; Šafařík, Ivo

    2015-01-01

    Roč. 380, APR 2015 (2015), s. 197-200 ISSN 0304-8853 R&D Projects: GA MŠk(CZ) LD13021 Institutional support: RVO:67179843 Keywords : enzyme powders * cross-linking * magnetic modification * magnetic separation * magnetic iron oxides particles * microwave-assisted synthesis Subject RIV: CE - Biochemistry Impact factor: 2.357, year: 2015

  16. ISFET based enzyme sensors

    NARCIS (Netherlands)

    van der Schoot, Bart H.; Bergveld, Piet

    1987-01-01

    This paper reviews the results that have been reported on ISFET based enzyme sensors. The most important improvement that results from the application of ISFETs instead of glass membrane electrodes is in the method of fabrication. Problems with regard to the pH dependence of the response and the

  17. Implantable enzyme amperometric biosensors.

    Science.gov (United States)

    Kotanen, Christian N; Moussy, Francis Gabriel; Carrara, Sandro; Guiseppi-Elie, Anthony

    2012-05-15

    The implantable enzyme amperometric biosensor continues as the dominant in vivo format for the detection, monitoring and reporting of biochemical analytes related to a wide range of pathologies. Widely used in animal studies, there is increasing emphasis on their use in diabetes care and management, the management of trauma-associated hemorrhage and in critical care monitoring by intensivists in the ICU. These frontier opportunities demand continuous indwelling performance for up to several years, well in excess of the currently approved seven days. This review outlines the many challenges to successful deployment of chronically implantable amperometric enzyme biosensors and emphasizes the emerging technological approaches in their continued development. The foreign body response plays a prominent role in implantable biotransducer failure. Topics considering the approaches to mitigate the inflammatory response, use of biomimetic chemistries, nanostructured topographies, drug eluting constructs, and tissue-to-device interface modulus matching are reviewed. Similarly, factors that influence biotransducer performance such as enzyme stability, substrate interference, mediator selection and calibration are reviewed. For the biosensor system, the opportunities and challenges of integration, guided by footprint requirements, the limitations of mixed signal electronics, and power requirements, has produced three systems approaches. The potential is great. However, integration along the multiple length scales needed to address fundamental issues and integration across the diverse disciplines needed to achieve success of these highly integrated systems, continues to be a challenge in the development and deployment of implantable amperometric enzyme biosensor systems. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Photoperiodism and Enzyme Activity

    Science.gov (United States)

    Queiroz, Orlando; Morel, Claudine

    1974-01-01

    Metabolic readjustments after a change from long days to short days appear, in Kalanchoe blossfeldiana, to be achieved through the operation of two main mechanisms: variation in enzyme capacity, and circadian rhythmicity. After a lag time, capacity in phosphoenolpyruvate carboxylase and capacity in aspartate aminotransferase increase exponentially and appear to be allometrically linked during 50 to 60 short days; then a sudden fall takes place in the activity of the former. Malic enzyme and alanine aminotransferase behave differently. Thus, the operation of the two sections of the pathway (before and after the malate step) give rise to a continuously changing functional compartmentation in the pathway. Circadian rhythmicity, on the other hand, produces time compartmentation through phase shifts and variation in amplitude, independently for each enzyme. These characteristics suggest that the operation of a so-called biological clock would be involved. We propose the hypothesis that feedback regulation would be more accurate and efficient when applied to an already oscillating, clock-controlled enzyme system. PMID:16658749

  19. Solid-phase cloning for high-throughput assembly of single and multiple DNA parts

    DEFF Research Database (Denmark)

    Lundqvist, Magnus; Edfors, Fredrik; Sivertsson, Åsa

    2015-01-01

    present a robust automated protocol for restriction enzyme based SPC and its performance for the cloning of >60 000 unique human gene fragments into expression vectors. In addition, we report on SPC-based single-strand assembly for applications where exact control of the sequence between fragments...... is needed or where multiple inserts are to be assembled. In this approach, the solid support allows for head-to-tail assembly of DNA fragments based on hybridization and polymerase fill-in. The usefulness of head-to-tail SPC was demonstrated by assembly of >150 constructs with up to four DNA parts...

  20. The Fidelity Index provides a systematic quantitation of star activity of DNA restriction endonucleases.

    Science.gov (United States)

    Wei, Hua; Therrien, Caitlin; Blanchard, Aine; Guan, Shengxi; Zhu, Zhenyu

    2008-05-01

    Restriction endonucleases are the basic tools of molecular biology. Many restriction endonucleases show relaxed sequence recognition, called star activity, as an inherent property under various digestion conditions including the optimal ones. To quantify this property we propose the concept of the Fidelity Index (FI), which is defined as the ratio of the maximum enzyme amount showing no star activity to the minimum amount needed for complete digestion at the cognate recognition site for any particular restriction endonuclease. Fidelity indices for a large number of restriction endonucleases are reported here. The effects of reaction vessel, reaction volume, incubation mode, substrate differences, reaction time, reaction temperature and additional glycerol, DMSO, ethanol and Mn(2+) on the FI are also investigated. The FI provides a practical guideline for the use of restriction endonucleases and defines a fundamental property by which restriction endonucleases can be characterized.

  1. Type III restriction endonuclease EcoP15I is a heterotrimeric complex containing one Res subunit with several DNA-binding regions and ATPase activity.

    Science.gov (United States)

    Wyszomirski, Karol H; Curth, Ute; Alves, Jürgen; Mackeldanz, Petra; Möncke-Buchner, Elisabeth; Schutkowski, Mike; Krüger, Detlev H; Reuter, Monika

    2012-04-01

    For efficient DNA cleavage, the Type III restriction endonuclease EcoP15I communicates with two inversely oriented recognition sites in an ATP-dependent process. EcoP15I consists of methylation (Mod) and restriction (Res) subunits forming a multifunctional enzyme complex able to methylate or to cleave DNA. In this study, we determined by different analytical methods that EcoP15I contains a single Res subunit in a Mod(2)Res stoichiometry. The Res subunit comprises a translocase (Tr) domain carrying functional motifs of superfamily 2 helicases and an endonuclease domain with a PD..D/EXK motif. We show that the isolated Tr domain retains ATP-hydrolyzing activity and binds single- and double-stranded DNA in a sequence-independent manner. To localize the regions of DNA binding, we screened peptide arrays representing the entire Res sequence for their ability to interact with DNA. We discovered four DNA-binding regions in the Tr domain and two DNA-binding regions in the endonuclease domain. Modelling of the Tr domain shows that these multiple DNA-binding regions are located on the surface, free to interact with DNA. Interestingly, the positions of the DNA-binding regions are conserved among other Type III restriction endonucleases.

  2. Enzymes/non-enzymes classification model complexity based on composition, sequence, 3D and topological indices.

    Science.gov (United States)

    Munteanu, Cristian Robert; González-Díaz, Humberto; Magalhães, Alexandre L

    2008-09-21

    The huge amount of new proteins that need a fast enzymatic activity characterization creates demands of protein QSAR theoretical models. The protein parameters that can be used for an enzyme/non-enzyme classification includes the simpler indices such as composition, sequence and connectivity, also called topological indices (TIs) and the computationally expensive 3D descriptors. A comparison of the 3D versus lower dimension indices has not been reported with respect to the power of discrimination of proteins according to enzyme action. A set of 966 proteins (enzymes and non-enzymes) whose structural characteristics are provided by PDB/DSSP files was analyzed with Python/Biopython scripts, STATISTICA and Weka. The list of indices includes, but it is not restricted to pure composition indices (residue fractions), DSSP secondary structure protein composition and 3D indices (surface and access). We also used mixed indices such as composition-sequence indices (Chou's pseudo-amino acid compositions or coupling numbers), 3D-composition (surface fractions) and DSSP secondary structure amino acid composition/propensities (obtained with our Prot-2S Web tool). In addition, we extend and test for the first time several classic TIs for the Randic's protein sequence Star graphs using our Sequence to Star Graph (S2SG) Python application. All the indices were processed with general discriminant analysis models (GDA), neural networks (NN) and machine learning (ML) methods and the results are presented versus complexity, average of Shannon's information entropy (Sh) and data/method type. This study compares for the first time all these classes of indices to assess the ratios between model accuracy and indices/model complexity in enzyme/non-enzyme discrimination. The use of different methods and complexity of data shows that one cannot establish a direct relation between the complexity and the accuracy of the model.

