WorldWideScience

Sample records for single resistance gene

  1. Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

    Directory of Open Access Journals (Sweden)

    Claire Chewapreecha

    2014-08-01

    Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

  2. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    Science.gov (United States)

    Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  3. Association of single nucleotide polymorphisms in the MVP gene with platinum resistance and survival in patients with epithelial ovarian cancer.

    Science.gov (United States)

    Zhao, Ya-Nan; He, Dong-Ning; Wang, Ya-DI; Li, Jun-Jie; Ha, Min-Wen

    2016-04-01

    The human major vault protein (MVP) has been linked to the development of multidrug resistance in cancer cells, and overexpression of MVP has been observed in ovarian cancer tissues. The aim of the present study was to investigate the association between single nucleotide polymorphisms (SNPs) in the MVP gene and the tumor response to platinum-based chemotherapy and survival of patients affected by epithelial ovarian cancer (EOC), in addition to confirm whether tetra-primer amplification-refractory mutation system (ARMS)-polymerase chain reaction (PCR) is an accurate genotyping method. For this purpose, two polymorphisms in the MVP gene, namely reference SNP (rs)1057451 and rs4788186, were selected from the data obtained by the International haplotype map (HapMap) Project regarding Chinese Han population, and were evaluated by tetra-primer ARMS-PCR. Upon validation by DNA sequencing, the association of these polymorphisms with platinum resistance, progression-free survival (PFS) and overall survival (OS) in patients with EOC was assessed. The results of tetra-primer ARMS-PCR were in agreement with those derived from DNA sequencing. No significant differences were observed between platinum-sensitive and platinum-resistant cohorts in terms of allele and genotype distribution of these two polymorphisms in the MVP gene, which were not associated with PFS or OS. However, a trend toward prolonged PFS was observed in patients carrying the heterozygous AG allele at the rs4788186 locus. These results suggest that rs1057451 and rs4788186 variants in the MVP gene are not associated with favorable therapeutic response to platinum or longer survival in Chinese Han patients affected by EOC. In addition, the data of the present study confirm that tetra-primer ARMS-PCR is a trustworthy and economical genotyping method.

  4. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  5. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

    Science.gov (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

    2003-07-01

    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  6. Association of single nucleotide polymorphism at position 45 in adiponectin gene with plasma adiponectin level and insulin resistance in obesity

    International Nuclear Information System (INIS)

    Chen Xiaoyu; Li Xisheng; Lin Xiahong; Gao Hongzhi; Li Qiulan; Zha Jinshun

    2012-01-01

    Objective: To explore the association of single nucleotide polymorphism at position 45 (SNP45) in adiponectin gene with plasma adiponectin level and insulin resistance in obesity in Quanzhou area of Fujian province. Methods: Two hundred and forty-eight patients with obesity and 225 normal control subjects were enrolled in this study.Fasting insulin (FINS) were measured by radioimmunoassay and fasting plasma glucose (FPG), total cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) were measured by BECKMAN DXC800 biochemistry analyzer. Body mass index (BMI), waist to hip ratio,homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Plasma adiponectin levels were examined by means of enzyme-linked immunosorbentassy. The adiponectin gene SNP45 was identified by PCR-restriction fragment length polymorphism. Results: (1) Frequencies of GG+GT genotype in obesity group and normal control group were 61% and 44% respectively (χ 2 =14.182, P<0.01), and G allele frequencies were 35% and 25% (χ 2 =10.708, P<0.01). (2) In obesity group,the subjects with SNP45 GG+GT genotype had higher TG and LDL-C levels than those with TT genotype (t=2.604, P<0.01; t=5.507, P<0.01), and had lower adiponectin level than those with TT genotype (t=2.275, P<0.05), and had significantly lower HDL-L level than those with TT genotype (t=10.100, P< 0.01). (3) In normal control group,the subjects with SNP45 GG +GT genotype had significantly lower adiponectin,TG,TC levels than those with TT genotype (t=2.510, P<0.05; t=2.922, P<0.01; t=3.272, P< 0.01). (4) Logistic analysis proved that the SNP45 GG+GT genotype in obesity group was associated with decreased risk of plasma adiponectin level (OR=0.810, 95% CI : 0.673-0.975, P<0.05), and with increased risk of HOMA-IR (OR=1.746, 95% CI : 1.060-2.875, P<0.05). The SNP45 GG+GT genotype in normal control group was associated with increased risk of HOMA-IR (OR=3

  7. The diversities of staphylococcal species, virulence and antibiotic resistance genes in the subclinical mastitis milk from a single Chinese cow herd.

    Science.gov (United States)

    Xu, Jia; Tan, Xiao; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang

    2015-11-01

    Staphylococci are the leading pathogens of bovine mastitis which is difficult to control. However, the published data on the prevalence of staphylococcal species, virulence and antibiotic resistance genes in bovine mastitis from China are limited. In this study, 104 out of 209 subclinical mastitis milk samples from a single Chinese dairy herd were cultured-positive for staphylococci (49.8%), which were further identified as coagulase-positive staphylococci (CPS) or coagulase-negative staphylococci (CNS). According to the partial tuf and/or 16S rRNA gene sequence, the 28 CPS isolates were confirmed to be Staphylococcus aureus (26.9%), and 76 CNS isolates were assigned to 13 different species (73.1%) with Staphylococcus arlettae, Staphylococcus sciuri, Staphylococcus xylosus and Staphylococcus chromogenes as the dominant species. In the 28 S. aureus isolates, the most prevalent general virulence genes were coa, Ig and eno (100%), followed by hla (96.4%), hlb (92.9%), fib (92.9%), clfA (89.3%), clfB (85.7%) and nuc (85.7%). Both exotoxin and biofilm-associated genes were significantly less prevalent than the previously reported. Although 19 different virulence gene patterns were found, only one was dominant (32.1%). The prevalence of blaZ (82.1%) or mecA gene (35.7%) was much higher than the previously reported. In the 76 CNS isolates, the virulence genes were significantly less prevalent than that in the S. aureus isolates. Among the 4 main CNS species, S. chromogenes (n = 12) was the only species with high percentage (75%) of blaZ gene, while S. sciuri (n = 12) was the only species with the high percentage (66.7%) of mecA gene. The most of antibiotic resistance genes were present as multi-resistance genes, and the antibiotic resistances were attributed by different resistance genes between resistant S. aureus and CNS isolates. These data suggest that the prevalence of staphylococcal species, virulence and antibiotic resistance in the mastitis milk from the Chinese

  8. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  9. Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

    Science.gov (United States)

    Huang, D; Wu, W; Lu, L

    2004-05-01

    Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

  10. Single nucleotide polymorphisms in i-type lysozyme gene and their correlation with vibrio-resistance and growth of clam Meretrix meretrix based on the selected resistance stocks.

