WorldWideScience

Sample records for single resistance gene

  1. Risk assessment for Helicoverpa zea (Lepidoptera: Noctuidae) resistance on dual-gene versus single-gene corn.

    Science.gov (United States)

    Edwards, Kristine T; Caprio, Michael A; Allen, K Clint; Musser, Fred R

    2013-02-01

    Recent Environmental Protection Agency (EPA) decisions regarding resistance management in Bt-cropping systems have prompted concern in some experts that dual-gene Bt-corn (CrylA.105 and Cry2Ab2 toxins) may result in more rapid selection for resistance in Helicoverpa zea (Boddie) than single-gene Bacillus thuringiensis (Bt)-corn (CrylAb toxin). The concern is that Bt-toxin longevity could be significantly reduced with recent adoption of a natural refuge for dual-gene Bt-cotton (CrylAc and Cry2Ab2 toxins) and concurrent reduction in dual-gene corn refuge from 50 to 20%. A population genetics framework that simulates complex landscapes was applied to risk assessment. Expert opinions on effectiveness of several transgenic corn and cotton varieties were captured and used to assign probabilities to different scenarios in the assessment. At least 350 replicate simulations with randomly drawn parameters were completed for each of four risk assessments. Resistance evolved within 30 yr in 22.5% of simulations with single-gene corn and cotton with no volunteer corn. When volunteer corn was added to this assessment, risk of resistance evolving within 30 yr declined to 13.8%. When dual-gene Bt-cotton planted with a natural refuge and single-gene corn planted with a 50% structured refuge was simulated, simultaneous resistance to both toxins never occurred within 30 yr, but in 38.5% of simulations, resistance evolved to toxin present in single-gene Bt-corn (CrylAb). When both corn and cotton were simulated as dual-gene products, cotton with a natural refuge and corn with a 20% refuge, 3% of simulations evolved resistance to both toxins simultaneously within 30 yr, while 10.4% of simulations evolved resistance to CrylAb/c toxin.

  2. Multiplex single nucleotide polymorphism (SNP) assay for detection of soybean mosaic virus resistance genes in soybean.

    Science.gov (United States)

    Shi, Ainong; Chen, Pengyin; Vierling, Richard; Zheng, Cuming; Li, Dexiao; Dong, Dekun; Shakiba, Ehsan; Cervantez, Innan

    2011-02-01

    Soybean mosaic virus (SMV) is one of the most destructive viral diseases in soybean (Glycine max). Three independent loci for SMV resistance have been identified in soybean germplasm. The use of genetic resistance is the most effective method of controlling this disease. Marker assisted selection (MAS) has become very important and useful in the effort of selecting genes for SMV resistance. Single nucleotide polymorphism (SNP), because of its abundance and high-throughput potential, is a powerful tool in genome mapping, association studies, diversity analysis, and tagging of important genes in plant genomics. In this study, a 10 SNPs plus one insert/deletion (InDel) multiplex assay was developed for SMV resistance: two SNPs were developed from the candidate gene 3gG2 at Rsv1 locus, two SNPs selected from the clone N11PF linked to Rsv1, one 'BARC' SNP screened from soybean chromosome 13 [linkage group (LG) F] near Rsv1, two 'BARC' SNPs from probe A519 linked to Rsv3, one 'BARC' SNP from chromosome 14 (LG B2) near Rsv3, and two 'BARC' SNPs from chromosome 2 (LG D1b) near Rsv4, plus one InDel marker from expressed sequence tag (EST) AW307114 linked to Rsv4. This 11 SNP/InDel multiplex assay showed polymorphism among 47 diverse soybean germplasm, indicating this assay can be used to investigate the mode of inheritance in a SMV resistant soybean line carrying Rsv1, Rsv3, and/or Rsv4 through a segregating population with phenotypic data, and to select a specific gene or pyramid two or three genes for SMV resistance through MAS in soybean breeding program. The presence of two SMV resistance genes (Rsv1 and Rsv3) in J05 soybean was confirmed by the SNP assay.

  3. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

    Directory of Open Access Journals (Sweden)

    Claire Chewapreecha

    2014-08-01

    Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

  4. Genetic analysis and mapping of genes for resistance to multiple strains of Soybean mosaic virus in a single resistant soybean accession PI 96983.

    Science.gov (United States)

    Yang, Yongqing; Zheng, Guijie; Han, Lu; Dagang, Wang; Yang, Xiaofeng; Yuan, Yuan; Huang, Saihua; Zhi, Haijian

    2013-07-01

    Soybean mosaic virus (SMV) is one of the most broadly distributed soybean (Glycine max (L.) Merr.) diseases and causes severe yield loss and seed quality deficiency. Multiple studies have proved that a single dominant gene can confer resistance to several SMV strains. Plant introduction (PI) 96983 has been reported to contain SMV resistance genes (e.g., Rsv1 and Rsc14) on chromosome 13. The objective of this study was to delineate the genetics of resistance to SMV in PI 96983 and determine whether one gene can control resistance to more than one Chinese SMV strain. In this study, PI 96983 was identified as resistant and Nannong 1138-2 was identified as susceptible to four SMV strains SC3, SC6, SC7, and SC17. Genetic maps based on 783 F2 individuals from the cross of PI 96983 × Nannong 1138-2 showed that the gene(s) conferring resistance to SC3, SC6, and SC17 were between SSR markers BARCSOYSSR_13_1114 and BARCSOYSSR_13_1136, whereas SC7 was between markers BARCSOYSSR_13_1140 and BARCSOYSSR_13_1185. The physical map based on 58 recombinant lines confirmed these results. The resistance gene for SC7 was positioned between BARCSOYSSR_13_1140 and BARCSOYSSR_13_1155, while the resistance gene(s) for SC3, SC6, and SC17 were between BARCSOYSSR_13_1128 and BARCSOYSSR_13_1136. We concluded that, there were two dominant resistance genes flanking Rsv1 or one of them at the reported genomic location of Rsv1. One of them (designated as "Rsc-pm") conditions resistance for SC3, SC6, and SC17 and another (designated as "Rsc-ps") confers resistance for SC7. The two tightly linked genes identified in this study would be helpful to cloning of resistance genes and breeding of multiple resistances soybean cultivars to SMV through marker-assisted selection (MAS).

  5. A single mutation in the GSTe2 gene allows tracking of metabolically based insecticide resistance in a major malaria vector.

    Science.gov (United States)

    Riveron, Jacob M; Yunta, Cristina; Ibrahim, Sulaiman S; Djouaka, Rousseau; Irving, Helen; Menze, Benjamin D; Ismail, Hanafy M; Hemingway, Janet; Ranson, Hilary; Albert, Armando; Wondji, Charles S

    2014-02-25

    Metabolic resistance to insecticides is the biggest threat to the continued effectiveness of malaria vector control. However, its underlying molecular basis, crucial for successful resistance management, remains poorly characterized. Here, we demonstrate that the single amino acid change L119F in an upregulated glutathione S-transferase gene, GSTe2, confers high levels of metabolic resistance to DDT in the malaria vector Anopheles funestus. Genome-wide transcription analysis revealed that GSTe2 was the most over-expressed detoxification gene in DDT and permethrin-resistant mosquitoes from Benin. Transgenic expression of GSTe2 in Drosophila melanogaster demonstrated that over-transcription of this gene alone confers DDT resistance and cross-resistance to pyrethroids. Analysis of GSTe2 polymorphism established that the point mutation is tightly associated with metabolic resistance to DDT and its geographical distribution strongly correlates with DDT resistance patterns across Africa. Functional characterization of recombinant GSTe2 further supports the role of the L119F mutation, with the resistant allele being more efficient at metabolizing DDT than the susceptible one. Importantly, we also show that GSTe2 directly metabolizes the pyrethroid permethrin. Structural analysis reveals that the mutation confers resistance by enlarging the GSTe2 DDT-binding cavity, leading to increased DDT access and metabolism. Furthermore, we show that GSTe2 is under strong directional selection in resistant populations, and a restriction of gene flow is observed between African regions, enabling the prediction of the future spread of this resistance. This first DNA-based metabolic resistance marker in mosquitoes provides an essential tool to track the evolution of resistance and to design suitable resistance management strategies.

  6. A single mutation in the GSTe2 gene allows tracking of metabolically based insecticide resistance in a major malaria vector

    Science.gov (United States)

    2014-01-01

    Background Metabolic resistance to insecticides is the biggest threat to the continued effectiveness of malaria vector control. However, its underlying molecular basis, crucial for successful resistance management, remains poorly characterized. Results Here, we demonstrate that the single amino acid change L119F in an upregulated glutathione S-transferase gene, GSTe2, confers high levels of metabolic resistance to DDT in the malaria vector Anopheles funestus. Genome-wide transcription analysis revealed that GSTe2 was the most over-expressed detoxification gene in DDT and permethrin-resistant mosquitoes from Benin. Transgenic expression of GSTe2 in Drosophila melanogaster demonstrated that over-transcription of this gene alone confers DDT resistance and cross-resistance to pyrethroids. Analysis of GSTe2 polymorphism established that the point mutation is tightly associated with metabolic resistance to DDT and its geographical distribution strongly correlates with DDT resistance patterns across Africa. Functional characterization of recombinant GSTe2 further supports the role of the L119F mutation, with the resistant allele being more efficient at metabolizing DDT than the susceptible one. Importantly, we also show that GSTe2 directly metabolizes the pyrethroid permethrin. Structural analysis reveals that the mutation confers resistance by enlarging the GSTe2 DDT-binding cavity, leading to increased DDT access and metabolism. Furthermore, we show that GSTe2 is under strong directional selection in resistant populations, and a restriction of gene flow is observed between African regions, enabling the prediction of the future spread of this resistance. Conclusions This first DNA-based metabolic resistance marker in mosquitoes provides an essential tool to track the evolution of resistance and to design suitable resistance management strategies. PMID:24565444

  7. Cry1F Resistance in Fall Armyworm Spodoptera frugiperda: Single Gene versus Pyramided Bt Maize

    OpenAIRE

    Huang, Fangneng; Qureshi, Jawwad A.; Meagher, Robert L.; Reisig, Dominic D.; Head, Graham P.; Andow, David A.; Ni, Xinzi; Kerns, David; Buntin, G. David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southea...

  8. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    Directory of Open Access Journals (Sweden)

    Fangneng Huang

    Full Text Available Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith, to Cry1F maize (TC 3507 in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293 Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  9. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    Science.gov (United States)

    Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  10. A single-gene cause in 29.5% of cases of steroid-resistant nephrotic syndrome.

    Science.gov (United States)

    Sadowski, Carolin E; Lovric, Svjetlana; Ashraf, Shazia; Pabst, Werner L; Gee, Heon Yung; Kohl, Stefan; Engelmann, Susanne; Vega-Warner, Virginia; Fang, Humphrey; Halbritter, Jan; Somers, Michael J; Tan, Weizhen; Shril, Shirlee; Fessi, Inès; Lifton, Richard P; Bockenhauer, Detlef; El-Desoky, Sherif; Kari, Jameela A; Zenker, Martin; Kemper, Markus J; Mueller, Dominik; Fathy, Hanan M; Soliman, Neveen A; Hildebrandt, Friedhelm

    2015-06-01

    Steroid-resistant nephrotic syndrome (SRNS) is the second most frequent cause of ESRD in the first two decades of life. Effective treatment is lacking. First insights into disease mechanisms came from identification of single-gene causes of SRNS. However, the frequency of single-gene causation and its age distribution in large cohorts are unknown. We performed exon sequencing of NPHS2 and WT1 for 1783 unrelated, international families with SRNS. We then examined all patients by microfluidic multiplex PCR and next-generation sequencing for all 27 genes known to cause SRNS if mutated. We detected a single-gene cause in 29.5% (526 of 1783) of families with SRNS that manifested before 25 years of age. The fraction of families in whom a single-gene cause was identified inversely correlated with age of onset. Within clinically relevant age groups, the fraction of families with detection of the single-gene cause was as follows: onset in the first 3 months of life (69.4%), between 4 and 12 months old (49.7%), between 1 and 6 years old (25.3%), between 7 and 12 years old (17.8%), and between 13 and 18 years old (10.8%). For PLCE1, specific mutations correlated with age of onset. Notably, 1% of individuals carried mutations in genes that function within the coenzyme Q10 biosynthesis pathway, suggesting that SRNS may be treatable in these individuals. Our study results should facilitate molecular genetic diagnostics of SRNS, etiologic classification for therapeutic studies, generation of genotype-phenotype correlations, and the identification of individuals in whom a targeted treatment for SRNS may be available. Copyright © 2015 by the American Society of Nephrology.

  11. Gene flow from single and stacked herbicide-resistant rice (Oryza sativa): modeling occurrence of multiple herbicide-resistant weedy rice.

    Science.gov (United States)

    Dauer, Joseph; Hulting, Andrew; Carlson, Dale; Mankin, Luke; Harden, John; Mallory-Smith, Carol

    2018-02-01

    Provisia™ rice (PV), a non-genetically engineered (GE) quizalofop-resistant rice, will provide growers with an additional option for weed management to use in conjunction with Clearfield ® rice (CL) production. Modeling compared the impact of stacking resistance traits versus single traits in rice on introgression of the resistance trait to weedy rice (also called red rice). Common weed management practices were applied to 2-, 3- and 4-year crop rotations, and resistant and multiple-resistant weedy rice seeds, seedlings and mature plants were tracked for 15 years. Two-year crop rotations resulted in resistant weedy rice after 2 years with abundant populations (exceeding 0.4 weedy rice plants m -2 ) occurring after 7 years. When stacked trait rice was rotated with soybeans in a 3-year rotation and with soybeans and CL in a 4-year rotation, multiple-resistance occurred after 2-5 years with abundant populations present in 4-9 years. When CL rice, PV rice, and soybeans were used in 3- and 4-year rotations, the median time of first appearance of multiple-resistance was 7-11 years and reached abundant levels in 10-15 years. Maintaining separate CL and PV rice systems, in rotation with other crops and herbicides, minimized the evolution of multiple herbicide-resistant weedy rice through gene flow compared to stacking herbicide resistance traits. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  13. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

    Science.gov (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

    2003-07-01

    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  14. Association of single nucleotide polymorphism at position 45 in adiponectin gene with plasma adiponectin level and insulin resistance in obesity

    International Nuclear Information System (INIS)

    Chen Xiaoyu; Li Xisheng; Lin Xiahong; Gao Hongzhi; Li Qiulan; Zha Jinshun

    2012-01-01

    Objective: To explore the association of single nucleotide polymorphism at position 45 (SNP45) in adiponectin gene with plasma adiponectin level and insulin resistance in obesity in Quanzhou area of Fujian province. Methods: Two hundred and forty-eight patients with obesity and 225 normal control subjects were enrolled in this study.Fasting insulin (FINS) were measured by radioimmunoassay and fasting plasma glucose (FPG), total cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) were measured by BECKMAN DXC800 biochemistry analyzer. Body mass index (BMI), waist to hip ratio,homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Plasma adiponectin levels were examined by means of enzyme-linked immunosorbentassy. The adiponectin gene SNP45 was identified by PCR-restriction fragment length polymorphism. Results: (1) Frequencies of GG+GT genotype in obesity group and normal control group were 61% and 44% respectively (χ 2 =14.182, P<0.01), and G allele frequencies were 35% and 25% (χ 2 =10.708, P<0.01). (2) In obesity group,the subjects with SNP45 GG+GT genotype had higher TG and LDL-C levels than those with TT genotype (t=2.604, P<0.01; t=5.507, P<0.01), and had lower adiponectin level than those with TT genotype (t=2.275, P<0.05), and had significantly lower HDL-L level than those with TT genotype (t=10.100, P< 0.01). (3) In normal control group,the subjects with SNP45 GG +GT genotype had significantly lower adiponectin,TG,TC levels than those with TT genotype (t=2.510, P<0.05; t=2.922, P<0.01; t=3.272, P< 0.01). (4) Logistic analysis proved that the SNP45 GG+GT genotype in obesity group was associated with decreased risk of plasma adiponectin level (OR=0.810, 95% CI : 0.673-0.975, P<0.05), and with increased risk of HOMA-IR (OR=1.746, 95% CI : 1.060-2.875, P<0.05). The SNP45 GG+GT genotype in normal control group was associated with increased risk of HOMA-IR (OR=3

  15. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  16. Single nucleotide deletion of cqm1 gene results in the development of resistance to Bacillus sphaericus in Culex quinquefasciatus.

    Science.gov (United States)

    Guo, Qing-yun; Cai, Quan-xin; Yan, Jian-ping; Hu, Xiao-min; Zheng, Da-sheng; Yuan, Zhi-ming

    2013-09-01

    The entomopathogen Bacillus sphaericus is one of the most effective biolarvicides used to control the Culex species of mosquito. The appearance of resistance in mosquitoes to this bacterium, however, remains a threat to its continuous use in integrated mosquito control programs. Previous work showed that the resistance to B. sphaericus in Culex colonies was associated with the absence of the 60-kDa binary toxin receptor (Cpm1/Cqm1), an alpha-glucosidase present in the larval midgut microvilli. In this work, we studied the molecular basis of the resistance developed by Culex quinquefasciatus to B. sphaericus C3-41. The cqm1 genes were cloned from susceptible (CqSL) and resistant (CqRL/C3-41) colonies, respectively. The sequence of the cDNA and genomic DNA derived from CqRL/C3-41 colony differed from that of CqSL one by a one-nucleotide deletion which resulted in a premature stop codon, leading to production of a truncated protein. Recombinant Cqm1S from the CqSL colony expressed in Escherichia coli specifically bound to the Bin toxin and had α-glucosidase activity, whereas the Cqm1R from the CqRL/C3-41 colony, with a deletion of three quarters of the receptor's C-terminal lost its α-glucosidase activity and could not bind to the binary toxin. Immunoblotting experiments showed that Cqm1 was undetectable in CqRL/C3-41 larvae, although the gene was correctly transcribed. Thus, the cqm1R represents a new allele in C. quinquefasciatus that confers resistance to B. sphaericus. Copyright © 2013. Published by Elsevier Ltd.

  17. CCR5 gene disruption via lentiviral vectors expressing Cas9 and single guided RNA renders cells resistant to HIV-1 infection.

    Science.gov (United States)

    Wang, Weiming; Ye, Chaobaihui; Liu, Jingjing; Zhang, Di; Kimata, Jason T; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1.

  18. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  19. Molecular Mapping of Stem Rust Resistance Loci Effective Against the Ug99 Race Group of the Stem Rust Pathogen and Validation of a Single Nucleotide Polymorphism Marker Linked to Stem Rust Resistance Gene Sr28.

    Science.gov (United States)

    Babiker, E M; Gordon, T C; Chao, S; Rouse, M N; Wanyera, R; Acevedo, M; Brown-Guedira, G; Bonman, J M

    2017-02-01

    Wheat landrace PI 177906 has seedling resistance to stem rust caused by Puccinia graminis f. sp. tritici races TTKSK, TTKST, and BCCBC and field resistance to the Ug99 race group. Parents, 140 recombinant inbred lines, and 138 double haploid (DH) lines were evaluated for seedling resistance to races TTKSK and BCCBC. Parents and the DH population were evaluated for field resistance to Ug99 in Kenya. The 90K wheat single nucleotide polymorphism (SNP) genotyping platform was used to genotype the parents and populations. Goodness-of-fit tests indicated that two dominant genes in PI 177906 conditioned seedling resistance to TTKSK. Two major loci for seedling resistance were consistently mapped to the chromosome arms 2BL and 6DS. The BCCBC resistance was mapped to the same location on 2BL as the TTKSK resistance. Using field data from the three seasons, two major QTL were consistently detected at the same regions on 2BL and 6DS. Based on the mapping result, race specificity, and the infection type observed in PI 177906, the TTKSK resistance on 2BL is likely due to Sr28. One SNP marker (KASP_IWB1208) was found to be predictive for the presence of the TTKSK resistance locus on 2BL and Sr28.

  20. l-arginine modulates inflammation and muscle regulatory genes after a single session of resistance exercise in rats.

    Science.gov (United States)

    Morais, S R L; Brito, V G B; Mello, W G; Oliveira, S H P

    2018-02-01

    We investigated the skeletal muscle adaptation to l-arginine supplementation prior to a single session of resistance exercise (RE) during the early phase of muscle repair. Wistar rats were randomly assigned into non-exercised (Control), RE plus vehicle (RE); RE plus l-arginine (RE+L-arg) and RE plus aminoguanidine (RE+AG) groups. Animals received four doses of either vehicle (0.9% NaCl), l-arg (1 g/b.w.), or AG (iNOS inhibitor) (50 mg/b.w.). The animals performed a single RE session until the concentric failure (ladder climbing; 80% overload) and the skeletal muscles were harvested at 0, 8, 24, and 48 hours post-RE. The RE resulted in increased neutrophil infiltrate (24 hours post-RE) (3621 vs 11852; Pl-arginine supplementation attenuates neutrophil infiltration (5622; Pl-arginine supplementation seems to attenuate the resolution of RE-induced muscle inflammation and up-regulates MyoD expression during the early phase of muscle repair. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  2. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  3. A single point mutation in Tomato spotted wilt virus NSs protein is sufficient to overcome Tsw-gene-mediated resistance in pepper.

    Science.gov (United States)

    Almási, Asztéria; Nemes, Katalin; Csömör, Zsófia; Tóbiás, István; Palkovics, László; Salánki, Katalin

    2017-06-01

    The nonstructural protein (NSs) of Tomato spotted wilt virus (TSWV) was previously identified as an avirulence determinant for Tsw-based resistance on pepper. The NSs of wild-type (WT) and resistance-breaking (RB) TSWV strains isolated in Hungary had only two amino acid substitutions (104, 461). We have analysed the ability of the NSs and their point mutant variants to trigger Tsw-mediated hypersensitive responses and RNA silencing suppressor (RSS) activity in patch assays. We identified a single amino acid change at position 104 (T-A) that was responsible for the necrosis induction or loss, while a significant difference was not detected in the RSS activity of the two parental strains. We have successfully complemented the infection of the WT strain on resistant pepper cultivar with the infectious S RNA transcript of the RB strain and the WT-T104A point mutant. Our work provides direct evidence that a single amino acid change can induce an RB phenotype.

  4. Prevalence of Single Nucleotide Polymorphisms in the Plasmodium falciparum Multidrug Resistance Gene (Pfmdr-1) in Korogwe District in Tanzania Before and After Introduction of Artemisinin-Based Combination Therapy

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Ishengoma, Deus S; Mmbando, Bruno P

    2011-01-01

    , which initially may be detected at the molecular level as temporal changes in the frequency of single nucleotide polymorphisms (SNPs) in the Pfmdr-1 gene associated with AL resistance. In Tanzania, 830 Plasmodium falciparum-positive samples collected between 2003 and 2010 were examined for SNPs of Pfmdr.......9). The observed changes may be because of introduction of AL, and if so, this finding gives cause for concern and argues for continued surveillance of these molecular markers.......Abstract. Tanzania implemented artemether-lumefantrine (AL) as the first-line treatment for uncomplicated malaria in November of 2006 because of resistance to sulfadoxine-pyrimethamine. AL remains highly efficacious, but widespread use may soon facilitate emergence of artemisinin tolerance/resistance...

  5. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  6. Complex Interactions between Fungal Avirulence Genes and Their Corresponding Plant Resistance Genes and Consequences for Disease Resistance Management

    Directory of Open Access Journals (Sweden)

    Yohann Petit-Houdenot

    2017-06-01

    Full Text Available During infection, pathogens secrete an arsenal of molecules, collectively called effectors, key elements of pathogenesis which modulate innate immunity of the plant and facilitate infection. Some of these effectors can be recognized directly or indirectly by resistance (R proteins from the plant and are then called avirulence (AVR proteins. This recognition usually triggers defense responses including the hypersensitive response and results in resistance of the plant. R—AVR gene interactions are frequently exploited in the field to control diseases. Recently, the availability of fungal genomes has accelerated the identification of AVR genes in plant pathogenic fungi, including in fungi infecting agronomically important crops. While single AVR genes recognized by their corresponding R gene were identified, more and more complex interactions between AVR and R genes are reported (e.g., AVR genes recognized by several R genes, R genes recognizing several AVR genes in distinct organisms, one AVR gene suppressing recognition of another AVR gene by its corresponding R gene, two cooperating R genes both necessary to recognize an AVR gene. These complex interactions were particularly reported in pathosystems showing a long co-evolution with their host plant but could also result from the way agronomic crops were obtained and improved (e.g., through interspecific hybridization or introgression of resistance genes from wild related species into cultivated crops. In this review, we describe some complex R—AVR interactions between plants and fungi that were recently reported and discuss their implications for AVR gene evolution and R gene management.

  7. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  8. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  9. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  10. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  11. Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2006-01-01

    A total of 302 chloramphenicol-resistant Staphylococcus isolates were screened for the presence of the florfenicol/chloramphenicol resistance genes fexA and cfr and their localization on mobile genetic elements. Of the 114 isolates from humans, only a single Staphylococcus aureus isolate showed an elevated MIC to florfenicol, but did not carry either of the known resistance genes, cfr or fexA. In contrast, 11 of the 188 staphylococci from animal sources were considered florfenicol resistant and carried either cfr (one isolate), fexA (five isolates), or both resistance genes (five isolates). In nine cases we confirmed that these genes were carried on a plasmid. Five different types of plasmids could be differentiated on the basis of their sizes, restriction patterns, and resistance genes. The gene fexA, which has previously been shown to be part of the nonconjugative transposon Tn558, was identified in 10 of the 11 resistant isolates from animals. PCR assays were developed to detect different parts of this transposon as well as their physical linkage. Complete copies of Tn558 were found in five different isolates and shown by inverse PCR to be functionally active. Truncated copies of Tn558, in which the tnpA-tnpB area was in part deleted by the integration of a 4,674-bp segment including the gene cfr and a novel 2,446-bp IS21-like insertion sequence, were seen in a plasmid present in three staphylococcal isolates. PMID:16569824

  12. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 showed resistance at both seedling and adult plant stages. Genetic analysis in F1, F2 and F2:3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR ...

  13. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae

    NARCIS (Netherlands)

    Rozwandowicz, M.; Brouwer, M.S.M.; Fischer, J.; Wagenaar, J.A.; Gonzalez-Zorn, B.; Guerra, B.; Mevius, D.J.; Hordijk, J.

    2018-01-01

    Bacterial antimicrobial resistance (AMR) is constantly evolving and horizontal gene transfer through plasmids plays a major role. The identification of plasmid characteristics and their association with different bacterial hosts provides crucial knowledge that is essential to understand the

  14. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  15. Exploring Antibiotic Resistance Genes and Metal Resistance Genes in Plasmid Metagenomes from Wastewater Treatment Plants

    Directory of Open Access Journals (Sweden)

    An-Dong eLi

    2015-09-01

    Full Text Available Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs database and a metal resistance genes (MRGs database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes and metal resistance genes (23 out of a total 23 types on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs than the activated sludge and the digested sludge metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in wastewater treatment plants could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  16. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  17. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  18. A single gene defect causing claustrophobia

    OpenAIRE

    El-Kordi, Ahmed; Kästner, Anne; Grube, Sabrina; Klugmann, M.; Begemann, Martin; Sperling, Swetlana; Hammerschmidt, K.; Hammer, Christian; Stepniak, Beata; Patzig, J.; Monasterio-Schrader, Patricia; Strenzke, N.; Flügge, G.; Werner, Hauke B.; Pawlak, R.

    2013-01-01

    Claustrophobia, the well-known fear of being trapped in narrow/closed spaces, is often considered a conditioned response to traumatic experience. Surprisingly, we found that mutations affecting a single gene, encoding a stress-regulated neuronal protein, can cause claustrophobia. Gpm6a-deficient mice develop normally and lack obvious behavioral abnormalities. However, when mildly stressed by single-housing, these mice develop a striking claustrophobia-like phenotype, which is not inducible in...

  19. Single gene retrieval from thermally degraded DNA

    Indian Academy of Sciences (India)

    To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...

  20. Single gene retrieval from thermally degraded DNA

    Indian Academy of Sciences (India)

    Unknown

    So, based on known geothermal gra- dients and the depth of ancient remains, one can try to estimate the chances of retrieval of single genes. Acknowledgements. We thank Prof. Gerard Peter Latawiec (University of Read- ing, UK) for his critical reading of the manuscript. This work was supported by the NSFC key project ...

  1. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  2. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  3. Single amino acid substitution in the methyltransferase domain of Paprika mild mottle virus replicase proteins confers the ability to overcome the high temperature-dependent Hk gene-mediated resistance in Capsicum plants.

    Science.gov (United States)

    Matsumoto, Katsutoshi; Johnishi, Kousuke; Hamada, Hiroyuki; Sawada, Hiromasa; Takeuchi, Shigeharu; Kobayashi, Kappei; Suzuki, Kazumi; Kiba, Akinori; Hikichi, Yasufumi

    2009-03-01

    Capsicum plants harboring the Hk gene (Hk) show resistance to Paprika mild mottle virus (PaMMV) at 32 degrees C but not 24 degrees C. To identify the viral elicitor that activates the Hk-mediated resistance, several chimeric viral genomes were constructed between PaMMV and Tobacco mosaic virus-L. Infection patterns of these chimeric viruses in Hk-harboring plants revealed responsibility of PaMMV replicase genes for activation of the Hk-mediated resistance. The comparison of nucleotide sequence of replicase genes between PaMMV and PaHk1, an Hk-resistance-breaking strain of PaMMV, revealed that the adenine-to-uracil substitution at the nucleotide position 721 causes an amino acid change from threonine to serine at the 241st residue in the methyltransferase domain. Introduction of the A721U mutation into the replicase genes of parental PaMMV overcame the Hk resistance at 32 degrees C. The results indicate that Hk-mediated resistance is induced by PaMMV replicase proteins and that methyltransferase domain has a role in this elicitation.

  4. Antibiotic-Resistance Genes in Waste Water.

    Science.gov (United States)

    Karkman, Antti; Do, Thi Thuy; Walsh, Fiona; Virta, Marko P J

    2018-03-01

    Waste water and waste water treatment plants can act as reservoirs and environmental suppliers of antibiotic resistance. They have also been proposed to be hotspots for horizontal gene transfer, enabling the spread of antibiotic resistance genes between different bacterial species. Waste water contains antibiotics, disinfectants, and metals which can form a selection pressure for antibiotic resistance, even in low concentrations. Our knowledge of antibiotic resistance in waste water has increased tremendously in the past few years with advances in the molecular methods available. However, there are still some gaps in our knowledge on the subject, such as how active is horizontal gene transfer in waste water and what is the role of the waste water treatment plant in the environmental resistome? The purpose of this review is to briefly describe some of the main methods for studying antibiotic resistance in waste waters and the latest research and main knowledge gaps on the issue. In addition, some future research directions are proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  6. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  7. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    Science.gov (United States)

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-07

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored.

  8. A single gene defect causing claustrophobia.

    Science.gov (United States)

    El-Kordi, A; Kästner, A; Grube, S; Klugmann, M; Begemann, M; Sperling, S; Hammerschmidt, K; Hammer, C; Stepniak, B; Patzig, J; de Monasterio-Schrader, P; Strenzke, N; Flügge, G; Werner, H B; Pawlak, R; Nave, K-A; Ehrenreich, H

    2013-04-30

    Claustrophobia, the well-known fear of being trapped in narrow/closed spaces, is often considered a conditioned response to traumatic experience. Surprisingly, we found that mutations affecting a single gene, encoding a stress-regulated neuronal protein, can cause claustrophobia. Gpm6a-deficient mice develop normally and lack obvious behavioral abnormalities. However, when mildly stressed by single-housing, these mice develop a striking claustrophobia-like phenotype, which is not inducible in wild-type controls, even by severe stress. The human GPM6A gene is located on chromosome 4q32-q34, a region linked to panic disorder. Sequence analysis of 115 claustrophobic and non-claustrophobic subjects identified nine variants in the noncoding region of the gene that are more frequent in affected individuals (P=0.028). One variant in the 3'untranslated region was linked to claustrophobia in two small pedigrees. This mutant mRNA is functional but cannot be silenced by neuronal miR124 derived itself from a stress-regulated transcript. We suggest that loosing dynamic regulation of neuronal GPM6A expression poses a genetic risk for claustrophobia.

  9. Complex single gene disorders and epilepsy.

    LENUS (Irish Health Repository)

    Merwick, Aine

    2012-09-01

    Epilepsy is a heterogeneous group of disorders, often associated with significant comorbidity, such as intellectual disability and skin disorder. The genetic underpinnings of many epilepsies are still being elucidated, and we expect further advances over the coming 5 years, as genetic technology improves and prices fall for whole exome and whole genome sequencing. At present, there are several well-characterized complex epilepsies associated with single gene disorders; we review some of these here. They include well-recognized syndromes such as tuberous sclerosis complex, epilepsy associated with Rett syndrome, some of the progressive myoclonic epilepsies, and novel disorders such as epilepsy associated with mutations in the PCDH 19 gene. These disorders are important in informing genetic testing to confirm a diagnosis and to permit better understanding of the variability in phenotype-genotype correlation.

  10. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  11. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge.

    Science.gov (United States)

    Jang, Hyun Min; Lee, Jangwoo; Kim, Young Beom; Jeon, Jong Hun; Shin, Jingyeong; Park, Mee-Rye; Kim, Young Mo

    2018-02-01

    This study examines the fate of twenty-three representative antibiotic resistance genes (ARGs) encoding tetracyclines, sulfonamides, quinolones, β-lactam antibiotics, macrolides, florfenicol and multidrug resistance during thermophilic aerobic digestion (TAD) of sewage sludge. The bacterial community, class 1 integrons (intI1) and four metal resistance genes (MRGs) were also quantified to determine the key drivers of changes in ARGs during TAD. At the end of digestion, significant decreases in the quantities of ARGs, MRGs and intI1 as well as 16S rRNA genes were observed. Partial redundancy analysis (RDA) showed that shifts in temperature were the key factors affecting a decrease in ARGs. Shifts in temperature led to decreased amounts of ARGs by reducing resistome and bacterial diversity, rather than by lowering horizontal transfer potential via intI1 or co-resistance via MRGs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Plant resistance genes : their structure, function and evolution

    NARCIS (Netherlands)

    Takken, F.L.W.; Joosten, M.H.A.J.

    2000-01-01

    Plants have developed efficient mechanisms to avoid infection or to mount responses that render them resistant upon attack by a pathogen. One of the best-studied defence mechanisms is based on gene-for-gene resistance through which plants, harbouring specific resistance (R) genes, specifically

  13. Novel Genes Related to Ceftriaxone Resistance Found among Ceftriaxone-Resistant Neisseria gonorrhoeae Strains Selected In Vitro.

    Science.gov (United States)

    Gong, Zijian; Lai, Wei; Liu, Min; Hua, Zhengshuang; Sun, Yayin; Xu, Qingfang; Xia, Yue; Zhao, Yue; Xie, Xiaoyuan

    2016-04-01

    The emergence of ceftriaxone-resistantNeisseria gonorrhoeaeis currently a global public health concern. However, the mechanism of ceftriaxone resistance is not yet fully understood. To investigate the potential genes related to ceftriaxone resistance inNeisseria gonorrhoeae, we subcultured six gonococcal strains with increasing concentrations of ceftriaxone and isolated the strains that became resistant. After analyzing several frequently reported genes involved in ceftriaxone resistance, we found only a single mutation inpenA(A501V). However, differential analysis of the genomes and transcriptomes between pre- and postselection strains revealed many other mutated genes as well as up- and downregulated genes. Transformation of the mutatedpenAgene into nonresistant strains increased the MIC between 2.0- and 5.3-fold, and transformation of mutatedftsXincreased the MIC between 3.3- and 13.3-fold. Genes encoding the ABC transporters FarB, Tfq, Hfq, and ExbB were overexpressed, whilepilM,pilN, andpilQwere downregulated. Furthermore, the resistant strain developed cross-resistance to penicillin and cefuroxime, had an increased biochemical metabolic rate, and presented fitness defects such as prolonged growth time and downregulated PilMNQ. In conclusion, antimicrobial pressure could result in the emergence of ceftriaxone resistance, and the evolution of resistance ofNeisseria gonorrhoeaeto ceftriaxone is a complicated process at both the pretranscriptional and posttranscriptional levels, involving several resistance mechanisms of increased efflux and decreased entry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  14. Gene pyramiding enhances durable blast disease resistance in rice.

    Science.gov (United States)

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  15. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  16. Resistance-Gene Cassettes Associated With Salmonella enterica Genotypes.