  3. Binding affinity and adhesion force of organophosphate hydrolase enzyme with soil particles related to the isoelectric point of the enzyme.

    Science.gov (United States)

    Islam, Shah Md Asraful; Yeasmin, Shabina; Islam, Md Saiful; Islam, Md Shariful

    2017-07-01

    The binding affinity of organophosphate hydrolase enzyme (OphB) with soil particles in relation to the isoelectric point (pI) was studied. Immobilization of OphB with soil particles was observed by confocal microscopy, Fourier transform infrared spectroscopy (FT-IR), and Atomic force microscopy (AFM). The calculated pI of OphB enzyme was increased from 8.69 to 8.89, 9.04 and 9.16 by the single, double and triple mutant of OphB enzyme, respectively through the replacement of negatively charged aspartate with positively charged histidine. Practically, the binding affinity was increased to 5.30%, 11.50%, and 16.80% for single, double and triple mutants, respectively. In contrast, enzyme activity of OphB did not change by the mutation of the enzyme. On the other hand, adhesion forces were gradually increased for wild type OphB enzyme (90 pN) to 96, 100 and 104 pN for single, double and triple mutants of OphB enzyme, respectively. There was an increasing trend of binding affinity and adhesion force by the increase of isoelectric point (pI) of OphB enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. HIV restriction by APOBEC3 in humanized mice.

    Directory of Open Access Journals (Sweden)

    John F Krisko

    2013-03-01

    Full Text Available Innate immune restriction factors represent important specialized barriers to zoonotic transmission of viruses. Significant consideration has been given to their possible use for therapeutic benefit. The apolipoprotein B mRNA editing enzyme catalytic polypeptide 3 (APOBEC3 family of cytidine deaminases are potent immune defense molecules capable of efficiently restricting endogenous retroelements as well as a broad range of viruses including Human Immunodeficiency virus (HIV, Hepatitis B virus (HBV, Human Papilloma virus (HPV, and Human T Cell Leukemia virus (HTLV. The best characterized members of this family are APOBEC3G (A3G and APOBEC3F (A3F and their restriction of HIV. HIV has evolved to counteract these powerful restriction factors by encoding an accessory gene designated viral infectivity factor (vif. Here we demonstrate that APOBEC3 efficiently restricts CCR5-tropic HIV in the absence of Vif. However, our results also show that CXCR4-tropic HIV can escape from APOBEC3 restriction and replicate in vivo independent of Vif. Molecular analysis identified thymocytes as cells with reduced A3G and A3F expression. Direct injection of vif-defective HIV into the thymus resulted in viral replication and dissemination detected by plasma viral load analysis; however, vif-defective viruses remained sensitive to APOBEC3 restriction as extensive G to A mutation was observed in proviral DNA recovered from other organs. Remarkably, HIV replication persisted despite the inability of HIV to develop resistance to APOBEC3 in the absence of Vif. Our results provide novel insight into a highly specific subset of cells that potentially circumvent the action of APOBEC3; however our results also demonstrate the massive inactivation of CCR5-tropic HIV in the absence of Vif.

  5. Subangstrom Measurements of Enzyme Function Using a Biological Nanopore, SPRNT.

    Science.gov (United States)

    Laszlo, A H; Derrrington, I M; Gundlach, J H

    2017-01-01

    Nanopores are emerging as new single-molecule tools in the study of enzymes. Based on the progress in nanopore sequencing of DNA, a tool called Single-molecule Picometer Resolution Nanopore Tweezers (SPRNT) was developed to measure the movement of enzymes along DNA in real time. In this new method, an enzyme is loaded onto a DNA (or RNA) molecule. A single-stranded DNA end of this complex is drawn into a nanopore by an electrostatic potential that is applied across the pore. The single-stranded DNA passes through the pore's constriction until the enzyme comes into contact with the pore. Further progression of the DNA through the pore is then controlled by the enzyme. An ion current that flows through the pore's constriction is modulated by the DNA in the constriction. Analysis of ion current changes reveals the advance of the DNA with high spatiotemporal precision, thereby providing a real-time record of the enzyme's activity. Using an engineered version of the protein nanopore MspA, SPRNT has spatial resolution as small as 40pm at millisecond timescales, while simultaneously providing the DNA's sequence within the enzyme. In this chapter, SPRNT is introduced and its extraordinary potential is exemplified using the helicase Hel308. Two distinct substates are observed for each one-nucleotide advance; one of these about half-nucleotide long steps is ATP dependent and the other is ATP independent. The spatiotemporal resolution of this low-cost single-molecule technique lifts the study of enzymes to a new level of precision, enabling exploration of hitherto unobservable enzyme dynamics in real time. © 2017 Elsevier Inc. All rights reserved.

  6. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes...

  7. Metformin prevents aggressive ovarian cancer growth driven by high-energy diet: similarity with calorie restriction

    OpenAIRE

    Al-Wahab, Zaid; Mert, Ismail; Tebbe, Calvin; Chhina, Jasdeep; Hijaz, Miriana; Morris, Robert T.; Ali-Fehmi, Rouba; Giri, Shailendra; Munkarah, Adnan R.; Rattan, Ramandeep

    2015-01-01

    Caloric restriction (CR) was recently demonstrated by us to restrict ovarian cancer growth in vivo. CR resulted in activation of energy regulating enzymes adenosine monophosphate activated kinase (AMPK) and sirtuin 1 (SIRT1) followed by downstream inhibition of Akt-mTOR. In the present study, we investigated the effects of metformin on ovarian cancer growth in mice fed a high energy diet (HED) and regular diet (RD) and compared them to those seen with CR in an immunocompetent isogeneic mouse ...

  8. Cleavage and protection of locked nucleic acid-modified DNA by restriction endonucleases

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Wengel, Jesper

    2012-01-01

    Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far. We herein for the first time report cleavage by restriction endonuclease of LNA-modified DNA oligonucleotides. The experiments revealed that RsaI is an efficient enzyme capable of recognizing and cleaving...... LNA-modified DNA oligonucleotides. Furthermore, introduction of LNA nucleotides protects against cleavage by the restriction endonucleases PvuII, PstI, SacI, KpnI and EcoRI....

  9. Pathological phenotypes and in vivo DNA cleavage by unrestrained activity of a phosphorothioate-based restriction system in Salmonella

    Science.gov (United States)

    Cao, Bo; Cheng, Qiuxiang; Gu, Chen; Yao, Fen; DeMott, Michael S.; Zheng, Xiaoqing; Deng, Zixin; Dedon, Peter C.; You, Delin

    2015-01-01

    Summary Prokaryotes protect their genomes from foreign DNA with a diversity of defense mechanisms, including a widespread restriction-modification (R-M) system involving phosphorothioate (PT) modification of the DNA backbone. Unlike classical R-M systems, highly partial PT-modification of consensus motifs in bacterial genomes suggests an unusual mechanism of PT-dependent restriction. In Salmonella enterica, PT modification is mediated by four genes dptB-E, while restriction involves additional three genes dptF-H. Here, we performed a series of studies to characterize the PT-dependent restriction, and found that it presented several features distinct with traditional R-M systems. The presence of restriction genes in a PT-deficient mutant was not lethal, but instead resulted in several pathological phenotypes. Subsequent transcriptional profiling revealed the expression of >600 genes was affected by restriction enzymes in cells lacking PT, including induction of bacteriophage, SOS response and DNA repair-related genes. These transcriptional responses are consistent with the observation that restriction enzymes caused extensive DNA cleavage in the absence of PT modifications in vivo. However, over-expression of restriction genes was lethal to the host in spite of the presence PT modifications. These results point to an unusual mechanism of PT-dependent DNA cleavage by restriction enzymes in the face of partial PT modification. PMID:25040300

  10. Pathological phenotypes and in vivo DNA cleavage by unrestrained activity of a phosphorothioate-based restriction system in Salmonella.