    Science.gov (United States)

    Yue, Xin; Wang, Hongxia; Huang, Xiaohong; Wang, Chao; Chai, Xueliang; Wang, Chunde; Liu, Baozhong

    2012-09-01

    I-type lysozyme is considered to play crucial roles in both anti-bacteria and digestion function of the bivalve, which signifies that it is related to both immunity and growth. In this study, based on the principle of case-control association analysis, using the stock materials with different vibrio-resistance profile obtained by selective breeding, single nucleotide polymorphisms (SNPs) in the DNA partial sequence of an i-type lysozyme of Meretrix meretrix (MmeLys) were discovered and examined for their association with vibrio-resistance and growth. Twenty-seven SNPs were detected and fifteen of them were genotyped in clam stocks with different resistance to Vibrio harveyi (09-C and 09-R) and to Vibrio parahaemolyticus (11-S and 11-R). Allele frequency distribution among different stocks was compared. And wet weight of clams with different genotype at each SNP locus was compared. The results indicated that SNP locus 9 was associated with V. harveyi and V. parahaemolyticus resistance and growth of M. meretrix. Loci 12 and 14 were associated with both V. parahaemolyticus-resistance and growth, and also have the potential to be related with V. harveyi-resistance of M. meretrix. Therefore these three SNPs especially locus 9 were the potential markers which may be involved in assisting resistance selective breeding. In addition, this study showed evidence that improvements in clam resistance to vibriosis could be achieved through selective breeding. All results provided encouragement for the continuation of the selective breeding program for vibrio-resistance gain in clam M. meretrix and the application of polymorphisms in MmeLys to the future marker assisted selection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

    Science.gov (United States)

    Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

  12. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  13. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  14. Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

    Directory of Open Access Journals (Sweden)

    Laura Mejía-Teniente

    2015-11-01

    Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  15. Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

    Science.gov (United States)

    Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

    2015-11-25

    Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

  16. A single point mutation in Tomato spotted wilt virus NSs protein is sufficient to overcome Tsw-gene-mediated resistance in pepper.

    Science.gov (United States)

    Almási, Asztéria; Nemes, Katalin; Csömör, Zsófia; Tóbiás, István; Palkovics, László; Salánki, Katalin

    2017-06-01

    The nonstructural protein (NSs) of Tomato spotted wilt virus (TSWV) was previously identified as an avirulence determinant for Tsw-based resistance on pepper. The NSs of wild-type (WT) and resistance-breaking (RB) TSWV strains isolated in Hungary had only two amino acid substitutions (104, 461). We have analysed the ability of the NSs and their point mutant variants to trigger Tsw-mediated hypersensitive responses and RNA silencing suppressor (RSS) activity in patch assays. We identified a single amino acid change at position 104 (T-A) that was responsible for the necrosis induction or loss, while a significant difference was not detected in the RSS activity of the two parental strains. We have successfully complemented the infection of the WT strain on resistant pepper cultivar with the infectious S RNA transcript of the RB strain and the WT-T104A point mutant. Our work provides direct evidence that a single amino acid change can induce an RB phenotype.

  17. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  18. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  19. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  20. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  1. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  2. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  3. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens

    OpenAIRE

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-01-01

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers d...

  4. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  5. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  6. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  7. Comparison between Radioisotopic and Non-radioisotopic Polymerase Chain Reaction-Single Strand Conformation Polymorphism (PCR-SSCP) Procedures in the Detection of Mutations at the rpoB Gene Associated with Rifampicin Resistance in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Lee, H.; Bang, H.E.; Johnson, R.; Jordaan, A.M.; Victor, T.C. . E-mail : tv@sun.ac.za; Dar, L.; Khan, B.K.; Cho, S.N. . E-mail : raycho@yonsei.ac.kr

    2006-01-01

    Rapid and sensitive detection of mutations at the rpoB gene of Mycobacterium tuberculosis would be of great importance for proper management of tuberculosis (TB) patients and control of multi-drug resistant TB. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) using both radioisotopic and non-radioisotopic methods have been widely used for detecting such mutations. However, the silver staining method, which is the most frequently employed in PCR-SSCP, has been reported to be producing results of varying sensitivity. Radioisotope-based methods have shown greater sensitivity in detecting the rpoB mutations than the silver staining method. The primary objective of this study was therefore to compare the radioisotopic method with the silver staining method detection of mutations of rpoB gene by PCR-SSCP in the same laboratory. Purified DNAs from M. tuberculosis H37Rv were serially diluted and used for PCR amplification with and without radionuclides. The PCR products were then detected by silver staining and autoradiography methods. In addition, clinical isolates were analyzed by PCR-SSCP. The radioisotopic method showed about four-fold increase in the detection of PCR products over ethidium bromide staining in agarose gel. When compared with silver staining, the radioisotopic method gave a sensitivity of more than 10-fold in detecting PCR products and about 8-fold in PCR-SSCP. Radioisotope-based detection methods provided a clearer resolution in PCR-SSCP than the silver staining method when applied to clinical isolates of M. tuberculosis. Radioisotope-based detection method was shown to be more sensitive than non-isotope-based method in detecting PCR products and mutations at the rpoB gene of M. tuberculosis by PCR-SSCP. It may be noted that mutations in the rpoB gene as a marker have significant clinical importance because of the increasing number of MDR-TB cases in the world. It is especially relevant to MDR and Extreme Drug Resistance TB

  8. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  9. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  10. Single gene retrieval from thermally degraded DNA

    Indian Academy of Sciences (India)

    To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...

  11. Noninvasive prenatal diagnosis for single gene disorders.

    Science.gov (United States)

    Allen, Stephanie; Young, Elizabeth; Bowns, Benjamin

    2017-04-01

    Noninvasive prenatal diagnosis for single gene disorders is coming to fruition in its clinical utility. The presence of cell-free DNA in maternal plasma has been recognized for many years, and a number of applications have developed from this. Noninvasive prenatal diagnosis for single gene disorders has lagged behind due to complexities of technology development, lack of investment and the need for validation samples for rare disorders. Publications are emerging demonstrating a variety of technical approaches and feasibility of clinical application. Techniques for analysis of cell-free DNA including digital PCR, next-generation sequencing and relative haplotype dosage have been used most often for assay development. Analysis of circulating fetal cells in the maternal blood is still being investigated as a viable alternative and more recently transcervical trophoblast cells. Studies exploring ethical and social issues are generally positive but raise concerns around the routinization of prenatal testing. Further work is necessary to make testing available to all patients with a pregnancy at risk of a single gene disorder, and it remains to be seen if the development of more powerful technologies such as isolation and analysis of single cells will shift the emphasis of noninvasive prenatal diagnosis. As testing becomes possible for a wider range of conditions, more ethical questions will become relevant.

  12. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  13. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

    2014-07-22

    Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  14. Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

    Science.gov (United States)

    Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

    2016-04-12

    Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

  15. Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

    Science.gov (United States)

    Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

  16. Complex single gene disorders and epilepsy.

    LENUS (Irish Health Repository)

    Merwick, Aine

    2012-09-01

    Epilepsy is a heterogeneous group of disorders, often associated with significant comorbidity, such as intellectual disability and skin disorder. The genetic underpinnings of many epilepsies are still being elucidated, and we expect further advances over the coming 5 years, as genetic technology improves and prices fall for whole exome and whole genome sequencing. At present, there are several well-characterized complex epilepsies associated with single gene disorders; we review some of these here. They include well-recognized syndromes such as tuberous sclerosis complex, epilepsy associated with Rett syndrome, some of the progressive myoclonic epilepsies, and novel disorders such as epilepsy associated with mutations in the PCDH 19 gene. These disorders are important in informing genetic testing to confirm a diagnosis and to permit better understanding of the variability in phenotype-genotype correlation.