    Science.gov (United States)

    Bakhshi, Bita; Ghafari, Mohsen; Pourshafie, Mohammad R; Zarbakhsh, Behnaz; Katouli, Mohammad; Rahbar, Mohammad; Hajia, Masoud; Hosseini-Aliabad, Neda; Boustanshenas, Mina

    2015-01-01

    The epidemiology of salmonellosis is complex because of the diversity and different serotypes of Salmonella enterica (S. enterica) that occur in different reservoirs and geographic incidences. To determine the genotype distribution and resistance-gene content of 2 classes of integron among S. enterica isolates. Thirty-six S. enterica species were isolated and tested for their serological distribution and the resistance-gene contents of 2 classes of integron, as well as for their genetic diversity, using the pulsed-field gel electrophoresis (PFGE) genotyping method. Serogroups E (36.1%) and D (30.5%) were dominant among the isolates. All of the isolates in serogroup D belonged to the serovar enteritidis. The aadA1 gene was found within all resistance-gene cassettes. We observed 4 common and 26 single pulsotypes among the isolates, which indicated a high degree of genetic diversity among the isolates. Using the PulseNet International standard protocol, it was found that these isolates were different from those reported previously in Iran. The presence of a few common and new pulsotypes among the isolates suggests the emergence and spread of new clones of S. enterica in Iran. Copyright© by the American Society for Clinical Pathology (ASCP).

  17. Chromosomal location and molecular mapping of tan spot resistance genes in common wheat (T. aestivum L.)

    OpenAIRE

    Tadesse, Wuletaw

    2008-01-01

    In this study, 75 cultivars highly resistant to tan spot were identified. A positive correlation (r = 0.864; P = 0.001) was found between seedling resistance and adult plant resistance. Inheritance of tan spot resistance was found to be qualitative goverened by single major genes. Three novel resistance genes: tsn3, tsn4 and tsn5 were identified and located on chromosomes 3D, 3A and 3B, respectively. Linkage analysis using SSR markers showed that both the tsn3 (tsn3a, Tsn3b and tsn3c) and ts...

  18. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  19. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    The central dogma of molecular biology states that information is stored in DNA, transcribed to messenger RNA (mRNA) and then translated into proteins. This picture is significantly augmentated when we consider the action of certain proteins in regulating transcription. These transcription factors provide a feedback pathway by which genes can regulate one another's expression as mRNA and then as protein. To review: DNA, RNA and proteins have different functions. DNA is the molecular storehouse of genetic information. When cells divide, the DNA is replicated, so that each daughter cell maintains the same genetic information as the mother cell. RNA acts as a go-between from DNA to proteins. Only a single copy of DNA is present, but multiple copies of the same piece of RNA may be present, allowing cells to make huge amounts of protein. In eukaryotes (organisms with a nucleus), DNA is found in the nucleus only. RNA is copied in the nucleus then translocates(moves) outside the nucleus, where it is transcribed into proteins. Along the way, the RNA may be spliced, i.e., may have pieces cut out. RNA then attaches to ribosomes and is translated to proteins. Proteins are the machinery of the cell other than DNA and RNA, all the complex molecules of the cell are proteins. Proteins are specialized machines, each of which fulfills its own task, which may be transporting oxygen, catalyzing reactions, or responding to extracellular signals, just to name a few. One of the more interesting functions a protein may have is binding directly or indirectly to DNA to perform transcriptional regulation, thus forming a closed feedback loop of gene regulation. The structure of DNA and the central dogma were understood in the 50s; in the early 80s it became possible to make arbitrary modifications to DNA and use cellular machinery to transcribe and translate the resulting genes; more recently, genomes (i.e., the complete DNA sequence) of many organisms have been sequenced. This large

  20. Stacking of blast resistance orthologue genes in susceptible indica rice line improves resistance againstMagnaporthe oryzae.

    Science.gov (United States)

    Kumari, Mandeep; Devanna, B N; Singh, Pankaj Kumar; Rajashekara, H; Sharma, Vinay; Sharma, Tilak Raj

    2018-01-01

    The emergence of new strains of Magnaporthe oryzae ( M. oryzae ) is associated with recurrent failure of resistance response mediated by single resistance ( R ) gene in rice. Therefore, stacking or combining of multiple R genes could improve the durability of resistance against multiple strains of M. oryzae . To achieve this, in the present study, intragenic stacking of rice blast resistance orthologue genes Pi54 and Pi54rh was performed through co-transformation approach. Both these genes were expressed under the control of independent promoters and blast susceptible indica rice line IET17021 was used for transformation. The highly virulent M. oryzae strain Mo-ei-ger1 that could knock down most of the major single blast R genes including Pi54 and exhibiting 89% virulence spectrum was used for phenotypic analysis. The stacked transgenic IET17021 lines ( Pi54  +  Pi54rh ) have shown complete resistance to Mo-ei-ger1 strain in comparison to non-transgenic lines. These two R gene stacked indica transgenic lines could serves as a novel germplasm for rice blast resistance breeding programmes.

  1. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants

    OpenAIRE

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the...

  2. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    Science.gov (United States)

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control.

  3. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  4. Plant agricultural streptomycin formulations do not carry antibiotic resistance genes.

    Science.gov (United States)

    Rezzonico, Fabio; Stockwell, Virginia O; Duffy, Brion

    2009-07-01

    Streptomycin is used in plant agriculture for bacterial disease control, particularly against fire blight in pome fruit orchards. Concerns that this may increase environmental antibiotic resistance have led to bans or restrictions on use. Experience with antibiotic use in animal feeds raises the possible influence of formulation-delivered resistance genes. We demonstrate that agricultural streptomycin formulations do not carry producer organism resistance genes. By using an optimized extraction procedure, Streptomyces 16S rRNA genes and the streptomycin resistance gene strA were not detected in agricultural streptomycin formulations. This diminishes the likelihood for one potential factor in resistance development due to streptomycin use.

  5. Marker mapping and resistance gene associations in soybean

    OpenAIRE

    2011-01-01

    The invention provides novel molecular genetic markers in soybean, where the markers are useful, for example, in the marker-assisted selection of gene alleles that impart disease-resistance, thereby allowing the identification and selection of a disease-resistant plant. The markers also find use in positional cloning of disease-resistance genes.

  6. A Genome-Wide Knockout Screen to Identify Genes Involved in Acquired Carboplatin Resistance

    Science.gov (United States)

    2016-07-01

    result in resistance is demonstrated by the fact that mutations in the DNA mismatch repair genes MLH1 or MSH2 produce resistance due to failure of the...cancer. Genes Dev 2010;24(8):837-52. 18. Fink D, Nebel S, Aebi S, Zheng H, Cenni B, Nehme A, et al. The role of DNA mismatch repair in platinum drug...CBDCA and cDDP, but it remains uncertain whether increased DNA repair capacity is the basis for resistance (17). That the loss of a single gene can

  7. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    Bulked segregant analysis (BSA) and F2 segregation analysis were used for detecting polymorphic primers to locate the gene. The resistance of the NIL Taichung 29*6/Strubes Dickkopf to CYR26 was controlled by a single dominant gene, named YrSD. The primer pair Xbarc59 on 5B was linked to YrSD and the genetic ...

  8. Effect of pressure on electrical resistance of WSe single crystal

    Indian Academy of Sciences (India)

    Effect of pressure on electrical resistance of WSe. 2 ... Pressure dependence of resistance; transition metal dichalcogenides; WSe2 single crys- ... friction and wear. With lamellar solids such as TMDCs, shearing takes place more easily when loads are high. So lamellar solids are well-suited to extreme pressure lubrication.

  9. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    wheat were undertaken. An F2 population derived from the cross of Triticum aestivum cv. WL711 – Ae. caudata introgression line T291-2 with wheat cultivar PBW343 segregated for a single dominant leaf rust resistance gene at the seedling and adult plant stages. Progeny testing in F3 confirmed the introgression of a single ...

  10. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  11. Genetic analysis and molecular mapping of resistance gene to Phakopsora pachyrhizi in soybean germplasm SX6907.

    Science.gov (United States)

    Chen, Haifeng; Zhao, Sheng; Yang, Zhonglu; Sha, Aihua; Wan, Qiao; Zhang, Chanjuan; Chen, Limiao; Yuan, Songli; Qiu, Dezhen; Chen, Shuilian; Shan, Zhihui; Zhou, Xin-an

    2015-04-01

    In this study, Rpp6907, a novel resistance gene/allele to Phakopsora pachyrhizi in soybean, was mapped in a 111.9-kb region, including three NBS-LRR type predicted genes, on chromosome 18. Soybean rust caused by Phakopsora pachyrhizi Sydow has been reported in numerous soybean-growing regions worldwide. The development of rust-resistant varieties is the most economical and environmentally safe method to control the disease. The Chinese soybean germplasm SX6907 is resistant to P. pachyrhizi and exhibits immune reaction compared with the known Rpp genes. These characteristics suggest that SX6907 may carry at least one novel Rpp gene/allele. Three F2 populations from the crosses of SX6907 (resistant) and Tianlong 1, Zhongdou40, and Pudou11 (susceptible) were used to map the Rpp gene. Three resistance responses (immune, red-brown, and tan-colored lesion) were observed from the F2 individuals. The segregation follows a ratio of 1(resistance):2(heterozygous):1(susceptible), indicating that the resistance in SX6907 is controlled by a single incomplete dominant gene (designated as Rpp6907). Results showed that Rpp6907 was mapped on soybean chromosome 18 (molecular linkage group G, MLG G) flanked by simple sequence repeat (SSR) markers SSR24 and SSR40 at a distance of 111.9 kb. Among the ten genes marked within this 111.9-kb region between the two markers, three genes (Glyma18g51930, Glyma18g51950, and Glyma18g51960) are nucleotide-binding site and leucine-rich repeat-type genes. These genes may be involved in recognizing the presence of pathogens and ultimately conferring resistance. Based on resistance spectrum analysis and mapping results, we inferred that Rpp6907 is a novel gene different from Rpp1 in PI 200492, PI 561356, PI 587880A, PI 587886, and PI 594538A, or a new Rpp1-b allele.

  12. [Establishment of 5 resistant ovarian cancer cell strains and expression of resistance-related genes].

    Science.gov (United States)

    Luan, Ying-zi; Li, Li; Li, Dang-rong; Zhang, Wei; Tang, Bu-jian

    2004-06-01

    To investigate expression difference of several drug resistance related genes between sensitive and resistant ovarian carcinoma cells. Cell lines resistant to cisplatin, carboplatin and taxol were established from ovarian carcinoma cell lines of SKOV3 and A2780, and their biological features were detected. The expressions of several genes related to drug resistance were measured by RT-PCR method. (1) The values of resistance index (RI) of resistant cells to relevant drugs were elevated 3 times or more, with different degrees of cross-resistance to several other drugs (RI 2 approximately 20). They grew more slowly than primary cells (Td elongated 1.4 approximately 2.4 times, P 0.05). Intracellular concentrations of relevant drugs were reduced 2.0 approximately 8.5 times in resistant cells (P p53, lung resistance protein-1 (LRP-1), multiple drug resistance related protein-1 (MRP-1) genes were expressed at lower levels in resistant cells than in sensitive cells; while protein kinase C (PKC), topoisomerase (topo) I, and topo II beta were expressed higher, no obvious alterations were found concerning glutathione S transferase-pi (GST-pi), and topo II alpha. Expression of multiple drug resistance-1 (MDR-1) gene was either elevated or reduced in different cells. The expressions of resistance related genes were widely different in different kinds of resistant cells, suggesting more than one pathway leading to resistance transformation. This adds more difficulties for clinical management.

  13. Fine mapping of the Asian soybean rust resistance gene Rpp2 from soybean PI 230970.

    Science.gov (United States)

    Yu, Neil; Kim, Myungsik; King, Zachary R; Harris, Donna K; Buck, James W; Li, Zenglu; Diers, Brian W

    2015-03-01

    Asian soybean rust (ASR) resistance gene Rpp2 has been fine mapped into a 188.1 kb interval on Glyma.Wm82.a2, which contains a series of plant resistance ( R ) genes. Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrihizi Syd. & P. Syd., is a serious disease in major soybean [Glycine max (L.) Merr.] production countries worldwide and causes yield losses up to 75 %. Defining the exact chromosomal position of ASR resistance genes is critical for improving the effectiveness of marker-assisted selection (MAS) for resistance and for cloning these genes. The objective of this study was to fine map the ASR resistance gene Rpp2 from the plant introduction (PI) 230970. Rpp2 was previously mapped within a 12.9-cM interval on soybean chromosome 16. The fine mapping was initiated by identifying recombination events in F2 and F3 plants using simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers that flank the gene. Seventeen recombinant plants were identified and then tested with additional genetic markers saturating the gene region to localize the positions of each recombination. The progeny of these selected plants were tested for resistance to ASR and with SSR markers resulting in the mapping of Rpp2 to a 188.1 kb interval on the Williams 82 reference genome (Glyma.Wm82.a2). Twelve genes including ten toll/interleukin-1 receptor (TIR)-nucleotide-binding site (NBS)-leucine-rich repeat (LRR) genes were predicted to exist in this interval on the Glyma.Wm82.a2.v1 gene model map. Eight of these ten genes were homologous to the Arabidopsis TIR-NBS-LRR gene AT5G17680.1. The identified SSR and SNP markers close to Rpp2 and the candidate gene information presented in this study will be significant resources for MAS and gene cloning research.

  14. Microarray-based Detection of Antibiotic Resisteance Genes in Salmonella

    NARCIS (Netherlands)

    Hoek, van A.H.A.M.; Aarts, H.J.M.

    2008-01-01

    In the presented study, 143 Salmonella isolates belonging to 26 different serovars were screened for the presence of antibiotic resistance genes by microarray analysis. The microarray contained a total of 223 oligonucleotides representing genes encoding for resistance to the following antibiotic

  15. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2016-08-26

    Oryza sativa L.) ... four blast resistance genes Pi1, Pi2, Pi33 and Pi54 in combination were used to study the nature and magnitude of gene action for disease resistance and yield attributes. ... Please take note of this change.

  16. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  17. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR instead of a native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and increased antibiotic resistance. Our result shows that similarity in ...

  18. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  19. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  20. Evolutionary meta-analysis of solanaceous resistance gene and solanum resistance gene analog sequences and a practical framework for cross-species comparisons.

    Science.gov (United States)

    Quirin, Edmund A; Mann, Harpartap; Meyer, Rachel S; Traini, Alessandra; Chiusano, Maria Luisa; Litt, Amy; Bradeen, James M

    2012-05-01

    Cross-species comparative genomics approaches have been employed to map and clone many important disease resistance (R) genes from Solanum species-especially wild relatives of potato and tomato. These efforts will increase with the recent release of potato genome sequence and the impending release of tomato genome sequence. Most R genes belong to the prominent nucleotide binding site-leucine rich repeat (NBS-LRR) class and conserved NBS-LRR protein motifs enable survey of the R gene space of a plant genome by generation of resistance gene analogs (RGA), polymerase chain reaction fragments derived from R genes. We generated a collection of 97 RGA from the disease-resistant wild potato S. bulbocastanum, complementing smaller collections from other Solanum species. To further comparative genomics approaches, we combined all known Solanum RGA and cloned solanaceous NBS-LRR gene sequences, nearly 800 sequences in total, into a single meta-analysis. We defined R gene diversity bins that reflect both evolutionary relationships and DNA cross-hybridization results. The resulting framework is amendable and expandable, providing the research community with a common vocabulary for present and future study of R gene lineages. Through a series of sequence and hybridization experiments, we demonstrate that all tested R gene lineages are of ancient origin, are shared between Solanum species, and can be successfully accessed via comparative genomics approaches.

  1. New resistance genes in the Zea mays: exserohilum turcicum pathosystem

    Directory of Open Access Journals (Sweden)

    Juliana Bernardi Ogliari

    2005-09-01

    Full Text Available The use of monogenic race-specific resistance is widespread for the control of maize (Zea mays L. helminthosporiosis caused by Exserohilum turcicum. Inoculation of 18 Brazilian isolates of E. turcicum onto elite maize lines containing previously identified resistance genes and onto differential near-isogenic lines allowed the identification of new qualitative resistance genes. The inoculation of one selected isolate on differential near-isogenic lines, F1 generations and a BC1F1 population from the referred elite lines enabled the characterization of the resistance spectrum of three new genes, one dominant (HtP, one recessive (rt and a third with non-identified genetic action. Three physiological races of the pathogen were also identified including two with new virulence factors capable of overcoming the resistance of one of the resistance genes identified here (rt.

  2. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21....... Conclusions: The detection of class 1 and 2 integrons and additional antimicrobial resistance genes allowed us to identify the most frequent antimicrobial resistance patterns of Shigella spp. isolated in Brazil....

  3. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis

    OpenAIRE

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D.; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J.; Hern?ndez-Pinz?n, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D. G.; Ward, Eric R.; Steffenson, Brian J.

    2017-01-01

    Key message We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Abstract Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relat...

  4. Transfer of tetracycline resistance gene (tetr) between replicons in ...

    African Journals Online (AJOL)

    Antimicrobial susceptibility testing among the isolates showed resistance to amoxicillin (92%), amoxicillin-clavulanic acid (84.4%), tetracycline (71.4%), gentamycin (43.5%), nalidixic acid (38.3%) and nitrofurantoin (7.9%). E. coli showed the highest resistance to most of the antibiotics. Tetracycline resistance gene was ...

  5. The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

    2012-01-01

    The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...... coli, and MICs for selected antibiotics indicate that the cfr-like genes confer resistance to PhLOPSa (phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A) antibiotics in the same way as the cfr gene. In addition, modification at A2503 on 23S rRNA was confirmed by primer extension...

  6. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  7. Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne

    Directory of Open Access Journals (Sweden)

    Asp Torben

    2007-08-01

    Full Text Available Abstract Background Association analysis is an alternative way for QTL mapping in ryegrass. So far, knowledge on nucleotide diversity and linkage disequilibrium in ryegrass is lacking, which is essential for the efficiency of association analyses. Results 11 expressed disease resistance candidate (R genes including 6 nucleotide binding site and leucine rich repeat (NBS-LRR like genes and 5 non-NBS-LRR genes were analyzed for nucleotide diversity. For each of the genes about 1 kb genomic fragments were isolated from 20 heterozygous genotypes in ryegrass. The number of haplotypes per gene ranged from 9 to 27. On average, one single nucleotide polymorphism (SNP was present per 33 bp between two randomly sampled sequences for the 11 genes. NBS-LRR like gene fragments showed a high degree of nucleotide diversity, with one SNP every 22 bp between two randomly sampled sequences. NBS-LRR like gene fragments showed very high non-synonymous mutation rates, leading to altered amino acid sequences. Particularly LRR regions showed very high diversity with on average one SNP every 10 bp between two sequences. In contrast, non-NBS LRR resistance candidate genes showed a lower degree of nucleotide diversity, with one SNP every 112 bp. 78% of haplotypes occurred at low frequency ( Conclusion Substantial LD decay was found within a distance of 500 bp for most resistance candidate genes in this study. Hence, LD based association analysis is feasible and promising for QTL fine mapping of resistance traits in ryegrass.

  8. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  9. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  resistance genes ( bla GES and bla OXA ) were overexpressed in all hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  10. Generation of novel resistance genes using mutation and targeted gene editing

    Science.gov (United States)

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a "dream technology" to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by ...

  11. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  12. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and ... to be taken into account when exogenous transgenes are expressed in Frankia cells. [Kucho K, Kakoi K, ..... gene coding for the green fluorescent protein (GFP) is a versatile ...

  13. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  14. Linking microbial community structure and function to characterize antibiotic resistant bacteria and antibiotic resistant genes from cattle feces

    Science.gov (United States)

    There is widespread interest in monitoring the development of antibiotic resistant bacteria and antibiotic resistance genes in agriculturally impacted environments, however little is known about the relationships between bacterial community structure, and antibiotic resistance gene profiles. Cattl...

  15. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  16. Mobile antibiotic resistance – the spread of genes determining the resistance of bacteria through food products

    Directory of Open Access Journals (Sweden)

    Jolanta Godziszewska

    2016-07-01

    Full Text Available In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  17. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    Science.gov (United States)

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  18. Effect of pressure on electrical resistance of WSe single crystal

    Indian Academy of Sciences (India)

    Abstract. The results of electrical resistance measurements under pressure on single crystals of. WSe2 are reported. Measurements up to 8.5 GPa are carried out using Bridgman anvil set up and beyond it using diamond anvil cell (DAC) up to a pressure of 27 GPa. There is no clear indication of any phase transition till the ...

  19. Resistivity distribution of silicon single crystals using codoping

    Science.gov (United States)

    Wang, Jong Hoe

    2005-07-01

    Numerous studies including continuous Czochralski method and double crucible technique have been reported on the control of macroscopic axial resistivity distribution in bulk crystal growth. The simple codoping method for improving the productivity of silicon single-crystal growth by controlling axial specific resistivity distribution was proposed by Wang [Jpn. J. Appl. Phys. 43 (2004) 4079]. Wang [J. Crystal Growth 275 (2005) e73] demonstrated using numerical analysis and by experimental results that the axial specific resistivity distribution can be modified in melt growth of silicon crystals and relatively uniform profile is possible by B-P codoping method. In this work, the basic characteristic of 8 in silicon single crystal grown using codoping method is studied and whether proposed method has advantage for the silicon crystal growth is discussed.

  20. Structural perfection and residual electric resistance of tungsten single crystals

    International Nuclear Information System (INIS)

    Tagirova, D.M.; Dyakina, V.P.; Startsev, V.E.; Esin, V.O.

    1997-01-01

    A study was made into residual relative resistance (RRR) and structural perfection (SP) of tungsten single crystals, grown by electron beam zone melting using seeding crystals of several orientations, namely, , , , . The single crystals were of 99.98 and 99.9995 wt.% purity. The RRR value is found to depend on crystallographic orientation of an axis of crystal growth and to correlate with SP. Single crystals of different purity are differ in the nature of orientational dependences. It is shown that the correlation between RRR and SP of crystals is mainly due to conduction electron scattering by subgrain boundaries (internal size effect)

  1. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  2. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  3. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Science.gov (United States)

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  4. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    OpenAIRE

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) versus their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp.) and thermophilic (Iso T10- a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts ...

  5. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically...... examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional......). Fifteen of 37 inserts harbored resistance genes that shared resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance...

  6. Candidate Gene Sequence Analyses toward Identifying Rsv3-Type Resistance to Soybean Mosaic Virus

    Directory of Open Access Journals (Sweden)

    N. R. Redekar

    2016-07-01

    Full Text Available is one of three genetic loci conferring strain-specific resistance to (SMV. The locus has been mapped to a 154-kb region on chromosome 14, containing a cluster of five nucleotide-binding leucine-rich repeat (NB-LRR resistance genes. High sequence similarity between the candidate genes challenges fine mapping of the locus. Among the five, Glyma14g38533 showed the highest transcript abundance in 1 to 3 h of SMV-G7 inoculation. Comparative sequence analyses were conducted with the five candidate NB-LRR genes from susceptible (-type soybean [ (L. Merr.] cultivar Williams 82, resistant (-type cultivar Hwangkeum, and resistant lines L29 and RRR. Sequence comparisons revealed that Glyma14g38533 had far more polymorphisms than the other candidate genes. Interestingly, Glyma14g38533 gene from -type lines exhibited 150 single-nucleotide polymorphism (SNP and six insertion–deletion (InDel markers relative to -type line, Furthermore, the polymorphisms identified in three -type lines were highly conserved. Several polymorphisms were validated in 18 -type resistant and six -type susceptible lines and were found associated with their disease response. The majority of the polymorphisms were located in LRR domain encoding region, which is involved in pathogen recognition via protein–protein interactions. These findings associating Glyma14g38533 with -type resistance to SMV suggest it is the most likely candidate gene for .

  7. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  8. Single gene retrieval from thermally degraded DNA

    Indian Academy of Sciences (India)

    Unknown

    Nuclear gene sequences from a late pleistoncene sloth copro- lite; Curr. Biol. 13 1150–1152. Poinar H N, HÖss M, Bada J L and Pääbo S 1996 Amino acid racemization and the preservation of ancient DNA; Science. 272 864–867. Reiners P W, Brady R, Farley K A, Fryxell J E, Wernicke B and Lux D 2000 Helium and argon ...

  9. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  10. Detection of bacterial blight resistance genes in basmati rice landraces.

    Science.gov (United States)

    Ullah, I; Jamil, S; Iqbal, M Z; Shaheen, H L; Hasni, S M; Jabeen, S; Mehmood, A; Akhter, M

    2012-07-20

    Aromatic basmati rice is vulnerable to bacterial blight disease. Genes conferring resistance to bacterial blight have been identified in coarse rice; however, their incorporation into basmati varieties compromises the prized basmati aroma. We identified bacterial blight resistance genes Xa4, xa5, Xa7, and xa13 in 52 basmati landraces and five basmati cultivars using PCR markers. The Xa7 gene was found to be the most prevalent among the cultivars and landraces. The cultivars Basmati-385 and Basmati-2000 also contained the Xa4 gene; however, xa5 and xa13 were confined to landraces only. Ten landraces were found to have multiple resistance genes. Landraces Basmati-106, Basmati-189 and Basmati-208 contained Xa4 and Xa7 genes. Whereas, landraces Basmati-122, Basmati-427, Basmati-433 were observed to have xa5 and Xa7 genes. Landraces Basmati-48, Basmati-51A, Basmati-334, and Basmati-370A possessed Xa7 and xa13 genes. The use of landraces containing recessive genes xa5 and xa13 as donor parents in hybridization with cultivars Basmati-385 and Basmati-2000, which contain the genes Xa4 and Xa7, will expedite efforts to develop bacterial blight-resistant basmati rice cultivars through marker assisted selection, based on a pyramiding approach, without compromising aroma and grain quality.

  11. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  12. High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species.

    Science.gov (United States)

    Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å

    2017-07-01

    Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  13. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar

    Science.gov (United States)

    Das, Gitishree; Rao, G. J. N.

    2015-01-01

    Severe yield loss due to various biotic stresses like bacterial blight (BB), gall midge (insect) and Blast (disease) and abiotic stresses like submergence and salinity are a serious constraint to the rice productivity throughout the world. The most effective and reliable method of management of the stresses is the enhancement of host resistance, through an economical and environmentally friendly approach. Through the application of marker assisted selection (MAS) technique, the present study reports a successful pyramidization of genes/QTLs to confer resistance/tolerance to blast (Pi2, Pi9), gall Midge (Gm1, Gm4), submergence (Sub1), and salinity (Saltol) in a released rice variety CRMAS2621-7-1 as Improved Lalat which had already incorporated with three BB resistance genes xa5, xa13, and Xa21 to supplement the Xa4 gene present in Improved Lalat. The molecular analysis revealed clear polymorphism between the donor and recipient parents for all the markers that are tagged to the target traits. The conventional backcross breeding approach was followed till BC3F1 generation and starting from BC1F1 onwards, marker assisted selection was employed at each step to monitor the transfer of the target alleles with molecular markers. The different BC3F1s having the target genes/QTLs were inter crossed to generate hybrids with all 10 stress resistance/tolerance genes/QTLs into a single plant/line. Homozygous plants for resistance/tolerance genes in different combinations were recovered. The BC3F3 lines were characterized for their agronomic and quality traits and promising progeny lines were selected. The SSR based background selection was done. Most of the gene pyramid lines showed a high degree of similarity to the recurrent parent for both morphological, grain quality traits and in SSR based background selection. Out of all the gene pyramids tested, two lines had all the 10 resistance/tolerance genes and showed adequate levels of resistance/tolerance against the five target

  14. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  15. Genetic characterization and fine mapping of the novel Phytophthora resistance gene in a Chinese soybean cultivar.

    Science.gov (United States)

    Zhang, Jiqing; Xia, Changjian; Wang, Xiaoming; Duan, Canxing; Sun, Suli; Wu, Xiaofei; Zhu, Zhendong

    2013-06-01

    Phytophthora root rot (PRR), caused by Phytophthora sojae Kaufmann & Gerdemann, is one of the most destructive diseases of soybean [Glycine max (L.) Merr.]. Deployment of resistance genes is the most economical and effective way of controlling the disease. The soybean cultivar 'Yudou 29' is resistant to many P. sojae isolates in China. The genetic basis of the resistance in 'Yudou 29' was elucidated through an inheritance study and molecular mapping. In response to 25 P. sojae isolates, 'Yudou 29' displayed a new resistance reaction pattern distinct from those of differentials carrying known Rps genes. A population of 214 F2:3 families from a cross between 'Jikedou 2' (PRR susceptible) and 'Yudou 29' was used for Rps gene mapping. The segregation fit a ratio of 1:2:1 for resistance:segregation:susceptibility within this population, indicating that resistance in 'Yudou 29' is controlled by a single dominant gene. This gene was temporarily named RpsYD29 and mapped on soybean chromosome 03 (molecular linkage group N; MLG N) flanked by SSR markers SattWM82-50 and Satt1k4b at a genetic distance of 0.5 and 0.2 cM, respectively. Two nucleotide binding site-leucine rich repeat (NBS-LRR) type genes were detected in the 204.8 kb region between SattWM82-50 and Satt1k4b. These two genes showed high similarity to Rps1k in amino acid sequence and could be candidate genes for PRR resistance. Based on the phenotype reactions and the physical position on soybean chromosome 03, RpsYD29 might be a novel allele at, or a novel gene tightly linked to, the Rps1 locus.

  16. Antimicrobial Peptide Resistance Genes in the Plant Pathogen Dickeya dadantii.

    Science.gov (United States)

    Pandin, Caroline; Caroff, Martine; Condemine, Guy

    2016-11-01

    Modification of teichoic acid through the incorporation of d-alanine confers resistance in Gram-positive bacteria to antimicrobial peptides (AMPs). This process involves the products of the dltXABCD genes. These genes are widespread in Gram-positive bacteria, and they are also found in a few Gram-negative bacteria. Notably, these genes are present in all soft-rot enterobacteria (Pectobacterium and Dickeya) whose dltDXBAC operons have been sequenced. We studied the function and regulation of these genes in Dickeya dadantii dltB expression was induced in the presence of the AMP polymyxin. It was not regulated by PhoP, which controls the expression of some genes involved in AMP resistance, but was regulated by ArcA, which has been identified as an activator of genes involved in AMP resistance. However, arcA was not the regulator responsible for polymyxin induction of these genes in this bacterium, which underlines the complexity of the mechanisms controlling AMP resistance in D. dadantii Two other genes involved in resistance to AMPs have also been characterized, phoS and phoH dltB, phoS, phoH, and arcA but not dltD mutants were more sensitive to polymyxin than the wild-type strain. Decreased fitness of the dltB, phoS, and phoH mutants in chicory leaves indicates that their products are important for resistance to plant AMPs. Gram-negative bacteria can modify their lipopolysaccharides (LPSs) to resist antimicrobial peptides (AMPs). Soft-rot enterobacteria (Dickeya and Pectobacterium spp.) possess homologues of the dlt genes in their genomes which, in Gram-positive bacteria, are involved in resistance to AMPs. In this study, we show that these genes confer resistance to AMPs, probably by modifying LPSs, and that they are required for the fitness of the bacteria during plant infection. Two other new genes involved in resistance were also analyzed. These results show that bacterial resistance to AMPs can occur in bacteria through many different mechanisms that need to be

  17. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  18. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  19. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  20. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  1. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  2. Occurrence and reservoirs of antibiotic resistance genes in the environment

    NARCIS (Netherlands)

    Seveno, N.; Kallifidas, D.; Smalla, K.; Elsas, van J.D.; Collard, J.M.; Karagouni, A.; Wellington, E.M.H.

    2002-01-01

    Antibiotic resistance genes have become highly mobile since the development of antibiotic chemotherapy. A considerable body of evidence exists proving the link between antibiotic use and the significant increase in drug-resistant human bacterial pathogens. The application of molecular detection and

  3. Identification of bacterial blight resistance genes Xa4 in Pakistani ...

    African Journals Online (AJOL)

    Identification of bacterial blight resistance genes Xa4 in Pakistani rice germplasm using PCR. M Arif, M Jaffar, M Babar, MA Sheikh, S Kousar, A Arif, Y Zafar. Abstract. Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most ...

  4. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  5. gene effects for resistance to groundnut rossette disease in exotic ...

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... Opposite and significant signs of dominance [d] and dominance × dominance [l] components indicated the importance of duplicate epitasis in the latter crosses in the control of GRD resistance, which revealed a complex nature of inheritance of GRD resistance. Key Words: Arachis hypogaea, gene effects, ...

  6. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  7. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  8. Gene pyramiding enhances durable blast disease resistance in rice

    OpenAIRE

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-01

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resista...

  9. Fecal Microbial Transplants Reduce Antibiotic-resistant Genes in Patients With Recurrent Clostridium difficile Infection.

    Science.gov (United States)

    Millan, Braden; Park, Heekuk; Hotte, Naomi; Mathieu, Olivier; Burguiere, Pierre; Tompkins, Thomas A; Kao, Dina; Madsen, Karen L

    2016-06-15

    Recurrent Clostridium difficile infection (RCDI) is associated with repeated antibiotic treatment and the enhanced growth of antibiotic-resistant microbes. This study tested the hypothesis that patients with RCDI would harbor large numbers of antibiotic-resistant microbes and that fecal microbiota transplantation (FMT) would reduce the number of antibiotic-resistant genes. In a single center study, patients with RCDI (n = 20) received FMT from universal donors via colonoscopy. Stool samples were collected from donors (n = 3) and patients prior to and following FMT. DNA was extracted and shotgun metagenomics performed. Results as well as assembled libraries from a healthy cohort (n = 87) obtained from the Human Microbiome Project were aligned against the NCBI bacterial taxonomy database and the Comprehensive Antibiotic Resistance Database. Results were corroborated through a DNA microarray containing 354 antibiotic resistance (ABR) genes. RCDI patients had a greater number and diversity of ABR genes compared with donors and healthy controls. Beta-lactam, multidrug efflux pumps, fluoroquinolone, and antibiotic inactivation ABR genes were increased in RCDI patients, although donors primarily had tetracycline resistance. RCDI patients were dominated by Proteobacteria with Escherichia coli and Klebsiella most prevalent. FMT resulted in a resolution of symptoms that correlated directly with a decreased number and diversity of ABR genes and increased Bacteroidetes and Firmicutes with reduced Proteobacteria. ABR gene profiles were maintained in recipients for up to a year following FMT. RCDI patients have increased numbers of antibiotic-resistant organisms. FMT is effective in the eradication of pathogenic antibiotic-resistant organisms and elimination of ABR genes. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  10. MetaCherchant: analyzing genomic context of antibiotic resistance genes in gut microbiota.

    Science.gov (United States)

    Olekhnovich, Evgenii I; Vasilyev, Artem T; Ulyantsev, Vladimir I; Kostryukova, Elena S; Tyakht, Alexander V

    2018-02-01

    Antibiotic resistance is an important global public health problem. Human gut microbiota is an accumulator of resistance genes potentially providing them to pathogens. It is important to develop tools for identifying the mechanisms of how resistance is transmitted between gut microbial species and pathogens. We developed MetaCherchant-an algorithm for extracting the genomic environment of antibiotic resistance genes from metagenomic data in the form of a graph. The algorithm was validated on a number of simulated and published datasets, as well as applied to new 'shotgun' metagenomes of gut microbiota from patients with Helicobacter pylori who underwent antibiotic therapy. Genomic context was reconstructed for several major resistance genes. Taxonomic annotation of the context suggests that within a single metagenome, the resistance genes can be contained in genomes of multiple species. MetaCherchant allows reconstruction of mobile elements with resistance genes within the genomes of bacteria using metagenomic data. Application of MetaCherchant in differential mode produced specific graph structures suggesting the evidence of possible resistance gene transmission within a mobile element that occurred as a result of the antibiotic therapy. MetaCherchant is a promising tool giving researchers an opportunity to get an insight into dynamics of resistance transmission in vivo basing on metagenomic data. Source code and binaries are freely available for download at https://github.com/ctlab/metacherchant. The code is written in Java and is platform-independent. ulyantsev@rain.ifmo.ru. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  11. Fine mapping of RYMV3: a new resistance gene to Rice yellow mottle virus from Oryza glaberrima.