    Science.gov (United States)

    Cao, Bo; Cheng, Qiuxiang; Gu, Chen; Yao, Fen; DeMott, Michael S; Zheng, Xiaoqing; Deng, Zixin; Dedon, Peter C; You, Delin

    2014-08-01

    Prokaryotes protect their genomes from foreign DNA with a diversity of defence mechanisms, including a widespread restriction-modification (R-M) system involving phosphorothioate (PT) modification of the DNA backbone. Unlike classical R-M systems, highly partial PT modification of consensus motifs in bacterial genomes suggests an unusual mechanism of PT-dependent restriction. In Salmonella enterica, PT modification is mediated by four genes dptB-E, while restriction involves additional three genes dptF-H. Here, we performed a series of studies to characterize the PT-dependent restriction, and found that it presented several features distinct with traditional R-M systems. The presence of restriction genes in a PT-deficient mutant was not lethal, but instead resulted in several pathological phenotypes. Subsequent transcriptional profiling revealed the expression of > 600 genes was affected by restriction enzymes in cells lacking PT, including induction of bacteriophage, SOS response and DNA repair-related genes. These transcriptional responses are consistent with the observation that restriction enzymes caused extensive DNA cleavage in the absence of PT modifications in vivo. However, overexpression of restriction genes was lethal to the host in spite of the presence PT modifications. These results point to an unusual mechanism of PT-dependent DNA cleavage by restriction enzymes in the face of partial PT modification. © 2014 John Wiley & Sons Ltd.

  11. Uronic polysaccharide degrading enzymes.

    Science.gov (United States)

    Garron, Marie-Line; Cygler, Miroslaw

    2014-10-01

    In the past several years progress has been made in the field of structure and function of polysaccharide lyases (PLs). The number of classified polysaccharide lyase families has increased to 23 and more detailed analysis has allowed the identification of more closely related subfamilies, leading to stronger correlation between each subfamily and a unique substrate. The number of as yet unclassified polysaccharide lyases has also increased and we expect that sequencing projects will allow many of these unclassified sequences to emerge as new families. The progress in structural analysis of PLs has led to having at least one representative structure for each of the families and for two unclassified enzymes. The newly determined structures have folds observed previously in other PL families and their catalytic mechanisms follow either metal-assisted or Tyr/His mechanisms characteristic for other PL enzymes. Comparison of PLs with glycoside hydrolases (GHs) shows several folds common to both classes but only for the β-helix fold is there strong indication of divergent evolution from a common ancestor. Analysis of bacterial genomes identified gene clusters containing multiple polysaccharide cleaving enzymes, the Polysaccharides Utilization Loci (PULs), and their gene complement suggests that they are organized to process completely a specific polysaccharide. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Polymorphism in mitochondrial DNA of humans as revealed by restriction endonuclease analysis.

    OpenAIRE

    Brown, W M

    1980-01-01

    Mitochondrial DNA samples from each of 21 humans of diverse racial and geographic origin were digested with each of 18 restriction endonucleases. The sizes of the resulting DNA fragments were compared after gel electrophoresis. No differences among the samples were detected in digest with 7 of the enzymes. Analysis of digests with the remaining enzymes showed one or more differences. Each of the 21 samples could be characterized individually on the basis of these digests. All between-sample d...

  14. Restriction endonucleases: natural and directed evolution.

    Science.gov (United States)

    Gupta, Richa; Capalash, Neena; Sharma, Prince

    2012-05-01

    Type II restriction endonucleases (REs) are highly sequence-specific compared with other classes of nucleases. PD-(D/E)XK nucleases, initially represented by only type II REs, now comprise a large and extremely diverse superfamily of proteins and, although sharing a structurally conserved core, typically display little or no detectable sequence similarity except for the active site motifs. Sequence similarity can only be observed in methylases and few isoschizomers. As a consequence, REs are classified according to combinations of functional properties rather than on the basis of genetic relatedness. New alignment matrices and classification systems based on structural core connectivity and cleavage mechanisms have been developed to characterize new REs and related proteins. REs recognizing more than 300 distinct specificities have been identified in RE database (REBASE: http://rebase.neb.com/cgi-bin/statlist ) but still the need for newer specificities is increasing due to the advancement in molecular biology and applications. The enzymes have undergone constant evolution through structural changes in protein scaffolds which include random mutations, homologous recombinations, insertions, and deletions of coding DNA sequences but rational mutagenesis or directed evolution delivers protein variants with new functions in accordance with defined biochemical or environmental pressures. Redesigning through random mutation, addition or deletion of amino acids, methylation-based selection, synthetic molecules, combining recognition and cleavage domains from different enzymes, or combination with domains of additional functions change the cleavage specificity or substrate preference and stability. There is a growing number of patents awarded for the creation of engineered REs with new and enhanced properties.

  15. Selective microbial genomic DNA isolation using restriction endonucleases.

    Science.gov (United States)

    Barnes, Helen E; Liu, Guohong; Weston, Christopher Q; King, Paula; Pham, Long K; Waltz, Shannon; Helzer, Kimberly T; Day, Laura; Sphar, Dan; Yamamoto, Robert T; Forsyth, R Allyn

    2014-01-01

    To improve the metagenomic analysis of complex microbiomes, we have repurposed restriction endonucleases as methyl specific DNA binding proteins. As an example, we use DpnI immobilized on magnetic beads. The ten minute extraction technique allows specific binding of genomes containing the DpnI Gm6ATC motif common in the genomic DNA of many bacteria including γ-proteobacteria. Using synthetic genome mixtures, we demonstrate 80% recovery of Escherichia coli genomic DNA even when only femtogram quantities are spiked into 10 µg of human DNA background. Binding is very specific with less than 0.5% of human DNA bound. Next Generation Sequencing of input and enriched synthetic mixtures results in over 100-fold enrichment of target genomes relative to human and plant DNA. We also show comparable enrichment when sequencing complex microbiomes such as those from creek water and human saliva. The technique can be broadened to other restriction enzymes allowing for the selective enrichment of trace and unculturable organisms from complex microbiomes and the stratification of organisms according to restriction enzyme enrichment.

  16. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    In a recent paper (Tran et al, Ann. Phys. 311, 204 (2004)), some asymptotic number theoretical results on the partitioning of an integer were derived exploiting its connection to the quantum density of states of a many-particle system. We generalise these results to obtain an asymptotic formula for the restricted or coloured ...

  17. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    We generalise these results to obtain an asymptotic formula for the restricted or coloured partitions p k s ( n ) , which is the number of partitions of an integer into the summand of th powers of integers such that each power of a given integer may occur utmost times. While the method is not rigorous, it reproduces the ...