  17. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  18. The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

    Science.gov (United States)

    Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

    2017-11-01

    The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  19. AFLP/SSR mapping of resistance genes to Alectra vogelii in cowpea ...

    African Journals Online (AJOL)

    To find and map the resistance gene to A. vogelii in cowpea, a F2 population from a cross involving a resistant parent IT81D-994 and a susceptible TVX3236 was screened. Amplified fragment length polymorphism (AFLP) in combination with Single Sequence Repeat (SSR) analysis was used to identify markers that may be ...

  20. Molecular mapping and genetic analysis of a rice brown planthopper (Nilaparvata lugens Stål) resistance gene.

    Science.gov (United States)

    Yang, Haiyuan; Ren, Xiang; Weng, Qingmei; Zhu, Lili; He, Guangcun

    2002-01-01

    The brown planthopper (BPH), Nilaparvata lugens Stål, is a serious insect pest of rice (Oryza saliva L.). We have determined the chromosomal location of a BPH resistance gene in rice using SSR and RFLP techniques. A rice line 'B14', derived from the wild rice Oryza latifolia, showed high resistance to BPH. For tagging the resistance gene in 'B14X', an F2 population and a recombinant inbred (RI) population from a cross between Taichung Native 1 and 'B14' were developed and evaluated for BPH resistance. The results showed that a single dominant gene controlled the resistance of 'B14' to BPH. Bulked segregant SSR analysis was employed for identification of DNA markers linked to the resistance gene. From the survey of 302 SSR primer pairs, three SSR (RM335, RM261, RM185) markers linked to the resistance gene were identified. The closest SSR marker RM261 was linked to the resistance gene at a distance of 1.8 cM. Regions surrounding the resistance gene and the SSR markers were examined with additional RFLP markers on chromosome 4 to define the location of the resistance gene. Linkage of RFLP markers C820, R288, C946 with the resistance gene further confirmed its location on the short arm of chromosome 4. Closely linked DNA markers will facilitate selection for resistant lines in breeding programs and provide the basis for map-based cloning of this resistance gene.

  1. Modeling the Activity of Single Genes

    Science.gov (United States)

    Mjolsness, Eric; Gibson, Michael

    1999-01-01

    The central dogma of molecular biology states that information is stored in DNA, transcribed to messenger RNA (mRNA) and then translated into proteins. This picture is significantly augmentated when we consider the action of certain proteins in regulating transcription. These transcription factors provide a feedback pathway by which genes can regulate one another's expression as mRNA and then as protein. To review: DNA, RNA and proteins have different functions. DNA is the molecular storehouse of genetic information. When cells divide, the DNA is replicated, so that each daughter cell maintains the same genetic information as the mother cell. RNA acts as a go-between from DNA to proteins. Only a single copy of DNA is present, but multiple copies of the same piece of RNA may be present, allowing cells to make huge amounts of protein. In eukaryotes (organisms with a nucleus), DNA is found in the nucleus only. RNA is copied in the nucleus then translocates(moves) outside the nucleus, where it is transcribed into proteins. Along the way, the RNA may be spliced, i.e., may have pieces cut out. RNA then attaches to ribosomes and is translated to proteins. Proteins are the machinery of the cell other than DNA and RNA, all the complex molecules of the cell are proteins. Proteins are specialized machines, each of which fulfills its own task, which may be transporting oxygen, catalyzing reactions, or responding to extracellular signals, just to name a few. One of the more interesting functions a protein may have is binding directly or indirectly to DNA to perform transcriptional regulation, thus forming a closed feedback loop of gene regulation. The structure of DNA and the central dogma were understood in the 50s; in the early 80s it became possible to make arbitrary modifications to DNA and use cellular machinery to transcribe and translate the resulting genes; more recently, genomes (i.e., the complete DNA sequence) of many organisms have been sequenced. This large

  2. Candidate gene association analyses for ketosis resistance in Holsteins.

    Science.gov (United States)

    Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J

    2018-06-01

    High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  4. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  5. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  6. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  7. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  8. Topological variation in single-gene phylogenetic trees

    OpenAIRE

    Castresana, Jose

    2007-01-01

    A recent large-scale phylogenomic study has shown the great degree of topological variation that can be found among eukaryotic phylogenetic trees constructed from single genes, highlighting the problems that can be associated with gene sampling in phylogenetic studies.

  9. Genetics of ischaemic stroke; single gene disorders.

    Science.gov (United States)

    Flossmann, Enrico

    2006-08-01

    Examples of single gene disorders have been described for all major subtypes of ischaemic stroke: accelerated atherosclerosis and subsequent thrombo-embolism (e.g. homocysteinuria), weakening of connective tissue resulting in arterial dissections (e.g. Ehler-Danlos type IV), disorders of cerebral small vessels (e.g. cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy and the collagen COL4A1 mutation), disorders increasing the thrombogenic potential of the heart through affecting the myocardium or the heart valves or through disturbance of the heart rhythm (e.g. hypertrophic cardiomyopathy), mitochondrial cytopathies increasing cerebral tissue susceptibility to insults (e.g. mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes), and finally disorders of coagulation that can either directly cause stroke or act synergistically with the aforementioned abnormalities (e.g. sickle cell disease). Most of these disorders are rare but they are important to consider particularly in young patients with stroke, those with a family history or those who have other characteristics of a particular syndrome.

  10. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    OpenAIRE

    Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

    2016-01-01

    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

  11. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  12. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  13. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  14. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  15. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  16. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  17. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  18. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  19. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  20. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

    Science.gov (United States)

    Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

    2018-04-01

    Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  1. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  2. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  3. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Science.gov (United States)

    Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

    2015-01-01

    Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  4. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

    Science.gov (United States)

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

    1999-11-23

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  5. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  6. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  7. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  8. Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.

    Science.gov (United States)

    Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H

    2017-06-01

    We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.

  9. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  10. High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species.

    Science.gov (United States)

    Sütterlin, S; Dahlö, M; Tellgren-Roth, C; Schaal, W; Melhus, Å

    2017-07-01

    Silver-based products have been marketed as an alternative to antibiotics, and their consumption has increased. Bacteria may, however, develop resistance to silver. To study the presence of genes encoding silver resistance (silE, silP, silS) over time in three clinically important Enterobacteriaceae genera. Using polymerase chain reaction (PCR), 752 bloodstream isolates from the years 1990-2010 were investigated. Age, gender, and ward of patients were registered, and the susceptibility to antibiotics and silver nitrate was tested. Clonality and single nucleotide polymorphism were assessed with repetitive element sequence-based PCR, multi-locus sequence typing, and whole-genome sequencing. Genes encoding silver resistance were detected most frequently in Enterobacter spp. (48%), followed by Klebsiella spp. (41%) and Escherichia coli 4%. Phenotypical resistance to silver nitrate was found in Enterobacter (13%) and Klebsiella (3%) isolates. The lowest carriage rate of sil genes was observed in blood isolates from the neonatology ward (24%), and the highest in blood isolates from the oncology/haematology wards (66%). Presence of sil genes was observed in international high-risk clones. Sequences of the sil and pco clusters indicated that a single mutational event in the silS gene could have caused the phenotypic resistance. Despite a restricted consumption of silver-based products in Swedish health care, silver resistance genes are widely represented in clinical isolates of Enterobacter and Klebsiella species. To avoid further selection and spread of silver-resistant bacteria with a high potential for healthcare-associated infections, the use of silver-based products needs to be controlled and the silver resistance monitored. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  11. Gene Expression Analysis of Four Radiation-resistant Bacteria

    OpenAIRE

    Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

    2009-01-01

    To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

  12. Overexpression of antibiotic resistance genes in hospital effluents over time

    OpenAIRE

    Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

    2017-01-01

    $\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

  13. The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

    DEFF Research Database (Denmark)

    Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

    2012-01-01

    The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...