    Science.gov (United States)

    Pidon, Hélène; Ghesquière, Alain; Chéron, Sophie; Issaka, Souley; Hébrard, Eugénie; Sabot, François; Kolade, Olufisayo; Silué, Drissa; Albar, Laurence

    2017-04-01

    A new resistance gene against Rice yellow mottle virus was identified and mapped in a 15-kb interval. The best candidate is a CC-NBS-LRR gene. Rice yellow mottle virus (RYMV) disease is a serious constraint to the cultivation of rice in Africa and selection for resistance is considered to be the most effective management strategy. The aim of this study was to characterize the resistance of Tog5307, a highly resistant accession belonging to the African cultivated rice species (Oryza glaberrima), that has none of the previously identified resistance genes to RYMV. The specificity of Tog5307 resistance was analyzed using 18 RYMV isolates. While three of them were able to infect Tog5307 very rapidly, resistance against the others was effective despite infection events attributed to resistance-breakdown or incomplete penetrance of the resistance. Segregation of resistance in an interspecific backcross population derived from a cross between Tog5307 and the susceptible Oryza sativa variety IR64 showed that resistance is dominant and is controlled by a single gene, named RYMV3. RYMV3 was mapped in an approximately 15-kb interval in which two candidate genes, coding for a putative transmembrane protein and a CC-NBS-LRR domain-containing protein, were annotated. Sequencing revealed non-synonymous polymorphisms between Tog5307 and the O. glaberrima susceptible accession CG14 in both candidate genes. An additional resistant O. glaberrima accession, Tog5672, was found to have the Tog5307 genotype for the CC-NBS-LRR gene but not for the putative transmembrane protein gene. Analysis of the cosegregation of Tog5672 resistance with the RYMV3 locus suggests that RYMV3 is also involved in Tog5672 resistance, thereby supporting the CC-NBS-LRR gene as the best candidate for RYMV3.

  12. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

    Science.gov (United States)

    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

    2015-01-01

    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  13. Characterization of genomic sequence of a drought-resistant gene ...

    Indian Academy of Sciences (India)

    Characterization of genomic sequence of a drought-resistant gene. TaSnRK2.7 in wheat species. HONG YING ZHANG1,2, WEI LI3, XIN GUO MAO1 and RUI LIAN JING1∗. 1The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science,. Chinese Academy of Agricultural Sciences, ...

  14. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  15. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Cereal cyst nematode (CCN) (Heterodera avenae Woll.) is one of the most economically damaging endoparasite pests of wheat worldwide. We isolated and characterized a novel cereal CCN resistance candidate gene, CreV8, from Aegilops variabilis (2n = 28, UUSvSv). The gene was 3,568 bp long and.

  16. Chloroplast genes in Chlamydomonas affecting organelle ribosomes. Genetic and biochemical analysis of analysis of antibiotic-resistant mutants at several gene loci.

    Science.gov (United States)

    Conde, M F; Boynton, J E; Gillham, N W; Harris, E H; Tingle, C L; Wang, W L

    1975-10-03

    Six chloroplast gene mutants of Chlamydomonas reinhardtii resistant to spectinomycin, erythromycin, or streptomycin have been assessed for antibiotic resistance of their chloroplast ribosomes. Four of these mutations clearly confer high levels of antibiotic resistance on the chloroplast ribosomes both in vivo. Although one mutant resistant to streptomycin and one resistant to spectinomycin have chloroplast ribosomes as sensitive to antibiotics as those of wild type in vivo, these mutations can be shown to alter the wildtype sensitivity of chloroplast ribosomes in polynucleotide-directed amino acid incorporation in vitro. Genetic analysis of these six chloroplast mutants and three similar mutants (Sager, 1972), two of which have been shown to affect chloroplast ribosomes (Mets and Bogorad, 1972; Schlanger and Sager, 1974), indicates that in Chlamydomonas at least three chloroplast gene loci can affect streptomycin resistance of chloroplast ribosomes and that two can affect erythromycin resistance. The three spectinomycin-resistant mutants examined appear to be alleles at a single chloroplast gene locus, but may represent mutations at two different sites within the same gene. Unlike wild type, the streptomycin and spectinomycin resistant mutants which have chloroplast ribosomes sensitive to antibiotics in vivo, grow well in the presence of antibiotic by respiring exogenously supplied acetate as a carbon source, and have normal levels of cytochrome oxidase activity and cyanide-sensitive respiration. We conclude that mitochondrial protein synthesis in these mutants is resistant to these antibiotics, whereas in wild type it is sensitive. To explain the behavior of these two chloroplast gene mutants as well as other one-step mutants which are resistant both photosynthetically and when respiring acetate in the dark, we have postulated that a mutation in a single chloroplast gene may result in alteration of both chloroplast and mitochondrial ribosomes. Mitochondrial

  17. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  18. A hybrid Bacillus thuringiensis delta-endotoxin gene gives resistance against a coleopteran and a lepidopteran pest in transgenic potato

    NARCIS (Netherlands)

    Naimov, S.; Dukiandjiev, S.; Maagd, de R.A.

    2003-01-01

    Expression of Bacillus thuringiensis delta-endotoxins has proven to be a successful strategy for obtaining insect resistance in transgenic plants. Drawbacks of expression of a single resistance gene are the limited target spectrum and the potential for rapid adaptation of the pest. Hybrid toxins

  19. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  20. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  1. Pl(17) is a novel gene independent of known downy mildew resistance genes in the cultivated sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J

    2015-04-01

    Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.

  2. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Interspecies gene transfer provides soybean resistance to a fungal pathogen.

    Science.gov (United States)

    Langenbach, Caspar; Schultheiss, Holger; Rosendahl, Martin; Tresch, Nadine; Conrath, Uwe; Goellner, Katharina

    2016-02-01

    Fungal pathogens pose a major challenge to global crop production. Crop varieties that resist disease present the best defence and offer an alternative to chemical fungicides. Exploiting durable nonhost resistance (NHR) for crop protection often requires identification and transfer of NHR-linked genes to the target crop. Here, we identify genes associated with NHR of Arabidopsis thaliana to Phakopsora pachyrhizi, the causative agent of the devastating fungal disease called Asian soybean rust. We transfer selected Arabidopsis NHR-linked genes to the soybean host and discover enhanced resistance to rust disease in some transgenic soybean lines in the greenhouse. Interspecies NHR gene transfer thus presents a promising strategy for genetically engineered control of crop diseases. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S. [National Center for Biotechnology Information; Omelchenko, Marina [National Center for Biotechnology Information; Gaidamakova, Elena [Uniformed Services University of the Health Sciences (USUHS); Matrosova, Vera [Uniformed Services University of the Health Sciences (USUHS); Vasilenko, Alexander [Uniformed Services University of the Health Sciences (USUHS); Zhai, Min [Uniformed Services University of the Health Sciences (USUHS); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Kim, Edwin [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pitluck, Samual [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Tom [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lai, Barry [Argonne National Laboratory (ANL); Ravel, Bruce [Argonne National Laboratory (ANL); Kemner, Kenneth M [Argonne National Laboratory (ANL); Wolf, Yuri [National Center for Biotechnology Information; Sorokin, Alexei [Genetique Microbienne; Gerasimova, Anna [Research Institute of Genetics and Selection of Industrial Microorganisms, Mosco; Gelfand, Mikhail [Moscow State University; Fredrickson, James K [Pacific Northwest National Laboratory (PNNL); Koonin, Eugene [National Center for Biotechnology Information; Daly, Michael [Uniformed Services University of the Health Sciences (USUHS)

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  5. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  6. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Deinococcus geothermalis: the pool of extreme radiation resistance genes shrinks.

    Directory of Open Access Journals (Sweden)

    Kira S Makarova

    2007-09-01

    Full Text Available Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR, ultraviolet light (UV and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and

  8. Emergence of azole resistance in Aspergillus fumigatus and spread of a single resistance mechanism.

    Directory of Open Access Journals (Sweden)

    Eveline Snelders

    2008-11-01

    Full Text Available BACKGROUND: Resistance to triazoles was recently reported in Aspergillus fumigatus isolates cultured from patients with invasive aspergillosis. The prevalence of azole resistance in A. fumigatus is unknown. We investigated the prevalence and spread of azole resistance using our culture collection that contained A. fumigatus isolates collected between 1994 and 2007. METHODS AND FINDINGS: We investigated the prevalence of itraconazole (ITZ resistance in 1,912 clinical A. fumigatus isolates collected from 1,219 patients in our University Medical Centre over a 14-y period. The spread of resistance was investigated by analyzing 147 A. fumigatus isolates from 101 patients, from 28 other medical centres in The Netherlands and 317 isolates from six other countries. The isolates were characterized using phenotypic and molecular methods. The electronic patient files were used to determine the underlying conditions of the patients and the presence of invasive aspergillosis. ITZ-resistant isolates were found in 32 of 1,219 patients. All cases were observed after 1999 with an annual prevalence of 1.7% to 6%. The ITZ-resistant isolates also showed elevated minimum inhibitory concentrations of voriconazole, ravuconazole, and posaconazole. A substitution of leucine 98 for histidine in the cyp51A gene, together with two copies of a 34-bp sequence in tandem in the gene promoter (TR/L98H, was found to be the dominant resistance mechanism. Microsatellite analysis indicated that the ITZ-resistant isolates were genetically distinct but clustered. The ITZ-sensitive isolates were not more likely to be responsible for invasive aspergillosis than the ITZ-resistant isolates. ITZ resistance was found in isolates from 13 patients (12.8% from nine other medical centres in The Netherlands, of which 69% harboured the TR/L98H substitution, and in six isolates originating from four other countries. CONCLUSIONS: Azole resistance has emerged in A. fumigatus and might be more

  9. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1997-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enterica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3 ")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-l beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  10. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1998-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enteritica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-1 beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  11. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  12. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  13. Resistance to rust ( Puccinia psidii Winter) in eucalyptus: mode of inheritance and mapping of a major gene with RAPD markers.

    Science.gov (United States)

    Junghans, D T; Alfenas, A C; Brommonschenkel, S H; Oda, S; Mello, E J; Grattapaglia, D

    2003-12-01

    Rust is one of the most-damaging eucalypt diseases in Brazil and is considered a potential threat to eucalypt plantations worldwide. To determine the mode of inheritance of resistance in the Eucalyptus grandis- Puccinia psidii pathosystem, ten full-sib families, generated from crosses between susceptible and resistant trees, were inoculated with a single-pustule isolate of the pathogen and rust severity was scored. The observed segregation ratios in segregating families suggested major gene control of rust resistance, although clearly incomplete penetrance, variable expressivity and minor genes are also involved in the global rust-resistance response. To identify markers linked to the resistance locus, screening of RAPD polymorphisms was conducted using bulked segregant analysis in a large full-sib family. A linkage group was built around the Ppr1 gene ( P. psidii resistance gene 1) encompassing six RAPD markers, with a genetic window spanning 5 cM with the two most-closely linked flanking markers. Besides these two flanking markers, RAPD marker AT9/917 co-segregated with Ppr1 without a single recombinant in 994 meioses. This tightly linked marker should prove useful for marker-assisted introgression and will provide an initial lead for a positional cloning effort of this resistance allele. This is the first report of a disease resistance gene identified in Eucalyptus, and one of the few examples of the involvement of a major gene in a non-coevolved pathosystem.

  14. Streptomycin Resistance and Lineage-Specific Polymorphisms in Mycobacterium tuberculosis gidB Gene

    Science.gov (United States)

    Spies, Fernanda S.; Ribeiro, Andrezza W.; Ramos, Daniela F.; Ribeiro, Marta O.; Martin, Anandi; Palomino, Juan Carlos; Rossetti, Maria Lucia R.; da Silva, Pedro Eduardo A.; Zaha, Arnaldo

    2011-01-01

    Mutations related to streptomycin resistance in the rpsL and rrs genes are well known and can explain about 70% of this phenotypic resistance. Recently, the gidB gene was found to be associated with low-level streptomycin resistance in Mycobacterium tuberculosis. Mutations in gidB have been reported with high frequency, and this gene appears to be very polymorphic, with frameshift and point mutations occurring in streptomycin-susceptible and streptomycin-resistant strains. In this study, mutations in gidB appeared in 27% of streptomycin-resistant strains that contained no mutations in the rpsL or rrs genes, and they were associated with low-level streptomycin resistance. However, the association of certain mutations in gidB with streptomycin resistance needs to be further investigated, as we also found mutations in gidB in streptomycin-susceptible strains. This occurred only when the strain was resistant to rifampin and isoniazid. Two specific mutations appeared very frequently in this and other studies of streptomycin-susceptible and -resistant strains; these mutations were not considered related to streptomycin resistance, but as a polymorphism. We stratified the strains according to the different phylogenetic lineages and showed that the gidB16 polymorphism (16G allele) was exclusively present in the Latin American-Mediterranean (LAM) genotype, while the gidB92 polymorphism (92C allele) was associated with the Beijing lineage in another population. In the sample studied, the two characterized single-nucleotide polymorphisms could distinguish LAM and Beijing lineages from the other lineages. PMID:21593257

  15. Streptomycin resistance and lineage-specific polymorphisms in Mycobacterium tuberculosis gidB gene.

    Science.gov (United States)

    Spies, Fernanda S; Ribeiro, Andrezza W; Ramos, Daniela F; Ribeiro, Marta O; Martin, Anandi; Palomino, Juan Carlos; Rossetti, Maria Lucia R; da Silva, Pedro Eduardo A; Zaha, Arnaldo

    2011-07-01

    Mutations related to streptomycin resistance in the rpsL and rrs genes are well known and can explain about 70% of this phenotypic resistance. Recently, the gidB gene was found to be associated with low-level streptomycin resistance in Mycobacterium tuberculosis. Mutations in gidB have been reported with high frequency, and this gene appears to be very polymorphic, with frameshift and point mutations occurring in streptomycin-susceptible and streptomycin-resistant strains. In this study, mutations in gidB appeared in 27% of streptomycin-resistant strains that contained no mutations in the rpsL or rrs genes, and they were associated with low-level streptomycin resistance. However, the association of certain mutations in gidB with streptomycin resistance needs to be further investigated, as we also found mutations in gidB in streptomycin-susceptible strains. This occurred only when the strain was resistant to rifampin and isoniazid. Two specific mutations appeared very frequently in this and other studies of streptomycin-susceptible and -resistant strains; these mutations were not considered related to streptomycin resistance, but as a polymorphism. We stratified the strains according to the different phylogenetic lineages and showed that the gidB(16) polymorphism (16G allele) was exclusively present in the Latin American-Mediterranean (LAM) genotype, while the gidB(92) polymorphism (92C allele) was associated with the Beijing lineage in another population. In the sample studied, the two characterized single-nucleotide polymorphisms could distinguish LAM and Beijing lineages from the other lineages.

  16. A single recessive gene conferring short leaves in romaine x Latin type lettuce (Lactuca sativa L.) crosses, and its effect on plant morphology and resistance to lettuce drop caused by Sclerotinia minor Jagger.

    Science.gov (United States)

    Understanding the relationship between plant morphology and disease resistance is crucial to successful breeding, particularly resistance to lettuce drop caused by Sclerotinia minor. Latin type lettuce cultivars are small plants with upright leaves longer than they are wide, similar to romaine type...

  17. Influence of Soil Use on Prevalence of Tetracycline, Streptomycin, and Erythromycin Resistance and Associated Resistance Genes

    Science.gov (United States)

    Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-01-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR). PMID:22203596

  18. Influence of soil use on prevalence of tetracycline, streptomycin, and erythromycin resistance and associated resistance genes.

    Science.gov (United States)

    Popowska, Magdalena; Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-03-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR).

  19. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  20. Tumor Heterogeneity, Single-Cell Sequencing, and Drug Resistance

    Directory of Open Access Journals (Sweden)

    Felix Schmidt

    2016-06-01

    Full Text Available Tumor heterogeneity has been compared with Darwinian evolution and survival of the fittest. The evolutionary ecosystem of tumors consisting of heterogeneous tumor cell populations represents a considerable challenge to tumor therapy, since all genetically and phenotypically different subpopulations have to be efficiently killed by therapy. Otherwise, even small surviving subpopulations may cause repopulation and refractory tumors. Single-cell sequencing allows for a better understanding of the genomic principles of tumor heterogeneity and represents the basis for more successful tumor treatments. The isolation and sequencing of single tumor cells still represents a considerable technical challenge and consists of three major steps: (1 single cell isolation (e.g., by laser-capture microdissection, fluorescence-activated cell sorting, micromanipulation, whole genome amplification (e.g., with the help of Phi29 DNA polymerase, and transcriptome-wide next generation sequencing technologies (e.g., 454 pyrosequencing, Illumina sequencing, and other systems. Data demonstrating the feasibility of single-cell sequencing for monitoring the emergence of drug-resistant cell clones in patient samples are discussed herein. It is envisioned that single-cell sequencing will be a valuable asset to assist the design of regimens for personalized tumor therapies based on tumor subpopulation-specific genetic alterations in individual patients.

  1. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  2. Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC

    Directory of Open Access Journals (Sweden)

    Amer Khalid

    2009-08-01

    Full Text Available Abstract Background NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. Methods The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE tissue. Results There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Conclusion Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer.

  3. The rph2 gene is responsible for high level resistance to phosphine in independent field strains of Rhyzopertha dominica.

    Directory of Open Access Journals (Sweden)

    Yosep S Mau

    Full Text Available The lesser grain borer Rhyzopertha dominica (F. is one of the most destructive insect pests of stored grain. This pest has been controlled successfully by fumigation with phosphine for the last several decades, though strong resistance to phosphine in many countries has raised concern about the long term usefulness of this control method. Previous genetic analysis of strongly resistant (SR R. dominica from three widely geographically dispersed regions of Australia, Queensland (SR(QLD, New South Wales (SR(NSW and South Australia (SR(SA, revealed a resistance allele in the rph1 gene in all three strains. The present study confirms that the rph1 gene contributes to resistance in a fourth strongly resistant strain, SR2(QLD, also from Queensland. The previously described rph2 gene, which interacts synergistically with rph1 gene, confers strong resistance on SR(QLD and SR(NSW. We now provide strong circumstantial evidence that weak alleles of rph2, together with rph1, contribute to the strong resistance phenotypes of SR(SA and SR2(QLD. To test the notion that rph1 and rph2 are solely responsible for the strong resistance phenotype of all resistant R. dominica, we created a strain derived by hybridising the four strongly resistant lines. Following repeated selection for survival at extreme rates of phosphine exposure, we found only slightly enhanced resistance. This suggests that a single sequence of genetic changes was responsible for the development of resistance in these insects.

  4. The rpg4/Rpg5 stem rust resistance locus in barley: resistance genes and cytoskeleton dynamics.

    Science.gov (United States)

    Brueggeman, Robert; Steffenson, Brian J; Kleinhofs, Andris

    2009-04-01

    Two closely linked resistance genes, rpg4 and Rpg5, conferring resistance to several races of Puccinia graminis, were cloned and characterized. The Rpg5 gene confers resistance to an isolate of Puccinia graminis f. sp. secalis (Pgs), while rpg4 confers resistance to Puccinia graminis f. sp. tritici (Pgt). Rpg5 is a novel gene containing nucleotide binding site-leucine rich repeat domains in combination with a serine threonine protein kinase domain. High-resolution mapping plus allele and recombinant sequencing identified the rpg4 gene, which encodes an actin depolymerizing factor-like protein (ADF2). Resistance against the Pgt races QCCJ, MCCF, TTKSK (aka Ug99) and RCRS requires both Rpg5 and rpg4, while Rpg5 alone confers resistance to Pgs isolate 92-MN-90. The dependency on the actin modifying protein ADF2 indicates cytoskeleton reorganization or redirection plays a role in pathogen-host interactions. Rpg5 may interact with ADF2 to activate or deactivate its function in the resistance response. Alternatively, Rpg5 could initiate signal transduction leading to resistance in response to detecting ADF2 protein modification. Pgt may redirect the actin cytoskeleton by inducing modifications of ADF2. The redirection of actin could possibly enable the pathogen to develop a haustoria-plant cell cytoskeleton interface for acquisition of nutrients.

  5. Inheritance, fine-mapping, and candidate gene analyses of resistance to soybean mosaic virus strain SC5 in soybean.

    Science.gov (United States)

    Karthikeyan, Adhimoolam; Li, Kai; Jiang, Hua; Ren, Rui; Li, Cui; Zhi, Haijian; Chen, Shouyi; Gai, Junyi

    2017-08-01

    Soybean mosaic virus (SMV) is one of the most devastating pathogens for soybeans in China. Among the country-wide 22 strains, SC5 dominates in Huang-Huai and Changjiang valleys. For controlling its damage, the resistance gene was searched through Mendelian inheritance study, gene fine-mapping, and candidate gene analysis combined with qRT-PCR (quantitative real-time polymerase chain reaction) analysis. The parents F 1 , F 2 , and RILs (recombinant inbred lines) of the cross Kefeng-1 (Resistance, R) × NN1138-2 (Susceptible, S) were used to examine the inheritance of SC5-resistance. The F 1 was resistant and the F 2 and RILs segregated in a 3R:1S and 1R:1S ratio, respectively, indicating a single dominant gene conferring the Kefeng-1 resistance. Subsequently, the genomic region conferring the resistance was found in "Bin 352-Bin353 with 500 kb" on Chromosome 2 using the phenotyping data of the 427 RILs and a high-density genetic map with 4703 bin markers. In the 500 kb genomic region, 38 putative genes are contained. The association analysis between the SNPs in a putative gene and the resistance phenotype for the 427 RILs prioritized 11 candidate genes using Chi-square criterion. The expression levels of these genes were tested by qRT-PCR. On infection with SC5, 7 out of the 11 genes had differential expression in Kefeng-1 and NN1138-2. Furthermore, integrating SNP-phenotype association analysis with qRT-PCR expression profiling analysis, Glyma02g13495 was found the most possible candidate gene for SC5-resistance. This finding can facilitate the breeding for SC5-resistance through marker-assisted selection and provide a platform to gain a better understanding of SMV-resistance gene system in soybean.

  6. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  7. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  8. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  9. Effect of swine manure application timing on the persistence and transport of antibiotic-resistant Enterococcus and resistance genes

    Science.gov (United States)

    Swine manure applied to agricultural fields may lead to the transport of antibiotic resistant bacteria and antibiotic resistance genes to freshwater systems. Enterococci were studied because they are fecal indicator bacteria associated with manure. Resistance genes include genes from live cells, dea...

  10. Vancomycin-resistance phenotypes, vancomycin-resistance genes, and resistance to antibiotics of enterococci isolated from food of animal origin.

    Science.gov (United States)

    Gousia, Panagiota; Economou, Vangelis; Bozidis, Petros; Papadopoulou, Chrissanthy

    2015-03-01

    In the present study, 500 raw beef, pork, and chicken meat samples and 100 pooled egg samples were analyzed for the presence of vancomycin-resistant enterococci, vancomycin-resistance phenotypes, and resistance genes. Of 141 isolates of enterococci, 88 strains of Enterococcus faecium and 53 strains of E. faecalis were identified. The most prevalent species was E. faecium. Resistance to ampicillin (n = 93, 66%), ciprofloxacin (n = 74, 52.5%), erythromycin (n = 73, 51.8%), penicillin (n = 59, 41.8%) and tetracycline (n = 52, 36.9%) was observed, while 53.2% (n = 75) of the isolates were multiresistant and 15.6% (n = 22) were susceptible to all antibiotics. Resistance to vancomycin was exhibited in 34.1% (n = 30) of the E. faecium isolates (n = 88) and 1.9% (n = 1) of the E. faecalis isolates (n = 53) using the disc-diffusion test and the E-test. All isolates were tested for vanA and vanB using real-time polymerase chain reaction (PCR) and multiplex PCR, and for vanC, vanD, vanE, vanG genes using multiplex PCR only. Among E. faecalis isolates, no resistance genes were identified. Among the E. faecium isolates, 28 carried the vanA gene when tested by multiplex PCR and 29 when tested with real-time PCR. No isolate carrying the vanC, vanD, vanE, or vanG genes was identified. Melting-curve analysis of the positive real-time PCR E. faecium isolates showed that 22 isolates carried the vanA gene only, 2 isolates the vanB2,3 genes only, and seven isolates carried both the vanA and vanB2,3 genes. Enterococci should be considered a significant zoonotic pathogen and a possible reservoir of genes encoding resistance potentially transferred to other bacterial species.

  11. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam

    Science.gov (United States)

    Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J.; Stålsby Lundborg, Cecilia

    2017-01-01

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the blaTEM gene being more common than blaCTX-M. Co-harbouring of the blaCTX-M, blaTEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs. PMID:28661465

  12. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  13. Fire resistance of single pitched-roof steel portal frame

    Directory of Open Access Journals (Sweden)

    J. J. Ferrán Gozálvez

    2017-03-01

    Full Text Available The standard procedure of structural fire design is based on the simplified analysis of single members. This method leads to conservative results in the case of structures able to redistribution of forces. The failure mechanism affecting both life safety and fire propagation is unknown. This work proposes a methodology for the advanced fire calculation of single pitched-roof portal frame for an agroindustrial building according to the Spanish Specifications with the structural software SAP2000. A non-linear dynamic and plastic, geometric (P-Delta and large-displacements calculation method has been developed. The different failure mechanisms and their influence are studied in terms of fire time resistance, human hazard and good safety. Also, parametric analyses were conducted: load level, rotational stiffness of the base and finally, support fire protection.

  14. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  15. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    Science.gov (United States)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  16. Micro-evolution of toxicant tolerance: from single genes to the genome's tangled bank.

    Science.gov (United States)

    van Straalen, Nico M; Janssens, Thierry K S; Roelofs, Dick

    2011-05-01

    Two case-studies published 55 years ago became textbook examples of evolution in action: DDT resistance in houseflies (Busvine) and the rise of melanic forms of the peppered moth (Kettlewell). Now, many years later, molecular studies have elucidated in detail the mechanisms conferring resistance. In this paper we focus on the case of metal tolerance in a soil-living arthropod, Orchesella cincta, and provide new evidence on the transcriptional regulation of a gene involved in stress tolerance, metallothionein. Evolution of resistance is often ascribed to cis-regulatory change of such stress-combatting genes. For example, DDT resistance in the housefly is due to insertion of a mobile element into the promoter of Cyp6g1, and overexpression of this gene allows rapid metabolism of DDT. The discovery of these mechanisms has promoted the idea that resistance to environmental toxicants can be brought about by relatively simple genetic changes, involving up-regulation, duplication or structural alteration of a single-gene. Similarly, the work on O. cincta shows that populations from metal-polluted mining sites have a higher constitutive expression of the cadmium-induced metallothionein (Mt) gene. Moreover, its promoter appears to include a large degree of polymorphism; Mt promoter alleles conferring high expression in cell-based bioreporter assays were shown to occur at higher frequency in populations living at polluted sites. The case is consistent with classical examples of micro-evolution through altered cis-regulation of a key gene. However, new data on qPCR analysis of gene expression in homozygous genotypes with both reference and metal-tolerant genetic backgrounds, show that Mt expression of the same pMt homozygotes depends on the origin of the population. This suggests that trans-acting factors are also important in the regulation of Mt expression and its evolution. So the idea that metal tolerance in Orchesella can be viewed as a single-gene adaptation must be

  17. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  18. Gene interactions and genetics of blast resistance and yield

    Indian Academy of Sciences (India)

    Blast disease caused by the pathogen Pyricularia oryzae is a serious threat to rice production. Six generations viz., P1, P2, F1, F2, B1 and B2 of a cross between blast susceptible high-yielding rice cultivar ADT 43 and resistant near isogenic line (NIL) CT13432-3R, carrying four blast resistance genes Pi1, Pi2, Pi33 and Pi54 ...

  19. Single nucleotide polymorphisms in ghrelin gene and the resulting ...

    African Journals Online (AJOL)

    Ghrelin is a growth hormone releasing peptide which also affects feed intake in chickens. Ghrelin is encoded by chicken ghrelin gene (cGHRL) found in chromosome 7. Single nucleotide polymorphisms (SNPs) have been reported in cGHRL in Chinese native chickens, but such studies have not been carried out in chickens ...

  20. Allele characterization of genes required for rpg4-mediated wheat stem rust resistance identifies Rpg5 as the R gene.

    Science.gov (United States)

    Arora, D; Gross, T; Brueggeman, R

    2013-11-01

    A highly virulent form of the wheat stem rust pathogen Puccinia graminis f. sp. tritici race TTKSK is virulent on both wheat and barley, presenting a major threat to world food security. The recessive and temperature-sensitive rpg4 gene is the only effective source of resistance identified in barley (Hordeum vulgare) against P. graminis f. sp. tritici race TTKSK. Efforts to position clone rpg4 localized resistance to a small interval on barley chromosome 5HL, tightly linked to the rye stem rust (P. graminis f. sp. secalis) resistance (R) gene Rpg5. High-resolution genetic analysis and post-transcriptional gene silencing of the genes at the rpg4/Rpg5 locus determined that three tightly linked genes (Rpg5, HvRga1, and HvAdf3) are required together for rpg4-mediated wheat stem rust resistance. Alleles of the three genes were analyzed from a diverse set of 14 domesticated barley lines (H. vulgare) and 8 wild barley accessions (H. vulgare subsp. spontaneum) to characterize diversity that may determine incompatibility (resistance). The analysis determined that HvAdf3 and HvRga1 code for predicted functional proteins that do not appear to contain polymorphisms determining the compatible (susceptible) interactions with the wheat stem rust pathogen and were expressed at the transcriptional level from both resistant and susceptible barley lines. The HvAdf3 alleles shared 100% amino acid identity among all 22 genotypes examined. The P. graminis f. sp. tritici race QCCJ-susceptible barley lines with HvRga1 alleles containing the limited amino acid substitutions unique to the susceptible varieties also contained predicted nonfunctional rpg5 alleles. Thus, susceptibility in these lines is likely due to the nonfunctional RPG5 proteins. The Rpg5 allele analysis determined that 9 of the 13 P. graminis f. sp. tritici race QCCJ-susceptible barley lines contain alleles that either code for predicted truncated proteins as the result of a single nucleotide substitution, resulting in a

  1. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  2. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  3. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens......, that appear to be closely related to actinobacterial ARGs known to confer resistance against clinically important antibiotics. Furthermore, we identify two potential examples of recent horizontal transfer of actinobacterial ARGs to proteobacterial pathogens. Based on this bioinformatic evidence, we propose...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  4. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    Science.gov (United States)

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  5. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  6. Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

    Directory of Open Access Journals (Sweden)

    Wang Hehe

    2012-08-01

    Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

  7. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  8. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes.

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-02-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l(-1) and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1(R) allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1(R) and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1(V) or the duplicated ace-1(D) allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects.

  9. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  10. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  11. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using...... the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42......%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  12. Dissemination of metal resistance genes among animal methicillin-resistant coagulase-negative Staphylococci.

    Science.gov (United States)

    Argudín, M Angeles; Butaye, Patrick

    2016-04-01

    The use of metals as feed supplement has been recognized as a potential driver for co-selection of methicillin-resistant Staphylococcus aureus in pigs. However, the prevalence of these determinants in methicillin-resistant coagulase-negative staphylococci (MRCoNS) is largely unknown. In this study, a collection of 130 MRCoNS from pigs and veal calves were investigated for the presence of metal-resistance genes (czrC, copB, cadD, arsA) associated to SCCmec. Near half of the isolates carried metal resistance genes (czrC 5.4%, copB 38.5%, cadD 7.7%, arsA 26.2%) regardless of their SCCmec type. The increased use of metals in livestock animals, especially zinc in pigs in several European countries may co-select for methicillin-resistance in several staphylococcal species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  14. Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem.

    Science.gov (United States)

    Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P

    2017-08-31

    Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

  15. A single-loop recombinant pseudotyped-virus-based assay to detect HIV-1 phenotypic resistance.

    Science.gov (United States)

    Wu, Shouli; Yan, Pingping; Yan, Yansheng; Qiu, Lijun; Xie, Meirong

    2015-06-01

    HIV/AIDS is a leading public health concern throughout the world. Currently, treatment of HIV/AIDS still depends on highly active antiretroviral therapy (HAART); however, there is increasing evidence showing the emergence of resistance to antiretroviral drugs in HIV-1 strains, making ART less effective over time. Intensive monitoring of HIV-1 drug resistance is therefore of great importance to evaluate the current sensitivity of antiretroviral agents and is urgently needed. The aim of this study was to develop a single-loop recombinant pseudotyped-virus-based assay to detect phenotypic resistance in clinical HIV-1 strains. HIV-1 RNA was extracted from HIV-1-infected human plasma samples, and an approximately 3-kb fragment containing p7/p1/p6 cleavage sites and full-length protease (PR), reverse transcriptase (RT), thermonuclease (TNase), and integrase (1-280 aa) genes was amplified by nested RT-PCR. A retroviral vector was constructed using the HIV-1 infectious molecular clone pLWJ to test antiretroviral drug susceptibility. pLWJ-SV40-Luc contained a luciferase expression cassette inserted within a deleted region of the envelope (env) gene as an indicator gene. Resistance test vectors (RTVs) were constructed by incorporating amplified target genes into pLWJ-SV40-Luc by using ApaI or AgeI and AarI restriction sites and conventional cloning methods. The virus stocks used for drug susceptibility test were produced by co-transfecting 293T cells with RTVs and a plasmid that provided vesicular stomatitis virus glycoprotein (VSV-G). Viral replication was monitored by measuring luciferase activity in infected target cells at approximately 48 h postinfection. A total of 35 clinical plasma samples from HIV-1-infected humans were tested, and target fragments were successfully amplified from 34 samples (97.1 %) and 33 RTVs were successfully constructed by directional cloning, with an overall success rate of 94.3 %. A clear-cut dose-dependent relationship was detected between

  16. Effect of adrenomedullin gene delivery on insulin resistance in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Hoda Y. Henein

    2011-01-01

    Full Text Available Type 2 diabetes mellitus is one of the common metabolic disorders that ultimately afflicts large number of individuals. Adrenomedullin (AM is a potent vasodilator peptide; previous studies reported development of insulin resistance in aged AM deficient mice. In this study, we employed a gene delivery approach to explore its potential role in insulin resistance. Four groups were included: control, diabetic, non-diabetic injected with the AM gene and diabetic injected with the AM gene. One week following gene delivery, serum glucose, insulin, triglycerides, leptin, adiponectin and corticosterone were measured as well as the insulin resistance index (HOMA-IR. Soleus muscle glucose uptake and RT-PCR of both AM and glucose transporter-4 (GLUT 4 gene expressions were assessed. A single tail vein injection of adrenomedullin gene in type 2 diabetic rats improved skeletal muscle insulin responsiveness with significant improvement of soleus muscle glucose uptake, HOMA-IR, serum glucose, insulin and triglycerides and significant increase in muscle GLUT 4 gene expression (P < 0.05 compared with the non-injected diabetic rats. The beneficial effects of AM gene delivery were accompanied by a significant increase in the serum level of adiponectin (2.95 ± 0.09 versus 2.33 ± 0.17 μg/ml in the non-injected diabetic group as well as a significant decrease in leptin and corticosterone levels (7.51 ± 0.51 and 262.88 ± 10.34 versus 10.63 ± 1.4 and 275.86 ± 11.19 ng/ml respectively in the non-injected diabetic group. The conclusion of the study is that AM gene delivery can improve insulin resistance and may have significant therapeutic applications in type 2 diabetes mellitus.

  17. Linezolid-resistant Staphylococcus aureus strain 1128105, the first known clinical isolate possessing the cfr multidrug resistance gene.

    Science.gov (United States)

    Locke, Jeffrey B; Zuill, Douglas E; Scharn, Caitlyn R; Deane, Jennifer; Sahm, Daniel F; Denys, Gerald A; Goering, Richard V; Shaw, Karen J

    2014-11-01

    The Cfr methyltransferase confers resistance to six classes of drugs which target the peptidyl transferase center of the 50S ribosomal subunit, including some oxazolidinones, such as linezolid (LZD). The mobile cfr gene was identified in European veterinary isolates from the late 1990s, although the earliest report of a clinical cfr-positive strain was the 2005 Colombian methicillin-resistant Staphylococcus aureus (MRSA) isolate CM05. Here, through retrospective analysis of LZD(r) clinical strains from a U.S. surveillance program, we identified a cfr-positive MRSA isolate, 1128105, from January 2005, predating CM05 by 5 months. Molecular typing of 1128105 revealed a unique pulsed-field gel electrophoresis (PFGE) profile most similar to that of USA100, spa type t002, and multilocus sequence type 5 (ST5). In addition to cfr, LZD resistance in 1128105 is partially attributed to the presence of a single copy of the 23S rRNA gene mutation T2500A. Transformation of the ∼37-kb conjugative p1128105 cfr-bearing plasmid from 1128105 into S. aureus ATCC 29213 background strains was successful in recapitulating the Cfr antibiogram, as well as resistance to aminoglycosides and trimethoprim. A 7-kb cfr-containing region of p1128105 possessed sequence nearly identical to that found in the Chinese veterinary Proteus vulgaris isolate PV-01 and in U.S. clinical S. aureus isolate 1900, although the presence of IS431-like sequences is unique to p1128105. The cfr gene environment in this early clinical cfr-positive isolate has now been identified in Gram-positive and Gram-negative strains of clinical and veterinary origin and has been associated with multiple mobile elements, highlighting the versatility of this multidrug resistance gene and its potential for further dissemination. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Directory of Open Access Journals (Sweden)

    Colin W Hiebert

    Full Text Available Stem rust, caused by Puccinia graminis (Pgt, is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  19. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  20. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  1. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean

    Science.gov (United States)

    Burt, Andrew J.; William, H. Manilal; Perry, Gregory; Khanal, Raja; Pauls, K. Peter; Kelly, James D.; Navabi, Alireza

    2015-01-01

    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co–4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co–4 is localized. Three SCAR markers with known linkage to Co–4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK–4 loci found in previous studies. It is possible that the Co–4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases. PMID:26431031

  2. Development of Gene-Pyramid Lines of the Elite Restorer Line, RPHR-1005 Possessing Durable Bacterial Blight and Blast Resistance.