  18. Restrictive dermopathy and fetal behaviour

    NARCIS (Netherlands)

    Mulder, EJH; Beemer, FA; Stoutenbeek, P

    We report three siblings from consecutive pregnancies affected with restrictive dermopathy (RD). During the second pregnancy, fetal behavioural development and growth were studied extensively using ultrasound at 1-4 week intervals. Dramatic and sudden changes occurred in fetal body movements and

  19. Pacifier restriction and exclusive breastfeeding.

    Science.gov (United States)

    Kair, Laura R; Kenron, Daniel; Etheredge, Konnette; Jaffe, Arthur C; Phillipi, Carrie A

    2013-04-01

    We tested the hypothesis that removing pacifiers from routine distribution in our mother-baby unit (MBU) would be associated with greater breastfeeding initiation or exclusivity during the birth hospitalization. We retrospectively compared exclusive breastfeeding, breastfeeding plus supplemental formula feeding, and exclusive formula feeding rates for 2249 infants admitted to the MBU at our university teaching hospital during the 5 months before and 8 months after restriction of routine pacifier distribution. Formula supplementation, if not medically indicated, was discouraged per standard practice, but access to formula was not restricted. Of the 2249 infants, 79% were exclusively breastfed from July through November 2010, when pacifiers were routinely distributed. During the 8-month period after pacifier restriction, this proportion decreased significantly to 68% (P pacifier distribution during the newborn hospitalization without also restricting access to formula was associated with decreased exclusive breastfeeding, increased supplemental formula feeding, and increased exclusive formula feeding. Because high-quality, prospective medical literature addressing pacifier use and breastfeeding does not conclusively show an adverse relationship in women who are motivated to breastfeed, more studies are needed to help determine what effect, if any, pacifiers have on breastfeeding initiation and exclusivity in the immediate newborn period.

  20. NRSA enzyme decomposition model data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Microbial enzyme activities measured at more than 2000 US streams and rivers. These enzyme data were then used to predict organic matter decomposition and microbial...

  1. "Slave" metabolites and enzymes. A rapid way of delineating metabolic control.

    NARCIS (Netherlands)

    Teusink, B.; Westerhoff, H.V.

    2000-01-01

    Although control of fluxes and concentrations tends to be distributed rather than confined to a single rate-limiting enzyme, the extent of control can differ widely between enzymes in a metabolic network. In some cases, there are enzymes that lack control completely. This paper identifies one

  2. 49 CFR 215.203 - Restricted cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Restricted cars. 215.203 Section 215.203..., DEPARTMENT OF TRANSPORTATION RAILROAD FREIGHT CAR SAFETY STANDARDS Restricted Equipment § 215.203 Restricted cars. (a) This section restricts the operation of any railroad freight car that is— (1) More than 50...

  3. Assisted reproductive technologies: professional and legal restrictions in Australian clinics.

    Science.gov (United States)

    Petersen, Kerry; Baker, H W G; Pitts, Marian; Thorpe, Rachel

    2005-02-01

    The professional and legal regulation of assisted reproductive technologies (ART) in Australia is a vast maze of intersecting laws and guidelines which place restrictions on the provision of services such as infertility treatment, surrogacy, sex selection for social reasons, donor insemination, pre-implantation diagnosis and human embryo research. This study investigated the application of these restrictions on clinical practice in New South Wales, a relatively unregulated State, and Victoria, a relatively highly regulated State. The results of the survey indicate that the range of ART services in Victorian clinics was far more limited than in New South Wales clinics. The Victorian clinics uniformly restricted access of single and lesbian women and did not offer social sex selection procedures. The New South Wales clinics adopted different polices regarding these services. It was found that restrictive laws governing "social" issues have a significant impact on the availability of ART services and some respondents seemed unclear about the nature of restrictions and laws relevant to their work. It was also found that "reproductive tourism" is prevalent and restrictions were circumnavigated by patients with assistance from clinics. It was concluded that more evidence is required to evaluate regulation in this field of medicine.

  4. Physiogenomic analysis of weight loss induced by dietary carbohydrate restriction

    Directory of Open Access Journals (Sweden)

    Wood Richard J

    2006-05-01

    Full Text Available Abstract Background Diets that restrict carbohydrate (CHO have proven to be a successful dietary treatment of obesity for many people, but the degree of weight loss varies across individuals. The extent to which genetic factors associate with the magnitude of weight loss induced by CHO restriction is unknown. We examined associations among polymorphisms in candidate genes and weight loss in order to understand the physiological factors influencing body weight responses to CHO restriction. Methods We screened for genetic associations with weight loss in 86 healthy adults who were instructed to restrict CHO to a level that induced a small level of ketosis (CHO ~10% of total energy. A total of 27 single nucleotide polymorphisms (SNPs were selected from 15 candidate genes involved in fat digestion/metabolism, intracellular glucose metabolism, lipoprotein remodeling, and appetite regulation. Multiple linear regression was used to rank the SNPs according to probability of association, and the most significant associations were analyzed in greater detail. Results Mean weight loss was 6.4 kg. SNPs in the gastric lipase (LIPF, hepatic glycogen synthase (GYS2, cholesteryl ester transfer protein (CETP and galanin (GAL genes were significantly associated with weight loss. Conclusion A strong association between weight loss induced by dietary CHO restriction and variability in genes regulating fat digestion, hepatic glucose metabolism, intravascular lipoprotein remodeling, and appetite were detected. These discoveries could provide clues to important physiologic adaptations underlying the body mass response to CHO restriction.

  5. Restricted Interval Guelph permeameter: Theory and application

    International Nuclear Information System (INIS)

    Freifeld, Barry M.; Oldenburg, Curtis M.

    2003-01-01

    A constant head permeameter system has been developed for use in small diameter boreholes with any orientation. It is based upon the original Guelph permeameter concept of using a Mariotte siphon reservoir to control the applied head. The new tool, called a Restricted Interval Guelph (RIG) permeameter uses either a single pneumatic packer or straddle packer to restrict the area through which water is allowed to flow so that the borehole wetted area is independent of the applied head. The RIG permeameter has been used at Yucca Mountain, Nevada, in the nonwelded rhyolitic Paintbrush Tuff. Analysis of the acquired data is based upon saturated-unsaturated flow theory that relies upon the quasi-linear approximation to estimate field-saturated hydraulic conductivity (Kfs) and the a parameter (sorptive number) of the exponential relative hydraulic conductivity pressure head relationship. These results are compared with a numerical model based upon the solution of the Richards equation using a van Genuchten capillary pressure-saturation formulation. The numerical model incorporates laboratory capillary pressure versus saturation functions measured from cores taken from nearby boreholes. Comparison between the analytical and numerical approaches shows that the simple analytic model is valid for analyzing the data collected. Sensitivity analysis performed with the numerical model shows that the RIG permeameter is an effective tool for estimating permeability and sorptive number for the nonwelded Paintbrush Tuff

  6. Selection of restriction endonucleases using artificial cells.

    Science.gov (United States)

    Zheng, Yu; Roberts, Richard J

    2007-01-01

    We describe in this article an in vitro system for the selection of restriction endonucleases using artificial cells. The artificial cells are generated in the form of a water-in-oil emulsion by in vitro compartmentalization. Each aqueous compartment contains a reconstituted transcription/translation mix along with the dispersed DNA templates. In the compartments containing endonuclease genes, an endonuclease expressed in vitro cleaves its own DNA template adjacent to the gene, leaving a sticky end. The pooled DNA templates are then ligated to an adaptor with a compatible end. The endonuclease genes are then enriched by adaptor-specific PCR on the ligation mix. We demonstrate that the system can achieve at least 100-fold enrichment in a single round of selection. It is sensitive enough to enrich an active endonuclease gene from a 1:10(5) model library in 2-3 rounds of selection. Finally, we describe experiments where we selected endonuclease genes directly from a bacterial genomic DNA source in three rounds of selections: the known PstI gene from Providencia stuartii and the new TspMI gene from Thermus sp. manalii. This method provides a unique tool for cloning restriction endonuclease genes and has many other potential applications.