  14. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  15. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  16. Genetic Mapping of a Major Resistance Gene to Pea Aphid (Acyrthosipon pisum in the Model Legume Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Lars G. Kamphuis

    2016-07-01

    Full Text Available Resistance to the Australian pea aphid (PA; Acyrthosiphon pisum biotype in cultivar Jester of the model legume Medicago truncatula is mediated by a single dominant gene and is phloem-mediated. The genetic map position for this resistance gene, APR (Acyrthosiphon pisum resistance, is provided and shows that APR maps 39 centiMorgans (cM distal of the A. kondoi resistance (AKR locus, which mediates resistance to a closely related species of the same genus bluegreen aphid (A. kondoi. The APR region on chromosome 3 is dense in classical nucleotide binding site leucine-rich repeats (NLRs and overlaps with the region harbouring the RAP1 gene which confers resistance to a European PA biotype in the accession Jemalong A17. Further screening of a core collection of M. truncatula accessions identified seven lines with strong resistance to PA. Allelism experiments showed that the single dominant resistance to PA in M. truncatula accessions SA10481 and SA1516 are allelic to SA10733, the donor of the APR locus in cultivar Jester. While it remains unclear whether there are multiple PA resistance genes in an R-gene cluster or the resistance loci identified in the other M. truncatula accessions are allelic to APR, the introgression of APR into current M. truncatula cultivars will provide more durable resistance to PA.

  17. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  18. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  19. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  20. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  1. Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

    Directory of Open Access Journals (Sweden)

    Aimée M Moore

    Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

  2. Resistivity distribution of silicon single crystals using codoping

    Science.gov (United States)

    Wang, Jong Hoe

    2005-07-01

    Numerous studies including continuous Czochralski method and double crucible technique have been reported on the control of macroscopic axial resistivity distribution in bulk crystal growth. The simple codoping method for improving the productivity of silicon single-crystal growth by controlling axial specific resistivity distribution was proposed by Wang [Jpn. J. Appl. Phys. 43 (2004) 4079]. Wang [J. Crystal Growth 275 (2005) e73] demonstrated using numerical analysis and by experimental results that the axial specific resistivity distribution can be modified in melt growth of silicon crystals and relatively uniform profile is possible by B-P codoping method. In this work, the basic characteristic of 8 in silicon single crystal grown using codoping method is studied and whether proposed method has advantage for the silicon crystal growth is discussed.

  3. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

    Science.gov (United States)

    Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

    2014-11-25

    The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

  4. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  5. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  6. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  7. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  8. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  9. RESISTANCE-RELATED GENE TRANSCRIPTION AND ...

    African Journals Online (AJOL)

    jdx

    2014-02-05

    Feb 5, 2014 ... By 72 hpi, the pathogen switched to necrotrophic growth to avoid contact with the increasing ... A better understanding of the gene network underlying ... 5.0 software under default parameters and were custom-ordered.

  10. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  13. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  14. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  15. Remapping of the stripe rust resistance gene Yr10 in common wheat.

    Science.gov (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin

    2018-02-23

    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  16. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...

  17. Molecular screening for erythromycin resistance genes in ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-15

    Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...

  18. Pl(17) is a novel gene independent of known downy mildew resistance genes in the cultivated sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J

    2015-04-01

    Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.

  19. Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

    Science.gov (United States)

    Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

    2017-11-01

    A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

  20. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1997-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enterica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3 ")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-l beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  1. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1998-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enteritica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-1 beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  2. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  3. A hybrid Bacillus thuringiensis delta-endotoxin gene gives resistance against a coleopteran and a lepidopteran pest in transgenic potato

    NARCIS (Netherlands)

    Naimov, S.; Dukiandjiev, S.; Maagd, de R.A.

    2003-01-01

    Expression of Bacillus thuringiensis delta-endotoxins has proven to be a successful strategy for obtaining insect resistance in transgenic plants. Drawbacks of expression of a single resistance gene are the limited target spectrum and the potential for rapid adaptation of the pest. Hybrid toxins

  4. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  5. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  6. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

    Science.gov (United States)

    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

    2015-01-01

    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  7. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  8. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  9. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  10. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  11. Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC)

    International Nuclear Information System (INIS)

    Glaysher, Sharon; Modi, Paul; Rahamim, Joe; Smith, Mark E; Amer, Khalid; Addis, Bruce; Poole, Matthew; Narayanan, Ajit; Gulliford, Tim J; Andreotti, Peter E; Cree, Ian A; Yiannakis, Dennis; Gabriel, Francis G; Johnson, Penny; Polak, Marta E; Knight, Louise A; Goldthorpe, Zoe; Peregrin, Katharine; Gyi, Mya

    2009-01-01

    NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA) and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE) tissue. There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer

  12. Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC

    Directory of Open Access Journals (Sweden)

    Amer Khalid

    2009-08-01

    Full Text Available Abstract Background NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. Methods The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE tissue. Results There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Conclusion Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer.

  13. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    Science.gov (United States)

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

  14. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  15. Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

    Science.gov (United States)

    Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

    2014-02-01

    This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

  16. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  17. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  18. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  19. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  20. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  1. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  2. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L

    2013-01-01

    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  3. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  4. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    Science.gov (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  5. Bacterial metal resistance genes and metal bioavailability in contaminated sediments

    International Nuclear Information System (INIS)

    Roosa, Stéphanie; Wattiez, Ruddy; Prygiel, Emilie; Lesven, Ludovic; Billon, Gabriel; Gillan, David C.