    Science.gov (United States)

    Abhilash Kumar, V; Balachiranjeevi, C H; Bhaskar Naik, S; Rambabu, R; Rekha, G; Harika, G; Hajira, S K; Pranathi, K; Anila, M; Kousik, M; Vijay Kumar, S; Yugander, A; Aruna, J; Dilip Kumar, T; Vijaya Sudhakara Rao, K; Hari Prasad, A S; Madhav, M S; Laha, G S; Balachandran, S M; Prasad, M S; Viraktamath, B C; Ravindra Babu, V; Sundaram, R M

    2016-01-01

    RPHR-1005, the stable restorer line of the popular medium slender (MS) grain type rice hybrid, DRRH-3 was improved in this study for resistance against bacterial blight (BB) and blast diseases through marker-assisted backcross breeding (MABB). In this study, four major resistance genes (i.e., Xa21 and Xa33 for BB resistance and Pi2 and Pi54 for blast resistance) have been transferred to RPHR-1005 using RPBio Patho-1 (possessing Xa21 + Pi2), RPBio Patho-2 (possessing Xa21 + Pi54) and FBR1-15EM (possessing Xa33) as the donors. Foreground selection was carried out using PCR-based molecular markers specific for the target resistance genes and the major fertility restorer genes, Rf3 and Rf4, while background selection was carried out using a set of parental polymorphic rice SSR markers and backcrossing was continued uptoBC2 generation. At BC2F2, plants possessing the gene combination- Xa21 + Pi2, Xa21 + Pi54 and Xa33 in homozygous condition and with >92% recovery of the recurrent parent genome (RPG) were identified and intercrossed to combine all the four resistance genes. Twenty-two homozygous, pyramid lines of RPHR-1005 comprising of three single-gene containing lines, six 2-gene containing lines, eight 3-gene containing lines, and five 4-gene containing lines were identified among the double intercross lines at F3 generation (DICF3). They were then evaluated for their resistance against BB and blast, fertility restoration ability and for key agro-morphological traits. While single gene containing lines were resistant to either BB or blast, the 2-gene, 3-gene, and 4-gene pyramid lines showed good level of resistance against both and/or either of the two diseases. Most of the 2-gene, 3-gene, and 4-gene containing pyramid lines showed yield levels and other key agro-morphological and grain quality traits comparable to the original recurrent parent and showed complete fertility restoration ability, with a few showing higher yield as compared to RPHR-1005. Further, the

  3. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    Science.gov (United States)

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  4. Longitudinal characterization of antimicrobial resistance genes in feces shed from cattle fed different subtherapeutic antibiotics

    Directory of Open Access Journals (Sweden)

    Read Ronald R

    2011-01-01

    Full Text Available Abstract Background Environmental transmission of antimicrobial-resistant bacteria and resistance gene determinants originating from livestock is affected by their persistence in agricultural-related matrices. This study investigated the effects of administering subtherapeutic concentrations of antimicrobials to beef cattle on the abundance and persistence of resistance genes within the microbial community of fecal deposits. Cattle (three pens per treatment, 10 steers per pen were administered chlortetracycline, chlortetracycline plus sulfamethazine, tylosin, or no antimicrobials (control. Model fecal deposits (n = 3 were prepared by mixing fresh feces from each pen into a single composite sample. Real-time PCR was used to measure concentrations of tet, sul and erm resistance genes in DNA extracted from composites over 175 days of environmental exposure in the field. The microbial communities were analyzed by quantification and denaturing gradient gel electrophoresis (DGGE of PCR-amplified 16S-rRNA. Results The concentrations of 16S-rRNA in feces were similar across treatments and increased by day 56, declining thereafter. DGGE profiles of 16S-rRNA differed amongst treatments and with time, illustrating temporal shifts in microbial communities. All measured resistance gene determinants were quantifiable in feces after 175 days. Antimicrobial treatment differentially affected the abundance of certain resistance genes but generally not their persistence. In the first 56 days, concentrations of tet(B, tet(C, sul1, sul2, erm(A tended to increase, and decline thereafter, whereas tet(M and tet(W gradually declined over 175 days. At day 7, the concentration of erm(X was greatest in feces from cattle fed tylosin, compared to all other treatments. Conclusion The abundance of genes coding for antimicrobial resistance in bovine feces can be affected by inclusion of antibiotics in the feed. Resistance genes can persist in feces from cattle beyond 175 days

  5. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  6. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... Isolation of NBS-LRR class resistant gene (I2 gene) from tomato cultivar Heamsona ... avirulence protein or effector protein secreted by fungal pathogen during the host colonization in tomato. These effector proteins .... and efficient method for isolation of genomic DNA from plant tissue. J. Cell Tissue Res.

  7. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  8. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  9. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  10. Determination and expression of genes for resistance to blast ...

    African Journals Online (AJOL)

    Determination and expression of genes for resistance to blast (Magnaporthe oryza) in Basmati and non-Basmati indica rices (Oryza sativa L.) Naveen Kumar, D Singh, S Gupta, A Sirohi, B Ramesh, Preeti Sirohi, Parul Sirohi, Atar Singh, N Kumar, A Kumar, Rajendra Kumar, R Kumar, J Singh, P. Kumar, P. Chauhan, ...

  11. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2014-08-11

    Aug 11, 2014 ... Keywords. blast; gene action; generation mean analysis; resistance; yield. Journal of Genetics, Vol. 93, No. .... Utilizing the variance of different generations, the variances of A, B, C and D scales were ...... Jia Y. 2003 Marker assisted selection for the control of rice blast disease. Pesticide Outlook 14 ...

  12. Evaluating antibiotic resistance genes in soils with applied manures

    Science.gov (United States)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  13. Absence of meca gene in methicillin-resistant staphylococcus ...

    African Journals Online (AJOL)

    Methicillin-resistant Staphylococcus aureus has emerged as a serious threat to public health, causing both hospital and community-associated infections. The gold standard for MRSA detection is the amplification of the mecA gene that codes for the production of the altered penicillin-binding protein (PBP2a) responsible for ...

  14. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  15. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2017-01-04

    Jan 4, 2017 ... 2. State Key Laboratory of Biology for Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of. Agricultural Sciences, Beijing 100193, China. Received 10 October, 2016; Accepted 14 December, 2016. A study was conducted to detect the presence of disease resistance genes to ...

  16. Cloning of a carbendazim-resistant gene from Colletotrichum ...

    African Journals Online (AJOL)

    Cloning of a carbendazim-resistant gene from Colletotrichum gloeosporioides of mango in South China. ... Abstract. Mango anthracnose caused by Colletotrichum gloeosporioides is an important disease and prevalent in tropical regions of China. High carbendazim ... employed to further test the above results. It involved an ...

  17. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Resistance genes honologues I theobroma cacao as useful genetic markers. Theor. Appl. Gent. 107:191-202. Kumar S, Tamura K, Nei M (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163. Lacock L, Niekerk CV, Loots S, ...

  18. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Full Length Research Paper. Cloning and characterization of NBS-LRR resistance gene analogues of Musa spp. and their expression profiling studies against Pratylenchus coffeae. S. Backiyarani*, S. Uma, G. Arunkumar, M. S. Saraswathi and P. Sundararaju. National Research Centre for Banana (ICAR), ...

  19. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  20. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    We generated a synthetic gentamicin resistance gene whose codon usage is optimized to Frankia (fgmR) and evaluated its usefulness as a selection marker using a transient transformation system. Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR ...

  1. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  2. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    Electrophoresis was carried out at 1400. V for 1.0 - 1.5 h. Gel staining and visualization was done as previously described (Chen et al. 1998). Polymorphic markers were used to genotype the F2 population. Genotype data were used to construct a genetic map and locate the resistance gene. Mapping and Data analysis.

  3. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  5. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  6. Identification of a new soybean rust resistance gene in PI 567102B.

    Science.gov (United States)

    Li, Shuxian; Smith, James R; Ray, Jeffery D; Frederick, Reid D

    2012-06-01

    Soybean rust (SBR) caused by Phakopsora pachyrhizi Syd. and P. Syd. is one of the most economically important diseases of soybean (Glycine max (L.) Merr.). Durable resistance to P. pachyrhizi is the most effective long-term strategy to control SBR. The objective of this study was to investigate the genetics of resistance to P. pachyrhizi in soybean accession PI 567102B. This accession was previously identified as resistant to SBR in Paraguay and to P. pachyrhizi isolates from seven states in the USA (Alabama, Florida, Georgia, Louisiana, Mississippi, South Carolina, and Texas). Analysis of two independent populations, one in which F(2) phenotypes were inferred from F(2)-derived F(3) (F(2:3)) families and the other in which F(2) plants had phenotypes measured directly, showed that the resistance in PI 567102B was controlled by a single dominant gene. Two different isolates (MS06-1 and LA04-1) at different locations (Stoneville, MS and Ft. Detrick, MD) were used to independently assay the two populations. Linkage analysis of both populations indicated that the resistance locus was located on chromosome 18 (formerly linkage group G), but at a different location than either Rpp1 or Rpp4, which were previously mapped to this linkage group. Therefore, the SBR resistance in PI 567102B appeared to be conditioned by a previously unreported locus, with an underlying single dominant gene inferred. We propose this gene to be designated Rpp6. Incorporating Rpp6 into improved soybean cultivars may have wide benefits as PI 567102B has been shown to provide resistance to P. pachyrhizi isolates from Paraguay and the US.

  7. Differential gene expression in individual papilla-resistant and powdery mildew-infected barley epidermal cells

    DEFF Research Database (Denmark)

    Gjetting, T.; Carver, Timothy L. W.; Skøt, Leif

    2004-01-01

    leading to papilla deposition and reinforcement of their cell wall. This conveys a race-nonspecific form of resistance. However, this defense is not complete, and a proportion of penetration attempts succeed in infection. The resultant mixture of infected and uninfected leaf cells makes it impossible...... separately. Contents of single epidermal cells (resistant, infected, and unattacked controls) were collected, and after cDNA synthesis and PCR amplification, the resulting sample was hybridized to dot-blots spotted with genes, including some previously reported to be induced upon pathogen attack. Transcripts...

  8. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  9. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  10. Effects of ultraviolet disinfection on antibiotic-resistant Escherichia coli from wastewater: inactivation, antibiotic resistance profiles and antibiotic resistance genes.

    Science.gov (United States)

    Zhang, Chong-Miao; Xu, Li-Mei; Wang, Xiaochang C; Zhuang, Kai; Liu, Qiang-Qiang

    2017-04-29

    To evaluate the effect of ultraviolet (UV) disinfection on antibiotic-resistant Escherichia coli (E. coli). Antibiotic-resistant E. coli strains were isolated from a wastewater treatment plant and subjected to UV disinfection. The effect of UV disinfection on the antibiotic resistance profiles and the antibiotic resistance genes (ARGs) of antibiotic-resistant E. coli was evaluated by a combination of antibiotic susceptibility analysis and molecular methods. Results indicated that multiple-antibiotic-resistant (MAR) E. coli were more resistant at low UV doses and required a higher UV dose (20 mJ cm -2 ) to enter the tailing phase compared with those of antibiotic-sensitive E. coli (8 mJ cm -2 ). UV disinfection caused a selective change in the inhibition zone diameters of surviving antibiotic-resistant E. coli and a slight damage to ARGs. The inhibition zone diameters of the strains resistant to antibiotics were more difficult to alter than those susceptible to antibiotics because of the existence and persistence of corresponding ARGs. The resistance of MAR bacteria to UV disinfection at low UV doses and the changes in inhibition zone diameters could potentially contribute to the selection of ARB in wastewater treatment after UV disinfection. The risk of spread of antibiotic resistance still exists owing to the persistence of ARGs. Our study highlights the acquisition of other methods to control the spread of ARGs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  12. Bacteria from Animals as a Pool of Antimicrobial Resistance Genes

    Science.gov (United States)

    Argudín, Maria Angeles; Deplano, Ariane; Meghraoui, Alaeddine; Dodémont, Magali; Heinrichs, Amelie; Denis, Olivier; Nonhoff, Claire; Roisin, Sandrine

    2017-01-01

    Antimicrobial agents are used in both veterinary and human medicine. The intensive use of antimicrobials in animals may promote the fixation of antimicrobial resistance genes in bacteria, which may be zoonotic or capable to transfer these genes to human-adapted pathogens or to human gut microbiota via direct contact, food or the environment. This review summarizes the current knowledge of the use of antimicrobial agents in animal health and explores the role of bacteria from animals as a pool of antimicrobial resistance genes for human bacteria. This review focused in relevant examples within the ESC(K)APE (Enterococcus faecium, Staphylococcus aureus, Clostridium difficile (Klebsiella pneumoniae), Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae) group of bacterial pathogens that are the leading cause of nosocomial infections throughout the world. PMID:28587316

  13. Inheritance and molecular mapping of a gene conferring seedling resistance against Puccinia hordei in the barley cultivar Ricardo.

    Science.gov (United States)

    Sandhu, K S; Forrest, K L; Kong, S; Bansal, U K; Singh, D; Hayden, M J; Park, R F

    2012-11-01

    Genetic studies were undertaken to determine the inheritance and genomic location of uncharacterised seedling resistance to leaf rust, caused by Puccinia hordei, in the barley cultivar Ricardo. The resistance was shown to be conferred by a single dominant gene, which was tentatively designated RphRic. Bulk segregant analysis (BSA) and genetic mapping of an F(3) mapping population using multiplex-ready SSR genotyping and Illumina GoldenGate SNP assay located RphRic in chromosome 4H. Given that this is the first gene for leaf rust resistance mapped on chromosome 4H, it was designated Rph21. The presence of an additional gene, Rph2, in Ricardo, was confirmed by the test of allelism. The seedling gene Rph21 has shown effectiveness against all Australian pathotypes of P. hordei tested since at least 1992 and hence represents a new and useful source of resistance to this pathogen.

  14. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  15. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    Directory of Open Access Journals (Sweden)

    Jorge Hernández

    2016-12-01

    Full Text Available Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL-type CTX-M genes in which multilocus sequencing typing (MLST showed different sequence types (STs, previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  16. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  17. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  18. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  19. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...... the SNPs of dhfr, dhps, and Pfcrt with high specificity. The SSOP-ELISA compared well with a standard PCR-restriction fragment length polymorphism procedure, and gave identical positive results in more than 90% of the P. falciparum slide-positive samples tested. The SSOP-ELISA of all dhfr, dhps, or Pfcrt...

  20. Single Gene and Syndromic Causes of Obesity: Illustrative Examples.

    Science.gov (United States)

    Butler, Merlin G

    2016-01-01

    Obesity is a significant health problem in westernized societies, particularly in the United States where it has reached epidemic proportions in both adults and children. The prevalence of childhood obesity has doubled in the past 30 years. The causation is complex with multiple sources, including an obesity promoting environment with plentiful highly dense food sources and overall decreased physical activity noted for much of the general population, but genetic factors clearly play a role. Advances in genetic technology using candidate gene approaches, genome-wide association studies, structural and expression microarrays, and next generation sequencing have led to the discovery of hundreds of genes recognized as contributing to obesity. Polygenic and monogenic causes of obesity are now recognized including dozens of examples of syndromic obesity with Prader-Willi syndrome, as a classical example and recognized as the most common known cause of life-threatening obesity. Genetic factors playing a role in the causation of obesity will be discussed along with the growing evidence of single genes and the continuum between monogenic and polygenic obesity. The clinical and genetic aspects of four classical but rare obesity-related syndromes (ie, Prader-Willi, Alström, fragile X, and Albright hereditary osteodystrophy) will be described and illustrated in this review of single gene and syndromic causes of obesity. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  2. Sequence variation in the CYP51 gene of Blumeria graminis associated with resistance to sterol demethylase inhibiting fungicides.

    Science.gov (United States)

    Wyand, R A; Brown, J K M

    2005-08-01

    Resistance to sterol 14alpha-demethylase inhibiting fungicides (DMIs) has been correlated with mutations in the CYP51 gene, which encodes the target enzyme eburicol 14alpha-demethylase. To test the hypothesis that variation in the CYP51 gene explains variation for DMI sensitivity in barley and wheat powdery mildew species, this gene was sequenced from isolates of Blumeria graminis f.sp. hordei (Bgh) and f.sp. tritici (Bgt), respectively, which differed in their responses to DMIs in agricultural populations in the UK. Two single-nucleotide mutations in the CYP51 gene, which resulted in the amino acid substitutions Y136F and K147Q, were detected. K147Q is a novel mutation present only in Bgh isolates expressing very high levels of resistance. Sequence analysis of the CYP51 gene from the progeny of a cross between DMI-sensitive and resistant Bgh isolates showed that both mutations segregate with resistance, which is consistent with CYP51 controlling a major portion of DMI resistance. However, genetic analysis of resistance to the DMI triadimenol indicates that mutation of the CYP51 gene is not the only mechanism of resistance operating in B. graminis.

  3. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...... was to evaluate whether the levels of AMR genes found in finisher pigs at slaughter were associated with the levels in the farm where the finishers were born, and whether the levels of the AMR genes were equal in the sow and finisher pig populations. We found a significant positive correlation between the levels...

  4. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  5. Life-threatening infectious diseases of childhood: single-gene inborn errors of immunity?

    Science.gov (United States)

    Alcaïs, Alexandre; Quintana-Murci, Lluis; Thaler, David S; Schurr, Erwin; Abel, Laurent; Casanova, Jean-Laurent

    2010-12-01

    The hypothesis that inborn errors of immunity underlie infectious diseases is gaining experimental support. However, the apparent modes of inheritance of predisposition or resistance differ considerably among diseases and among studies. A coherent genetic architecture of infectious diseases is lacking. We suggest here that life-threatening infectious diseases in childhood, occurring in the course of primary infection, result mostly from individually rare but collectively diverse single-gene variations of variable clinical penetrance, whereas the genetic component of predisposition to secondary or reactivation infections in adults is more complex. This model is consistent with (i) the high incidence of most infectious diseases in early childhood, followed by a steady decline; (ii) theoretical modeling of the impact of monogenic or polygenic predisposition on the incidence distribution of infectious diseases before reproductive age; (iii) available molecular evidence from both monogenic and complex genetics of infectious diseases in children and adults; (iv) current knowledge of immunity to primary and secondary or latent infections; (v) the state of the art in the clinical genetics of noninfectious pediatric and adult diseases; and (vi) evolutionary data for the genes underlying single-gene and complex disease risk. With the recent advent of new-generation deep resequencing, this model of single-gene variations underlying severe pediatric infectious diseases is experimentally testable. © 2010 New York Academy of Sciences.

  6. Continental-scale pollution of estuaries with antibiotic resistance genes.

    Science.gov (United States)

    Zhu, Yong-Guan; Zhao, Yi; Li, Bing; Huang, Chu-Long; Zhang, Si-Yu; Yu, Shen; Chen, Yong-Shan; Zhang, Tong; Gillings, Michael R; Su, Jian-Qiang

    2017-01-30

    Antibiotic resistance genes (ARGs) have moved from the environmental resistome into human commensals and pathogens, driven by human selection with antimicrobial agents. These genes have increased in abundance in humans and domestic animals, to become common components of waste streams. Estuarine habitats lie between terrestrial/freshwater and marine ecosystems, acting as natural filtering points for pollutants. Here, we have profiled ARGs in sediments from 18 estuaries over 4,000 km of coastal China using high-throughput quantitative polymerase chain reaction, and investigated their relationship with bacterial communities, antibiotic residues and socio-economic factors. ARGs in estuarine sediments were diverse and abundant, with over 200 different resistance genes being detected, 18 of which were found in all 90 sediment samples. The strong correlations of identified resistance genes with known mobile elements, network analyses and partial redundancy analysis all led to the conclusion that human activity is responsible for the abundance and dissemination of these ARGs. Such widespread pollution with xenogenetic elements has environmental, agricultural and medical consequences.

  7. Resistance gene transfer during treatments for experimental avian colibacillosis.

    Science.gov (United States)

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric; Kempf, Isabelle

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments-oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)-on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (bla(CTX-M) or bla(FOX)), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, "old" antimicrobials may coselect antimicrobial resistance to recent and critical molecules.

  8. Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

    Directory of Open Access Journals (Sweden)

    Jingbo Xia

    2013-01-01

    Full Text Available To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

  9. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  10. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  11. Detection of Genes for Superantigen Toxins in Methicillin-Resistant Staphylococcus aureus Clinical Isolates in Karachi

    International Nuclear Information System (INIS)

    Taj, Y.; Fatima, I.; Ali, S. W.; Kazmi, S. U.

    2014-01-01

    Objective: To detect genes for enterotoxins, exfoliative and toxic shock syndrome toxins in Staphylococcus aureus (S. aureus) strains isolated from clinical specimens. Study Design: Cross-sectional observational study. Place and Duration of Study: Department of Molecular Genetics, Dr. Ziauddin Hospital, Karachi, from January to December 2010. Methodology: Two hundred and ninety eight S. aureus clinical isolates were obtained from various clinical samples received at Dr. Ziauddin Hospital, Karachi. Out of these, 115 were detected as methicillin resistant (MRSA) by cefoxitin disk diffusion test showing a prevalence rate of 38.6%. Detection of individual toxin genes was performed by Polymerase Chain Reaction (PCR) by using only one primer pair for each tube. Uniplex primers were preferred as multiplex primers are longer in base pairs and have the potential for cross reaction due to non-specific binding and increase in optimization time. Results: The possession of a single gene or more than a single gene in MRSA isolates was found in 61.73% of clinical samples; the highest number was found in pus swab, followed by sputum, blood, urethral swab, and urine. The prevalence of toxin genes was higher in MRSA as compared to methicillin sensitive (MSSA) isolates (19.12%). Conclusion: PCR detects strains possessing toxin genes independent of their expression. The possession of genes for super-antigens seems to be a frequent and habitual trait of S. aureus more so in MRSA. (author)

  12. Aberrant mRNA processing of the maize Rp1-D rust resistance gene in wheat and barley.

    Science.gov (United States)

    Ayliffe, Michael A; Steinau, Martin; Park, Robert F; Rooke, Lee; Pacheco, Maria G; Hulbert, Scot H; Trick, Harold N; Pryor, Anthony J

    2004-08-01

    The maize Rp1-D gene confers race-specific resistance against Puccinia sorghi (common leaf rust) isolates containing a corresponding avrRp1-D avirulence gene. An Rp1-D genomic clone and a similar Rp1-D transgene regulated by the maize ubiquitin promoter were transformed independently into susceptible maize lines and shown to confer Rp1-D resistance, demonstrating that this resistance can be transferred as a single gene. Transfer of these functional transgenes into wheat and barley did not result in novel resistances when these plants were challenged with isolates of wheat stem rust (P. graminis), wheat leaf rust (P. triticina), or barley leaf rust (P. hordei). Regardless of the promoter employed, low levels of gene expression were observed. When constitutive promoters were used for transgene expression, a majority of Rp1-D transcripts were truncated in the nucleotide binding site-encoding region by premature polyadenylation. This aberrant mRNA processing was unrelated to gene function because an inactive version of the gene also generated such transcripts. These data demonstrate that resistance gene transfer between species may not be limited only by divergence of signaling effector molecules and pathogen avirulence ligands, but potentially also by more fundamental gene expression and transcript processing limitations.

  13. Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1

    Directory of Open Access Journals (Sweden)

    Scheffler Brian

    2009-01-01

    Full Text Available Abstract Background Lettuce (Lactuca saliva L. is susceptible to dieback, a soilborne disease caused by two viruses from the family Tombusviridae. Susceptibility to dieback is widespread in romaine and leaf-type lettuce, while modern iceberg cultivars are resistant to this disease. Resistance in iceberg cultivars is conferred by Tvr1 - a single, dominant gene that provides durable resistance. This study describes fine mapping of the resistance gene, analysis of nucleotide polymorphism and linkage disequilibrium in the Tvr1 region, and development of molecular markers for marker-assisted selection. Results A combination of classical linkage mapping and association mapping allowed us to pinpoint the location of the Tvr1 resistance gene on chromosomal linkage group 2. Nine molecular markers, based on expressed sequence tags (EST, were closely linked to Tvr1 in the mapping population, developed from crosses between resistant (Salinas and Salinas 88 and susceptible (Valmaine cultivars. Sequencing of these markers from a set of 68 cultivars revealed a relatively high level of nucleotide polymorphism (θ = 6.7 × 10-3 and extensive linkage disequilibrium (r2 = 0.124 at 8 cM in this region. However, the extent of linkage disequilibrium was affected by population structure and the values were substantially larger when the analysis was performed only for romaine (r2 = 0.247 and crisphead (r2 = 0.345 accessions. The association mapping approach revealed that one of the nine markers (Cntg10192 in the Tvr1 region matched exactly with resistant and susceptible phenotypes when tested on a set of 200 L. sativa accessions from all horticultural types of lettuce. The marker-trait association was also confirmed on two accessions of Lactuca serriola - a wild relative of cultivated lettuce. The combination of three single-nucleotide polymorphisms (SNPs at the Cntg10192 marker identified four haplotypes. Three of the haplotypes were associated with resistance and one

  14. Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China

    Directory of Open Access Journals (Sweden)

    Wang Chuanqing

    2008-05-01

    Full Text Available Abstract Background Quinolone resistance in Enterobacteriaceae results mainly from mutations in type II DNA topoisomerase genes and/or changes in the expression of outer membrane and efflux pumps. Several recent studies have indicated that plasmid-mediated resistance mechanisms also play a significant role in fluoroquinolone resistance, and its prevalence is increasing worldwide. In China, the presence of the qnr gene in the clinical isolates of Enterobacteriaceae has been reported, but this transmissible quinolone resistance gene has not been detected in strains isolated singly from pediatric patients. Because quinolones associated with a variety of adverse side effects on children, they are not authorized for pediatric use. This study therefore aimed to investigate the presence of the qnr gene in clinical isolates of E. coli and K. pneumoniae from pediatric patients in China. Methods A total 213 of non-repetitive clinical isolates resistant to ciprofloxacin from E. coli and K. pneumoniae were collected from hospitalized patients at five children's hospital in Beijing, Shanghai, Guangzhou, and Chongqing. The isolates were screened for the plasmid-mediated quinolone resistance genes of qnrA, qnrB, and qnrS by PCR. Transferability was examined by conjugation with the sodium azide-resistant E. coli J53. All qnr-positive were analyzed for clonality by enterobacterial repetitive intergenic consensus (ERIC-PCR. Results The study found that 19 ciprofloxacin-resistant clinical isolates of E. coli and K. pneumoniae were positive for the qnr gene, and most of the qnr positive strains were ESBL producers. Conjugation experiments showed that quinolone resitance could be transferred to recipients. Apart from this, different DNA banding patterns were obtained by ERIC-PCR from positive strains, which means that most of them were not clonally related. Conclusion This report on transferable fluoroquinolone resistance due to the qnr gene among E. coli and K

  15. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  16. Multiple antibiotic resistance genes distribution in ten large-scale membrane bioreactors for municipal wastewater treatment.

    Science.gov (United States)

    Sun, Yanmei; Shen, Yue-Xiao; Liang, Peng; Zhou, Jizhong; Yang, Yunfeng; Huang, Xia

    2016-12-01

    Wastewater treatment plants are thought to be potential reservoirs of antibiotic resistance genes. In this study, GeoChip was used for analyzing multiple antibiotic resistance genes, including four multidrug efflux system gene groups and three β-lactamase genes in ten large-scale membrane bioreactors (MBRs) for municipal wastewater treatment. Results revealed that the diversity of antibiotic genes varied a lot among MBRs, but about 40% common antibiotic resistance genes were existent. The average signal intensity of each antibiotic resistance group was similar among MBRs, nevertheless the total abundance of each group varied remarkably and the dominant resistance gene groups were different in individual MBR. The antibiotic resistance genes majorly derived from Proteobacteria and Actinobacteria. Further study indicated that TN, TP and COD of influent, temperature and conductivity of mixed liquor were significant (Pantibiotic resistance genes distribution in MBRs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Abundant rifampin resistance genes and significant correlations of antibiotic resistance genes and plasmids in various environments revealed by metagenomic analysis.

    Science.gov (United States)

    Ma, Liping; Li, Bing; Zhang, Tong

    2014-06-01

    In the present study, a newly developed metagenomic analysis approach was applied to investigate the abundance and diversity of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aquaculture farm sediments, activated sludge, biofilm, anaerobic digestion sludge, and river water. BLASTX analysis against the Comprehensive Antibiotic Resistance Database was conducted for the metagenomic sequence data of each sample and then the ARG-like sequences were sorted based on structured sub-database using customized scripts. The results showed that freshwater fishpond sediment had the highest abundance (196 ppm), and anaerobic digestion sludge possessed the highest diversity (133 subtypes) of ARGs among the samples in this study. Significantly, rifampin resistance genes were universal in all the diverse samples and consistently accounted for 26.9~38.6 % of the total annotated ARG sequences. Furthermore, a significant linear correlation (R (2) = 0.924) was found between diversities (number of subtypes) of ARGs and diversities of plasmids in diverse samples. This work provided a wide spectrum scan of ARGs and MGEs in different environments and revealed the prevalence of rifampin resistance genes and the strong correlation between ARG diversity and plasmid diversity for the first time.

  18. The T687G SNP in a P-glycoprotein gene of Fasciola hepatica is not associated with resistance to triclabendazole in two resistant Australian populations.

    Science.gov (United States)

    Elliott, Timothy P; Spithill, Terry W

    2014-11-01

    Triclabendazole (TCBZ) is widely used for control of Fasciola hepatica (liver fluke) in animals and humans and resistance to this drug is now widespread. However, the mechanism of resistance to TCBZ is not known. A T687G single nucleotide polymorphism (SNP) in a P-glycoprotein gene was proposed as a molecular marker for TCBZ resistance in F. hepatica (Wilkinson et al., 2012). We analyzed this Pgp gene from TCBZ-susceptible and TCBZ-resistant populations from Australia to determine if the SNP was a marker for TCBZ resistance. From the 21 parasites studied we observed 27 individual haplotypes in the Pgp sequences which comprised seven haplotypic groups (A-G), with haplotypes A and B representing 81% of the total observed. The T687G SNP was not observed in either of the resistant or susceptible populations. We conclude that the T687G SNP in this Pgp gene is not associated with TCBZ resistance in these Australian F. hepatica populations and therefore unlikely to be a universal molecular marker for TCBZ resistance. Copyright © 2014. Published by Elsevier B.V.

  19. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Science.gov (United States)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  20. Fate and transport of antibiotic resistant bacteria and resistance genes in artificially drained agricultural fields receiving swine manure application

    Science.gov (United States)

    While previous studies have examined the occurrence of antibiotic resistant bacteria and antibiotic resistant genes around confined swine feeding operations, little information is known about their release and transport from artificially drained fields receiving swine manure application. Much of the...

  1. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  2. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms

    1977-01-01

    /(4) in all tests. They were also resistant to field populations of the pathogen when scored in disease nurseries at more than 78 locations in 29 countries in Europe, the Near East, North and South America. New Zealand, and Japan. This indicates that the 11 genes confer the same, world-wide spectrum...

  3. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat.

    Science.gov (United States)

    Bansal, Urmil K; Muhammad, Sher; Forrest, Kerrie L; Hayden, Matthew J; Bariana, Harbans S

    2015-10-01

    A new stem rust resistance gene Sr49 was mapped to chromosome 5BL of wheat. Usefulness of the closely linked markers sun209 and sun479 for marker-assisted selection of Sr49 was demonstrated. Landrace AUS28011 (Mahmoudi), collected from Ghardimaou, Tunisia, produced low stem rust response against Australian pathotypes of Puccinia graminis f. sp. tritici (Pgt) carrying virulence for several stem rust resistance genes deployed in modern wheat cultivars. Genetic analysis based on a Mahmoudi/Yitpi F3 population indicated the involvement of a single all-stage stem rust resistance gene and it was temporarily named SrM. Bulked segregant analysis using multiplex-ready SSR technology located SrM on the long arm of chromosome 5B. Since there is no other all-stage stem rust resistance gene located in chromosome 5BL, SrM was permanently designated Sr49. The Mahmoudi/Yitpi F3 population was enhanced to generate F6 recombinant inbred line (RIL) population for detailed mapping of Sr49 using publicly available genomic resources. Markers sun209 and sun479 flanked Sr49 at 1.5 and 0.9 cM distally and proximally, respectively. Markers sun209 and sun479 amplified PCR products different than the Sr49-linked alleles in 146 and 145 common wheat cultivars, respectively. Six and seven cultivars, respectively, carried the resistance-linked marker alleles sun209 148bp and sun479 200bp ; however, none of the cultivars carried both resistance-linked alleles. These results demonstrated the usefulness of these markers for marker-assisted selection of Sr49 in breeding programs.

  4. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    Science.gov (United States)

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene transfer between raw sludge bacteria and the digester microbial community. PMID:27014196

  5. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  6. Antibiotic resistance genes and residual antimicrobials in cattle feedlot surface soil

    Science.gov (United States)

    Antibiotic residues and resistant bacteria in cattle feedlot manure may impact antibiotic resistance in the environment. This study investigated common antimicrobials (tetracyclines and monensin) and associated resistance genes in cattle feedlot soils over time. Animal diets and other feedlot soil...

  7. Novel streptomycin and spectinomycin resistance gene as a gene cassette within a class 1 integron isolated from Escherichia coli

    DEFF Research Database (Denmark)

    Sandvang, D.

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim...... resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate....

  8. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    Science.gov (United States)

    Sandvang, Dorthe

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  9. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  10. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Science.gov (United States)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  11. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...

  12. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates

    DEFF Research Database (Denmark)

    Argudin, Maria Angeles; Lauzat, Birgit; Kraushaar, Britta

    2016-01-01

    substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus...... collection [n = 554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n = 456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic......, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398...

  13. Resistance of Antimicrobial Peptide Gene Transgenic Rice to Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Wei WANG

    2011-03-01

    Full Text Available Antimicrobial peptide is a polypeptide with antimicrobial activity. Antimicrobial peptide genes Np3 and Np5 from Chinese shrimp (Fenneropenaeus Chinensis were integrated into Oryza sativa L. subsp. japonica cv. Aichi ashahi by Agrobacterium mediated transformation system. PCR analysis showed that the positive ratios of Np3 and Np5 were 36% and 45% in T0 generation, respectively. RT-PCR analysis showed that the antimicrobial peptide genes were expressed in T1 generation, and there was no obvious difference in agronomic traits between transgenic plants and non-transgenic plants. Four Np3 and Np5 transgenic lines in T1 generation were inoculated with Xanthomonas oryzae pv. oryzae strain CR4, and all the four transgenic lines had significantly enhanced resistance to bacterial blight caused by the strain CR4. The Np5 transgenic lines also showed higher resistance to bacterial blight caused by strains JS97-2, Zhe 173 and OS-225. It is suggested that transgenic lines with Np5 gene might possess broad spectrum resistance to rice bacterial blight.

  14. Countering criticisms of single mitochondrial DNA gene barcoding in birds.

    Science.gov (United States)

    Baker, Allan J; Tavares, Erika Sendra; Elbourne, Rebecca F

    2009-05-01

    General criticisms of a single mtDNA gene barcodes include failure to identify newly evolved species, use of species-delimitation thresholds, effects of selective sweeps and chance occurrence of reciprocal monophyly within species, inability to deal with hybridization and incomplete lineage sorting, and superiority of multiple genes in species identification. We address these criticisms in birds because most species are known and thus provide an ideal test data set, and we argue with selected examples that with the exception of thresholds these criticisms are not problematic for avian taxonomy. Even closely related sister species of birds have distinctive COI barcodes, but it is not possible to universally apply distance thresholds based on ratios of within-species and among-species variation. Instead, more rigorous methods of species delimitation should be favoured using coalescent-based techniques that include tests of chance reciprocal monophyly, and times of lineage separation and sequence divergence. Incomplete lineage sorting is also easily detected with DNA barcodes, and usually at a younger time frame than a more slowly evolving nuclear gene. Where DNA barcodes detect divergent reciprocally monophyletic lineages, the COI sequences can be combined with multiple nuclear genes to distinguish between speciation or population subdivision arising from high female philopatry or regional selective sweeps. Although selective sweeps are increasingly invoked to explain patterns of shallow within-species coalescences in COI gene trees, caution is warranted in this conjecture because of limited sampling of individuals and the reduced power to detect additional mtDNA haplotypes with one gene. © 2009 Blackwell Publishing Ltd.