  7. Restriction site polymorphisms in the pig beta-globin gene cluster.

    Science.gov (United States)

    Rando, A; Masina, P

    1985-01-01

    A restriction fragment length polymorphism was detected in pig DNA digested with Hind III restriction endonuclease and probed with rabbit beta 1-globin gene. Eight different phenotypes were observed and for six of them family data demonstrated that they are determined by three alleles. As this polymorphism is not found with four other restriction endonucleases (Bam HI, Eco RI, Kpn I, and Pst I), single point mutations are proposed to explain the observed differences.

  8. The Catalytic Function of Enzymes.

    Science.gov (United States)

    Splittgerber, Allan G.

    1985-01-01

    Discusses: structure of the enzyme molecule; active site; reaction mechanism; transition state; factors affecting enzyme reaction rates, concentration of enzyme; concentration of substrate; product concentration; temperature effects and pH effects; factors causing a lowering of activation energy; proximity and orientation effects; substrate strain…

  9. Ordered Restriction Maps of Saccharomyces cerevisiae Chromosomes Constructed by Optical Mapping

    Science.gov (United States)

    Schwartz, David C.; Li, Xiaojun; Hernandez, Luis I.; Ramnarain, Satyadarshan P.; Huff, Edward J.; Wang, Yu-Ker

    1993-10-01

    A light microscope-based technique for rapidly constructing ordered physical maps of chromosomes has been developed. Restriction enzyme digestion of elongated individual DNA molecules (about 0.2 to 1.0 megabases in size) was imaged by fluorescence microscopy after fixation in agarose gel. The size of the resulting individual restriction fragments was determined by relative fluorescence intensity and apparent molecular contour length. Ordered restriction maps were then created from genomic DNA without reliance on cloned or amplified sequences for hybridization or analytical gel electrophoresis. Initial application of optical mapping is described for Saccharomyces cerevisiae chromosomes.

  10. Restriction Map Variation at the Adh Locus of Drosophila Melanogaster in Inverted and Noninverted Chromosomes

    OpenAIRE

    Aguade, M.

    1988-01-01

    Restriction map variation among 39 Standard and 40 In(2L)t chromosomes extracted from a Spanish natural population of Drosophila melanogaster was investigated for a 2.7-kb region encompassing the Adh locus with ten four-cutter restriction enzymes. A total of 20 polymorphisms were detected, representing 15 restriction site polymorphisms, 4 length polymorphisms and the allozyme polymorphism. Variation at the DNA level was compared among St-Adh(F), St-Adh(S) and t-Adh(S) chromosomes. t-Adh(S) ch...

  11. Enzymes as Sensors.

    Science.gov (United States)

    Staiano, Maria; Pennacchio, Angela; Varriale, Antonio; Capo, Alessandro; Majoli, Adelia; Capacchione, Clotilde; D'Auria, Sabato

    2017-01-01

    Over the last few decades the development of new technologies, the fabrication of new materials, and the introduction of nanotechnologies created new trends in a series of advances that produced innovations in biological sensing devices with a wide range of application from health, security, defense, food, and medicine, to the environment. Specificity, low cost, rapidity, sensitivity, and multiplicity are some of the reasons for their growth, and their commercial success is expected to increase in the next future. Biosensors are devices in which the recognition part of the target molecule is accomplished by biological macromolecules such as proteins, enzymes, antibodies, aptamers, etc. These biomolecules are able to bind to the target molecules with high selectivity and specificity. The interaction between the target molecule and the specific biomolecule is reflected as a change of the biomolecule structural features. The extent of this change is strictly related to the biosensor response. Fluorescence spectroscopy, due to its sensitivity, is often used as the principal technique to monitor biological interactions, and thus the biosensor response as well. Both the intrinsic ultraviolet fluorescence of protein, arising from aromatic amino acids (tryptophan, tyrosine, and phenylalanine), and extrinsic fluorescent labels emitting in the visible region of the spectrum together allow for very flexible transduction of the analyte recognition, suitable for many different applications. This chapter focuses special attention on enzymes as practically unmatched recognition elements for biosensors and emphasizes the potential advantages of customized biosensor devices using apo- or holo forms of enzymes also isolated from thermophile sources. © 2017 Elsevier Inc. All rights reserved.

  12. Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.

    Science.gov (United States)

    Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

    1990-10-01

    Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster

  13. Protein Crystal Malic Enzyme

    Science.gov (United States)

    1992-01-01

    Malic Enzyme is a target protein for drug design because it is a key protein in the life cycle of intestinal parasites. After 2 years of effort on Earth, investigators were unable to produce any crystals that were of high enough quality and for this reason the structure of this important protein could not be determined. Crystals obtained from one STS-50 were of superior quality allowing the structure to be determined. This is just one example why access to space is so vital for these studies. Principal Investigator is Larry DeLucas.

  14. Food restriction modulates β-adrenergic-sensitive adenylate cyclase in rat liver during aging

    International Nuclear Information System (INIS)

    Katz, M.S.

    1988-01-01

    Adenylate cyclase activities were studied in rat liver during postmaturational aging of male Fischer 344 rats fed ad libitum or restricted to 60% of the ad libitum intake. Catecholamine-stimulated adenylate cyclase activity increased by 200-300% between 6 and 24-27 mo of age in ad libitum-fed rats, whereas in food-restricted rats catecholamine response increased by only 58-84% between 6 and 30 mo. In ad libitum-fed rats, glucagon-stimulated enzyme activity also increased by 40% between 6 and 12 mo and in restricted rats a similar age-related increase was delayed until 18 mo. β-Adrenergic receptor density increased by 50% between 6 and 24 mo in livers from ad libitum-fed but not food-restricted rats and showed a highly significant correlation with maximal isoproterenol-stimulated adenylate cyclase activity over the postmaturational life span. Age-related increases in unstimulated (basal) adenylate cyclase activity and nonreceptor-mediated enzyme activation were retarded by food restriction. The results demonstrate that food restriction diminishes a marked age-related increase in β-adrenergic-sensitive adenylate cyclase activity of rat liver. Alterations of adrenergic-responsive adenylate cyclase with age and the modulatory effects of food restriction appear to be mediated by changes in both receptor and nonreceptor components of adenylate cyclase

  15. Identification of Egyptian Fasciola species by PCR and restriction endonucleases digestion of the nuclear small subunit ribosomal RNA gene.

    Science.gov (United States)

    El-Gozamy, Bothina R; Shoukry, Nahla M

    2009-08-01

    Fascioliasis is one of the familiar zoonotic health problems of worldwide distribution including Egypt. In this study, a simple and rapid polymerase chain reaction/restriction fragment length polymorphisms (PCR/RFLPs) assay, using the common restriction endonucleases Aval, EcoRI, Eael, Sac11 and Avail was applied to differentiate between both Fasciola gigantica and F. hepatica. The five restriction endonucleases were used to differentiate between the two species of Fasciola based on -1950 bp long sequence of the 18S nuclear small subunit ribosomal RNA gene. Aval and EcoRI restriction endonucleases failed to differentiate between the two Fasciola species when each restriction enzyme gave the same restriction patterns in both of them. However, F. gigantica and F. hepatica were well-differentiated when their small subunit ribosomal DNA were digested with Eael and Sac 11 restriction endonucleases.

  16. Caloric restriction and its mimetics

    Directory of Open Access Journals (Sweden)

    Shin-Hae Lee

    2013-04-01

    Full Text Available Caloric restriction is the most reliable intervention to preventage-related disorders and extend lifespan. The reduction ofcalories by 10-30% compared to an ad libitum diet is known toextend the longevity of various species from yeast to rodents.The underlying mechanisms by which the benefits of caloricrestriction occur have not yet been clearly defined. However,many studies are being conducted in an attempt to elucidatethese mechanisms, and there are indications that the benefits ofcaloric restriction are related to alteration of the metabolic rateand the accumulation of reactive oxygen species. Duringmolecular signaling, insulin/insulin-like growth factor signaling,target of rapamycin pathway, adenosine monophosphateactivated protein kinase signaling, and Sirtuin are focused asunderlying pathways that mediate the benefits of caloricrestriction. Here, we will review the current status of caloricrestriction. [BMB Reports 2013; 46(4: 181-187

  17. Enzymic liquefaction and saccharification of agricultural biomass. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Beldman, G.; Searle-Van Leeuwen, M.J.F.; Voragen, A.G.J.; Rombouts, F.M.; Pilnik, W.