    2014-01-01

    In bacteria a metal may be defined as bioavailable if it crosses the cytoplasmic membrane to reach the cytoplasm. Once inside the cell, specific metal resistance systems may be triggered. In this research, specific metal resistance genes were used to estimate metal bioavailability in sediment microbial communities. Gene levels were measured by quantitative PCR and correlated to metals in sediments using five different protocols to estimate dissolved, particle-adsorbed and occluded metals. The best correlations were obtained with czcA (a Cd/Zn/Co efflux pump) and Cd/Zn adsorbed or occluded in particles. Only adsorbed Co was correlated to czcA levels. We concluded that the measurement of czcA gene levels by quantitative PCR is a promising tool which may complement the classical approaches used to estimate Cd/Zn/Co bioavailability in sediment compartments. - Highlights: • Metal resistance genes were used to estimate metal bioavailability in sediments. • Gene levels were correlated to metals using 5 different metal extraction protocols. • CzcA gene levels determined by quantitative PCR is a promising tool for Cd/Zn/Co. - Capsule Bacterial czcA is a potential biomarker of Cd, Zn and Co bioavailability in aquatic sediments as shown by quantitative PCR and sequential metal extraction

  6. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    Science.gov (United States)

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  7. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional...... resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis, and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n = 6), gentamicin (n = 1), amikacin (n = 7), trimethoprim (n = 17), chloramphenicol (n = 1), rifampicin (n = 2) and ampicillin (n = 3......-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance...

  8. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  9. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  10. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  11. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

    Directory of Open Access Journals (Sweden)

    Wang Hehe

    2012-08-01

    Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

  13. Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem.

    Science.gov (United States)

    Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P

    2017-08-31

    Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

  14. Geographic and Research Center Origins of Rice Resistance to Asian Planthoppers and Leafhoppers: Implications for Rice Breeding and Gene Deployment

    Directory of Open Access Journals (Sweden)

    Finbarr G. Horgan

    2017-09-01

    Full Text Available This study examines aspects of virulence to resistant rice varieties among planthoppers and leafhoppers. Using a series of resistant varieties, brown planthopper, Nilaparvata lugens, virulence was assessed in seedlings and early-tillering plants at seven research centers in South and East Asia. Virulence of the whitebacked planthopper, Sogatella furcifera, in Taiwan and the Philippines was also assessed. Phylogenetic analysis of the varieties using single-nucleotide polymorphisms (SNPs indicated a clade of highly resistant varieties from South Asia with two further South Asian clades of moderate resistance. Greenhouse bioassays indicated that planthoppers can develop virulence against multiple resistance genes including genes introgressed from wild rice species. Nilaparvata lugens populations from Punjab (India and the Mekong Delta (Vietnam were highly virulent to a range of key resistance donors irrespective of variety origin. Sogatella furcifera populations were less virulent to donors than N. lugens; however, several genes for resistance to S. furcifera are now ineffective in East Asia. A clade of International Rice Research Institute (IRRI-bred varieties and breeding lines, without identified leafhopper-resistance genes, were highly resistant to the green leafhopper, Nephotettix virescens. Routine phenotyping during breeding programs likely maintains high levels of quantitative resistance to leafhoppers. We discuss these results in the light of breeding and deploying resistant rice in Asia.

  15. Effect of adrenomedullin gene delivery on insulin resistance in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Hoda Y. Henein

    2011-01-01

    Full Text Available Type 2 diabetes mellitus is one of the common metabolic disorders that ultimately afflicts large number of individuals. Adrenomedullin (AM is a potent vasodilator peptide; previous studies reported development of insulin resistance in aged AM deficient mice. In this study, we employed a gene delivery approach to explore its potential role in insulin resistance. Four groups were included: control, diabetic, non-diabetic injected with the AM gene and diabetic injected with the AM gene. One week following gene delivery, serum glucose, insulin, triglycerides, leptin, adiponectin and corticosterone were measured as well as the insulin resistance index (HOMA-IR. Soleus muscle glucose uptake and RT-PCR of both AM and glucose transporter-4 (GLUT 4 gene expressions were assessed. A single tail vein injection of adrenomedullin gene in type 2 diabetic rats improved skeletal muscle insulin responsiveness with significant improvement of soleus muscle glucose uptake, HOMA-IR, serum glucose, insulin and triglycerides and significant increase in muscle GLUT 4 gene expression (P < 0.05 compared with the non-injected diabetic rats. The beneficial effects of AM gene delivery were accompanied by a significant increase in the serum level of adiponectin (2.95 ± 0.09 versus 2.33 ± 0.17 μg/ml in the non-injected diabetic group as well as a significant decrease in leptin and corticosterone levels (7.51 ± 0.51 and 262.88 ± 10.34 versus 10.63 ± 1.4 and 275.86 ± 11.19 ng/ml respectively in the non-injected diabetic group. The conclusion of the study is that AM gene delivery can improve insulin resistance and may have significant therapeutic applications in type 2 diabetes mellitus.

  16. Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

    Directory of Open Access Journals (Sweden)

    Andrew J Burt

    Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

  17. Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356.

    Science.gov (United States)

    Tan, Chengcheng; Li, Genqiao; Cowger, Christina; Carver, Brett F; Xu, Xiangyang

    2018-05-01

    A new powdery mildew resistance gene, designated Pm59, was identified in Afghanistan wheat landrace PI 181356, and mapped in the terminal region of the long arm of chromosome 7A. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is an important foliar disease of wheat worldwide. In the Great Plains of the USA, Bgt isolates virulent to widely used powdery mildew resistance genes, such as Pm3a, were previously identified. The objectives of this study were to characterize the powdery mildew resistance gene in Afghanistan landrace PI 181356, which exhibited high resistance to Bgt isolates collected in southern Great Plains, and identify molecular markers for marker-assisted selection. An F 2 population and F 2:3 lines derived from a cross between PI 181356 and OK1059060-126135-3 were used in this study. Genetic analysis indicated that PI 181356 carries a single dominant gene, designated Pm59, in the terminal region of the long arm of chromosome 7A. Pm59 was mapped to an interval between sequence tag site (STS) markers Xmag1759 and Xmag1714 with genetic distances of 0.4 cM distal to Xmag1759 and 5.7 cM proximal to Xmag1714. Physical mapping suggested that Pm59 is in the distal bin 7AL 0.99-1.00. Pm59 is a novel powdery mildew resistance gene, and confers resistance to Bgt isolates collected from the Great Plains and the state of Montana. Therefore, Pm59 can be used to breed powdery mildew-resistant cultivars in these regions. Xmag1759 is ideal for marker-assisted selection of Pm59 in wheat breeding.

  18. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  19. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  20. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  1. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  2. Spatial patterns of Antimicrobial Resistance Genes in Danish Pig Farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Ersbøll, A. K.; Hisham Beshara Halasa, Tariq

    2016-01-01

    antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O) and tet(W), was quantified by a high-throughput qPCR. It was evaluated whether the sample method resulted in a study population representative of Danish pig farms with finishers where it was found that the study population was biased...