  15. Expression levels of resistant genes affect cervical cancer prognosis.

    Science.gov (United States)

    Yang, Fengmei; Gao, Bo; Li, Rui; Li, Wencui; Chen, Wei; Yu, Zongtao; Zhang, Jicai

    2017-05-01

    Tumor cells may develop multidrug resistance (MDR) to various chemotherapy regimens. Such resistance reduces the sensitivity of cells to chemotherapy drugs, leading to the failure of cervical cancer (CC) treatment and disease progression. The present study aimed to investigate the role of MDR1, lung resistance protein (LRP) and placental glutathione S‑transferase π 1 (GSTP1) in CC and MDR, and the prognostic value of these genes. The mRNA expression levels of these resistance‑associated genes were determined in 47 CC and 20 healthy cervical tissue samples. Subsequently, the data was analyzed alongside clinicopathological parameters. The mRNA expression levels of MDR1, LRP and GSTP1 in CC were 0.57±0.32, 0.58±0.29 and 0.44±0.24, respectively, whereas those in healthy cervical tissues were 0.19±0.10, 0.17±0.14 and 0.18±0.10, respectively. Therefore, the expression levels of these genes were significantly greater in CC compared with healthy cervical tissue (PMRD1 were increased in the well differentiated group (0.68±0.27) compared with the poorly differentiated group (0.38±0.33; P0.05). Multivariate logistic regression indicated that the degree of differentiation and the MDR1 gene expression levels were predictors of CC prognosis (P<0.05). The survival rate of patients in the MDR1‑negative group was significantly greater compared with the MDR1‑positive group (P<0.05). The results of the present study therefore suggested that MDR1 gene expression is a predictor of poor survival in CC.

  16. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  17. Tagging microsatellite marker to a blast resistance gene in the irrigated rice cultivar Cica-8

    Directory of Open Access Journals (Sweden)

    Thiago Martins Pinheiro

    2012-09-01

    Full Text Available The rice cultivar Cica-8 exhibit differential reaction to several pathotypes of Magnaporthe oryzae. The objective of the present investigation was to determine the number of alleles involved in the expression of resistance to leaf blast and identify microsatellite markers linked to these alleles. A cross between cultivar Metica-1 and Cica-8 susceptible and resistant, respectively, to pathotype IB-1 (Py1049 was made to obtain F1, F2, BC1:1 and BC1:2 progenies. Greenhouse tests for leaf blast reaction showed that resistance is controlled by a monogenic dominant gene. For testing microsatellite markers, DNA of both resistant and susceptible parents and F1 and F2 populations was extracted. As expected for single dominant gene the F2 populations segregated at a ratio of 3:1. Of the 11 microsatellite markers tested, one marker RM 7102 was found to be closely linked to the resistant allele at a distance of 2.7 cM, in the cultivar Cica-8 to pathotype IB-1.

  18. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  19. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Energy Technology Data Exchange (ETDEWEB)

    Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

    2004-01-13

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

  20. Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.

    Science.gov (United States)

    López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V

    2003-08-01

    Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

  1. A single gene (yes controls pigmentation of eyes and scales in Heliothis virescens

    Directory of Open Access Journals (Sweden)

    Thomas M. Brown

    2001-02-01

    Full Text Available A yellow-eyed mutant was discovered in a strain of Heliothis virescens, the tobacco budworm, that already exhibited a mutation for yellow scale, y. We investigated the inheritance of these visible mutations as candidate markers for transgenesis. Yellow eye was controlled by a single, recessive, autosomal factor, the same type of inheritance previously known for y. Presence of the recombinant mutants with yellow scales with wild type eyes in test crosses indicated independent segregation of genes for these traits. The recombinant class with wild type scales and yellow eyes was completely absent and there was a corresponding increase of the double mutant parental class having yellow scales and yellow eyes. These results indicated that a single factor for yellow eye also controls yellow scales independently of y. This gene was named yes, for yellow eye and scale. We hypothesize that yes controls both eye and scale color through a deficiency in transport of pigment precursors in both the ommochrome and melanin pathways. The unlinked gene y likely controls an enzyme affecting the melanin pathway only. Both y and yes segregated independently of AceIn, acetylcholinesterase insensitivity, and sodium channel hscp, which are genes related to insecticide resistance.

  2. Resistance gene homologues in melon are linked to genetic loci conferring disease and pest resistance.

    Science.gov (United States)

    Brotman, Y.; Silberstein, L.; Kovalski, I.; Perin, C.; Dogimont, C.; Pitrat, M.; Klingler, J.; Thompson, A.; Perl-Treves, R.

    2002-05-01

    Genomic and cDNA fragments with homology to known disease resistance genes (RGH fragments) were cloned from Cucumis melo using degenerate-primer PCR. Fifteen homologues of the NBS-LRR gene family have been isolated. The NBS-LRR homologues show high divergence and, based on the partial NBS-fragment sequences, appear to include members of the two major subfamilies that have been described in dicot plants, one that possesses a TIR-protein element and one that lacks such a domain. Genomic organization of these sequences was explored by DNA gel-blot analysis, and conservation among other Cucurbitaceae was assessed. Two mapping populations that segregate for several disease and pest resistance loci were used to map the RGH probes onto the melon genetic map. Several NBS-LRR related sequences mapped to the vicinity of genetic loci that control resistance to papaya ringspot virus, Fusarium oxysporum race 1, F. oxysporum race 2 and to the insect pest Aphis gossypii. The utility of such markers for breeding resistant melon cultivars and for cloning the respective R-genes is discussed.

  3. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  4. Vancomycin-resistant Enterococcus faecium with vanA gene isolated for the first time from wildlife in Slovakia.

    Science.gov (United States)

    Oravcova, Veronika; Hadelova, Daniela; Literak, Ivan

    2016-10-15

    Corvids have been identified as an important vector of vancomycin-resistant enterococci (VRE) in several European countries. The aim of this study was to assess the prevalence of VRE in wildlife in Slovakia and to characterize vanA-carrying VRE. At the beginning of 2013, we collected 287 fecal samples of common raven (Corvus corax) in Petrovce and 99 fecal samples of rooks (Corvus frugilegus) in Kosice. Samples were cultured selectively on Slanetz-Bartley agar with vancomycin and screened for vanA, other resistance genes, and virulence genes. PCR mapping of Tn1546 carrying vanA gene was performed. Multilocus sequence typing and pulsed-field gel electrophoresis were used to examine the genotypic diversity of vanA-containing VRE. The mobility of vancomycin resistance traits was tested in vitro, using filter mating experiments. VRE with the vanA gene were found in 4 (1.4%) of 287 raven samples and in one (1%) of 99 rook samples. All 5 isolates belonged to Enterococcus faecium and were multiresistant with resistance to erythromycin encoded by the erm(B) gene, tetracycline (tet(M) and tet(L) genes), and ampicillin (mutations in C-terminal region of pbp5 gene). Isolates from Petrovce also were resistant to chloramphenicol. Virulence genes were not proven. The vanA gene was carried by Tn1546 types E (combined with insertion sequence IS1216) or F5 (IS1251). One isolate from a rook in Kosice belonged to ST (sequence type) 6 and the remaining four from ravens in Petrovce belonged to new ST917 (a single locus variant of ST18). All tested VRE were able to transfer the vancomycin resistance trait. In conclusion, we identified clinically important enterococci with the vanA gene in corvids in Slovakia. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  6. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  7. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  8. Novel polymorphisms and lack of mutations in the ACD gene in patients with ACTH resistance syndromes.

    Science.gov (United States)

    Keegan, Catherine E; Hutz, Janna E; Krause, Andrea S; Koehler, Katrin; Metherell, Louise A; Boikos, Sosipatros; Stergiopoulos, Sotirios; Clark, Adrian J L; Stratakis, Constantine A; Huebner, Angela; Hammer, Gary D

    2007-08-01

    ACTH resistance is a feature of several human syndromes with known genetic causes, including familial glucocorticoid deficiency (types 1 and 2) and triple A syndrome. However, many patients with ACTH resistance lack an identifiable genetic aetiology. The human homolog of the Acd gene, mutated in a mouse model of adrenal insufficiency, was sequenced in 25 patients with a clinical diagnosis of familial glucocorticoid deficiency or triple A syndrome. A 3.4 kilobase genomic fragment containing the entire ACD gene was analysed for mutations in all 25 patients. Samples were obtained by three investigators from different institutions. The primary cohort consisted of 25 unrelated patients, primarily of European or Middle Eastern descent, with a clinical diagnosis of either familial glucocorticoid deficiency (FGD) or triple A syndrome. Patients lacked mutations in other genes known to cause ACTH resistance, including AAAS for patients diagnosed with triple A syndrome and MC2R and MRAP for patients diagnosed with familial glucocorticoid deficiency. Thirty-five additional patients with adrenal disease phenotypes were added to form an expanded cohort of 60 patients. Identification of DNA sequence changes in the ACD gene in the primary cohort and analysis of putative ACD haplotypes in the expanded cohort. No disease-causing mutations were found, but several novel single nucleotide polymorphisms (SNPs) and two putative haplotypes were identified. The overall frequency of SNPs in ACD is low compared to other gene families. No mutations were identified in ACD in this collection of patients with ACTH resistance phenotypes. However, the newly identified SNPs in ACD should be more closely examined for possible links to disease.

  9. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  10. Label-free screening of single biomolecules through resistive pulse sensing technology for precision medicine applications

    Science.gov (United States)

    Harrer, S.; Kim, S. C.; Schieber, C.; Kannam, S.; Gunn, N.; Moore, S.; Scott, D.; Bathgate, R.; Skafidas, S.; Wagner, J. M.

    2015-05-01

    Employing integrated nano- and microfluidic circuits for detecting and characterizing biological compounds through resistive pulse sensing technology is a vibrant area of research at the interface of biotechnology and nanotechnology. Resistive pulse sensing platforms can be customized to study virtually any particle of choice which can be threaded through a fluidic channel and enable label-free single-particle interrogation with the primary read-out signal being an electric current fingerprint. The ability to perform label-free molecular screening with single-molecule and even single binding site resolution makes resistive pulse sensing technology a powerful tool for analyzing the smallest units of biological systems and how they interact with each other on a molecular level. This task is at the core of experimental systems biology and in particular ‘omics research which in combination with next-generation DNA-sequencing and next-generation drug discovery and design forms the foundation of a novel disruptive medical paradigm commonly referred to as personalized medicine or precision medicine. DNA-sequencing has approached the 1000-Dollar-Genome milestone allowing for decoding a complete human genome with unmatched speed and at low cost. Increased sequencing efficiency yields massive amounts of genomic data. Analyzing this data in combination with medical and biometric health data eventually enables understanding the pathways from individual genes to physiological functions. Access to this information triggers fundamental questions for doctors and patients alike: what are the chances of an outbreak for a specific disease? Can individual risks be managed and if so how? Which drugs are available and how should they be applied? Could a new drug be tailored to an individual’s genetic predisposition fast and in an affordable way? In order to provide answers and real-life value to patients, the rapid evolvement of novel computing approaches for analyzing big data in

  11. The tandem repeated organization of NB-LRR genes in the clubroot-resistant CRb locus in Brassica rapa L.

    Science.gov (United States)

    Hatakeyama, Katsunori; Niwa, Tomohisa; Kato, Takeyuki; Ohara, Takayoshi; Kakizaki, Tomohiro; Matsumoto, Satoru

    2017-04-01

    To facilitate prevention of clubroot disease, a major threat to the successful cultivation of Chinese cabbage (Brassica rapa L.), we bred clubroot-resistant (CR) cultivars by introducing resistance genes from CR turnips via conventional breeding. Among 11 CR loci found in B. rapa, we identified CRb in Chinese cabbage cultivar 'CR Shinki' as a single dominant gene for resistance against Plasmodiophora brassicae pathotype group 3, against which the stacking of Crr1 and Crr2 loci was not effective. However, the precise location and pathotype specificity of CRb have been controversial, because CRa and Rcr1 also map near this locus. Previously, our fine-mapping study revealed that CRb is located in a 140-kb genomic region on chromosome A03. Here, we determined the nucleotide sequence of an approximately 64-kb candidate region in the resistant line; this region contains six open reading frames (ORFs) similar to NB-LRR encoding genes that are predicted to occur in tandem with the same orientation. Among the six ORFs present, only four on the genome of the resistant line showed a strong DNA sequence identity with each other, and only one of those four could confer resistance to P. brassicae isolate No. 14 of the pathotype group 3. These results suggest that these genes evolved through recent gene duplication and uneven crossover events that could lead to the acquisition of clubroot resistance. The DNA sequence of the functional ORF was identical to that of the previously cloned CRa gene; thus, we showed that the independently identified CRb and CRa are one and the same clubroot-resistance gene.

  12. Paraquat resistance in a Lolium rigidum population is governed by one major nuclear gene.

    Science.gov (United States)

    Yu, Qin; Han, Heping; Nguyen, Linh; Forster, John W; Powles, Stephen B

    2009-05-01

    Paraquat resistance in an annual ryegrass (Lolium rigidum Gaud.) population (AFLR1) has been attributed to reduced paraquat translocation. Genetic inheritance of paraquat resistance in this population was investigated in the present study. The paraquat dose response of progeny from 8 F(1) families was more similar to that of the resistant than the susceptible parent, while the equivalent data for a further three families were intermediate compared to those of the parental populations. No significant differences in dose response were observed between reciprocal crosses of specific F(1) families. These results suggest that paraquat resistance in AFLR1 is inherited as a dominant or partially dominant nuclear-encoded trait. Pseudo-F(2) (psi-F(2)) generation seedlings were treated with multiple dose rates sufficient to control the susceptible parental population, and observed segregation ratios in all instances conformed to a 3:1 (resistant:susceptible) segregation ratio, and this ratio was further confirmed by individual phenotyping of cloned plant genotypes. A single major nuclear gene is hence apparently responsible for evolved paraquat resistance in AFLR1.

  13. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    OpenAIRE

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human?s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistan...

  14. Identification of ABC transporter genes conferring combined pleuromutilin-lincosamide-streptogramin A resistance in bovine methicillin-resistant Staphylococcus aureus and coagulase-negative staphylococci.

    Science.gov (United States)

    Wendlandt, Sarah; Kadlec, Kristina; Feßler, Andrea T; Schwarz, Stefan

    2015-06-12

    The aim of this study was to investigate the genetic basis of combined pleuromutilin-lincosamide-streptogramin A resistance in 26 unrelated methicillin-resistant Staphylococcus aureus (MRSA) and coagulase-negative staphylococci (CoNS) from dairy cows suffering from mastitis. The 26 pleuromutilin-resistant staphylococcal isolates were screened for the presence of the genes vga(A), vga(B), vga(C), vga(E), vga(E) variant, sal(A), vmlR, cfr, lsa(A), lsa(B), lsa(C), and lsa(E) by PCR. None of the 26 isolates carried the genes vga(B), vga(C), vga(E), vga(E) variant, vmlR, cfr, lsa(A), lsa(B), or lsa(C). Two Staphylococcus haemolyticus and single Staphylococcus xylosus, Staphylococcus lentus, and Staphylococcus hominis were vga(A)-positive. Twelve S. aureus, two Staphylococcus warneri, as well as single S. lentus and S. xylosus carried the lsa(E) gene. Moreover, single S. aureus, S. haemolyticus, S. xylosus, and Staphylococcus epidermidis were positive for both genes, vga(A) and lsa(E). The sal(A) gene was found in a single Staphylococcus sciuri. All ABC transporter genes were located in the chromosomal DNA, except for a plasmid-borne vga(A) gene in the S. epidermidis isolate. The genetic environment of the lsa(E)-positive isolates was analyzed using previously described PCR assays. Except for the S. warneri and S. xylosus, all lsa(E)-positive isolates harbored a part of the previously described enterococcal multiresistance gene cluster. This is the first report of the novel lsa(E) gene in the aforementioned bovine CoNS species. This is also the first identification of the sal(A) gene in a S. sciuri from a case of bovine mastitis. Moreover, the sal(A) gene was shown to also confer pleuromutilin resistance. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  16. pncA gene expression and prediction factors on pyrazinamide resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Sheen, Patricia; Lozano, Katherine; Gilman, Robert H; Valencia, Hugo J; Loli, Sebastian; Fuentes, Patricia; Grandjean, Louis; Zimic, Mirko

    2013-09-01

    Mutations in the pyrazinamidase (PZAse) coding gene, pncA, have been considered as the main cause of pyrazinamide (PZA) resistance in Mycobacterium tuberculosis. However, recent studies suggest there is no single mechanism of resistance to PZA. The pyrazinoic acid (POA) efflux rate is the basis of the PZA susceptibility Wayne test, and its quantitative measurement has been found to be a highly sensitive and specific predictor of PZA resistance. Based on biological considerations, the POA efflux rate is directly determined by the PZAse activity, the level of pncA expression, and the efficiency of the POA efflux pump system. This study analyzes the individual and the adjusted contribution of PZAse activity, pncA expression and POA efflux rate on PZA resistance. Thirty M. tuberculosis strains with known microbiological PZA susceptibility or resistance were analyzed. For each strain, PZAse was recombinantly produced and its enzymatic activity measured. The level of pncA mRNA was estimated by quantitative RT-PCR, and the POA efflux rate was determined. Mutations in the pncA promoter were detected by DNA sequencing. All factors were evaluated by multiple regression analysis to determine their adjusted effects on the level of PZA resistance. Low level of pncA expression associated to mutations in the pncA promoter region was observed in pncA wild type resistant strains. POA efflux rate was the best predictor after adjusting for the other factors, followed by PZAse activity. These results suggest that tests which rely on pncA mutations or PZAse activity are likely to be less predictive of real PZA resistance than tests which measure the rate of POA efflux. This should be further analyzed in light of the development of alternate assays to determine PZA resistance. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  18. Diversity of Integron- and Culture-Associated Antibiotic Resistance Genes in Freshwater Floc

    OpenAIRE

    Drudge, Christopher N.; Elliott, Amy V. C.; Plach, Janina M.; Ejim, Linda J.; Wright, Gerard D.; Droppo, Ian G.; Warren, Lesley A.

    2012-01-01

    Clinically important antibiotic resistance genes were detected in culturable bacteria and class 1 integron gene cassettes recovered from suspended floc, a significant aquatic repository for microorganisms and trace elements, across freshwater systems variably impacted by anthropogenic activities. Antibiotic resistance gene cassettes in floc total community DNA differed appreciably in number and type from genes detected in bacteria cultured from floc. The number of floc antibiotic resistance g...

  19. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  20. Detection and fine-mapping of SC7 resistance genes via linkage and association analysis in soybean.

    Science.gov (United States)

    Yan, Honglang; Wang, Hui; Cheng, Hao; Hu, Zhenbin; Chu, Shanshan; Zhang, Guozheng; Yu, Deyue

    2015-08-01

    Soybean mosaic virus (SMV) disease is one of the most serious and broadly distributed soybean (Glycine max (L.) Merr.) diseases. Here, we combine the advantages of association and linkage analysis to identify and fine-map the soybean genes associated with resistance to SMV strain SC7. A set of 191 soybean accessions from different geographic origins and 184 recombinant inbred lines (RILs) derived from Kefeng No.1 (resistant) × Nannong 1138-2 (susceptible) were used in this study. The SC7 resistance genes were previously mapped to a 2.65 Mb region on chromosome 2 and a 380 kb region on chromosome 13. Among 19 single nucleotide polymorphisms (SNPs) detected via association analysis in the study, the SNP BARC-021625-04157 was located in the 2.65 Mb region, and the SNP BARC-041671-08065 was located near the 380 kb region; three genes harboring the SNPs were probably related to SC7 resistance. The resistance gene associated with BARC-021625-04157 was then fine-mapped to a region of approximately 158 kb on chromosome 2 using 184 RILs. Among the 15 genes within this region, one NBS-LRR type gene, one HSP40 gene and one serine carboxypeptidase-type gene might be candidate SC7 resistance genes. These results will be useful for map-based cloning and marker-assisted selection in soybean breeding programs. © 2014 Institute of Botany, Chinese Academy of Sciences.

  1. Stormwater loadings of antibiotic resistance genes in an urban stream.

    Science.gov (United States)

    Garner, Emily; Benitez, Romina; von Wagoner, Emily; Sawyer, Richard; Schaberg, Erin; Hession, W Cully; Krometis, Leigh-Anne H; Badgley, Brian D; Pruden, Amy

    2017-10-15

    Antibiotic resistance presents a critical public health challenge and the transmission of antibiotic resistance via environmental pathways continues to gain attention. Factors driving the spread of antibiotic resistance genes (ARGs) in surface water and sources of ARGs in urban stormwater have not been well-characterized. In this study, five ARGs (sul1, sul2, tet(O), tet(W), and erm(F)) were quantified throughout the duration of three storm runoff events in an urban inland stream. Storm loads of all five ARGs were significantly greater than during equivalent background periods. Neither fecal indicator bacteria measured (E. coli or enterococci) was significantly correlated with sul1, sul2, or erm(F), regardless of whether ARG concentration was absolute or normalized to 16S rRNA levels. Both E. coli and enterococci were correlated with the tetracycline resistance genes, tet(O) and tet(W). Next-generation shotgun metagenomic sequencing was conducted to more thoroughly characterize the resistome (i.e., full complement of ARGs) and profile the occurrence of all ARGs described in current databases in storm runoff in order to inform future watershed monitoring and management. Between 37 and 121 different ARGs were detected in each stream sample, though the ARG profiles differed among storms. This study establishes that storm-driven transport of ARGs comprises a considerable fraction of overall downstream loadings and broadly characterizes the urban stormwater resistome to identify potential marker ARGs indicative of impact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants.

    Science.gov (United States)

    Das, Surajit; Dash, Hirak R; Chakraborty, Jaya

    2016-04-01

    Metal pollution is one of the most persistent and complex environmental issues, causing threat to the ecosystem and human health. On exposure to several toxic metals such as arsenic, cadmium, chromium, copper, lead, and mercury, several bacteria has evolved with many metal-resistant genes as a means of their adaptation. These genes can be further exploited for bioremediation of the metal-contaminated environments. Many operon-clustered metal-resistant genes such as cadB, chrA, copAB, pbrA, merA, and NiCoT have been reported in bacterial systems for cadmium, chromium, copper, lead, mercury, and nickel resistance and detoxification, respectively. The field of environmental bioremediation has been ameliorated by exploiting diverse bacterial detoxification genes. Genetic engineering integrated with bioremediation assists in manipulation of bacterial genome which can enhance toxic metal detoxification that is not usually performed by normal bacteria. These techniques include genetic engineering with single genes or operons, pathway construction, and alternations of the sequences of existing genes. However, numerous facets of bacterial novel metal-resistant genes are yet to be explored for application in microbial bioremediation practices. This review describes the role of bacteria and their adaptive mechanisms for toxic metal detoxification and restoration of contaminated sites.

  3. A review of the influence of treatment strategies on antibiotic resistant bacteria and antibiotic resistance genes.

    Science.gov (United States)

    Sharma, Virender K; Johnson, Natalie; Cizmas, Leslie; McDonald, Thomas J; Kim, Hyunook

    2016-05-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in the aquatic environment have become an emerging contaminant issue, which has implications for human and ecological health. This review begins with an introduction to the occurrence of ARB and ARG in different environmental systems such as natural environments and drinking water resources. For example, ARG or ARB with resistance to ciprofloxacin, sulfamethoxazole, trimethoprim, quinolone, vancomycin, or tetracycline (e.g., tet(A), tet(B), tet(C), tet(G), tet(O), tet(M), tet(W), sul I, and sul II) have been detected in the environment. The development of resistance may be intrinsic, may be acquired through spontaneous mutations (de novo), or may occur due to horizontal gene transfer from donor bacteria, phages, or free DNA to recipient bacteria. An overview is also provided of the current knowledge regarding inactivation of ARB and ARG, and the mechanism of the effects of different disinfection processes in water and wastewater (chlorination, UV irradiation, Fenton reaction, ozonation, and photocatalytic oxidation). The effects of constructed wetlands and nanotechnology on ARB and ARG are also summarized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...... strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...

  5. Versatile nourseothricin and streptomycin/spectinomycin resistance gene cassettes and their use in chromosome integration vectors.

    Science.gov (United States)

    Lehman, Stephanie S; Mladinich, Katherine M; Boonyakanog, Angkana; Mima, Takehiko; Karkhoff-Schweizer, RoxAnn R; Schweizer, Herbert P

    2016-10-01

    An obstacle for the development of genetic systems for many bacteria is the limited number of antibiotic selection markers, especially for bacteria that are intrinsically antibiotic resistant or where utilization of such markers is strictly regulated. Here we describe the development of versatile cassettes containing nourseothricin, streptomycin/spectinomycin, and spectinomycin selection markers. The antibiotic resistance genes contained on these cassettes are flanked by loxP sites with allow their in vivo excision from the chromosome of target bacteria using Cre recombinase. The respective selection marker cassettes were used to derive mini-Tn7 elements that can be used for single-copy insertion of genes into bacterial chromosomes. The utility of the selection markers was tested by insertion of the resulting mini-Tn7 elements into the genomes of Burkholderia thailandensis and B. pseudomallei efflux pump mutants susceptible to aminoglycosides, aminocyclitols, and streptothricins, followed by Cre-mediated antibiotic resistance marker excision. The versatile nourseothricin, streptomycin/spectinomycin and spectinomycin resistance loxP cassette vectors described here extend the repertoire of antibiotic selection markers for genetic manipulation of diverse bacteria that are susceptible to aminoglycosides and aminocyclitols. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  7. Survival of antibiotic resistant bacteria and horizontal gene transfer control antibiotic resistance gene content in anaerobic digesters

    Directory of Open Access Journals (Sweden)

    Jennifer Hafer Miller

    2016-03-01

    Full Text Available Understanding fate of antibiotic resistant bacteria (ARB versus their antibiotic resistance genes (ARGs during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp. and thermophilic (Iso T10- a Bacillus sp. anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic or 1-log above baseline (mesophilic while levels of the ARG present in the spiked isolate (tet(G remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O, tet(W, and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457 to 0.829, P<0.05 with the raw feed sludge. There was no correlation in tet(O or tet(W ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130 to 0.486, P = 0.075 to 0.612. However, in the thermophilic digester, the tet(O and tet(W ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and

  8. A Comprehensive Insight into Tetracycline Resistant Bacteria and Antibiotic Resistance Genes in Activated Sludge Using Next-Generation Sequencing

    OpenAIRE

    Huang, Kailong; Tang, Junying; Zhang, Xu-Xiang; Xu, Ke; Ren, Hongqiang

    2014-01-01

    In order to comprehensively investigate tetracycline resistance in activated sludge of sewage treatment plants, 454 pyrosequencing and Illumina high-throughput sequencing were used to detect potential tetracycline resistant bacteria (TRB) and antibiotic resistance genes (ARGs) in sludge cultured with different concentrations of tetracycline. Pyrosequencing of 16S rRNA gene revealed that tetracycline treatment greatly affected the bacterial community structure of the sludge. Nine genera cons...

  9. Fate of antibiotic resistant cultivable heterotrophic bacteria and antibiotic resistance genes in wastewater treatment processes.

    Science.gov (United States)

    Zhang, Songhe; Han, Bing; Gu, Ju; Wang, Chao; Wang, Peifang; Ma, Yanyan; Cao, Jiashun; He, Zhenli

    2015-09-01

    Antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are emerging contaminants of environmental concern. Heterotrophic bacteria in activated sludge have an important role in wastewater treatment plants (WWTPs). However, the fate of cultivable heterotrophic ARB and ARGs in WWPTs process remains unclear. In the present study, we investigated the antibiotic-resistant phenotypes of cultivable heterotrophic bacteria from influent and effluent water of three WWTPs and analysed thirteen ARGs in ARB and in activated sludge from anoxic, anaerobic and aerobic compartments. From each influent or effluent sample of the three plants, 200 isolates were randomly tested for susceptibility to 12 antibiotics. In these samples, between 5% and 64% isolates showed resistance to >9 antibiotics and the proportion of >9-drug-resistant bacteria was lower in isolates from effluent than from influent. Eighteen genera were identified in 188 isolates from influent (n=94) and effluent (n=94) of one WWTP. Six genera (Aeromonas, Bacillus, Lysinibacillus, Microbacterium, Providencia, and Staphylococcus) were detected in both influent and effluent samples. Gram-negative and -positive isolates dominated in influent and effluent, respectively. The 13 tetracycline-, sulphonamide-, streptomycin- and β-lactam-resistance genes were detected at a higher frequency in ARB from influent than from effluent, except for sulA and CTX-M, while in general, the abundances of ARGs in activated sludge from two of the three plants were higher in aerobic compartments than in anoxic ones, indicating abundant ARGs exit in the excess sledges and/or in uncultivable bacteria. These findings may be useful for elucidating the effect of WWTP on ARB and ARGs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Rapid Screening of Topoisomerase Gene Mutations by a Novel Melting Curve Analysis Method for Early Warning of Fluoroquinolone-Resistant Streptococcus pneumoniae Emergence▿

    OpenAIRE

    Fukushima, Kazuko Y.; Hirakata, Yoichi; Sugahara, Kazuyuki; Yanagihara, Katsunori; Kondo, Akira; Kohno, Shigeru; Kamihira, Shimeru

    2006-01-01

    We developed a real-time PCR assay combined with melting curve analysis for rapidly genotyping quinolone resistance-determining regions (QRDR) of topoisomerase genes in Streptococcus pneumoniae. This assay was not only accurate for the screening of fluoroquinolone (FQ) resistance but also relevant as an early warning system for detecting preexisting single QRDR mutations.

  11. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Sandra Prüller

    Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.

  12. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes

    Science.gov (United States)

    Prüller, Sandra; Rensch, Ulrike; Meemken, Diana; Kaspar, Heike; Kopp, Peter A.; Klein, Günter; Kehrenberg, Corinna

    2015-01-01

    Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1–2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147), blaOXA-2, (n = 4), strA and strB (n = 17), sul1 (n = 10), sul2 (n = 73), dfrA7 (n = 3) and tet(A) (n = 8) were detected and a plasmid localisation was identified for several of the resistance genes. PMID:26275219

  13. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    Science.gov (United States)

    Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (panimal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China. PMID:25405870

  14. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae.

    Directory of Open Access Journals (Sweden)

    Alin M Puinean

    2010-06-01

    Full Text Available The aphid Myzus persicae is a globally significant crop pest that has evolved high levels of resistance to almost all classes of insecticide. To date, the neonicotinoids, an economically important class of insecticides that target nicotinic acetylcholine receptors (nAChRs, have remained an effective control measure; however, recent reports of resistance in M. persicae represent a threat to the long-term efficacy of this chemical class. In this study, the mechanisms underlying resistance to the neonicotinoid insecticides were investigated using biological, biochemical, and genomic approaches. Bioassays on a resistant M. persicae clone (5191A suggested that P450-mediated detoxification plays a primary role in resistance, although additional mechanism(s may also contribute. Microarray analysis, using an array populated with probes corresponding to all known detoxification genes in M. persicae, revealed constitutive over-expression (22-fold of a single P450 gene (CYP6CY3; and quantitative PCR showed that the over-expression is due, at least in part, to gene amplification. This is the first report of a P450 gene amplification event associated with insecticide resistance in an agriculturally important insect pest. The microarray analysis also showed over-expression of several gene sequences that encode cuticular proteins (2-16-fold, and artificial feeding assays and in vivo penetration assays using radiolabeled insecticide provided direct evidence of a role for reduced cuticular penetration in neonicotinoid resistance. Conversely, receptor radioligand binding studies and nucleotide sequencing of nAChR subunit genes suggest that target-site changes are unlikely to contribute to resistance to neonicotinoid insecticides in M. persicae.

  15. Characterization of resistance genes to Cladosporium fulvum on the short arm of chromosome 1 of tomato

    NARCIS (Netherlands)

    Haanstra, J.

    2000-01-01

    Plant breeders generally use qualitative resistance that is associated with a hypersensitive reaction (HR) to obtain cultivars that are resistant to pathogens and pests. The genetics of this resistance is based on the gene-for-gene relationship, which involves the product of a plant

  16. Distribution and quantification of antibiotic resistance genes and bacteria across agricultural and non-agricultural metagenomes

    Science.gov (United States)

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described and few details are known about how antibiotic resistance genes i...

  17. Rapid identification of rice blast resistance gene by specific length amplified fragment sequencing

    Directory of Open Access Journals (Sweden)

    Shen Chen

    2016-05-01

    Full Text Available Excavation of resistance genes is one of the most effective and environment-friendly measures to control the devastating rice disease caused by Magnaporthe oryzae. Many resistance genes have been mapped and characterized in the last century. Nevertheless, only a few of the total resistance genes could be really applied in the rice breeding program. Huazhan (HZ is a new native rice restorer line developed in China and widely used in hybrid rice in recent years. HZ and its crossed combinations usually show a broad spectrum of resistance against rice blast in different rice ecosystems in China. Dissection of the genetic background of HZ is very useful for its further application. In this study, a combined method based on bulked segregation analysis (BSA and specific length amplified fragment sequencing (SLAF-seq was used to identify blast resistance gene(s in HZ. A total of 56,187 SLAFs labels were captured and 9051 polymorphic SLAFs markers were analysed and procured in this study. One trait associated with candidate resistance genes region on chromosome 12 overlapping 10.2–17.6 Mb has been identified, in which 10 NBS-LRR (nucleotide-binding site-leucine-rich repeat coding genes were used as resistance gene candidates. Our result indicated that SLAF-seq with BSA is a rapid and effective method for initial identification of blast resistance genes. The identification of resistance gene in HZ will improve its molecular breeding and resistance variety application.

  18. Genes for resistance to wheat powdery mildew in derivatives of Triticum Timopheevi and T. Carthlicum

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms; Jensen, C. J.

    1972-01-01

    and/or Ml designated genes; a temporary designation, Ml f ,is proposed for this gene. Gene Ml f is closely associated with a gene conditioning resistance to the stem rust fungus (Puccinia graminis f. sp. tritici), probably gene Sr9c. The winter wheat line TP 229 derived from Triticum carthlicum has...

  19. Electromigration induced resistance changes in a single aluminum via

    Science.gov (United States)

    Alers, G. B.; Oates, A. S.; Beverly, N. L.

    1995-06-01

    High resolution resistance measurements have been performed on isolated aluminum vias to study resistance changes induced by electromigration. The via test structures consisted of a 1.5 μm diameter, 0.8 μm deep interconnect between two aluminum alloy metallization layers separated by a TiN layer. The TiN interlayer acts as a diffusion barrier for the electromigration process at which material may accumulate or be depleted to induce resistance changes. The resistance changes were measured with a resolution of 10-9 Ω/s for a ˜0.1 Ω via. A dc current caused both increases and decreases in the resistance, depending in the current direction, which recovered completely when the current was removed. The initial resistance changes were found to be proportional to t1/2 as would be expected for a diffusive electromigration process. Because both the geometry and diffusion barrier of these structures are well defined a quantitative analysis can be made which is found to be most consistent with copper as the initial diffusing element.

  20. Identification of a RAPD marker linked to the Co-6 anthracnose resistant gene in common bean cultivar AB 136

    Directory of Open Access Journals (Sweden)

    Alzate-Marin Ana Lilia

    2000-01-01

    Full Text Available The pathogenic variability of the fungus Colletotrichum lindemuthianum represents an obstacle for the creation of resistant common bean (Phaseolus vulgaris L. varieties. Gene pyramiding is an alternative strategy for the development of varieties with durable resistance. RAPD markers have been proposed as a means to facilitate pyramiding of resistance genes without the need for multiple inoculations of the pathogens. The main aims of this work were to define the inheritance pattern of resistance present in common bean cultivar AB 136 in segregating populations derived from crosses with cultivar Rudá (susceptible to most C. lindemuthianum races and to identify RAPD markers linked to anthracnose resistance. The two progenitors, populations F1 and F2, F2:3 families and backcross-derived plants were inoculated with race 89 of C. lindemuthianum under environmentally controlled greenhouse conditions. The results indicate that a single dominant gene, Co-6, controls common bean resistance to this race, giving a segregation ratio between resistant and susceptible plants of 3:1 in the F2, 1:0 in the backcrosses to AB 136 and 1:1 in the backcross to Rudá. The segregation ratio of F2:3 families derived from F2 resistant plants was 1:2 (homozygous to heterozygous resistant. Molecular marker analyses in the F2 population identified a DNA band of approximately 940 base pairs (OPAZ20(940, linked in coupling phase at 7.1 cM of the Co-6 gene. This marker is being used in our backcross breeding program to develop Rudá-derived common bean cultivars resistant to anthracnose and adapted to central Brazil.