    1985-01-01

    The aim of this project was to study the application of polysaccharide degrading enzymes (cellulases, hemicellulases, pectinases) in the conversion of agricultural and horticultural raw materials, surpluses and wastes to fermentable sugar solutions. Several aspects of such a process had to be investigated. In order to select optimal enzyme combinations, the polysaccharide composition of the raw materials had to be studied. Commercial enzyme preparations had to be screened on their liquefying and saccharifying capability. We had to study optimal reaction conditions of these enzymes such as pH, temperature and reactor design as well as the effect of pretreatment of the raw materials on enzyme action. Ligno-cellulosic materials like wood chips and tomato plant waste gave low sugar yields, when treated with enzymes alone. Extrusion of wood chips in a single screw extruder at 170/sup 0/C gave a 5 fold increase of its enzymic digestibility. The same pretreatment on tomato plant waste gave less satisfactory results. Preliminary experiments were carried out on the improvement of the solid phase fermentation of sugar beets. Addition of pectolytic and cellulolytic enzymes to the mash gave a liquid product, faster fermentation and more ethanol. The cellulase preparation Maxazyme was studied into more detail by fractionation and characterization of the different endoglucanases, exoglucanases and ..beta..-glucosidases. Binding of the individual enzymes to crystalline cellulose was studied, as well as the endoglucanase/exoglucanase ratio for maximum synergism between the two enzymes. From experiments with the original enzyme preparation Maxazyme Cl, enriched with the purified enzymes, we concluded that a harmoniously composed mixture is needed to obtain maximal cellulose hydrolysis.

  18. Using Restriction Mapping to Teach Basic Skills in the Molecular Biology Lab

    Science.gov (United States)

    Walsh, Lauren; Shaker, Elizabeth; De Stasio, Elizabeth A.

    2007-01-01

    Digestion of DNA with restriction enzymes, calculation of volumes and concentrations of reagents for reactions, and the separation of DNA fragments by agarose gel electrophoresis are common molecular biology techniques that are best taught through repetition. The following open-ended, investigative laboratory exercise in plasmid restriction…

  19. Demonstration of the Principles of Restriction Endonuclease Cleavage Reactions Using Thermostable Bfl I from "Anoxybacillus Flavithermus"

    Science.gov (United States)

    Sharma, Prince; D'Souza, David R.; Bhandari, Deepali; Parashar, Vijay; Capalash, Neena

    2003-01-01

    Restriction enzymes are basic tools in recombinant DNA technology. To shape the molecular biology experiments, the students must know how to work with these molecular scissors. Here, we describe an integrated set of experiments, introduced in the "Advances in Molecular Biology and Biotechnology" postgraduate course, which covers the important…

  20. Alteration of sequence specificity of the type IIS restriction endonuclease BtsI.

    Directory of Open Access Journals (Sweden)

    Shengxi Guan

    Full Text Available The Type IIS restriction endonuclease BtsI recognizes and digests at GCAGTG(2/0. It comprises two subunits: BtsIA and BtsIB. The BtsIB subunit contains the recognition domain, one catalytic domain for bottom strand nicking and part of the catalytic domain for the top strand nicking. BtsIA has the rest of the catalytic domain that is responsible for the DNA top strand nicking. BtsIA alone has no activity unless it mixes with BtsIB to reconstitute the BtsI activity. During characterization of the enzyme, we identified a BtsIB mutant R119A found to have a different digestion pattern from the wild type BtsI. After characterization, we found that BtsIB(R119A is a novel restriction enzyme with a previously unreported recognition sequence CAGTG(2/0, which is named as BtsI-1. Compared with wild type BtsI, BtsI-1 showed different relative activities in NEB restriction enzyme reaction buffers NEB1, NEB2, NEB3 and NEB4 and less star activity. Similar to the wild type BtsIB subunit, the BtsI-1 B subunit alone can act as a bottom nicking enzyme recognizing CAGTG(-/0. This is the first successful case of a specificity change among this restriction endonuclease type.

  1. Laparoscopic sleeve gastrectomy: More than a restrictive bariatric surgery procedure?

    Science.gov (United States)

    Benaiges, David; Más-Lorenzo, Antonio; Goday, Albert; Ramon, José M; Chillarón, Juan J; Pedro-Botet, Juan; Roux, Juana A Flores-Le

    2015-01-01

    Sleeve gastrectomy (SG) is a restrictive bariatric surgery technique that was first used as part of restrictive horizontal gastrectomy in the original Scopinaro type biliopancreatic diversion. Its good results as a single technique have led to a rise in its use, and it is currently the second most performed technique worldwide. SG achieves clearly better results than other restrictive techniques and is comparable in some aspects to the Roux-en-Y gastric bypass, the current gold standard in bariatric surgery. These benefits have been associated with different pathophysiologic mechanisms unrelated to weight loss such as increased gastric emptying and intestinal transit, and activation of hormonal mechanisms such as increased GLP-1 hormone and decreased ghrelin. The aim of this review was to highlight the salient aspects of SG regarding its historical evolution, pathophysiologic mechanisms, main results, clinical applications and perioperative complications. PMID:26557004

  2. TFAP2B influences the effect of dietary fat on weight loss under energy restriction

    DEFF Research Database (Denmark)

    Stocks, Tanja; Angquist, Lars; Banasik, Karina

    2012-01-01

    Numerous gene loci are related to single measures of body weight and shape. We investigated if 55 SNPs previously associated with BMI or waist measures, modify the effects of fat intake on weight loss and waist reduction under energy restriction.......Numerous gene loci are related to single measures of body weight and shape. We investigated if 55 SNPs previously associated with BMI or waist measures, modify the effects of fat intake on weight loss and waist reduction under energy restriction....

  3. Measuring the Enzyme Activity of Arabidopsis Deubiquitylating Enzymes.

    Science.gov (United States)

    Kalinowska, Kamila; Nagel, Marie-Kristin; Isono, Erika

    2016-01-01

    Deubiquitylating enzymes, or DUBs, are important regulators of ubiquitin homeostasis and substrate stability, though the molecular mechanisms of most of the DUBs in plants are not yet understood. As different ubiquitin chain types are implicated in different biological pathways, it is important to analyze the enzyme characteristic for studying a DUB. Quantitative analysis of DUB activity is also important to determine enzyme kinetics and the influence of DUB binding proteins on the enzyme activity. Here, we show methods to analyze DUB activity using immunodetection, Coomassie Brilliant Blue staining, and fluorescence measurement that can be useful for understanding the basic characteristic of DUBs.

  4. Action of ionizing radiation on the carbohydrate metabolism enzymes

    International Nuclear Information System (INIS)

    Cherkasova, L.S.; Mironova, T.M.

    1976-01-01

    It follows from data reported in literature and those obtained in our laboratory that ionizing radiation does not drastically change the activity of enzymes of the carbohydrate metabolism in tissues of an animal organism. The data are reported on the effect of a whole-body single, fractionated or continuous irradiation of the enzymes of carbohydrate metabolism and the accompanying interrelated co-operative redistributions within the processes of aerobic and anaerobic glycolysis, and the pentose route of their conversion. The dependence of the postirradiation changes in the activity of enzymes on the neuroendocrine system response to irradiation has been demonstrated

  5. Structures of the rare-cutting restriction endonuclease NotI reveal a unique metal binding fold involved in DNA binding.