  3. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  4. Longitudinal characterization of antimicrobial resistance genes in feces shed from cattle fed different subtherapeutic antibiotics

    Directory of Open Access Journals (Sweden)

    Read Ronald R

    2011-01-01

    Full Text Available Abstract Background Environmental transmission of antimicrobial-resistant bacteria and resistance gene determinants originating from livestock is affected by their persistence in agricultural-related matrices. This study investigated the effects of administering subtherapeutic concentrations of antimicrobials to beef cattle on the abundance and persistence of resistance genes within the microbial community of fecal deposits. Cattle (three pens per treatment, 10 steers per pen were administered chlortetracycline, chlortetracycline plus sulfamethazine, tylosin, or no antimicrobials (control. Model fecal deposits (n = 3 were prepared by mixing fresh feces from each pen into a single composite sample. Real-time PCR was used to measure concentrations of tet, sul and erm resistance genes in DNA extracted from composites over 175 days of environmental exposure in the field. The microbial communities were analyzed by quantification and denaturing gradient gel electrophoresis (DGGE of PCR-amplified 16S-rRNA. Results The concentrations of 16S-rRNA in feces were similar across treatments and increased by day 56, declining thereafter. DGGE profiles of 16S-rRNA differed amongst treatments and with time, illustrating temporal shifts in microbial communities. All measured resistance gene determinants were quantifiable in feces after 175 days. Antimicrobial treatment differentially affected the abundance of certain resistance genes but generally not their persistence. In the first 56 days, concentrations of tet(B, tet(C, sul1, sul2, erm(A tended to increase, and decline thereafter, whereas tet(M and tet(W gradually declined over 175 days. At day 7, the concentration of erm(X was greatest in feces from cattle fed tylosin, compared to all other treatments. Conclusion The abundance of genes coding for antimicrobial resistance in bovine feces can be affected by inclusion of antibiotics in the feed. Resistance genes can persist in feces from cattle beyond 175 days

  5. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  6. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.

    Science.gov (United States)

    Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev

    The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with

  7. Strategies to be used in the struggle between resistance and virulence genes

    International Nuclear Information System (INIS)

    Zitelli, G.; Vallega, V.

    1977-01-01

    The cultivation of wheat varieties resistant to diseases such as stem and leaf rusts, mildew and septoria plays an important role in modern agriculture. However, the problem of how to keep varieties resistant for a long period has not yet been solved. Whatever type of resistance (specific, non-specific, tolerance etc.) the breeder chooses to use in his breeding work, the resistance stability will depend very much on the strategy used. There are many different approaches: (i) To introduce single specific factors into the cultivated varieties; (ii) To introduce the maximum number of factors in the same variety; (iii) To create multiline varieties; (iv) To cultivate different varieties carrying different resistant factors. Such a ''mosaic'' artificially creates, as in the case of multiline varieties, conditions similar to those which we find in wild populations. The use of multiline varieties and of ''mosaic'' varieties stresses the need for finding a greater number of different genes for resistance. At present we know that a large number of genes for resistance to rusts and to mildew is available in bread and durum wheats and in related species. (author)

  8. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  9. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  10. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  11. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  12. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  13. Fire resistance of single pitched-roof steel portal frame

    Directory of Open Access Journals (Sweden)

    J. J. Ferrán Gozálvez

    2017-03-01

    Full Text Available The standard procedure of structural fire design is based on the simplified analysis of single members. This method leads to conservative results in the case of structures able to redistribution of forces. The failure mechanism affecting both life safety and fire propagation is unknown. This work proposes a methodology for the advanced fire calculation of single pitched-roof portal frame for an agroindustrial building according to the Spanish Specifications with the structural software SAP2000. A non-linear dynamic and plastic, geometric (P-Delta and large-displacements calculation method has been developed. The different failure mechanisms and their influence are studied in terms of fire time resistance, human hazard and good safety. Also, parametric analyses were conducted: load level, rotational stiffness of the base and finally, support fire protection.

  14. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  15. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  16. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  17. Terbinafine Resistance of Trichophyton Clinical Isolates Caused by Specific Point Mutations in the Squalene Epoxidase Gene.

    Science.gov (United States)

    Yamada, Tsuyoshi; Maeda, Mari; Alshahni, Mohamed Mahdi; Tanaka, Reiko; Yaguchi, Takashi; Bontems, Olympia; Salamin, Karine; Fratti, Marina; Monod, Michel

    2017-07-01

    Terbinafine is one of the allylamine antifungal agents whose target is squalene epoxidase (SQLE). This agent has been extensively used in the therapy of dermatophyte infections. The incidence of patients with tinea pedis or unguium tolerant to terbinafine treatment prompted us to screen the terbinafine resistance of all Trichophyton clinical isolates from the laboratory of the Centre Hospitalier Universitaire Vaudois collected over a 3-year period and to identify their mechanism of resistance. Among 2,056 tested isolates, 17 (≈1%) showed reduced terbinafine susceptibility, and all of these were found to harbor SQLE gene alleles with different single point mutations, leading to single amino acid substitutions at one of four positions (Leu 393 , Phe 397 , Phe 415 , and His 440 ) of the SQLE protein. Point mutations leading to the corresponding amino acid substitutions were introduced into the endogenous SQLE gene of a terbinafine-sensitive Arthroderma vanbreuseghemii (formerly Trichophyton mentagrophytes ) strain. All of the generated A. vanbreuseghemii transformants expressing mutated SQLE proteins exhibited obvious terbinafine-resistant phenotypes compared to the phenotypes of the parent strain and of transformants expressing wild-type SQLE proteins. Nearly identical phenotypes were also observed in A. vanbreuseghemii transformants expressing mutant forms of Trichophyton rubrum SQLE proteins. Considering that the genome size of dermatophytes is about 22 Mb, the frequency of terbinafine-resistant clinical isolates was strikingly high. Increased exposure to antifungal drugs could favor the generation of resistant strains. Copyright © 2017 American Society for Microbiology.

  18. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  19. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  20. Introgression of ivermectin resistance genes into a susceptible Haemonchus contortus strain by multiple backcrossing.

    Directory of Open Access Journals (Sweden)

    Elizabeth Redman

    2012-02-01

    Full Text Available Anthelmintic drug resistance in livestock parasites is already widespread and in recent years there has been an increasing level of anthelmintic drug selection pressure applied to parasitic nematode populations in humans leading to concerns regarding the emergence of resistance. However, most parasitic nematodes, particularly those of humans, are difficult experimental subjects making mechanistic studies of drug resistance extremely difficult. The small ruminant parasitic nematode Haemonchus contortus is a more amenable model system to study many aspects of parasite biology and investigate the basic mechanisms and genetics of anthelmintic drug resistance. Here we report the successful introgression of ivermectin resistance genes from two independent ivermectin resistant strains, MHco4(WRS and MHco10(CAVR, into the susceptible genome reference strain MHco3(ISE using a backcrossing approach. A panel of microsatellite markers were used to monitor the procedure. We demonstrated that after four rounds of backcrossing, worms that were phenotypically resistant to ivermectin had a similar genetic background to the susceptible reference strain based on the bulk genotyping with 18 microsatellite loci and individual genotyping with a sub-panel of 9 microsatellite loci. In addition, a single marker, Hcms8a20, showed evidence of genetic linkage to an ivermectin resistance-conferring locus providing a starting point for more detailed studies of this genomic region to identify the causal mutation(s. This work presents a novel genetic approach to study anthelmintic resistance and provides a "proof-of-concept" of the use of forward genetics in an important model strongylid parasite of relevance to human hookworms. The resulting strains provide valuable resources for candidate gene studies, whole genome approaches and for further genetic analysis to identify ivermectin resistance loci.