  1. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line

    Directory of Open Access Journals (Sweden)

    Liyuan Hou

    2015-07-01

    Full Text Available Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt, is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68–0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  2. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat.

    Directory of Open Access Journals (Sweden)

    Long-Xi Yu

    Full Text Available Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn. is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS for identifying loci associated with the Ug99 stem rust resistance (SR in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT. Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat.

  3. Mapping and Cloning of Late Blight Resistance Genes from Solanum venturii Using an Interspecific Candidate Gene Approach

    NARCIS (Netherlands)

    Pel, M.; Foster, S.J.; Park, T.H.; Rietman, H.; Arkel, van G.; Jones, J.D.G.; Eck, van H.J.; Jacobsen, E.; Visser, R.G.F.; Vossen, van der E.A.G.

    2009-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases of potato. Resistance (R) genes from the wild species Solanum demissum have been used by breeders to generate late-blight-resistant cultivars but resistance was soon overcome by the pathogen. A more

  4. Antimicrobial susceptibility and presence of resistance genes in staphylococci from poultry

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Agersø, Yvonne; Ahrens, Peter

    2000-01-01

    to ciprofloxacin. Only six (7%) S. aureus isolates and one Staphylococcus saprophyticus were penicillin resistant. Resistance to sulphamethoxazole was observed among 16 (19%) of S. aureus isolates and two coagulase negative staphylococci (CNS). Twenty (24%) of the S. aureus isolates were resistant to erythromycin...... study showed a frequent occurrence of resistance to fluoroquinolones, tetracycline and macrolides among staphylococci isolated from broilers in Denmark, whereas the occurrence of resistance to other antimicrobial agents remains low. Similar genes, encoding resistance to erythromycin, tetracycline...

  5. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  6. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  7. Effective strategy for pyramiding three bacterial blight resistance genes into fine grain rice cultivar, Samba Mahsuri, using sequence tagged site markers.

    Science.gov (United States)

    Kottapalli, Kameswara Rao; Lakshmi Narasu, M; Jena, Kshirod K

    2010-07-01

    Bacterial leaf blight (BB) of rice is a major disease limiting rice production in several rice growing regions of the world. The pathogen, Xanthomonas oryzae pv oryzae, causing the disease is highly virulent to rice crops and is capable of evolving new races. Breeding efforts to incorporate single BB resistant gene often leads to resistance breakdown within a short period. To overcome such breakdown of resistance and develop germplasm with durable disease resistance, we have introgressed three bacterial blight resistance genes, xa5, xa13, and Xa21 into a fine grain rice variety, Samba Mahsuri, using sequence tagged site (STS) markers linked to these genes. Since the efficiency of the STS markers linked to recessive genes to detect homozygotes is less than 100%, we adopted four different pyramiding schemes to minimize loss of recessive resistance genes in advanced backcross generations. Pyramiding scheme A in which a two-gene Samba Mahsuri pyramid line containing Xa21 and xa5 genes was crossed with the Samba Mahsuri line having xa13 gene alone was found to be most effective in preventing the loss of an important recessive gene xa13. We further demonstrated that there was no yield penalty due to pyramiding of multiple genes into the elite indica rice variety.

  8. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  9. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  10. Analytical Performance of Multiplexed Screening Test for 10 Antibiotic Resistance Genes from Perianal Swab Samples.

    Science.gov (United States)

    Walker, G Terrance; Rockweiler, Tony J; Kersey, Rossio K; Frye, Kelly L; Mitchner, Susan R; Toal, Douglas R; Quan, Julia

    2016-02-01

    Multiantibiotic-resistant bacteria pose a threat to patients and place an economic burden on health care systems. Carbapenem-resistant bacilli and extended-spectrum β-lactamase (ESBL) producers drive the need to screen infected and colonized patients for patient management and infection control. We describe a multiplex microfluidic PCR test for perianal swab samples (Acuitas(®) MDRO Gene Test, OpGen) that detects the vancomycin-resistance gene vanA plus hundreds of gene subtypes from the carbapenemase and ESBL families Klebsiella pneumoniae carbapenemase (KPC), New Delhi metallo-β-lactamase (NDM), Verona integron-mediated metallo-β-lactamase (VIM), imipenemase metallo-β-lactamase (IMP), OXA-23, OXA-48, OXA-51, CTX-M-1, and CTX-M-2, regardless of the bacterial species harboring the antibiotic resistance. Analytical test sensitivity per perianal swab is 11-250 CFU of bacteria harboring the antibiotic resistance genes. Test throughput is 182 samples per test run (1820 antibiotic resistance gene family results). We demonstrate reproducible test performance and 100% gene specificity for 265 clinical bacterial organisms harboring a variety of antibiotic resistance genes. The Acuitas MDRO Gene Test is a sensitive, specific, and high-throughput test to screen colonized patients and diagnose infections for several antibiotic resistance genes directly from perianal swab samples, regardless of the bacterial species harboring the resistance genes. © 2015 American Association for Clinical Chemistry.

  11. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Mohanty, Soumya; Behera, Lambodar; Barik, Saumya Ranjan; Pandit, Elssa; Lenka, Srikanta; Anandan, Annamalai

    2015-12-01

    Jalmagna is a popular deepwater rice variety with farmers of India because of its good yield under waterlogged condition. However, the variety is highly susceptible to bacterial blight (BB) disease. The development of resistant cultivars has been the most effective and economical strategy to control the disease under deepwater situation. Three resistance genes (xa5 + xa13 + Xa21) were transferred from Swarna BB pyramid line, using a marker-assisted backcrossing (MAB) breeding strategy, into the BB-susceptible elite deepwater cultivar, Jalmagna. Molecular marker integrated backcross breeding program has been employed to transfer three major BB resistance genes (Xa21, xa13 and xa5) into Jalmagna variety. During backcross generations, markers closely linked to the three genes were used to select plants possessing these resistance genes and markers polymorphic between donor and recurrent parent were used to select plants that have maximum contribution from the recurrent parent genome. A selected BC3F1 plant was selfed to generate homozygous BC3F2 plants with different combinations of BB resistance genes. The three-gene pyramid and two gene pyramid lines exhibited high levels of resistance against the BB pathogen. Under conditions of BB infection, the three-gene pyramided lines exhibited a significant yield advantage over Jalmagna. The selected pyramided lines showed all agro-morphologic traits of Jalmagna without compromising the yield. The three major BB resistance genes pyramided lines exhibited high level of resistance and are expected to provide durable resistance under deep water situation where control through chemicals is less effective. High similarity in agro-morphologic traits and absence of antagonistic effects for yield and other characters were observed in the best pyramided lines.

  12. Manipulation of intracellular auxin in a single cell by light with esterase-resistant caged auxins.

    Science.gov (United States)

    Kusaka, Naoyuki; Maisch, Jan; Nick, Peter; Hayashi, Ken-ichiro; Nozaki, Hiroshi

    2009-09-04

    Auxin, a plant hormone, is polar transported from its site of production. This auxin polar transport system establishes an auxin gradient in plant tissue that is necessary for proper plant development. Therefore, the spatial effect of the auxin gradient on plant development is highly important for the understanding of plant auxin responses. Herein we report the design, syntheses and biological properties of esterase-resistant caged auxins. The conventional caging group, 2-nitrobenzyl ester, was found to be enzymatically hydrolyzed in plant cells and released original auxin without photolysis. The esterase-resistant caging group, (2,5-dimethoxyphenyl)(2-nitrobenzyl) ester, (DMPNB) was designed to improve the stability of caged auxins. Three auxins, indole 3-acetic acid, naphthalene 1-acetic acid and 2,4-dichlorophenoxy acetic acid were caged with the DMPNB caging group. DMPNB-caged auxins were inactive within a plant cell until photolysis, but they release auxins with photoirradiation to activate auxin-responsive gene expression. We demonstrated spatial and temporal control of intracellular auxin levels with photoirradiation by using this caged auxin system and were able to photocontrol the physiological auxin response in Arabidopsis plants. Additionally, the photoirradiation of DMPNB-caged auxin within a single cell can manipulate the intracellular auxin level and triggers auxin response.

  13. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  14. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  15. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

    2016-01-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several...... antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related...

  16. Lampreys have a single gene cluster for the fast skeletal myosin heavy chain gene family.

    Directory of Open Access Journals (Sweden)

    Daisuke Ikeda

    Full Text Available Muscle tissues contain the most classic sarcomeric myosin, called myosin II, which consists of 2 heavy chains (MYHs and 4 light chains. In the case of humans (tetrapod, a total of 6 fast skeletal-type MYH genes (MYHs are clustered on a single chromosome. In contrast, torafugu (teleost contains at least 13 fast skeletal MYHs, which are distributed in 5 genomic regions; the MYHs are clustered in 3 of these regions. In the present study, the evolutionary relationship among fast skeletal MYHs is elucidated by comparing the MYHs of teleosts and tetrapods with those of cyclostome lampreys, one of two groups of extant jawless vertebrates (agnathans. We found that lampreys contain at least 3 fast skeletal MYHs, which are clustered in a head-to-tail manner in a single genomic region. Although there was apparent synteny in the corresponding MYH cluster regions between lampreys and tetrapods, phylogenetic analysis indicated that lamprey and tetrapod MYHs have independently duplicated and diversified. Subsequent transgenic approaches showed that the 5'-flanking sequences of Japanese lamprey fast skeletal MYHs function as a regulatory sequence to drive specific reporter gene expression in the fast skeletal muscle of zebrafish embryos. Although zebrafish MYH promoters showed apparent activity to direct reporter gene expression in myogenic cells derived from mice, promoters from Japanese lamprey MYHs had no activity. These results suggest that the muscle-specific regulatory mechanisms are partially conserved between teleosts and tetrapods but not between cyclostomes and tetrapods, despite the conserved synteny.

  17. The Co-Selection of Fluoroquinolone Resistance Genes in the Gut Flora of Vietnamese Children

    NARCIS (Netherlands)

    Vien, Le Thi Minh; Minh, Ngo Ngoc Quang; Thuong, Tang Chi; Khuong, Huynh Duy; Nga, Tran Vu Thieu; Thompson, Corinne; Campbell, James I.; de Jong, Menno; Farrar, Jeremy J.; Schultsz, Constance; van Doorn, H. Rogier; Baker, Stephen

    2012-01-01

    Antimicrobial consumption is one of the major contributing factors facilitating the development and maintenance of bacteria exhibiting antimicrobial resistance. Plasmid-mediated quinolone resistance (PMQR) genes, such as the qnr family, can be horizontally transferred and contribute to reduced

  18. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties.

    Directory of Open Access Journals (Sweden)

    Silvia Venuti

    Full Text Available The Amur grape (Vitis amurensis Rupr. thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.. A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance-a hypersensitive response in leaves challenged with P. viticola-was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12(+ haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12(+ haplotype is shared by 15 varieties, the most ancestral of which are the century-old 'Zarja severa' and 'Michurinets'. Before this knowledge, the chromosome segment around Rpv12(+ became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3 only by phenotypic selection. Rpv12(+ has an additive effect with Rpv3(+ to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3(+ plants.

  19. Identification and characterization of a fusarium head blight resistance gene TaACT in wheat QTL-2DL.

    Science.gov (United States)

    Kage, Udaykumar; Karre, Shailesh; Kushalappa, Ajjamada C; McCartney, Curt

    2017-04-01

    Fusarium head blight (FHB) resistance in wheat is considered to be polygenic in nature. Cell wall fortification is one of the best resistance mechanisms in wheat against Fusarium graminearum which causes FHB. Metabolomics approach in our study led to the identification of a wide array of resistance-related (RR) metabolites, among which hydroxycinnamic acid amides (HCAAs), such as coumaroylagmatine and coumaroylputrescine, were the highest fold change RR metabolites in the rachis of a resistant near-isogenic line (NIL-R) upon F. graminearum infection. Placement of these metabolites in the secondary metabolic pathway led to the identification of a gene encoding agmatine coumaroyl transferase, herein referred to as TaACT, as a candidate gene. Based on wheat survey sequence, TaACT was located within a FHB quantitative trait loci on chromosome 2DL (FHB QTL-2DL) between the flanking markers WMC245 and GWM608. Phylogenetic analysis suggested that TaACT shared closest phylogenetic relationship with an ACT ortholog in barley. Sequence analysis of TaACT in resistant and susceptible NILs, with contrasting levels of resistance to FHB, led to the identification of several single nucleotide polymorphisms (SNPs) and two inversions that may be important for gene function. Further, a role for TaACT in FHB resistance was functionally validated by virus-induced gene silencing (VIGS) in wheat NIL-R and based on complementation studies in Arabidopsis with act mutant background. The disease severity, fungal biomass and RR metabolite analysis confirmed TaACT as an important gene in wheat FHB QTL-2DL, conferring resistance to F. graminearum. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  1. Single muscle fiber gene expression with run taper.

    Directory of Open Access Journals (Sweden)

    Kevin Murach

    Full Text Available This study evaluated gene expression changes in gastrocnemius slow-twitch myosin heavy chain I (MHC I and fast-twitch (MHC IIa muscle fibers of collegiate cross-country runners (n = 6, 20±1 y, VO₂max = 70±1 ml•kg-1•min-1 during two distinct training phases. In a controlled environment, runners performed identical 8 kilometer runs (30:18±0:30 min:s, 89±1% HRmax while in heavy training (∼72 km/wk and following a 3 wk taper. Training volume during the taper leading into peak competition was reduced ∼50% which resulted in improved race times and greater cross-section and improved function of MHC IIa fibers. Single muscle fibers were isolated from pre and 4 hour post run biopsies in heavily trained and tapered states to examine the dynamic acute exercise response of the growth-related genes Fibroblast growth factor-inducible 14 (FN14, Myostatin (MSTN, Heat shock protein 72 (HSP72, Muscle ring-finger protein-1 (MURF1, Myogenic factor 6 (MRF4, and Insulin-like growth factor 1 (IGF1 via qPCR. FN14 increased 4.3-fold in MHC IIa fibers with exercise in the tapered state (P<0.05. MSTN was suppressed with exercise in both fiber types and training states (P<0.05 while MURF1 and HSP72 responded to running in MHC IIa and I fibers, respectively, regardless of training state (P<0.05. Robust induction of FN14 (previously shown to strongly correlate with hypertrophy and greater overall transcriptional flexibility with exercise in the tapered state provides an initial molecular basis for fast-twitch muscle fiber performance gains previously observed after taper in competitive endurance athletes.

  2. Detection of mutations in mtrR gene in quinolone resistant strains of N.gonorrhoeae isolated from India

    Directory of Open Access Journals (Sweden)

    S V Kulkarni

    2015-01-01

    Full Text Available Background and Objectives: Emergence of multi-drug resistant Neisseria gonorrhoeae resulting from new genetic mutation is a serious threat in controlling gonorrhea. This study was undertaken to identify and characterise mutations in the mtrR genes in N.gonorrhoeae isolates resistant to six different antibiotics in the quinolone group. Materials and Methods: The Minimum inhibitory concentrations (MIC of five quinolones for 64 N.gonorrhoeae isolates isolated during Jan 2007-Jun 2009 were determined by E-test method. Mutations in MtrR loci were examined by deoxyribonucleic acid (DNA sequencing. Results: The proportion of N.gonorrhoeae strains resistant to anti-microbials was 98.4% for norfloxacin and ofloxacin, 96.8% for enoxacin and ciprofloxacin, 95.3% for lomefloxacin. Thirty-one (48.4% strains showed mutation (single/multiple in mtrR gene. Ten different mutations were observed and Gly-45 → Asp, Tyr-105 → His being the most common observed mutation. Conclusion: This is the first report from India on quinolone resistance mutations in MtrRCDE efflux system in N.gonorrhoeae. In conclusion, the high level of resistance to quinolone and single or multiple mutations in mtrR gene could limit the drug choices for gonorrhoea.

  3. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across...... species, genes conferring antimicrobial resistance were observed with the following frequencies: bla TEM, 40.7%; bla CMY-2, 15.2%; bla CTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%;tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial...

  4. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine.

    Science.gov (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke

    2002-01-01

    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  5. Physical size of the donor locus and transmission of Haemophilus influenzae ampicillin resistance genes by deoxyribonucleic acid-mediated transformation

    International Nuclear Information System (INIS)

    Bendler, J.W. III

    1976-01-01

    The properties of donor deoxyribonucleic acid (DNA) from three clinical isolates and its ability to mediate the transformation of competent Rd strains to ampicillin resistance were examined. A quantitative technique for determining the resistance of individual Haemophilus influenzae cells to ampicillin was developed. When this technique was used, sensitive cells failed to tolerate levels of ampicillin greater than 0.1 to 0.2 μg/ml, whereas three resistant type b β-lactamase-producing strains could form colonies 1- to 3-μg/ml levels of the antibiotic. DNA extracted from the resistant strains elicited transformation of the auxotrophic genes in a multiply auxotrophic Rd strain. For two of the donors, transformation to ampicillin resistance occurred after the uptake of a single DNA molecule approximately 10 4 -fold less frequently than transformation of auxotrophic loci and was not observed to occur at all with the third. The frequency of transformation to ampicillin resistance was two- to fivefold higher in strain BC200 (Okinaka and Barnhart, 1974), which was cured of a defective prophage. All three clinical ampicillin-resistant strains were poor recipients, but the presence of the ampicillin resistant genes in strain BC200 did not reduce its competence

  6. Development of Random Amplified Polymorphism DNA Markers Linked to CMV-B2 Resistance Gene in Melon

    Directory of Open Access Journals (Sweden)

    BUDI SETIADI DARYONO

    2009-12-01

    Full Text Available Two random amplified polymorphic DNA (RAPD markers linked to CMV-B2 resistance gene (Creb-2 in melon cultivar Yamatouri were cloned and sequenced to design sequence characterized amplified region (SCAR markers for detection of CMV-B2 resistance gene (Creb-2 in melon. SCOPE14 derived from OPE-14 yielded a single DNA band at 541 bp, while SCAPB05 derived from APB-05, yielded a single DNA band at 1,046 bp, respectively. Segregation of SCOPE14 and SCAPB05 markers in bulk of F2 plants demonstrated that they were co-segregated with RAPD markers from which the SCAR markers were originated. Furthermore, results of SCAR analysis in diverse melons showed SCAPB05 primers obtained a single 1,046 bp linked to Creb-2 in resistant cultivars Sanuki-shirouri and Kohimeuri. However, SCOPE14 failed to detect Creb-2 in diverse melons. Results of this study revealed that SCAR analysis not only confirmed melons that had been clearly scored for resistance to CMV-B2 by RAPD markers, but also clarified the ambiguous resistance results obtained by the RAPD markers.

  7. Single-shell tank riser resistance to ground test plan

    International Nuclear Information System (INIS)

    Kiewert, L.R.

    1996-01-01

    This Test Procedure provides the general directions for conducting Single-Shell Tank Riser to Earth Measurements which will be used by engineering as a step towards providing closure for the Lightning Hazard Issue

  8. White pine blister rust resistance in limber pine: evidence for a major gene.

    Science.gov (United States)

    Schoettle, A W; Sniezko, R A; Kegley, A; Burns, K S

    2014-02-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections from >100 limber pine trees confirm that genetic segregation of a stem symptom-free trait to blister rust is consistent with inheritance by a single dominant resistance (R) gene, and the resistance allele appears to be distinct from the R allele in western white pine. Following previous conventions, we are naming the R gene for limber pine "Cr4." The frequency of the Cr4 allele across healthy and recently invaded populations in the Southern Rocky Mountains was unexpectedly high (5.0%, ranging from 0 to 13.9%). Cr4 is in equilibrium, suggesting that it is not a product of a recent mutation and may have other adaptive significance within the species, possibly related to other abiotic or biotic stress factors. The identification of Cr4 in native populations of limber pine early in the invasion progress in this region provides useful information for predicting near-term impacts and structuring long-term management strategies.

  9. Genotyping-by-sequencing targeting of a novel downy mildew resistance gene Pl 20 from wild Helianthus argophyllus for sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Markell, S G; Song, Q J; Qi, L L

    2017-07-01

    Genotyping-by-sequencing revealed a new downy mildew resistance gene, Pl 20 , from wild Helianthus argophyllus located on linkage group 8 of the sunflower genome and closely linked to SNP markers that facilitate the marker-assisted selection of resistance genes. Downy mildew (DM), caused by Plasmopara halstedii, is one of the most devastating and yield-limiting diseases of sunflower. Downy mildew resistance identified in wild Helianthus argophyllus accession PI 494578 was determined to be effective against the predominant and virulent races of P. halstedii occurring in the United States. The evaluation of 114 BC 1 F 2:3 families derived from the cross between HA 89 and PI 494578 against P. halstedii race 734 revealed that single dominant gene controls downy mildew resistance in the population. Genotyping-by-sequencing analysis conducted in the BC 1 F 2 population indicated that the DM resistance gene derived from wild H. argophyllus PI 494578 is located on the upper end of the linkage group (LG) 8 of the sunflower genome, as was determined single nucleotide polymorphism (SNP) markers associated with DM resistance. Analysis of 11 additional SNP markers previously mapped to this region revealed that the resistance gene, named Pl 20 , co-segregated with four markers, SFW02745, SFW09076, S8_11272025, and S8_11272046, and is flanked by SFW04358 and S8_100385559 at an interval of 1.8 cM. The newly discovered P. halstedii resistance gene has been introgressed from wild species into cultivated sunflower to provide a novel gene with DM resistance. The homozygous resistant individuals were selected from BC 2 F 2 progenies with the use of markers linked to the Pl 20 gene, and these lines should benefit the sunflower community for Helianthus improvement.

  10. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  11. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China.

    Science.gov (United States)

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-17

    Emerging antimicrobial resistance is a major threat to human's health in the 21 st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6')-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought.

  12. Fracture resistance of single-tooth implant-supported

    OpenAIRE

    Piloto, P.A.G.; Piloto, Joana F.

    2014-01-01

    The purpose of this study is to identify and compare the fracture behaviour of the ceramic used in a single-tooth implant-supported. This type of prosthesis is mainly used when a single tooth replacement is needed. Two different materials are tested for the abutment (ceramic and titanium), assuming fully connection to the crown. The implant is made of Titanium. The numerical simulations used the concept of continuous damage mechanics to predict crack pattern when loading the tooth in the vert...

  13. Gene pyramiding of peptidase inhibitors enhances plant resistance to the spider mite Tetranychus urticae.

    Directory of Open Access Journals (Sweden)

    Maria Estrella Santamaria

    Full Text Available The two-spotted spider mite Tetranychus urticae is a damaging pest worldwide with a wide range of host plants and an extreme record of pesticide resistance. Recently, the complete T. urticae genome has been published and showed a proliferation of gene families associated with digestion and detoxification of plant secondary compounds which supports its polyphagous behaviour. To overcome spider mite adaptability a gene pyramiding approach has been developed by co-expressing two barley proteases inhibitors, the cystatin Icy6 and the trypsin inhibitor Itr1 genes in Arabidopsis plants by Agrobacterium-mediated transformation. The presence and expression of both transgenes was studied by conventional and quantitative real time RT-PCR assays and by indirect ELISA assays. The inhibitory activity of cystatin and trypsin inhibitor was in vitro analysed using specific substrates. Single and double transformants were used to assess the effects of spider mite infestation. Double transformed lines showed the lowest damaged leaf area in comparison to single transformants and non-transformed controls and different accumulation of H(2O(2 as defence response in the leaf feeding site, detected by diaminobenzidine staining. Additionally, an impact on endogenous mite cathepsin B- and L-like activities was observed after feeding on Arabidopsis lines, which correlates with a significant increase in the mortality of mites fed on transformed plants. These effects were analysed in view of the expression levels of the target mite protease genes, C1A cysteine peptidase and S1 serine peptidase, identified in the four developmental mite stages (embryo, larvae, nymphs and adults performed using the RNA-seq information available at the BOGAS T. urticae database. The potential of pyramiding different classes of plant protease inhibitors to prevent plant damage caused by mites as a new tool to prevent pest resistance and to improve pest control is discussed.

  14. Gene Pyramiding of Peptidase Inhibitors Enhances Plant Resistance to the Spider Mite Tetranychus urticae

    Science.gov (United States)

    Santamaria, Maria Estrella; Cambra, Inés; Martinez, Manuel; Pozancos, Clara; González-Melendi, Pablo; Grbic, Vojislava; Castañera, Pedro; Ortego, Felix; Diaz, Isabel

    2012-01-01

    The two-spotted spider mite Tetranychus urticae is a damaging pest worldwide with a wide range of host plants and an extreme record of pesticide resistance. Recently, the complete T. urticae genome has been published and showed a proliferation of gene families associated with digestion and detoxification of plant secondary compounds which supports its polyphagous behaviour. To overcome spider mite adaptability a gene pyramiding approach has been developed by co-expressing two barley proteases inhibitors, the cystatin Icy6 and the trypsin inhibitor Itr1 genes in Arabidopsis plants by Agrobacterium-mediated transformation. The presence and expression of both transgenes was studied by conventional and quantitative real time RT-PCR assays and by indirect ELISA assays. The inhibitory activity of cystatin and trypsin inhibitor was in vitro analysed using specific substrates. Single and double transformants were used to assess the effects of spider mite infestation. Double transformed lines showed the lowest damaged leaf area in comparison to single transformants and non-transformed controls and different accumulation of H2O2 as defence response in the leaf feeding site, detected by diaminobenzidine staining. Additionally, an impact on endogenous mite cathepsin B- and L-like activities was observed after feeding on Arabidopsis lines, which correlates with a significant increase in the mortality of mites fed on transformed plants. These effects were analysed in view of the expression levels of the target mite protease genes, C1A cysteine peptidase and S1 serine peptidase, identified in the four developmental mite stages (embryo, larvae, nymphs and adults) performed using the RNA-seq information available at the BOGAS T. urticae database. The potential of pyramiding different classes of plant protease inhibitors to prevent plant damage caused by mites as a new tool to prevent pest resistance and to improve pest control is discussed. PMID:22900081

  15. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Science.gov (United States)

    Agga, Getahun E; Arthur, Terrance M; Durso, Lisa M; Harhay, Dayna M; Schmidt, John W

    2015-01-01

    This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie). Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR) Gram-negative (Escherichia coli and Salmonella enterica) and Gram-positive (enterococci) bacteria were determined from individual samples (n = 174). The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44) by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine), low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P resistant bacteria and antimicrobial resistance genes exist in cattle, human, and swine waste streams, but a higher diversity of antimicrobial resistance genes are present

  16. Mutations in the rpsL gene are involved in streptomycin resistance in Campylobacter coli.

    Science.gov (United States)

    Olkkola, Satu; Juntunen, Pekka; Heiska, Helmi; Hyytiäinen, Heidi; Hänninen, Marja-Liisa

    2010-06-01

    To characterize the mechanisms of streptomycin (STR) resistance in Campylobacter coli, we chose 17 isolates that were resistant to STR, erythromycin (ERY), or both, and the putative STR resistance target genes rpsL, rrs, and gidB were analyzed for mutations. The presence of the aadE gene encoding aminoglycoside 6-adenylyltransferase was also evaluated. To reveal putative connection between ERY and STR resistance mechanisms, 13 C. coli isolates initially susceptible to STR and ERY were exposed to STR, and resistant variants were characterized. We also assessed the development of ERY resistance with a similar method. Finally, the effect of the putative CmeABC efflux pump inhibitor phenyl-arginine-beta-naphthylamine on STR resistance was tested. Our studies showed an association between mutations in the rpsL gene and STR resistance in C. coli. Further, mutations obtained in vitro were more diverse than those occurring in vivo. However, we observed no resistance associated mutations in the other genes studied, and selection with STR did not result in variants resistant to ERY and vice versa. None of the isolates harbored the aadE gene, and no differences in STR minimum inhibitory concentration levels were detected in the presence or absence of phenyl-arginine-beta-naphthylamine. In conclusion, we found that STR resistance was associated with mutations in the rpsL gene, but no obvious association between STR and ERY resistance mechanisms was found in C. coli.

  17. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  18. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    Science.gov (United States)

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Abundance of antibiotic resistance genes in environmental bacteriophages.

    Science.gov (United States)

    Anand, Taruna; Bera, Bidhan Ch; Vaid, Rajesh K; Barua, Sanjay; Riyesh, Thachamvally; Virmani, Nitin; Hussain, Mubarik; Singh, Raj K; Tripathi, Bhupendra N

    2016-12-01

    The ecosystem is continuously exposed to a wide variety of antimicrobials through waste effluents, agricultural run-offs and animal-related and anthropogenic activities, which contribute to the spread of antibiotic resistance genes (ARGs). The contamination of ecosystems with ARGs may create increased opportunities for their transfer to naive microbes and eventually lead to entry into the human food chain. Transduction is a significant mechanism of horizontal gene transfer in natural environments, which has traditionally been underestimated as compared to transformation. We explored the presence of ARGs in environmental bacteriophages in order to recognize their contribution in the spread of ARGs in environmental settings. Bacteriophages were isolated against environmental bacterial isolates, purified and bulk cultured. They were characterized, and detection of ARG and intI genes including blaTEM, blaOXA-2, intI1, intI2, intI3, tetA and tetW was carried out by PCR. This study revealed the presence of various genes [tetA (12.7 %), intI1 (10.9 %), intI2 (10.9 %), intI3 (9.1 %), tetW (9.1 %) and blaOXA-2 (3.6 %)] and blaTEM in a significantly higher proportion (30.9 %). blaSHV, blaOXA-1, tetO, tetB, tetG, tetM and tetS were not detected in any of the phages. Soil phages were the most versatile in terms of ARG carriage. Also, the relative abundance of tetA differed significantly vis-à-vis source. The phages from organized farms showed varied ARGs as compared to the unorganized sector, although blaTEM ARG incidences did not differ significantly. The study reflects on the role of phages in dissemination of ARGs in environmental reservoirs, which may provide an early warning system for future clinically relevant resistance mechanisms.

  20. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    Science.gov (United States)

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  1. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    Science.gov (United States)

    Versluis, Dennis; D'Andrea, Marco Maria; Ramiro Garcia, Javier; Leimena, Milkha M.; Hugenholtz, Floor; Zhang, Jing; Öztürk, Başak; Nylund, Lotta; Sipkema, Detmer; Schaik, Willem Van; de Vos, Willem M.; Kleerebezem, Michiel; Smidt, Hauke; Passel, Mark W. J. Van

    2015-07-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing the expression of associated secondary metabolite biosynthesis gene clusters. Metatranscriptome datasets from intestinal microbiota of four human adults, one human infant, 15 mice and six pigs, of which only the latter have received antibiotics prior to the study, as well as from sea bacterioplankton, a marine sponge, forest soil and sub-seafloor sediment, were investigated. We found that resistance genes are expressed in all studied ecological niches, albeit with niche-specific differences in relative expression levels and diversity of transcripts. For example, in mice and human infant microbiota predominantly tetracycline resistance genes were expressed while in human adult microbiota the spectrum of expressed genes was more diverse, and also included β-lactam, aminoglycoside and macrolide resistance genes. Resistance gene expression could result from the presence of natural antibiotics in the environment, although we could not link it to expression of corresponding secondary metabolites biosynthesis clusters. Alternatively, resistance gene expression could be constitutive, or these genes serve alternative roles besides antibiotic resistance.

  3. Reconstructing Cell Lineages from Single-Cell Gene Expression Data: A Pilot Study

    Science.gov (United States)

    2016-08-30

    Reconstructing cell lineages from single -cell gene expression data: a pilot study The goal of this pilot study is to develop novel mathematical...methods, by leveraging tools developed in the bifurcation theory, to infer the underlying cell-state dynamics from single -cell gene expression data. Our...from single -cell gene expression data. The views, opinions and/or findings contained in this report are those of the author(s) and should not contrued

  4. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  5. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased......Samples from 687 Danish pig farms were collected at five finisher slaughterhouses in February and March 2015. Faecal samples from five pigs per farm were collected randomly at the slaughter line and pooled into one sample per farm. DNA was extracted from the pooled samples and the level of seven...

  6. Exposure of Salmonella enterica serovar Typhimurium to high level biocide challenge can select multidrug resistant mutants in a single step.

    Directory of Open Access Journals (Sweden)

    Rebekah N Whitehead

    Full Text Available Biocides are crucial to the prevention of infection by bacteria, particularly with the global emergence of multiply antibiotic resistant strains of many species. Concern has been raised regarding the potential for biocide exposure to select for antibiotic resistance due to common mechanisms of resistance, notably efflux.Salmonella enterica serovar Typhimurium was challenged with 4 biocides of differing modes of action at both low and recommended-use concentration. Flow cytometry was used to investigate the physiological state of the cells after biocide challenge. After 5 hours exposure to biocide, live cells were sorted by FACS and recovered. Cells recovered after an exposure to low concentrations of biocide had antibiotic resistance profiles similar to wild-type cells. Live cells were recovered after exposure to two of the biocides at in-use concentration for 5 hours. These cells were multi-drug resistant and accumulation assays demonstrated an efflux phenotype of these mutants. Gene expression analysis showed that the AcrEF multidrug efflux pump was de-repressed in mutants isolated from high-levels of biocide.These data show that a single exposure to the working concentration of certain biocides can select for mutant Salmonella with efflux mediated multidrug resistance and that flow cytometry is a sensitive tool for identifying biocide tolerant mutants. The propensity for biocides to select for MDR mutants varies and this should be a consideration when designing new biocidal formulations.

  7. [Loading and strength of single- and multi-unit fixed dental prostheses. 1. Retention and resistance

    NARCIS (Netherlands)

    Baat, C. de; Witter, D.J.; Meijers, C.C.A.J.; Vergoossen, E.L.; Creugers, N.H.J.

    2014-01-01

    The degree to which single- and multi-unit fixed dental prostheses are able to withstand loading forces is dependent, among other things, on the quality of their retention and resistance. The quality of the retention and resistance of the configuration of an abutment tooth prepared for a metal and

  8. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics.

    Science.gov (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N

    1996-01-01

    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  9. Evolution of resistance to single and combined floral phytochemicals by a bumble bee parasite.

    Science.gov (United States)

    Palmer-Young, E C; Sadd, B M; Adler, L S

    2017-02-01

    Repeated exposure to inhibitory compounds can drive the evolution of resistance, which weakens chemical defence against antagonists. Floral phytochemicals in nectar and pollen have antimicrobial properties that can ameliorate infection in pollinators, but evolved resistance among parasites could diminish the medicinal efficacy of phytochemicals. However, multicompound blends, which occur in nectar and pollen, present simultaneous chemical challenges that may slow resistance evolution. We assessed evolution of resistance by the common bumble bee gut parasite Crithidia bombi to two floral phytochemicals, singly and combined, over 6 weeks (~100 generations) of chronic exposure. Resistance of C. bombi increased under single and combined phytochemical exposure, without any associated costs of reduced growth under phytochemical-free conditions. After 6 weeks' exposure, phytochemical concentrations that initially inhibited growth by > 50%, and exceeded concentrations in floral nectar, had minimal effects on evolved parasite lines. Unexpectedly, the phytochemical combination did not impede resistance evolution compared to single compounds. These results demonstrate that repeated phytochemical exposure, which could occur in homogeneous floral landscapes or with therapeutic phytochemical treatment of managed hives, can cause rapid evolution of resistance in pollinator parasites. We discuss possible explanations for submaximal phytochemical resistance in natural populations. Evolved resistance could diminish the antiparasitic value of phytochemical ingestion, weakening an important natural defence against infection. © 2016 The Authors. Journal of Evolutionary Biology Published by John Wiley & Sons ltd on behalf of European Society for Evolutionary Biology.