    Science.gov (United States)

    Lambert, Abigail R; Sussman, Django; Shen, Betty; Maunus, Robert; Nix, Jay; Samuelson, James; Xu, Shuang-Yong; Stoddard, Barry L

    2008-04-01

    The structure of the rare-cutting restriction endonuclease NotI, which recognizes the 8 bp target 5'-GCGGCCGC-3', has been solved with and without bound DNA. Because of its specificity (recognizing a site that occurs once per 65 kb), NotI is used to generate large genomic fragments and to map DNA methylation status. NotI contains a unique metal binding fold, found in a variety of putative endonucleases, occupied by an iron atom coordinated within a tetrahedral Cys4 motif. This domain positions nearby protein elements for DNA recognition, and serves a structural role. While recognition of the central six base pairs of the target is accomplished via a saturated hydrogen bond network typical of restriction enzymes, the most peripheral base pairs are engaged in a single direct contact in the major groove, reflecting reduced pressure to recognize those positions. NotI may represent an evolutionary intermediate between mobile endonucleases (which recognize longer target sites) and canonical restriction endonucleases.

  6. Characterization of LlaKI, a New Metal Ion-Independent Restriction Endonuclease from Lactococcus lactis KLDS4.

    Science.gov (United States)

    Belkebir, Abdelkarim; Azeddoug, Houssine

    2012-01-01

    Requirement of divalent cations for DNA cleavage is a general feature of type II restriction enzymes with the exception of few members of this group. A new type II restriction endonuclease has been partially purified from Lactococcus lactis KLDS4. The enzyme was denoted as LlaKI and showed to recognize and cleave the same site as FokI. The enzyme displayed a denatured molecular weight of 50 kDa and behaved as a dimer in solution as evidenced by the size exclusion chromatography. To investigate the role of divalent cations in DNA cleavage by LlaKI, digestion reactions were carried out at different Mg(2+), Mn(2+), and Ca(2+) concentrations. Unlike most of type II restriction endonucleases, LlaKI did not require divalent metal ions to cleave DNA and is one of the few metal-independent restriction endonucleases found in bacteria. The enzyme showed near-maximal levels of activity in 10 mM Tris-HCl pH 7.9, 50 mM NaCl, 10 mM MgCl2, and 1 mM dithiothreitol at 30°C. The presence of DNA modification was also determined and was correlated with the correspondent restriction enzyme.

  7. Partial sleep restriction decreases insulin sensitivity in type 1 diabetes.

    Science.gov (United States)

    Donga, Esther; van Dijk, Marieke; van Dijk, J Gert; Biermasz, Nienke R; Lammers, Gert-Jan; van Kralingen, Klaas; Hoogma, Roel P L M; Corssmit, Eleonora P M; Romijn, Johannes A

    2010-07-01

    Sleep restriction results in decreased insulin sensitivity and glucose tolerance in healthy subjects. We hypothesized that sleep duration is also a determinant of insulin sensitivity in patients with type 1 diabetes. We studied seven patients (three men, four women) with type 1 diabetes: mean age 44 +/- 7 years, BMI 23.5 +/- 0.9 kg/m(2), and A1C 7.6 +/- 0.3%. They were studied once after a night of normal sleep duration and once after a night of only 4 h of sleep. Sleep characteristics were assessed by polysomnography. Insulin sensitivity was measured by hyperinsulinemic euglycemic clamp studies with an infusion of [6,6-(2)H(2)]glucose. RESULTS Sleep duration was shorter in the night with sleep restriction than in the unrestricted night (469 +/- 8.5 vs. 222 +/- 7.1 min, P = 0.02). Sleep restriction did not affect basal levels of glucose, nonesterified fatty acids (NEFAs), or endogenous glucose production. Endogenous glucose production during the hyperinsulinemic clamp was not altered during the night of sleep restriction compared with the night of unrestricted sleep (6.2 +/- 0.8 vs. 6.9 +/- 0.6 micromol x kg lean body mass(-1) x min(-1), NS). In contrast, sleep restriction decreased the glucose disposal rate during the clamp (25.5 +/- 2.6 vs. 22.0 +/- 2.1 micromol x kg lean body mass(-1) x min(-1), P = 0.04), reflecting decreased peripheral insulin sensitivity. Accordingly, sleep restriction decreased the rate of glucose infusion by approximately 21% (P = 0.04). Sleep restriction did not alter plasma NEFA levels during the clamp (143 +/- 29 vs. 133 +/- 29 micromol/l, NS). Partial sleep deprivation during a single night induces peripheral insulin resistance in these seven patients with type 1 diabetes. Therefore, sleep duration is a determinant of insulin sensitivity in patients with type 1 diabetes.

  8. Who will resettle single Syrian men?

    Directory of Open Access Journals (Sweden)

    Lewis Turner

    2017-02-01

    Full Text Available Resettlement programmes for Syrian refugees severely restrict access to resettlement for single Syrian men, despite the conditions of vulnerability, insecurity and danger in which they live.

  9. Penetration Enzymes of Schistosome Cercariae.

    Science.gov (United States)

    1982-10-12

    schistosomules; *: (4) differences in intraspecific geographical strains of Schistosoma mansoni; and (5) snail -parasite relationships. (1) Cercarial Enzymes...3) Skin surface lipid can be used to stimulate cercarial secretion which can be collected in vitro. (4) Since postacetabular gland mucus is not water...enzyme activity throughout the patency of infection in snails exposed to 8 to 10 or to I miracidium, required recording cercarial harvests and enzyme

  10. Rurality study of restricted areas

    Directory of Open Access Journals (Sweden)

    Sergio Rivaroli

    2011-02-01

    Full Text Available Two main perspectives of investigation emerge from the study of a territory’s rurality: a geographical approach and a sociological approach. The research examines the sub-regional study case of ‘Nuovo circondario imolese’. The analysis shows that the combination of traditional institutional criteria with detailed informations about the territory, generates more accurate results which determine a better comprehension of the characteristics of restricted areas’ rurality. Over the period 1991-2001, the study highlights an increase in rural areas. This result could be interpreted as an effect of urban sprawl’s intensification, that increases the competition between non-farm residences and agricultural activities.

  11. A study of enzyme and protein microencapsulation--some factors affecting the low apparent enzymic activity yields.

    Science.gov (United States)

    Wood, D A; Whateley, T L

    1982-09-01

    Microencapsulation of aqueous solutions of enzymes, alpha-chymotrypsin (EC 3.4.21.1) and histidase (EC 4.3.1.3), with semipermeable polyamide membranes resulted in a loss of enzymic activity. The low yields (less than 40%) found with both enzymes were typical of others reported in the literature. The activity of broken histidase-containing microcapsules was greater than that of the microcapsules before breaking, and this was interpreted as being due to a simple diffusional restriction on the substrate and product. The maximum of the apparent pH-activity curve of alpha-chymotrypsin was found to be shifted one unit to more alkaline pH when the enzyme was encapsulated. This phenomenon was explained in terms of the hydrogen ion concentration in the microenvironment surrounding the enzyme being different from that in the bulk solution. Microencapsulation of aqueous solutions of enzymes is accomplished by in situ polymerization reactions at the interface of a water-in-oil emulsion. 125I-labelled proteins (albumin and fibrinogen) were encapsulated under similar conditions to determine the efficiency of the microencapsulation process. About one third of these proteins was lost during the overall preparation procedure and a further fraction was attached to the membranes of the microcapsules.

  12. Parenting and restrictions in childhood epilepsy

    NARCIS (Netherlands)

    Rodenburg, R.; Meijer, A.M.; Scherphof, C.; Carpay, J.A.; Augustijn, P.; Aldenkamp, A.P.; Deković, M.