  1. Mapping of powdery mildew resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter wheat.

    Science.gov (United States)

    Petersen, Stine; Lyerly, Jeanette H; Worthington, Margaret L; Parks, Wesley R; Cowger, Christina; Marshall, David S; Brown-Guedira, Gina; Murphy, J Paul

    2015-02-01

    A powdery mildew resistance gene was introgressed from Aegilops speltoides into winter wheat and mapped to chromosome 5BL. Closely linked markers will permit marker-assisted selection for the resistance gene. Powdery mildew of wheat (Triticum aestivum L.) is a major fungal disease in many areas of the world, caused by Blumeria graminis f. sp. tritici (Bgt). Host plant resistance is the preferred form of disease prevention because it is both economical and environmentally sound. Identification of new resistance sources and closely linked markers enable breeders to utilize these new sources in marker-assisted selection as well as in gene pyramiding. Aegilops speltoides (2n = 2x = 14, genome SS), has been a valuable disease resistance donor. The powdery mildew resistant wheat germplasm line NC09BGTS16 (NC-S16) was developed by backcrossing an Ae. speltoides accession, TAU829, to the susceptible soft red winter wheat cultivar 'Saluda'. NC-S16 was crossed to the susceptible cultivar 'Coker 68-15' to develop F2:3 families for gene mapping. Greenhouse and field evaluations of these F2:3 families indicated that a single gene, designated Pm53, conferred resistance to powdery mildew. Bulked segregant analysis showed that multiple simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers specific to chromosome 5BL segregated with the resistance gene. The gene was flanked by markers Xgwm499, Xwmc759, IWA6024 (0.7 cM proximal) and IWA2454 (1.8 cM distal). Pm36, derived from a different wild wheat relative (T. turgidum var. dicoccoides), had previously been mapped to chromosome 5BL in a durum wheat line. Detached leaf tests revealed that NC-S16 and a genotype carrying Pm36 differed in their responses to each of three Bgt isolates. Pm53 therefore appears to be a new source of powdery mildew resistance.

  2. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  3. Spatial reconstruction of single-cell gene expression data.

    Science.gov (United States)

    Satija, Rahul; Farrell, Jeffrey A; Gennert, David; Schier, Alexander F; Regev, Aviv

    2015-05-01

    Spatial localization is a key determinant of cellular fate and behavior, but methods for spatially resolved, transcriptome-wide gene expression profiling across complex tissues are lacking. RNA staining methods assay only a small number of transcripts, whereas single-cell RNA-seq, which measures global gene expression, separates cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos and generated a transcriptome-wide map of spatial patterning. We confirmed Seurat's accuracy using several experimental approaches, then used the strategy to identify a set of archetypal expression patterns and spatial markers. Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems.

  4. Local evolution of pyrethroid resistance offsets gene flow among Aedes aegypti collections in Yucatan State, Mexico.

    Science.gov (United States)

    Saavedra-Rodriguez, Karla; Beaty, Meaghan; Lozano-Fuentes, Saul; Denham, Steven; Garcia-Rejon, Julian; Reyes-Solis, Guadalupe; Machain-Williams, Carlos; Loroño-Pino, Maria Alba; Flores-Suarez, Adriana; Ponce-Garcia, Gustavo; Beaty, Barry; Eisen, Lars; Black, William C

    2015-01-01

    The mosquito Aedes aegypti is the major vector of the four serotypes of dengue virus (DENV1-4). Previous studies have shown that Ae. aegypti in Mexico have a high effective migration rate and that gene flow occurs among populations that are up to 150 km apart. Since 2000, pyrethroids have been widely used for suppression of Ae. aegypti in cities in Mexico. In Yucatan State in particular, pyrethroids have been applied in and around dengue case households creating an opportunity for local selection and evolution of resistance. Herein, we test for evidence of local adaptation by comparing patterns of variation among 27 Ae. aegypti collections at 13 single nucleotide polymorphisms (SNPs): two in the voltage-gated sodium channel gene para known to confer knockdown resistance, three in detoxification genes previously associated with pyrethroid resistance, and eight in putatively neutral loci. The SNPs in para varied greatly in frequency among collections, whereas SNPs at the remaining 11 loci showed little variation supporting previous evidence for extensive local gene flow. Among Ae. aegypti in Yucatan State, Mexico, local adaptation to pyrethroids appears to offset the homogenizing effects of gene flow. © The American Society of Tropical Medicine and Hygiene.

  5. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  6. Overexpression of SOS genes in ciprofloxacin resistant Escherichia coli mutants.

    Science.gov (United States)

    Pourahmad Jaktaji, Razieh; Pasand, Shirin

    2016-01-15

    Fluoroquinolones are important antibiotics for the treatment of urinary tract infections caused by Escherichia coli. Mutational studies have shown that ciprofloxacin, a member of fluoroquinolones induces SOS response and mutagenesis in pathogenic bacteria which in turn develop antibiotic resistance. However, inhibition of SOS response can increase recombination activity which in turn leads to genetic variation. The aim of this study was to measure 5 SOS genes expressions in nine E. coli mutants with different MICs for ciprofloxacin following exposure to ciprofloxacin. Gene expression was assessed by quantitative real time PCR. Gene alteration assessment was conducted by PCR amplification and DNA sequencing. Results showed that the expression of recA was increased in 5 mutants. This overexpression is not related to gene alteration, and enhances the expression of polB and umuCD genes encoding nonmutagenic and mutagenic polymerases, respectively. The direct relationship between the level of SOS expression and the level of resistance to ciprofloxacin was also indicated. It was concluded that novel therapeutic strategy that inhibits RecA activity would enhance the efficiency of common antibiotics against pathogenic bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Pyramiding and evaluation of three dominant brown planthopper resistance genes in the elite indica rice 9311 and its hybrids.

    Science.gov (United States)

    Hu, Jie; Cheng, Mingxing; Gao, Guanjun; Zhang, Qinglu; Xiao, Jinghua; He, Yuqing

    2013-07-01

    Brown planthopper (BPH), Nilaparvata lugens Stål, is the most devastating insect pest in rice-producing areas. Three dominant BPH resistance genes (Bph14, Bph15, Bph18) were pyramided into elite indica rice 9311 and its hybrids using marker-assisted selection. Gene effectiveness was evaluated on the basis of seedling and adult rice resistance, honeydew weight and survival rate of BPH. All three genes affected BPH growth and development and antibiotic factors, resulting in both seedling and adult resistance. Bph15 had the greatest effect on conferring resistance to BPH. The results showed an additive effect of pyramiding genes, the order of the gene effect being 14/15/18 ≥ 14/15 > 15/18 ≥ 15 > 14/18 ≥ 14 ≥ 18 > none. The pyramided or single-gene introgression hybrids showed greater resistance than conventional hybrids, although the heterozygous genotypes had weaker effects than the corresponding homozygous genotypes. Furthermore, field trial data demonstrated that yields of improved 9311 lines were higher than or similar to that of the control under natural field conditions. These improved versions can be immediately used in hybrid improvement and production. Compared with controls, pyramided lines and hybrids with three genes showed the strongest resistance to BPH, without a yield decrease. © 2012 Society of Chemical Industry.

  8. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  9. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Science.gov (United States)

    Hong, Pei-Ying; Al-Jassim, Nada; Ansari, Mohd Ikram; Mackie, Roderick I.