  10. SNP assay to detect the ‘Hyuuga’ red-brown lesion resistance gene for Asian soybean rust

    Science.gov (United States)

    Ha, Bo-Keun; Phillips, Daniel V.; Boerma, H. Roger

    2010-01-01

    Asian soybean rust (ASR), caused by Phakopsora pachyrhizi Syd., has the potential to become a serious threat to soybean, Glycine max L. Merr., production in the USA. A novel rust resistance gene, Rpp?(Hyuuga), from the Japanese soybean cultivar Hyuuga has been identified and mapped to soybean chromosome 6 (Gm06). Our objectives were to fine-map the Rpp?(Hyuuga) gene and develop a high-throughput single nucleotide polymorphism (SNP) assay to detect this ASR resistance gene. The integration of recombination events from two different soybean populations and the ASR reaction data indicates that the Rpp?(Hyuuga) locus is located in a region of approximately 371 kb between STS70887 and STS70923 on chromosome Gm06. A set of 32 ancestral genotypes which is predicted to contain 95% of the alleles present in current elite North American breeding populations and the sources of the previously reported ASR resistance genes (Rpp1, Rpp2, Rpp3, Rpp4, Rpp5, and rpp5) were genotyped with five SNP markers. We developed a SimpleProbe assay based on melting curve analysis for SNP06-44058 which is tighly linked to the Rpp?(Hyuuga) gene. This SNP assay can differentiate plants/lines that are homozygous/homogeneous or heterozygous/heterogeneous for the resistant and susceptible alleles at the Rpp?(Hyuuga) locus. PMID:20532750

  11. Single base resolution analysis of 5-hydroxymethylcytosine in 188 human genes: implications for hepatic gene expression

    Science.gov (United States)

    Ivanov, Maxim; Kals, Mart; Lauschke, Volker; Barragan, Isabel; Ewels, Philip; Käller, Max; Axelsson, Tomas; Lehtiö, Janne; Milani, Lili; Ingelman-Sundberg, Magnus

    2016-01-01

    To improve the epigenomic analysis of tissues rich in 5-hydroxymethylcytosine (hmC), we developed a novel protocol called TAB-Methyl-SEQ, which allows for single base resolution profiling of both hmC and 5-methylcytosine by targeted next-generation sequencing. TAB-Methyl-SEQ data were extensively validated by a set of five methodologically different protocols. Importantly, these extensive cross-comparisons revealed that protocols based on Tet1-assisted bisulfite conversion provided more precise hmC values than TrueMethyl-based methods. A total of 109 454 CpG sites were analyzed by TAB-Methyl-SEQ for mC and hmC in 188 genes from 20 different adult human livers. We describe three types of variability of hepatic hmC profiles: (i) sample-specific variability at 40.8% of CpG sites analyzed, where the local hmC values correlate to the global hmC content of livers (measured by LC-MS), (ii) gene-specific variability, where hmC levels in the coding regions positively correlate to expression of the respective gene and (iii) site-specific variability, where prominent hmC peaks span only 1 to 3 neighboring CpG sites. Our data suggest that both the gene- and site-specific components of hmC variability might contribute to the epigenetic control of hepatic genes. The protocol described here should be useful for targeted DNA analysis in a variety of applications. PMID:27131363

  12. Investigation of the Effects of rs137852599 Single-nucleotide Polymorphism Existence in Drug Resistance against Treatment with Enzalutamide in Individuals Diagnosed with Prostate Cancer in Isfahan Province

    Directory of Open Access Journals (Sweden)

    Bita Kaviani

    2018-02-01

    Full Text Available Abstract Background: The aim of this study is to investigate the role of rs137852599 single-nucleotide polymorphism in the androgen receptor coding gene on drug resistance against treatment with Enzalutamide in individuals diagnosed with prostate cancer. Materials and Methods: In this case-control study, the ARMS-PCR analysis was conducted on androgen receptor coding gene in 50 patients diagnosed with prostate cancer with drug resistance and on 50 patients diagnosed with prostate cancer without drug resistance. The statistical analyses were performed using the GeNePop server and then the results were investigated by the SISA server. Results: The allele frequencies of A and C alleles in rs137852599 were 0.78 and 0.22 for drug resistant and 0.94 and 0.06 for non-drug resistance groups. The results indicated that there is a meaningful relationship between drug resistance and rs137852599 single-nucleotide polymorphism (p = 0.020. Conclusion: The existence of single-nucleotide polymorphisms may result in drug resistance in individuals diagnosed with prostate cancer. Therefore, investigation of the existence of such polymorphisms can be effective in prescription of suitable drugs for these patients.

  13. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.

    Science.gov (United States)

    Baba, Tomoya; Ara, Takeshi; Hasegawa, Miki; Takai, Yuki; Okumura, Yoshiko; Baba, Miki; Datsenko, Kirill A; Tomita, Masaru; Wanner, Barry L; Mori, Hirotada

    2006-01-01

    We have systematically made a set of precisely defined, single-gene deletions of all nonessential genes in Escherichia coli K-12. Open-reading frame coding regions were replaced with a kanamycin cassette flanked by FLP recognition target sites by using a one-step method for inactivation of chromosomal genes and primers designed to create in-frame deletions upon excision of the resistance cassette. Of 4288 genes targeted, mutants were obtained for 3985. To alleviate problems encountered in high-throughput studies, two independent mutants were saved for every deleted gene. These mutants-the 'Keio collection'-provide a new resource not only for systematic analyses of unknown gene functions and gene regulatory networks but also for genome-wide testing of mutational effects in a common strain background, E. coli K-12 BW25113. We were unable to disrupt 303 genes, including 37 of unknown function, which are candidates for essential genes. Distribution is being handled via GenoBase (http://ecoli.aist-nara.ac.jp/).

  14. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  15. Streptomycin and chloramphenicol resistance genes in Escherichia coli isolates from cattle, pigs, and chicken in Kenya.

    Science.gov (United States)

    Kikuvi, G M; Schwarz, S; Ombui, J N; Mitema, E S; Kehrenberg, C

    2007-01-01

    The aims of this study were to determine the genetic basis of streptomycin and chloramphenicol resistance in 30 Escherichia coli isolates from food animals in Kenya and the role of plasmids in the spread of the resistance. Seven of the 29 streptomycin-resistant isolates harbored both the strA and strB genes. Twenty-one of isolates had the strA, strB, and aadA1 genes. The strA gene was disrupted by a functional trimethoprim gene, dfrA14 in 10 of the 21 isolates harboring the three streptomycin resistance genes. Physical linkage of intact strA and sul2 genes was found in two different plasmids from four isolates. Linkage of cassette-borne aadA1 and dfrA1 genes in class 1 integrons was found in two of the isolates. Chloramphenicol resistance was due to the gene catA1 in all the chloramphenicol resistant isolates. The strB, strA, and catA1 genes were transferable by conjugation and this points to the significance of conjugative resistance plasmids in the spread and persistence of streptomycin and chloramphenicol resistance in food animals in Kenya.

  16. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines

    OpenAIRE

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W.; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T.

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in “colony forming bacterial assemblages” and “natural bacterial assemblages.” Our monitoring for antibiotic contamination r...

  17. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  18. QTL Mapping by SLAF-seq and Expression Analysis of Candidate Genes for Aphid Resistance in Cucumber

    Directory of Open Access Journals (Sweden)

    Danna Liang

    2016-07-01

    Full Text Available Cucumber, a very important vegetable crop worldwide, is easily damaged by pests. Aphid is one of the most serious cucumber pests and frequently cause severe damage to commercially produced crops. Understanding the genetic mechanisms underlying pest resistance is important for aphid-resistant cucumber varieties breeding. In this study, two parental cucumber lines, JY30 (aphid susceptible and EP6392 (aphid resistant, and pools of resistant and susceptible (n = 50 each plants from 1000 F2 individuals derived from crossing JY30 with EP6392, were used to detect genomic regions associated with aphid resistance in cucumbers. The analysis was performed using specific length amplified fragment sequencing (SLAF-seq, bulked segregant analysis (BSA and single nucleotide polymorphism index (SNP-index methods. A main effect QTL (quantitative trait locus of 0.31 Mb on Chr5, including 43 genes, was identified by association analysis. Sixteen of the 43 genes were identified as potentially associated with aphid resistance through gene annotation analysis. The effect of aphid infestation on the expression of these candidate genes screened by SLAF-seq was investigated in EP6392 plants by qRT-PCR. The results indicated that 7 genes including encoding transcription factor MYB59-like (Csa5M641610.1, auxin transport protein BIG-like (Csa5M642140.1, F-box/kelch-repeat protein At5g15710-like (Csa5M642160.1, transcription factor HBP-1a-like (Csa5M642710.1, beta-glucan-binding protein (Csa5M643380.1, endo-1,3(4-beta-glucanase 1-like (Csa5M643880.1, and proline-rich receptor-like protein kinase PERK10-like (Csa5M643900.1, out of the 16 genes were down regulated after aphid infestation, whereas 5 genes including encoding probable leucine-rich repeat receptor-like serine/threonine-protein kinase At5g15730-like (Csa5M642150.1, Stress-induced protein KIN2 (Csa5M643240.1 and Csa5M643260.1, F-box family protein (Csa5M643280.1, F-box/kelch-repeat protein (Csa5M643290.1, were up

  19. Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance.

    Science.gov (United States)

    Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes

    2007-11-01

    The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.

  20. Could bacteriophages transfer antibiotic resistance genes from environmental bacteria to human-body associated bacterial populations?

    Science.gov (United States)

    Muniesa, Maite; Colomer-Lluch, Marta; Jofre, Juan

    2013-07-01

    Environments without any contact with anthropogenic antibiotics show a great abundance of antibiotic resistance genes that use to be chromosomal and are part of the core genes of the species that harbor them. Some of these genes are shared with human pathogens where they appear in mobile genetic elements. Diversity of antibiotic resistance genes in non-contaminated environments is much greater than in human and animal pathogens, and in environments contaminated with antibiotic from anthropogenic activities. This suggests the existence of some bottleneck effect for the mobilization of antibiotic resistance genes among different biomes. Bacteriophages have characteristics that make them suitable vectors between different biomes, and as well for transferring genes from biome to biome. Recent metagenomic studies and detection of bacterial genes by genomic techniques in the bacteriophage fraction of different microbiota provide indirect evidences that the mobilization of genes mediated by phages, including antibiotic resistance genes, is far more relevant than previously thought. Our hypothesis is that bacteriophages might be of critical importance for evading one of the bottlenecks, the lack of ecological connectivity that modulates the pass of antibiotic resistance genes from natural environments such as waters and soils, to animal and human microbiomes. This commentary concentrates on the potential importance of bacteriophages in transferring resistance genes from the environment to human and animal body microbiomes, but there is no doubt that transduction occurs also in body microbiomes.

  1. Lr67 and Lr34 rust resistance genes have much in common – they confer broad spectrum resistance to multiple pathogens in wheat

    Science.gov (United States)

    2013-01-01

    Background Adult plant rust resistance genes Lr67 and Lr34 confer race non-specific resistance to multiple fungal pathogens of wheat. Induced, susceptible mutants were characterised for both genes. Results Three categories of Lr34 mutants were identified that were either partial susceptible, fully susceptible or hyper-susceptible to stripe rust and leaf rust. The likely impact of the mutational change on the predicted Lr34 protein correlated with differences in response to rust infection. Four independent Lr67 mutants were recovered that were susceptible to stripe rust, leaf rust and stem rust pathogens, including one possible hyper-susceptible Lr67 mutant. Conclusions Detailed study of Lr34 mutants revealed that subtle changes in resistance response to multiple pathogens were correlated with mutational changes in the predicted protein. Recovery of independent Lr67 mutants indicates that as for Lr34, a single gene at the Lr67 locus is likely to confer resistance to multiple pathogens. The infection phenotypes of Lr67 mutants closely resembled that of Lr34 mutants. PMID:23819608

  2. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  3. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  4. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  5. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using specific STS primer. ... conducted on the life cycles of rust pathogens and their management. Due to airborne nature .... To date, more than 45 stem rust resistance Sr (genes) (McIntosh et ...

  6. Presence of tetracycline resistance genes in ecosystems with distinct levels of human impact

    OpenAIRE

    STEHLÍKOVÁ, Zuzana

    2011-01-01

    The incidence of tetracycline resistance genes in the environments with different levels of human impact were compared in this work. The experimental part included detection of eight tetracycline resistance genes in soils from manured and non-manured farms (representing man-affected environment) and soils from national parks (representing non-affected environment).

  7. Mining microbial metatranscriptomes for expression of antibiotic resistance genes under natural conditions

    NARCIS (Netherlands)

    Versluis, D.; Andrea, D' M.M.; Ramiro Garcia, J.; Leimena, M.M.; Hugenholtz, F.; Zhang, J.; Öztürk, B.; Nylund, L.; Sipkema, D.; Schaik, van W.; Vos, de W.M.; Kleerebezem, M.; Smidt, H.; Passel, van M.W.J.

    2015-01-01

    Antibiotic resistance genes are found in a broad range of ecological niches associated with complex microbiota. Here we investigated if resistance genes are not only present, but also transcribed under natural conditions. Furthermore, we examined the potential for antibiotic production by assessing

  8. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  9. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  10. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  11. Involvement of aph(3‘-IIa in the formation of mosaic aminoglycoside resistance genes in natural environments

    Directory of Open Access Journals (Sweden)

    Markus eWoegerbauer

    2015-05-01

    Full Text Available Intragenic recombination leading to mosaic gene formation is known to alter resistance profiles for particular genes and bacterial species. Few studies have examined to what extent aminoglycoside resistance genes undergo intragenic recombination.We screened the GenBank database for mosaic gene formation in homologs of the aph(3’-IIa (nptII gene. APH(3’-IIa inactivates important aminoglycoside antibiotics. The gene is widely used as a selectable marker in biotechnology and enters the environment via laboratory discharges and the release of transgenic organisms. Such releases may provide opportunities for recombination in competent environmental bacteria.The retrieved GenBank sequences were grouped in 3 datasets comprising river water samples, duck pathogens and full-length variants from various bacterial genomes and plasmids. Analysis for recombination in these datasets was performed with the Recombination Detection Program, RDP4, and the Genetic Algorithm for Recombination Detection, GARD.From a total of 89 homologous sequences, 83% showed 99% - 100% sequence identity with aph(3’-IIa originally described as part of transposon Tn5. Fifty one were unique sequence variants eligible for recombination analysis. Only a single recombination event was identified with high confidence and indicated the involvement of aph(3’-IIa in the formation of a mosaic gene located on a plasmid of environmental origin in the multi-resistant isolate Pseudomonas aeruginosa PA96. The available data suggest that aph(3’-IIa is not an archetypical mosaic gene as the divergence between the described sequence variants and the number of detectable recombination events is low. This is in contrast to the numerous mosaic alleles reported for certain penicillin or tetracycline resistance determinants.

  12. Inducible expression of a fusion gene encoding two proteinase inhibitors leads to insect and pathogen resistance in transgenic rice.

    Science.gov (United States)

    Quilis, Jordi; López-García, Belén; Meynard, Donaldo; Guiderdoni, Emmanuel; San Segundo, Blanca

    2014-04-01

    Plant proteinase inhibitors (PIs) are considered as candidates for increased insect resistance in transgenic plants. Insect adaptation to PI ingestion might, however, compromise the benefits received by transgenic expression of PIs. In this study, the maize proteinase inhibitor (MPI), an inhibitor of insect serine proteinases, and the potato carboxypeptidase inhibitor (PCI) were fused into a single open reading frame and introduced into rice plants. The two PIs were linked using either the processing site of the Bacillus thuringiensis Cry1B precursor protein or the 2A sequence from the foot-and-mouth disease virus (FMDV). Expression of each fusion gene was driven by the wound- and pathogen-inducible mpi promoter. The mpi-pci fusion gene was stably inherited for at least three generations with no penalty on plant phenotype. An important reduction in larval weight of Chilo suppressalis fed on mpi-pci rice, compared with larvae fed on wild-type plants, was observed. Expression of the mpi-pci fusion gene confers resistance to C. suppressalis (striped stem borer), one of the most important insect pest of rice. The mpi-pci expression systems described may represent a suitable strategy for insect pest control, better than strategies based on the use of single PI genes, by preventing insect adaptive responses. The rice plants expressing the mpi-pci fusion gene also showed enhanced resistance to infection by the fungus Magnaporthe oryzae, the causal agent of the rice blast disease. Our results illustrate the usefulness of the inducible expression of the mpi-pci fusion gene for dual resistance against insects and pathogens in rice plants. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Novel mutations in the antifolate drug resistance marker genes among Plasmodium vivax isolates exhibiting severe manifestations.

    Science.gov (United States)

    Garg, Shilpi; Saxena, Vishal; Lumb, Vanshika; Pakalapati, Deepak; Boopathi, P A; Subudhi, Amit Kumar; Chowdhury, Shibasish; Kochar, Sanjay K; Kochar, Dhanpat K; Sharma, Y D; Das, Ashis

    2012-12-01

    Plasmodium vivax is the predominant species of the human malaria parasite present in the Indian subcontinent. There have been recent reports on Chloroquine (CQ) resistance and severe manifestations shown by P. vivax from different regions of the world including India. This study focuses on Bikaner, India where during the last few years there have been continuous reports of severe manifestations by both Plasmodium falciparum and P. vivax. This region has a widespread use of Chloroquine and Sulfadoxine-Pyrimethamine for the treatment of malaria, but the resistance profiles of these drugs are not available. We report here the profile of mutations in marker genes associated with Chloroquine and antifolate drug resistance among the P. vivax parasites obtained from patients with severe (n=30) and non-severe (n=48) manifestations from this region. Most isolates showed the wild type alleles for both the Chloroquine and antifolate resistance markers (Presistance has been reported from this region. However, the single isolate with a mutation in Pvmdr-1 may suggest the beginning of the trend towards decreased susceptibility to Chloroquine. The frequency of PvDHFR-PvDHPS two locus mutations was higher among the patients showing severe manifestations than the patient group with non-severe (uncomplicated) malaria (Pexhibiting severe complications. Preliminary homology modeling and molecular docking studies predicted that these mutations apparently do not have any effect on the binding of the drug molecule to the enzyme. However, the presence of novel mutations in the PvDHPS gene indicate a degree of polymorphism of this molecule which is in contrast to available published information. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Role and prevalence of antibiosis and the related resistance genes in the environment

    DEFF Research Database (Denmark)

    Nazaret, Sylvie; Aminov, Rustam

    2014-01-01

    It becomes increasingly clear that the basis of antibiotic resistance problem among bacterial pathogens is not confined to the borders of clinical microbiology but has broader ecological and evolutionary associations. This Research Topic “Role and prevalence of antibiosis and the related resistance...... genes in the environment” in Frontiers in Microbiology: Antimicrobials, Resistance, and Chemotherapy presents the examples of occurrence and diversity of antibiotic resistance genes (ARGs) in the wide range of environments, from the grasslands of the Colombian Andes, to the dairy farms and small animal...... approach to access the probability of rare horizontal gene transfer (HGT) events in bacterial populations....

  15. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  16. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    This gene block, which was found in all the southern African areas studied, appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the tetM resistance determinant was readily demonstrated in 11 Botswana Namibia isolates exhibiting high-level resistance to tetracycline ...

  17. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the. tetM resistance determinant was readily demonstrated in. 11 Botswana! Namibia isolates exhibiting high-level resistance to tetracycline (MICs ? 16 IJg/ml). The tetM gene was shown to be of the American type.

  18. Genetic engineering of crop plants for fungal resistance: role of antifungal genes.

    Science.gov (United States)

    Ceasar, S Antony; Ignacimuthu, S

    2012-06-01

    Fungal diseases damage crop plants and affect agricultural production. Transgenic plants have been produced by inserting antifungal genes to confer resistance against fungal pathogens. Genes of fungal cell wall-degrading enzymes, such as chitinase and glucanase, are frequently used to produce fungal-resistant transgenic crop plants. In this review, we summarize the details of various transformation studies to develop fungal resistance in crop plants.

  19. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo

    Directory of Open Access Journals (Sweden)

    Ana Paula Matoso Teixeira

    2008-01-01

    Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.

  20. Fine mapping of the Bsr1 barley stripe mosaic virus resistance gene in the model grass Brachypodium distachyon.

    Directory of Open Access Journals (Sweden)

    Yu Cui

    Full Text Available The ND18 strain of Barley stripe mosaic virus (BSMV infects several lines of Brachypodium distachyon, a recently developed model system for genomics research in cereals. Among the inbred lines tested, Bd3-1 is highly resistant at 20 to 25 °C, whereas Bd21 is susceptible and infection results in an intense mosaic phenotype accompanied by high levels of replicating virus. We generated an F(6:7 recombinant inbred line (RIL population from a cross between Bd3-1 and Bd21 and used the RILs, and an F(2 population of a second Bd21 × Bd3-1 cross to evaluate the inheritance of resistance. The results indicate that resistance segregates as expected for a single dominant gene, which we have designated Barley stripe mosaic virus resistance 1 (Bsr1. We constructed a genetic linkage map of the RIL population using SNP markers to map this gene to within 705 Kb of the distal end of the top of chromosome 3. Additional CAPS and Indel markers were used to fine map Bsr1 to a 23 Kb interval containing five putative genes. Our study demonstrates the power of using RILs to rapidly map the genetic determinants of BSMV resistance in Brachypodium. Moreover, the RILs and their associated genetic map, when combined with the complete genomic sequence of Brachypodium, provide new resources for genetic analyses of many other traits.

  1. Insulin resistance induced by a high-fat diet is associated with the induction of genes related to leukocyte activation in rat peripheral leukocytes.

    Science.gov (United States)

    Fujimoto, Saki; Mochizuki, Kazuki; Shimada, Masaya; Hori, Tomoyo; Murayama, Yuki; Ohashi, Norio; Goda, Toshinao

    2010-12-18

    Insulin resistance caused by a high-fat diet induces type 2 diabetes and its complications. In this study, we investigated gene expression changes in peripheral leukocytes with insulin resistance by conducting microarray analyses in rats with high-fat diet-induced insulin resistance. After assessing insulin resistance in rats by an oral glucose tolerance test, we performed microarray analyses using peripheral leukocytes from normal rats and insulin-resistant rats after fasting. Real-time RT-PCR analyses were performed for several upregulated genes in the microarray data after fasting and at 3h after a single oral glucose load. Feeding rats a high-fat diet for 77days induced moderate insulin resistance. Microarray analysis showed that the high-fat diet enhances many genes related to leukocyte activation. These upregulated genes included genes related to host defense, and many genes related to G-protein-coupled receptor/tyrosine receptor signaling. Moreover, many genes, such as Anxa1, S100a8, Il22ra2, Gng10, Csf3r and Cd302, showed further upregulation of their expression after a single oral glucose load. Exposure to high glucose and/or tumor necrosis factor-α which is known to be a factor that induces insulin resistance, enhanced the mRNA levels of DUSP1, ANXA1, IL1B, S100A8, IL22RA2, S100A9 and IRF1 in human monocyte-like U937 cells. These results suggest that the expression of genes related to leukocyte activation in peripheral leukocytes is associated with the development of moderate insulin resistance. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Reclaimed water as a reservoir of antibiotic resistance genes: distribution system and irrigation implications

    Directory of Open Access Journals (Sweden)

    Nicole L Fahrenfeld

    2013-05-01

    Full Text Available Treated wastewater is increasingly being reused to achieve sustainable water management in arid regions. The objective of this study was to quantify the distribution of antibiotic resistance genes (ARGs in recycled water, particularly after it has passed through the distribution system, and to consider point-of-use implications for soil irrigation. Three separate reclaimed wastewater distribution systems in the western U.S. were examined. Quantitative polymerase chain reaction (qPCR was used to quantify ARGs corresponding to resistance to sulfonamides (sul1, sul2, macrolides (ermF, tetracycline (tet(A, tet(O, glycopeptides (vanA, and methicillin (mecA, in addition to genes present in waterborne pathogens Legionella pneumophila (Lmip, Escherichia coli (gadAB, and Pseudomonas aeruginosa (ecfx, gyrB. In a parallel lab study, the effect of irrigating an agricultural soil with secondary, chlorinated, or dechlorinated wastewater effluent was examined in batch microcosms. A broader range of ARGs were detected after the reclaimed water passed through the distribution systems, highlighting the importance of considering bacterial re-growth and the overall water quality at the point of use. Screening for pathogens with qPCR indicated presence of Lmip and gadAB genes, but not ecfx or gyrB. In the lab study, chlorination was observed to reduce 16S rRNA and sul2 gene copies in the wastewater effluent, while dechlorination had no apparent effect. ARGs levels did not change with time in soil slurries incubated after a single irrigation event with any of the effluents. However, when irrigated repeatedly with secondary wastewater effluent (not chlorinated or dechlorinated, elevated levels of sul1 and sul2 were observed. This study suggests that reclaimed water may be an important reservoir of ARGs, especially at the point of use, and that attention should be directed towards the fate of ARGs in irrigation water and the implications for human health.

  3. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...

  4. Pollen-mediated gene flow from glyphosate-resistant common waterhemp (Amaranthus rudis Sauer): consequences for the dispersal of resistance genes.

    Science.gov (United States)

    Sarangi, Debalin; Tyre, Andrew J; Patterson, Eric L; Gaines, Todd A; Irmak, Suat; Knezevic, Stevan Z; Lindquist, John L; Jhala, Amit J

    2017-03-22

    Gene flow is an important component in evolutionary biology; however, the role of gene flow in dispersal of herbicide-resistant alleles among weed populations is poorly understood. Field experiments were conducted at the University of Nebraska-Lincoln to quantify pollen-mediated gene flow (PMGF) from glyphosate-resistant (GR) to -susceptible (GS) common waterhemp using a concentric donor-receptor design. More than 130,000 common waterhemp plants were screened and 26,199 plants were confirmed resistant to glyphosate. Frequency of gene flow from all distances, directions, and years was estimated with a double exponential decay model using Generalized Nonlinear Model (package gnm) in R. PMGF declined by 50% at <3 m distance from the pollen source, whereas 90% reduction was found at 88 m (maximum) depending on the direction of the pollen-receptor blocks. Amplification of the target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), was identified as the mechanism of glyphosate resistance in parent biotype. The EPSPS gene amplification was heritable in common waterhemp and can be transferred via PMGF, and also correlated with glyphosate resistance in pseudo-F 2 progeny. This is the first report of PMGF in GR common waterhemp and the results are critical in explaining the rapid dispersal of GR common waterhemp in Midwestern United States.

  5. [Loading and strength of single- and multi-unit fixed dental prostheses. 1. Retention and resistance].

    Science.gov (United States)

    de Baat, C; Witter, D J; Meijers, C C A J; Vergoossen, E L M; Creugers, N H J

    2014-03-01

    The degree to which single- and multi-unit fixed dental prostheses are able to withstand loading forces is dependent, among other things, on the quality of their retention and resistance. The quality of the retention and resistance of the configuration of an abutment tooth prepared for a metal and metal-ceramic single-unit fixed dental prosthesis is determined by the configuration's convergence angle, the height, the volume, the interocclusal space, the cervical outline design, the additional preparations, the quality of the (build-up) restoration, and the surface roughness. A silicate ceramic single-unit fixed dental prosthesis is attached through adhesion using a composite cement, but the retention and resistance of an oxide ceramic single-unit fixed dental prosthesis is dependent on the abutment tooth configuration. Most types of multi-unit fixed dental prosthesis have the following additional retention and resistance determining factors: the position in the occlusal system, the number of abutment teeth and their mutual configurations, and the length of (cantilever) pontics. A resin-bonded fixed partial denture's retention and resistance are determined by its bonding as well as its enamel surface coverage and its resistance preparations.

  6. Dysphonia – the single symptom of rifampicin resistant laryngeal tuberculosis

    Directory of Open Access Journals (Sweden)

    Paulauskienė Iveta

    2016-01-01

    Full Text Available Tuberculosis is still the most frequent granulomatous laryngeal disease. Absence of pathognomonic symptoms and change in clinical pattern frequently leads to misdiagnosis and delayed treatment. Hoarseness is the commonest symptom of laryngeal tuberculosis and constitutional symptoms are usually rare. However dysphonia can be caused by many other more common conditions. Hoarseness can be a symptom of organic (nodules and polyps of vocal folds, tumors, vocal fold paresis or functional (functional dysphonia, laryngeal conversion disorder, paradoxical vocal folds motion conditions. Rarely systemic diseases as amyloidosis, sarcoidosis, Wegener’s granulomatosis or tuberculosis can cause vocal dysfunction too. That is why laryngeal tuberculosis is often forgotten in case of persistent hoarseness. In this article, we present a case of a young previously healthy woman, complaining of persistent hoarseness with no other leading symptoms. Though endoscopic image suggested a malignancy, histology showed granulomatous lesion. Detailed examination revealed laryngeal and pulmonary tuberculosis resistant to rifampicin. Conclusion: Dysphonia can be the only one symptom of laryngeal tuberculosis. The disease should be taken into consideration when a patient complains of persistent hoarseness in order to avoid delays in treatment and spread of infection.

  7. Mobile elements, zoonotic pathogens and commensal bacteria: conduits for the delivery of resistance genes into humans, production animals and soil microbiota.

    Science.gov (United States)

    Djordjevic, Steven P; Stokes, Harold W; Roy Chowdhury, Piklu

    2013-01-01

    Multiple antibiotic resistant pathogens represent a major clinical challenge in both human and veterinary context. It is now well-understood that the genes that encode resistance are context independent. That is, the same gene is commonly present in otherwise very disparate pathogens in both humans and production and companion animals, and among bacteria that proliferate in an agricultural context. This can be true even for pathogenic species or clonal types that are otherwise confined to a single host or ecological niche. It therefore follows that mechanisms of gene flow must exist to move genes from one part of the microbial biosphere to another. It is widely accepted that lateral (or horizontal) gene transfer (L(H)GT) drives this gene flow. LGT is relatively well-understood mechanistically but much of this knowledge is derived from a reductionist perspective. We believe that this is impeding our ability to deal with the medical ramifications of LGT. Resistance genes and the genetic scaffolds that mobilize them in multiply drug resistant bacteria of clinical significance are likely to have their origins in completely unrelated parts of the microbial biosphere. Resistance genes are increasingly polluting the microbial biosphere by contaminating environmental niches where previously they were not detected. More attention needs to be paid to the way that humans have, through the widespread application of antibiotics, selected for combinations of mobile elements that enhance the flow of resistance genes between remotely linked parts of the microbial biosphere. Attention also needs to be paid to those bacteria that link human and animal ecosystems. We argue that multiply antibiotic resistant commensal bacteria are especially important in this regard. More generally, the post genomics era offers the opportunity for understanding how resistance genes are mobilized from a one health perspective. In the long term, this holistic approach offers the best opportunity to

  8. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  9. Genes Expressed Differentially in Hessian Fly Larvae Feeding in Resistant and Susceptible Plants

    Directory of Open Access Journals (Sweden)

    Ming-Shun Chen

    2016-08-01

    Full Text Available The Hessian fly, Mayetiola destructor, is a destructive pest of wheat worldwide and mainly controlled by deploying resistant cultivars. In this study, we investigated the genes that were expressed differentially between larvae in resistant plants and those in susceptible plants through RNA sequencing on the Illumina platform. Informative genes were 11,832, 14,861, 15,708, and 15,071 for the comparisons between larvae in resistant versus susceptible plants for 0.5, 1, 3, and 5 days, respectively, after larvae had reached the feeding site. The transcript abundance corresponding to 5401, 6902, 8457, and 5202 of the informative genes exhibited significant differences (p ≤ 0.05 in the respective paired comparisons. Overall, genes involved in nutrient metabolism, RNA and protein synthesis exhibited lower transcript abundance in larvae from resistant plants, indicating that resistant plants inhibited nutrient metabolism and protein production in larvae. Interestingly, the numbers of cytochrome P450 genes with higher transcript abundance in larvae from resistant plants were comparable to, or higher than those with lower transcript abundance, indicating that toxic chemicals from resistant plants may have played important roles in Hessian fly larval death. Our study also identified several families of genes encoding secreted salivary gland proteins (SSGPs that were expressed at early stage of 1st instar larvae and with more genes with higher transcript abundance in larvae from resistant plants. Those SSGPs are candidate effectors with important roles in plant manipulation.

  10. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  11. RAPD PCR Profile, Antibiotic Resistance, Prevalence of armA Gene, and Detection of KPC Enzyme in Klebsiella pneumoniae Isolates

    Directory of Open Access Journals (Sweden)

    Arezoo Saadatian Farivar

    2018-01-01

    Full Text Available The increasing prevalence of multidrug-resistant Klebsiella pneumoniae strains isolated from hospitals shows the limitation of recent antibiotics used for bacterial eradication. In this study, 81 K. pneumoniae isolates were collected from three hospitals in Tehran. Antibiotic susceptibility test showed the highest rates of resistance to cefotaxim (85.5% and ceftazidime (78.3%, and the lowest rates of resistance were detected for colistin (16.9%, streptomycin (16.8%, and chloroamphenicol (21.7%. Eleven different resistance patterns were observed. Sixty-six out of 81 isolates (81.5% were found to be multidrug resistant (MDR, and 35.8% of them belonged to A3 resistance pattern. 7.4% and 66.7% were KPC enzyme and armA gene positive, respectively. RAPD PCR assay of these bacteria showed 5 clusters, 16 single types, and 14 common types, and there was not any correlation between genetic patterns of the isolates and presence of resistance agents. Simultaneous detection of resistance-creating agents could be an important challenge for combination therapy of MDR K. pneumoniae-caused infections.

  12. Loci and candidate gene identification for resistance to Phytophthora sojae via association analysis in soybean [Glycine max (L.) Merr].

    Science.gov (United States)

    Li, Lihong; Guo, Na; Niu, Jingping; Wang, Zili; Cui, Xiaoxia; Sun, Jutao; Zhao, Tuanjie; Xing, Han

    2016-06-01

    Phytophthora sojae is an oomycete soil-borne plant pathogen that causes the serious disease Phytophthora root rot in soybean, leading to great loss of soybean production every year. Understanding the genetic basis of this plant-pathogen interaction is important to improve soybean disease resistance. To discover genes or QTLs underlying naturally occurring variations in soybean P.sojae resistance, we performed a genome-wide association study using 59,845 single-nucleotide polymorphisms identified from re-sequencing of 279 accessions from Yangtze-Huai soybean breeding germplasm. We used two models for association analysis. The same strong peak was detected by both two models on chromosome 13. Within the 500-kb flanking regions, three candidate genes (Glyma13g32980, Glyma13g33900, Glyma13g33512) had SNPs in their exon regions. Four other genes were located in this region, two of which contained a leucine-rich repeat domain, which is an important characteristic of R genes in plants. These candidate genes could be potentially useful for improving the resistance of cultivated soybean to P.sojae in future soybean breeding.

  13. A Cluster of Nucleotide-Binding Site–Leucine-Rich Repeat Genes Resides in a Barley Powdery Mildew Resistance Quantitative Trait Loci on 7HL

    Directory of Open Access Journals (Sweden)

    Carlos P. Cantalapiedra

    2016-07-01

    Full Text Available Powdery mildew causes severe yield losses in barley production worldwide. Although many resistance genes have been described, only a few have already been cloned. A strong QTL (quantitative trait locus conferring resistance to a wide array of powdery mildew isolates was identified in a Spanish barley landrace on the long arm of chromosome 7H. Previous studies narrowed down the QTL position, but were unable to identify candidate genes or physically locate the resistance. In this study, the exome of three recombinant lines from a high-resolution mapping population was sequenced and analyzed, narrowing the position of the resistance down to a single physical contig. Closer inspection of the region revealed a cluster of closely related NBS-LRR (nucleotide-binding site–leucine-rich repeat containing protein genes. Large differences were found between the resistant lines and the reference genome of cultivar Morex, in the form of PAV (presence-absence variation in the composition of the NBS-LRR cluster. Finally, a template-guided assembly was performed and subsequent expression analysis revealed that one of the new assembled candidate genes is transcribed. In summary, the results suggest that NBS-LRR genes, absent from the reference and the susceptible genotypes, could be functional and responsible for the powdery mildew resistance. The procedure followed is an example of the use of NGS (next-generation sequencing tools to tackle the challenges of gene cloning when the target gene is absent from the reference genome.

  14. Impact of pre-application treatment on municipal sludge composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    Science.gov (United States)

    Lau, Calvin Ho-Fung; Li, Bing; Zhang, Tong; Tien, Yuan-Ching; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Lapen, David R; Duenk, Peter; Topp, Edward

    2017-06-01

    In many jurisdictions sludge recovered from the sewage treatment process is a valued fertilizer for crop production. Pre-treatment of sewage sludge prior to land application offers the potential to abate enteric microorganisms that carry genes conferring resistance to antibiotics. Pre-treatment practices that accomplish this should have the desirable effect of reducing the risk of contamination of crops or adjacent water with antibiotic resistance genes carried in these materials. In the present study, we obtained municipal sludge that had been subjected to one of five treatments. There were, anaerobic-digestion or aerobic-digestion, in both instances with and without dewatering; and heat-treatment and pelletization. Each of the five types of biosolids was applied to an agricultural field at commercial rates, following which lettuce, carrots and radishes were planted. Based on qPCR, the estimated antibiotic gene loading rates were comparable with each of the five biosolids. However, the gene abundance in soil following application of the pelletized biosolids was anomalously lower than expected. Following application, the abundance of antibiotic resistance genes decreased in a generally coherent fashion, except sul1 which increased in abundance during the growing season in the soil fertilized with pelletized biosolids. Based on qPCR and high throughput sequencing evidence for transfer of antibiotic resistance genes from the biosolids to the vegetables at harvest was weak. Clostridia were more abundant in soils receiving any of the biosolids except the pelletized. Overall, the behavior of antibiotic resistance genes in soils receiving aerobically or anaerobically-digested biosolids was consistent and coherent with previous studies. However, dynamics of antibiotic resistance genes in soils receiving the heat treated pelletized biosolids were very different, and the underlying mechanisms merit investigation. Crown Copyright © 2017. Published by Elsevier B.V. All

  15. Mechanism of single-layer 193-nm dissolution inhibition resist

    Science.gov (United States)

    Yan, Zhenglin; Houlihan, Francis M.; Reichmanis, Elsa; Nalamasu, Omkaram; Reiser, Arnost; Dabbagh, Gary; Hutton, Richard S.; Osei, Dan; Sousa, Jose; Bolan, Kevin J.