    2013-01-01

    Purpose: From the overprotection literature, the predictive and interactional (moderation) effects of controlling and indulgent parenting on restrictions in children with epilepsy were examined. Methods: Parents of 73 children with epilepsy completed questionnaires on parenting, restrictions, and

  13. 9 CFR 78.5 - General restrictions.

    Science.gov (United States)

    2010-01-01

    ... INTERSTATE TRANSPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS BRUCELLOSIS Restrictions on Interstate Movement of Cattle Because of Brucellosis § 78.5 General restrictions. Cattle may not be moved...

  14. Enzyme Mimics: Advances and Applications.

    Science.gov (United States)

    Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang

    2016-06-13

    Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Enzymes From Rare Actinobacterial Strains.

    Science.gov (United States)

    Suriya, J; Bharathiraja, S; Manivasagan, P; Kim, S-K

    Actinobacteria constitute rich sources of novel biocatalysts and novel natural products for medical and industrial utilization. Although actinobacteria are potential source of economically important enzymes, the isolation and culturing are somewhat tough because of its extreme habitats. But now-a-days, the rate of discovery of novel compounds producing actinomycetes from soil, freshwater, and marine ecosystem has increased much through the developed culturing and genetic engineering techniques. Actinobacteria are well-known source of their bioactive compounds and they are the promising source of broad range of industrially important enzymes. The bacteria have the capability to degrade a range of pesticides, hydrocarbons, aromatic, and aliphatic compounds (Sambasiva Rao, Tripathy, Mahalaxmi, & Prakasham, 2012). Most of the enzymes are mainly derived from microorganisms because of their easy of growth, minimal nutritional requirements, and low-cost for downstream processing. The focus of this review is about the new, commercially useful enzymes from rare actinobacterial strains. Industrial requirements are now fulfilled by the novel actinobacterial enzymes which assist the effective production. Oxidative enzymes, lignocellulolytic enzymes, extremozymes, and clinically useful enzymes are often utilized in many industrial processes because of their ability to catalyze numerous reactions. Novel, extremophilic, oxidative, lignocellulolytic, and industrially important enzymes from rare Actinobacterial population are discussed in this chapter. © 2016 Elsevier Inc. All rights reserved.

  16. Enzyme therapeutics for systemic detoxification.

    Science.gov (United States)

    Liu, Yang; Li, Jie; Lu, Yunfeng

    2015-08-01

    Life relies on numerous biochemical processes working synergistically and correctly. Certain substances disrupt these processes, inducing living organism into an abnormal state termed intoxication. Managing intoxication usually requires interventions, which is referred as detoxification. Decades of development on detoxification reveals the potential of enzymes as ideal therapeutics and antidotes, because their high substrate specificity and catalytic efficiency are essential for clearing intoxicating substances without adverse effects. However, intrinsic shortcomings of enzymes including low stability and high immunogenicity are major hurdles, which could be overcome by delivering enzymes with specially designed nanocarriers. Extensive investigations on protein delivery indicate three types of enzyme-nanocarrier architectures that show more promise than others for systemic detoxification, including liposome-wrapped enzymes, polymer-enzyme conjugates, and polymer-encapsulated enzymes. This review highlights recent advances in these nano-architectures and discusses their applications in systemic detoxifications. Therapeutic potential of various enzymes as well as associated challenges in achieving effective delivery of therapeutic enzymes will also be discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Direct comparison of enzyme histochemical and immunohistochemical methods to localize an enzyme

    NARCIS (Netherlands)

    van Noorden, Cornelis J. F.

    2002-01-01

    Immunohistochemical localization of enzymes is compared directly with localization of enzyme activity with (catalytic) enzyme histochemical methods. The two approaches demonstrate principally different aspects of an enzyme. The immunohistochemical method localizes the enzyme protein whether it is

  18. An isoelectrically trapped enzyme reactor operating in an electric field.

    Science.gov (United States)

    Righetti, P G; Bossi, A

    1998-06-01

    Membrane enzyme reactors constitute an attempt at integrating catalytic conversion, product separation and/or concentration and catalyst recovery into a single operation. Whereas conventional membrane reactors confine an enzyme, in a free form, to one side of a membrane by size exclusion, electrostatic repulsion, or physical or chemical immobilization onto an intermediate support (gel, liposome), the membrane reactor here described is shown to operate under an entirely new principle: enzyme confinement into an isoelectric trap located in a multicompartment electrolyzer operating in an electric field. Two isoelectric membranes, having pI values encompassing both the enzyme pI and the pH of its optimum of activity, act by continuously titrating the enzyme trapped inside, thus preventing it from escaping the reaction chamber. Charged products generated by the enzyme catalysis are continuously electrophoretically transported away from the reaction chamber and collected into other chambers stacked either towards the cathodic or anodic sides. In a urease reactor, ammonia is continuously harvested towards the cathode, thus allowing >95% substrate consumption with maintenance of enzyme integrity over much longer time periods than in a batch reactor. In a trypsin reactor, casein is digested and biologically active peptides are continuously harvested in a pure form into appropriate isoelectric traps. In a third example, pure D-phenylglycine is produced from a racemate mixture, via an acylation reaction onto a cosubstrate (the ester methyl-4-hydroxyphenyl acetate), brought about by the enzyme penicillin G acylase.

  19. Coproduction of detergent compatible bacterial enzymes and stain removal evaluation.

    Science.gov (United States)

    Niyonzima, Francois N; More, Sunil S

    2015-10-01

    Most of the detergents that are presently produced contain the detergent compatible enzymes to improve and accelerate the washing performance by removing tough stains. The process is environment friendly as the use of enzymes in the detergent formulation reduces the utilization of toxic detergent constituents. The current trend is to use the detergent compatible enzymes that are active at low and ambient temperature in order to save energy and maintain fabric quality. As the detergent compatible bacterial enzymes are used together in the detergent formulation, it is important to co-produce the detergent enzymes in a single fermentation medium as the enzyme stability is assured, and production cost gets reduced enormously. The review reports on the production, purification, characterization and application of detergent compatible amylases, lipases, and proteases are available. However, there is no specific review or minireview on the concomitant production of detergent compatible amylases, lipases, and proteases. In this minireview, the coproduction of detergent compatible enzymes by bacterial species, enzyme stability towards detergents and detergent components, and stain release analysis were discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Directed evolution of thermotolerant malic enzyme for improved malate production.

    Science.gov (United States)

    Morimoto, Yumi; Honda, Kohsuke; Ye, Xiaoting; Okano, Kenji; Ohtake, Hisao

    2014-02-01

    The directed evolution of the thermotolerant NADP(H)-dependent malic enzyme from Thermococcus kodakarensis was conducted to alter the cofactor preference of the enzyme from NADP(H) to NAD(H). The construction and screening of two generations of mutant libraries led to the isolation of a triple mutant that exhibited 6-fold higher kcat/Km with NAD(+) than the wild type. We serendipitously found that, in addition to the change in the cofactor preference, the reaction specificity of the mutant enzyme was altered. The reductive carboxylation of pyruvate to malate catalyzed by the wild type enzyme is accompanied by HCO(3)(-)-independent reduction of pyruvate and gives lactate as a byproduct. The reaction specificity of the triple mutant was significantly shifted to malate production and the mutant gave a less amount of the byproduct than the wild type. When the triple mutant enzyme was used as a catalyst for pyruvate carboxylation with NADH, the enzyme gave 1.2 times higher concentration of malate than the wild type with NADPH. Single-point mutation analysis revealed that the substitution of Arg221 with Gly is responsible for the shift in reaction specificity. This finding may shed light on the catalytic mechanisms of malic enzymes and other related CO2- and/or HCO(3)(-)-fixing enzymes. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.