    2000-06-01

    We have found that the progress of developer base into films of terpolymers of norbornene (NB)-maleic anhydride (MA) and acrylic acid (AA) is a percolation process with a critical site concentration of x(c) equals 0.084 which suggests that every acrylic acid site in the terpolymer of norbornene-maleic anhydride-acrylic acid can make 12 monomer units of the polymer water compatible. In practice these systems are being used with various tert-butyl esters of cholic acid as dissolution inhibitors. The cholates differ very much in their dissolution inhibition factors (lowest t-butyl cholate (1.3) to highest t-butyl lithocholate glutarate dimer (7.4). The change in these factors corrected for molarity follow the hydrophobic character of the dissolution as measured by log(p). A quick screening method has also been established to evaluate dissolution inhibitors based on our observation that the cloud point (the volume % acetone in a water/acetone which gives persistent cloudiness) parallels the dissolution inhibiting power as measured by the dissolution inhibition factor. For dissolution promotion, optimal results are obtained with t-butyl 1,3,5-cyclohexanetricarboxylate (f equals -6.3) and poorest results with t-butyl lithocholate (f equals -2.8); this appears to track with the number of carboxyl groups and the hydrophobicity of the carboxylic acids. The Rmax found for resist formulations tracks well with these findings. Another factor in determining the ultimate achievable contrast is the degree of acidolytic deprotection achieved by the material. It appears that acidolyticaly cleaveable carboxylate esters with a higher concentration of electron withdrawing groups such as t-butyl 1,3,5-cyclohexanetricarboxylate are more effective.

  16. Transcriptome analysis of resistant and susceptible genotypes of Glycine tomentella during Phakopsora pachyrhizi infection reveals novel rust resistance genes.

    Science.gov (United States)

    Soria-Guerra, Ruth Elena; Rosales-Mendoza, Sergio; Chang, Sungyul; Haudenshield, James S; Padmanaban, Annamalai; Rodriguez-Zas, Sandra; Hartman, Glen L; Ghabrial, Said A; Korban, Schuyler S

    2010-05-01

    Soybean rust, caused by Phakopsora pachyrhizi, is a destructive foliar disease in nearly all soybean-producing countries. To identify genes controlling resistance to soybean rust, transcriptome profiling was conducted in resistant and susceptible Glycine tomentella genotypes triggered by P. pachyrhizi infection. Among 38,400 genes monitored using a soybean microarray, at 5% false discovery rate, 1,342 genes were identified exhibiting significant differential expression between uninfected and P. pachyrhizi-infected leaves at 12, 24, 48, and 72 h post-inoculation (hpi) in both rust-susceptible and rust-resistant genotypes. Differentially expressed genes were grouped into 12 functional categories, and among those, large numbers relate to basic plant metabolism. Transcripts for genes involved in the phenylpropanoid pathway were up-regulated early during rust infection. Similarly, genes coding for proteins related to stress and defense responses such as glutathione-S-transferases, peroxidases, heat shock proteins, and lipoxygenases were consistently up-regulated following infection at all four time points. Whereas, subsets of genes involved in cellular transport, cellular communication, cell cycle, and DNA processing were down-regulated. Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) on randomly selected genes from the different categories confirmed these findings. Of differentially expressed genes, those associated with the flavonoid biosynthesis pathway as well as those coding for peroxidases and lipoxygenases were likely to be involved in rust resistance in soybean, and would serve as good candidates for functional studies. These findings provided insights into mechanisms underlying resistance and general activation of plant defense pathways in response to rust infection.

  17. A pigeonpea gene confers resistance to Asian soybean rust in soybean.

    Science.gov (United States)

    Kawashima, Cintia G; Guimarães, Gustavo Augusto; Nogueira, Sônia Regina; MacLean, Dan; Cook, Doug R; Steuernagel, Burkhard; Baek, Jongmin; Bouyioukos, Costas; Melo, Bernardo do V A; Tristão, Gustavo; de Oliveira, Jamile Camargos; Rauscher, Gilda; Mittal, Shipra; Panichelli, Lisa; Bacot, Karen; Johnson, Ebony; Iyer, Geeta; Tabor, Girma; Wulff, Brande B H; Ward, Eric; Rairdan, Gregory J; Broglie, Karen E; Wu, Gusui; van Esse, H Peter; Jones, Jonathan D G; Brommonschenkel, Sérgio H

    2016-06-01

    Asian soybean rust (ASR), caused by the fungus Phakopsora pachyrhizi, is one of the most economically important crop diseases, but is only treatable with fungicides, which are becoming less effective owing to the emergence of fungicide resistance. There are no commercial soybean cultivars with durable resistance to P. pachyrhizi, and although soybean resistance loci have been mapped, no resistance genes have been cloned. We report the cloning of a P. pachyrhizi resistance gene CcRpp1 (Cajanus cajan Resistance against Phakopsora pachyrhizi 1) from pigeonpea (Cajanus cajan) and show that CcRpp1 confers full resistance to P. pachyrhizi in soybean. Our findings show that legume species related to soybean such as pigeonpea, cowpea, common bean and others could provide a valuable and diverse pool of resistance traits for crop improvement.

  18. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  19. Characterization of the Maize Chitinase Genes and Their Effect on Aspergillus flavus and Aflatoxin Accumulation Resistance

    Science.gov (United States)

    Hawkins, Leigh K.; Mylroie, J. Erik; Oliveira, Dafne A.; Smith, J. Spencer; Ozkan, Seval; Windham, Gary L.; Williams, W. Paul; Warburton, Marilyn L.

    2015-01-01

    Maize (Zea mays L.) is a crop of global importance, but prone to contamination by aflatoxins produced by fungi in the genus Aspergillus. The development of resistant germplasm and the identification of genes contributing to resistance would aid in the reduction of the problem with a minimal need for intervention by farmers. Chitinolytic enzymes respond to attack by potential pathogens and have been demonstrated to increase insect and fungal resistance in plants. Here, all chitinase genes in the maize genome were characterized via sequence diversity and expression patterns. Recent evolution within this gene family was noted. Markers from within each gene were developed and used to map the phenotypic effect on resistance of each gene in up to four QTL mapping populations and one association panel. Seven chitinase genes were identified that had alleles associated with increased resistance to aflatoxin accumulation and A. flavus infection in field grown maize. The chitinase in bin 1.05 identified a new and highly significant QTL, while chitinase genes in bins 2.04 and 5.03 fell directly beneath the peaks of previously published QTL. The expression patterns of these genes corroborate possible grain resistance mechanisms. Markers from within the gene sequences or very closely linked to them are presented to aid in the use of marker assisted selection to improve this trait. PMID:26090679

  20. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Effect of ribosome-targeting antibiotics on streptomycin-resistant Mycobacterium mutants in the rpsL gene.

    Science.gov (United States)

    Pelchovich, Gidi; Zhuravlev, Alina; Gophna, Uri

    2013-08-01

    Streptomycin (Sm) was the first antibiotic used against Mycobacterium tuberculosis, the aetiological agent of tuberculosis (TB). However, point mutations in the rpsL gene can generate resistance to Sm, which is why spontaneous resistance to this antibiotic emerges so rapidly during treatment. Here we examine the interaction between Sm resistance and sensitivity to other ribosome-targeting antibiotics. Levels of resistance of rpsL mutants to the ribosome-affecting antibiotics chloramphenicol, tetracycline, gentamicin and erythromycin were tested, both singly and in combination. For this purpose, Mycobacterium smegmatis was used, which is commonly used in laboratory experiments as a model for TB. Generally, Sm-resistant mutants were as sensitive to the ribosome-affecting antibiotics as the wild-type strain. Combinations of different ribosome-affecting antibiotics were occasionally more potent than either of the single drugs, with better inhibition of both wild-type and mutant strains. Combining different ribosome-affecting drugs could represent an additional strategy in treating mycobacterial infections, including those resistant to newer drugs such as isoniazid or ethambutol. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  2. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    friendly method. Wild relatives of wheat are reservoir of useful genes, including genes for rust resis- tance. To date, 74 leaf rust resistance genes have been des- ignated and about half of them have originated from various closely or distantly related ...

  3. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Molecular detection of methicillin resistant Staphylococcus aureus harbouring β- lactamase resistance genes isolated from different sources of infections

    Directory of Open Access Journals (Sweden)

    Amir Hani Raziq

    2017-12-01

    Full Text Available Background and objective: The detection and investigation of methicillin resistance staphylococci specifically S. aureus in clinical microbiology setting is very helpful both for informing the appropriate treatment of individual patients and also for the surveillance of these organisms. This study aimed at the rapid molecular detection of methicillin resistant staphylococci harbouring β-lactamase gene and determination of the efficiency of m-PCR through comparison with uniplex PCR. Methods: Standard microbiological techniques were applied for the determination of the presence of methicillin resistant S. aureus in samples recovered from different body sites of patients who attended Al-Kadhumyhia Teaching and Baghdad Teaching Hospitals. The resulting methicillin resistant S. aureus (MRSA isolates were subjected to uni and multiplex PCR amplifications for detecting the existence of mec A gene and β-lactamase (TEM resistance gene. Results: Half of the cases involved were found to be caused by MRSA. All the tested isolates showed positive amplification bands for the presence of mec A gene and only 48.8% of these harbored TEM gene. The obtained results revealed high sensitivity of universal bacterial and TEM primers expressed as 97.6% and 100% respectively, while the sensitivity of mec A primer was limited to 60%. Conclusion: The phenotypic identification of MRSA revealed a higher incidence rate and that different molecular techniques can yield conflicting results and it can also be concluded that resistant due to beta- lactamase production can be a crucial factor added to the previously settled methicillin resistant due to mec A gene.

  5. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  6. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  7. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  8. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun

    2014-01-01

    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  9. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  10. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L

    2018-03-21

    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  11. Transcriptomic analysis of colistin-susceptible and colistin-resistant isolates identifies genes associated with colistin resistance in Acinetobacter baumannii.

    Science.gov (United States)

    Park, Y K; Lee, J-Y; Ko, K S

    2015-08-01

    The emergence of colistin-resistant Acinetobacter baumannii is concerning, as colistin is often regarded as the last option for treating multidrug-resistant (MDR) A. baumannii infections. Using mRNA sequencing, we compared whole transcriptomes of colistin-susceptible and colistin-resistant A. baumannii strains, with the aim of identifying genes involved in colistin resistance. A clinical colistin-susceptible strain (06AC-179) and a colistin-resistant strain (07AC-052) were analysed in this study. In addition, a colistin-resistant mutant (06AC-179-R1) derived from 06AC-179 was also included in this study. High throughput mRNA sequencing was performed with an Illumina HiSeq TM 2000. In total, six genes were identified as associated with colistin resistance in A. baumannii. These six genes encode PmrAB two-component regulatory enzymes, PmrC (a lipid A phosphoethanolamine transferase), a glycosyltransferase, a poly-β-1,6-N-acetylglucosamine deacetylase, and a putative membrane protein. Matrix-assisted laser desorption/ionization time of flight mass spectrometry revealed that all three colistin-resistant strains used in this study had modified lipid A structure by addition of phosphoethanolamine. As genes found in our results are all associated with either lipopolysaccharide biosynthesis or electrostatic changes in the bacterial cell membrane, lipopolysaccharide modification might be one of the principal modes of acquisition of colistin resistance in some A. baumannii strains. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  13. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  14. Epidemiologic evaluation of Vancomycin Resistant genes in Enterococcus spp. isolated from clinical samples

    Directory of Open Access Journals (Sweden)

    Omid Teymournejad

    2011-09-01

    Full Text Available Background & Objectives: Isolation of vancomycin resistant Enterococcus from clinical samples is very important. The aim of this study was evaluation of phenotype and genotype of van genes in vancomycine resistant Enterococcus. Materials and Methods: 411 Enterococcus isolates were collected from selected Tehran’s hospitals between March 2004 and December 2007. The enterococcal isolates were identified by biochemical confirmation tests. Resistance of each isolate to vancomycin determined by disk diffusion and agar dilution test. The presence of the vanA, B, C, D, E resistance gene was assessed by PCR. Results: 185(45% and 23(5.6% with disc-diffusion method and agar-dilution method were resistant to vancomucin (VRE and all of VREs were Enterococcus faecium. 12 (52.2%, 7(30.4% of the VRE isolates had vanA, vanB and 3(13% had both of vanA and vanB gene. Conclusion: Most important mechanism for high level resistance to vancomycin is presence of van genes and these genes can transfer between Enterococci. Significance of investigation in molecular level of resistance to vancomycin was due to relation between phenotypic resistant and presence of van genes.

  15. Genome wide single cell analysis of chemotherapy resistant metastatic cells in a case of gastroesophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Hjortland, Geir Olav; Fodstad, Oystein; Smeland, Sigbjorn; Hovig, Eivind; Meza-Zepeda, Leonardo A; Beiske, Klaus; Ree, Anne H; Tveito, Siri; Hoifodt, Hanne; Bohler, Per J; Hole, Knut H; Myklebost, Ola

    2011-01-01

    Metastatic progression due to development or enrichment of therapy-resistant tumor cells is eventually lethal. Molecular characterization of such chemotherapy resistant tumor cell clones may identify markers responsible for malignant progression and potential targets for new treatment. Here, in a case of stage IV adenocarcinoma of the gastroesophageal junction, we report the successful genome wide analysis using array comparative genomic hybridization (CGH) of DNA from only fourteen tumor cells using a bead-based single cell selection method from a bone metastasis progressing during chemotherapy. In a case of metastatic adenocarcinoma of the gastroesophageal junction, the progression of bone metastasis was observed during a chemotherapy regimen of epirubicin, oxaliplatin and capecitabine, whereas lung-, liver and lymph node metastases as well as the primary tumor were regressing. A bone marrow aspirate sampled at the site of progressing metastasis in the right iliac bone was performed, and single cell molecular analysis using array-CGH of Epithelial Specific Antigen (ESA)-positive metastatic cells, and revealed two distinct regions of amplification, 12p12.1 and 17q12-q21.2 amplicons, containing the KRAS (12p) and ERBB2 (HER2/NEU) (17q) oncogenes. Further intrapatient tumor heterogeneity of these highlighted gene copy number changes was analyzed by fluorescence in situ hybridization (FISH) in all available primary and metastatic tumor biopsies, and ErbB2 protein expression was investigated by immunohistochemistry. ERBB2 was heterogeneously amplified by FISH analysis in the primary tumor, as well as liver and bone metastasis, but homogenously amplified in biopsy specimens from a progressing bone metastasis after three initial cycles of chemotherapy, indicating a possible enrichment of erbB2 positive tumor cells in the progressing bone marrow metastasis during chemotherapy. A similar amplification profile was detected for wild-type KRAS, although more heterogeneously

  16. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  17. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  18. Emergence of macrolide resistance gene mph(B) in Streptococcus uberis and cooperative effects with rdmC-like gene.

    Science.gov (United States)

    Achard, Adeline; Guérin-Faublée, Véronique; Pichereau, Vianney; Villers, Corinne; Leclercq, Roland

    2008-08-01

    Streptococcus uberis UCN60 was resistant to spiramycin (MIC = 8 microg/ml) but susceptible to erythromycin (MIC = 0.06 microg/ml), azithromycin (MIC = 0.12 microg/ml), josamycin (MIC = 0.25 microg/ml), and tylosin (MIC = 0.5 microg/ml). A 2.5-kb HindIII fragment was cloned from S. uberis UCN60 DNA on plasmid pUC18 and introduced into Escherichia coli AG100A, where it conferred resistance to spiramycin by inactivation. The sequence analysis of the fragment showed the presence of an rdmC-like gene that putatively encoded a protein belonging to the alpha/beta hydrolase family and of the first 196 nucleotides of the mph(B) gene putatively encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli. The entire mph(B) gene was then identified in S. uberis UCN60. The two genes were expressed alone or in combination in E. coli, Staphylococcus aureus, and Enterococcus faecalis. Analysis of MICs revealed that rdmC-like alone did not confer resistance to erythromycin, tylosin, and josamycin in those three hosts. It conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. mph(B) conferred resistance in E. coli to erythromycin, tylosin, josamycin, and spiramycin but only low levels of resistance in E. faecalis and S. aureus to spiramycin (MIC = 8 microg/ml). The combination of mph(B) and rdmC-like genes resulted in a resistance to spiramycin and tylosin in the three hosts that significantly exceeded the mere addition of the resistance levels conferred by each resistance mechanism alone.

  19. Molecular Evolution of the Rice Blast Resistance Gene Pi-ta in Invasive Weedy Rice in the USA

    Science.gov (United States)

    Lee, Seonghee; Jia, Yulin; Jia, Melissa; Gealy, David R.; Olsen, Kenneth M.; Caicedo, Ana L.

    2011-01-01

    The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus), which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta) found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH), suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s) required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta), not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing. PMID:22043312

  20. Molecular evolution of the rice blast resistance gene Pi-ta in invasive weedy rice in the USA.

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    Full Text Available The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus, which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH, suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta, not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing.

  1. Antimicrobial resistance genes in Actinobacillus pleuropneumoniae, Haemophilus parasuis and Pasteurella multocida isolated from Australian pigs.

    Science.gov (United States)

    Dayao, Dae; Gibson, J S; Blackall, P J; Turni, C

    2016-07-01

    To identify genes associated with the observed antimicrobial resistance in Actinobacillus pleuropneumoniae, Haemophilus parasuis and Pasteurella multocida isolated from Australian pigs. Isolates with known phenotypic resistance to β-lactams, macrolides and tetracycline were screened for the presence of antimicrobial resistance genes. A total of 68 A. pleuropneumoniae, 62 H. parasuis and 20 P. multocida isolates exhibiting phenotypic antimicrobial resistance (A. pleuropneumoniae and P. multocida) or elevated minimal inhibitory concentrations (MICs) (H. parasuis) to any of the following antimicrobial agents - ampicillin, erythromycin, penicillin, tetracycline, tilmicosin and tulathromycin - were screened for a total of 19 associated antimicrobial resistance genes (ARGs) by PCR. The gene bla ROB-1 was found in all ampicillin- and penicillin-resistant isolates, but none harboured the bla TEM-1 gene. The tetB gene was found in 76% (74/97) of tetracycline-resistant isolates, 49/53 A. pleuropneumoniae, 17/30 H. parasuis and 8/14 P. multocida. One A. pleuropneumoniae isolate harboured the tetH gene, but none of the 97 isolates had tetA, tetC, tetD, tetE, tetL, tetM or tetO. A total of 92 isolates were screened for the presence of macrolide resistance genes. None was found to have ermA, ermB, ermC, erm42, mphE, mefA, msrA or msrE. The current study has provided a genetic explanation for the resistance or elevated MIC of the majority of isolates of Australian porcine respiratory pathogens to ampicillin, penicillin and tetracycline. However, the macrolide resistance observed by phenotypic testing remains genetically unexplained and further studies are required. © 2016 Australian Veterinary Association.

  2. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  3. QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii.

    Science.gov (United States)

    Shen, Bang; Powell, Robin H; Behnke, Michael S

    2017-06-22

    Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

  4. Quinolone resistance mutations in the gyrA gene of clinical isolates of Salmonella.

    Science.gov (United States)

    Ouabdesselam, S; Tankovic, J; Soussy, C J

    1996-01-01

    S. typhimurium AlhR, S. enteritidis OulR, and S. hadar GueR resistant to fluoroquinolones (QR), ciprofloxacin MICs, 0.25 to 1 microgram/ml; norfloxacin MICs, 0.5 to 4 micrograms/ml; nalidixic acid MIC, 256 micrograms/ml were isolated from urinary tract infections (AlhR and OulR) during FQ therapy in immunocompromised patients infected by the parent FQ-susceptible strains (AlhS and OulS) (ciprofloxacin MICs, 0.032-0.063; norfloxacin MICs, 0.125-0.25; nalidixic acid MICs, 4-8) or from intestinal infection (GueR). Transformation of AlhR, OulR, and GueR by plasmid pJSW101 carrying the wild-type gyrA gene of Escherichia coli resulted in complementation (nalidixic acid MICs, 4 to 8), proving that these strains had a gyrA mutation. A 800-bp fragment of gyrA from the five strains was amplified by PCR. Direct DNA sequencing of 252-bp region of this fragment identified a single point mutation leading to a substitution Ser-83 to Tyr in AlhR and to a substitution Ser-83 to Phe in OulR and in GueR. These results emphasize the potential risk of selection of FQ-resistant Salmonella during FQ therapy in immunocompromised patients and suggest that these strains differ from the parent strains at least by one mutation in the gyrA gene. They also confirm the role of substitutions in position 83 of gyrA in FQ-resistant clinical isolates of Salmonella.

  5. Targeted Next-Generation Sequencing Identification of Mutations in Disease Resistance Gene Analogs (RGAs) in Wild and Cultivated Beets

    Science.gov (United States)

    Broccanello, Chiara; Pajola, Luca; Biscarini, Filippo; Richards, Chris; Panella, Lee; Hassani, Mahdi; Formentin, Elide; Chiodi, Claudia; Concheri, Giuseppe; Heidari, Bahram

    2017-01-01

    Resistance gene analogs (RGAs) were searched bioinformatically in the sugar beet (Beta vulgaris L.) genome as potential candidates for improving resistance against different diseases. In the present study, Ion Torrent sequencing technology was used to identify mutations in 21 RGAs. The DNA samples of ninety-six individuals from six sea beets (Beta vulgaris L. subsp. maritima) and six sugar beet pollinators (eight individuals each) were used for the discovery of single-nucleotide polymorphisms (SNPs). Target amplicons of about 200 bp in length were designed with the Ion AmpliSeq Designer system in order to cover the DNA sequences of the RGAs. The number of SNPs ranged from 0 in four individuals to 278 in the pollinator R740 (which is resistant to rhizomania infection). Among different groups of beets, cytoplasmic male sterile lines had the highest number of SNPs (132) whereas the lowest number of SNPs belonged to O-types (95). The principal coordinates analysis (PCoA) showed that the polymorphisms inside the gene Bv8_184910_pkon (including the CCCTCC sequence) can effectively differentiate wild from cultivated beets, pointing at a possible mutation associated to rhizomania resistance that originated directly from cultivated beets. This is unlike other resistance sources that are introgressed from wild beets. This gene belongs to the receptor-like kinase (RLK) class of RGAs, and is associated to a hypothetical protein. In conclusion, this first report of using Ion Torrent sequencing technology in beet germplasm suggests that the identified sequence CCCTCC can be used in marker-assisted programs to differentiate wild from domestic beets and to identify other unknown disease resistance genes in beet. PMID:29019931

  6. Two pathways act in an additive rather than obligatorily synergistic fashion to induce systemic acquired resistance and PR gene expression

    Directory of Open Access Journals (Sweden)

    Shapiro Allan D

    2002-10-01

    Full Text Available Abstract Background Local infection with necrotizing pathogens induces whole plant immunity to secondary challenge. Pathogenesis-related genes are induced in parallel with this systemic acquired resistance response and thought to be co-regulated. The hypothesis of co-regulation has been challenged by induction of Arabidopsis PR-1 but not systemic acquired resistance in npr1 mutant plants responding to Pseudomonas syringae carrying the avirulence gene avrRpt2. However, experiments with ndr1 mutant plants have revealed major differences between avirulence genes. The ndr1-1 mutation prevents hypersensitive cell death, systemic acquired resistance and PR-1 induction elicited by bacteria carrying avrRpt2. This mutation does not prevent these responses to bacteria carrying avrB. Results Systemic acquired resistance, PR-1 induction and PR-5 induction were assessed in comparisons of npr1-2 and ndr1-1 mutant plants, double mutant plants, and wild-type plants. Systemic acquired resistance was displayed by all four plant lines in response to Pseudomonas syringae bacteria carrying avrB. PR-1 induction was partially impaired by either single mutation in response to either bacterial strain, but only fully impaired in the double mutant in response to avrRpt2. PR-5 induction was not fully impaired in any of the mutants in response to either avirulence gene. Conclusion Two pathways act additively, rather than in an obligatorily synergistic fashion, to induce systemic acquired resistance, PR-1 and PR-5. One of these pathways is NPR1-independent and depends on signals associated with hypersensitive cell death. The other pathway is dependent on salicylic acid accumulation and acts through NPR1. At least two other pathways also contribute additively to PR-5 induction.

  7. Inducible clindamycin resistance in clinical isolates of Staphylococcus aureus due to erm genes, Iran.

    Science.gov (United States)

    Moosavian, Mojtaba; Shoja, Saeed; Rostami, Soodabeh; Torabipour, Maryam; Farshadzadeh, Zahra

    2014-12-01

    Resistance to macrolide can be mediated by erm and msrA genes in Staphylococcus aureus. There are the evidences that show erm genes may be causative agent of inducible or constitutive resistance. The aim of this study was to investigate the incidence of inducible clindamycin resistance and determine the most frequency of erm and msrA genes among S. aureus isolates. In this study a total of 124 non duplicated clinical isolates of S. aureus were tested with disk diffusion method. All isolates were tested by PCR for mecA, ermA, ermB, ermC and msrA genes. According to PCR results, 48.4% had mecA gene and 51.6% were mecA negative. By phenotypic D-test method, 32.3% revealed inducible resistance and recorded as D and D(+). Sensitive and constitutive phenotypes were found in 54.8% and 12.9% of isolates respectively. Inducible clindamycin resistance was more prevalent in MRSA (29%) than MSSA isolates (2.4%). Among studied erm genes, the most frequency genes were ermA and ermC with 41.1% and 17.7% respectively. Three isolates of them had D phenotype, while the PCR results of erm genes were negative. All isolates were negative for ermB or msrA genes. Since S. aureus isolates with inducible resistance may mutate and change to constitutive resistance, to prevent treatment failure, we suggest that inducible resistance test be performed on erythromycin resistant/clindamycin sensitive isolates.

  8. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  9. Abrasion resistance, microhardness and microstructures of single-phase niobium nitride films

    International Nuclear Information System (INIS)

    Singer, I.L.; Bolster, R.N.; Wolf, S.A.; Skelton, E.F.; Jeffries, R.A.

    1983-01-01

    The relative abrasive wear resistance of single-phase niobium nitride films deposited at 900 and 500 0 C was measured. Wear resistance versus depth profiles of films abraded against 1-5 μm diamond were obtained by weight loss methods. A β phase Nb 2 N film was five to 20 times more abrasion resistant, but only slightly (40%) harder, than the delta phase NbN films made at the same temperature. The β-Nb 2 N film was deformed plastically during wear, reorienting the [002] c axis perpendicular to the plane of the substrate. The abrasion resistance of the delta-NbN films was initially proportional to the microhardness. Two films had changes in their abrasion resistance as wear proceeded: for one film the change was attributable to deviations in stoichiometry and for the other film it was attributable to increased lattice distortion. (Auth.)

  10. Bias voltage induced resistance switching effect in single-molecule magnets’ tunneling junction

    Science.gov (United States)

    Zhang, Zhengzhong; Jiang, Liang

    2014-09-01

    An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be ‘read out’ by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

  11. Bias voltage induced resistance switching effect in single-molecule magnets' tunneling junction.

    Science.gov (United States)

    Zhang, Zhengzhong; Jiang, Liang

    2014-09-12

    An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be 'read out' by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

  12. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  13. Galactosemia, a single gene disorder with epigenetic consequences.

    LENUS (Irish Health Repository)

    Coman, David J

    2010-03-01

    Long-term outcomes of classic galactosemia (GAL) remain disappointing. It is unclear if the complications result mainly from prenatal-neonatal toxicity or persistent glycoprotein and glycolipid synthesis abnormalities. We performed gene expression profiling (T transcriptome) to characterize key-altered genes and gene clusters of four patients with GAL with variable outcomes maintained on a galactose-restricted diet, compared with controls. Significant perturbations of multiple cell signaling pathways were observed including mitogen-activated protein kinase (MAPK) signaling, regulation of the actin cytoskeleton, focal adhesion, and ubiquitin mediated proteolysis. A number of genes significantly altered were further investigated in the GAL cohort including SPARC (osteonectin) and S100A8 (S100 calcium-binding protein). The whole serum N-glycan profile and IgG glycosylation status of 10 treated patients with GAL were compared with healthy control serum and IgG using a quantitative high-throughput analytical HPLC platform. Increased levels of agalactosylated and monogalactosylated structures and decreases in certain digalactosylated structures were identified in the patients. The persistent abnormal glycosylation of serum glycoproteins seen with the microarray data indicates persisting metabolic dyshomeostasis and gene dysregulation in "treated" GAL. Strict restriction of dietary galactose is clearly life saving in the neonatal period; long-term severe galactose restriction may contribute to ongoing systemic abnormalities.

  14. Identification and molecular mapping of Rps11, a novel gene conferring resistance to Phytophthora sojae in soybean.

    Science.gov (United States)

    Ping, Jieqing; Fitzgerald, Joshua C; Zhang, Chunbao; Lin, Feng; Bai, Yonghe; Wang, Dechun; Aggarwal, Rajat; Rehman, Maqsood; Crasta, Oswald; Ma, Jianxin

    2016-02-01

    Rps11 confers excellent resistance to predominant Phytophthora sojae isolates capable of defeating major Rps genes deployed into soybean production, representing a novel source of resistance for soybean cultivar enhancement. Phytophthora root and stem rot (PRSR), caused by the soil-borne pathogen Phytophthora sojae, is a devastating disease of soybean [Glycine max (L.) Merr.] throughout the world. Deploying resistant soybean cultivars is the most effective and environmentally friendly approach to managing this disease. The soybean landrace PI 594527 was found to carry excellent resistance to all P. sojae isolates examined, some of which were capable of overcoming the major Rps genesp, such as Rps1-k, Rps1-c, and Rps3-a, predominantly used for soybean protection in the past decades. A mapping population consisting of 58 F2 individuals and 209 F2:3 families derived from a cross between PI 594527 and the susceptible cultivar 'Williams' was used to characterize the inheritance pattern of the resistance to P. soja (Rps) in PI 594527. It was found that the resistance was conferred by a single Rps gene, designated Rps11, which was initially defined as an ~5 Mb genomic region at the beginning of chromosome 7 by bulked segregant analysis (BSA) with a nucleotide polymorphism (SNP) chip comprising 7039 SNP markers. Subsequently, simple sequence repeat (SSR) markers in the defined region were used to genotype the F2:3 mapping population to map Rps11 to a 225.3 kb genomic region flanked by SSR markers BARCSOYSSR_07_0286 and BARCSOYSSR_07_0300, according to the soybean reference genome sequence. Particularly, an SSR marker (i.e., BARCSOYSSR_07_0295) was found to tightly co-segregate with Rps11 in the mapping population and can be effectively used for marker-assisted selection of this gene for development of resistant soybean cultivars.

  15. Parallel evolution of tetrodotoxin resistance in three voltage-gated sodium channel genes in the garter snake Thamnophis sirtalis.

    Science.gov (United States)

    McGlothlin, Joel W; Chuckalovcak, John P; Janes, Daniel E; Edwards, Scott V; Feldman, Chris R; Brodie, Edmund D; Pfrender, Michael E; Brodie, Edmund D

    2014-11-01

    Members of a gene family expressed in a single species often experience common selection pressures. Consequently, the molecular basis of complex adaptations may be expected to involve parallel evolutionary changes in multiple paralogs. Here, we use bacterial artificial chromosome library scans to investigate the evolution of the voltage-gated sodium channel (Nav) family in the garter snake Thamnophis sirtalis, a predator of highly toxic Taricha newts. Newts possess tetrodotoxin (TTX), which blocks Nav's, arresting action potentials in nerves and muscle. Some Thamnophis populations have evolved resistance to extremely high levels of TTX. Previous work has identified amino acid sites in the skeletal muscle sodium channel Nav1.4 that confer resistance to TTX and vary across populations. We identify parallel evolution of TTX resistance in two additional Nav paralogs, Nav1.6 and 1.7, which are known to be expressed in the peripheral nervous system and should thus be exposed to ingested TTX. Each paralog contains at least one TTX-resistant substitution identical to a substitution previously identified in Nav1.4. These sites are fixed across populations, suggesting that the resistant peripheral nerves antedate resistant muscle. In contrast, three sodium channels expressed solely in the central nervous system (Nav1.1-1.3) showed no evidence of TTX resistance, consistent with protection from toxins by the blood-brain barrier. We also report the exon-intron structure of six Nav paralogs, the first such analysis for snake genes. Our results demonstrate that the molecular basis of adaptation may be both repeatable across members of a gene family and predictable based on functional considerations. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme

    Science.gov (United States)

    2013-01-01

    Background Resistance of the highly aggressive glioblastoma multiforme (GBM) to drug therapy is a major clinical problem resulting in a poor patient’s prognosis. Beside promoter methylation of the O 6 -methylguanine-DNA-methyltransferase (MGMT) gene the efflux transporters ABCB1 and ABCG2 have been suggested as pivotal factors contributing to drug resistance, but the methylation of ABCB1 and ABCG2 has not been assessed before in GBM. Methods Therefore, we evaluated the proportion and prognostic significance of promoter methylation of MGMT, ABCB1 and ABCG2 in 64 GBM patient samples using pyrosequencing technology. Further, the single nucleotide polymorphisms MGMT C-56 T (rs16906252), ABCB1 C3435T (rs1045642) and ABCG2 C421A (rs2231142) were determined using the restriction fragment length polymorphism method (RFLP). To study a correlation between promoter methylation and gene expression, we analyzed MGMT, ABCB1 and ABCG2 expression in 20 glioblastoma and 7 non-neoplastic brain samples. Results Despite a significantly increased MGMT and ABCB1 promoter methylation in GBM tissue, multivariate regression analysis revealed no significant association between overall survival of glioblastoma patients and MGMT or ABCB1 promoter methylation. However, a significant negative correlation between promoter methylation and expression could be identified for MGMT but not for ABCB1 and ABCG2. Furthermore, MGMT promoter methylation was significantly associated with the genotypes of the MGMT C-56 T polymorphism showing a higher methylation level in the T allele bearing GBM. Conclusions In summary, the data of this study confirm the previous published relation of MGMT promoter methylation and gene expression, but argue for no pivotal role of MGMT, ABCB1 and ABCG2 promoter methylation in GBM patients’ survival. PMID:24380367

  17. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  18. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  19. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  20. [Genetic analysis and molecular mapping of stripe rust resistance gene in a restore line of Thermo-Photo sensitive hybrid wheat MR168].

    Science.gov (United States)

    Ren, Yong; Li, Sheng-Rong; Li, Jun; Zhou, Qiang; DU, Xiao-Ying; Li, Tai-Jun; Yang, Wu-Yun; Zheng, You-Liang

    2011-11-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important limiting factor to popularize hybrid wheat. The objectives of this study were to map a stripe rust resistance gene in a Chinese thermo-photo-sensitive hybrid wheat restore line MR168 using gene postulation and SSR markers. MR168 was highly resistant to 23 Pst races including CYR29, CYR31, CYR32, and CYR33. The populations F1, BC1, F2, and F3 from the cross between MR168 and SY95-71 (a wheat cultivar susceptible to Pst races) were inoculated with the race of Pst CYR32 of China in greenhouse. MR168 carried a single dominant gene for resistance to CYR32, tentatively designated YrMR168. It originated from Liaochun 10, a spring wheat variety. A total of 183 F2 plants, the resistant and susceptible parents and resistant and susceptible bulks were used for resistance gene mapping with 329 pairs of wheat SSR markers.Five SSR markers on chromosome 1BS including Xgwm18, Xbarc187, Xwmc269, Xgwm273, and Xwmc406 were linked with YrMR168. The resistance gene was closely linked to Xgwm18 and Xbarc187 with the genetic distances of 1.9 and 2.4 cM, respectively. Xgwm18 and Xbarc187 could be used for molecular marker assisted selection of YrMR168 in hybrid wheat breeding program.

  1. Selection and characterization of a promoter for expression of single-copy recombinant genes in Gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Manganelli Riccardo

    2005-01-01

    Full Text Available Abstract Background In the past ten years there has been a growing interest in engineering Gram-positive bacteria for biotechnological applications, including vaccine delivery and production of recombinant proteins. Usually, bacteria are manipulated using plasmid expression vectors. The major limitation of this approach is due to the fact that recombinant plasmids are often lost from the bacterial culture upon removal of antibiotic selection. We have developed a genetic system based on suicide vectors on conjugative transposons allowing stable integration of recombinant DNA into the chromosome of transformable and non-transformable Gram-positive bacteria. Results The aim of this work