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water. PMID:27029309

  10. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying; Aljassim, Nada I.; Ansari, Mohd Ikram; Mackie, Roderick

    2013-01-01

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  11. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Roderick I. Mackie

    2013-07-01

    Full Text Available Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  12. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  13. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  14. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  15. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  16. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    %, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  17. Detection of Genes for Superantigen Toxins in Methicillin-Resistant Staphylococcus aureus Clinical Isolates in Karachi

    International Nuclear Information System (INIS)

    Taj, Y.; Fatima, I.; Ali, S. W.; Kazmi, S. U.

    2014-01-01

    Objective: To detect genes for enterotoxins, exfoliative and toxic shock syndrome toxins in Staphylococcus aureus (S. aureus) strains isolated from clinical specimens. Study Design: Cross-sectional observational study. Place and Duration of Study: Department of Molecular Genetics, Dr. Ziauddin Hospital, Karachi, from January to December 2010. Methodology: Two hundred and ninety eight S. aureus clinical isolates were obtained from various clinical samples received at Dr. Ziauddin Hospital, Karachi. Out of these, 115 were detected as methicillin resistant (MRSA) by cefoxitin disk diffusion test showing a prevalence rate of 38.6%. Detection of individual toxin genes was performed by Polymerase Chain Reaction (PCR) by using only one primer pair for each tube. Uniplex primers were preferred as multiplex primers are longer in base pairs and have the potential for cross reaction due to non-specific binding and increase in optimization time. Results: The possession of a single gene or more than a single gene in MRSA isolates was found in 61.73% of clinical samples; the highest number was found in pus swab, followed by sputum, blood, urethral swab, and urine. The prevalence of toxin genes was higher in MRSA as compared to methicillin sensitive (MSSA) isolates (19.12%). Conclusion: PCR detects strains possessing toxin genes independent of their expression. The possession of genes for super-antigens seems to be a frequent and habitual trait of S. aureus more so in MRSA. (author)

  18. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  19. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

  20. Evolution of resistance against CRISPR/Cas9 gene drive

    OpenAIRE

    Clark, Andrew; Unckless, Robert; Messer, Philipp

    2016-01-01

    CRISPR/Cas9 gene drive (CGD) promises to be a highly adaptable approach for spreading genetically engineered alleles throughout a species, even if those alleles impair reproductive success. CGD has been shown to be effective in laboratory crosses of insects, yet it remains unclear to what extent potential resistance mechanisms will affect the dynamics of this process in large natural populations. Here we develop a comprehensive population genetic framework for modeling CGD dynamics, which inc...

  1. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  2. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  3. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

    OpenAIRE

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

  4. Identification and validation of a gene causing cross-resistance between insecticide classes in Anopheles gambiae from Ghana.

    Science.gov (United States)

    Mitchell, Sara N; Stevenson, Bradley J; Müller, Pie; Wilding, Craig S; Egyir-Yawson, Alexander; Field, Stuart G; Hemingway, Janet; Paine, Mark J I; Ranson, Hilary; Donnelly, Martin James

    2012-04-17

    In the last decade there have been marked reductions in malaria incidence in sub-Saharan Africa. Sustaining these reductions will rely upon insecticides to control the mosquito malaria vectors. We report that in the primary African malaria vector, Anopheles gambiae sensu stricto, a single enzyme, CYP6M2, confers resistance to two classes of insecticide. This is unique evidence in a disease vector of cross-resistance associated with a single metabolic gene that simultaneously reduces the efficacy of two of the four classes of insecticide routinely used for malaria control. The gene-expression profile of a highly DDT-resistant population of A. gambiae s.s. from Ghana was characterized using a unique whole-genome microarray. A number of genes were significantly overexpressed compared with two susceptible West African colonies, including genes from metabolic families previously linked to insecticide resistance. One of the most significantly overexpressed probe groups (false-discovery rate-adjusted P P450 gene CYP6M2. This gene is associated with pyrethroid resistance in wild A. gambiae s.s. populations) and can metabolize both type I and type II pyrethroids in recombinant protein assays. Using in vitro assays we show that recombinant CYP6M2 is also capable of metabolizing the organochlorine insecticide DDT in the presence of solubilizing factor sodium cholate.

  5. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  6. Radiation resistance characteristics of optical communication system for single mode

    International Nuclear Information System (INIS)

    Ohe, Masamoto; Chigusa, Yoshiki; Kyodo, Tomohisa; Tanaka, Gohtaro; Watanabe, Hajime; Okamoto, Shin-ichi; Yamamoto, Takao.

    1988-01-01

    Optical communication has been utilized also for nuclear power stations and fuel reporocessing plants. As the sufficient safety countermeasures are required there, the amount of information becomes enormous, therefore, optical communication, by which the required space is expected to be reduced, becomes more important. Also in the application to submarine cables, attention must be paid to the radiation resistance as there are the effects of potassium contained in large amount in seawater and uranium deposits in sea bottom. Therefore, the reliability of the components of optical communication systems against radiation becomes a problem. In this study, single mode optical fibers and transmission and receipt modules were selected, and high dose rate irradiation supposing the case of using in a cell and low dose rate, long time irradiation supposing the case of submarine cables were carried out to evaluate the radiation resistance characteristics. The fibers tested were SiO 2 core/F-SiO 2 clad type and GeO 2 -SiO 2 core/SiO 2 clad type. The characteristics of increasing loss in irradiation and restoration after irradiation of the former type were superior to those of the latter type. The output of a receipt module was normal during irradiation, and the output power of a transmission module decreases, but other problems did not arise. (K.I.)

  7. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  8. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  9. Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

    2013-03-23

    Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia guyanensis.

    Directory of Open Access Journals (Sweden)

    Rubens Monte-Neto

    2015-02-01

    Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

  11. Fibrosis-Related Gene Expression in Single Ventricle Heart Disease.

    Science.gov (United States)

    Nakano, Stephanie J; Siomos, Austine K; Garcia, Anastacia M; Nguyen, Hieu; SooHoo, Megan; Galambos, Csaba; Nunley, Karin; Stauffer, Brian L; Sucharov, Carmen C; Miyamoto, Shelley D

    2017-12-01

    To evaluate fibrosis and fibrosis-related gene expression in the myocardium of pediatric subjects with single ventricle with right ventricular failure. Real-time quantitative polymerase chain reaction was performed on explanted right ventricular myocardium of pediatric subjects with single ventricle disease and controls with nonfailing heart disease. Subjects were divided into 3 groups: single ventricle failing (right ventricular failure before or after stage I palliation), single ventricle nonfailing (infants listed for primary transplantation with normal right ventricular function), and stage III (Fontan or right ventricular failure after stage III). To evaluate subjects of similar age and right ventricular volume loading, single ventricle disease with failure was compared with single ventricle without failure and stage III was compared with nonfailing right ventricular disease. Histologic fibrosis was assessed in all hearts. Mann-Whitney tests were performed to identify differences in gene expression. Collagen (Col1α, Col3) expression is decreased in single ventricle congenital heart disease with failure compared with nonfailing single ventricle congenital heart disease (P = .019 and P = .035, respectively), and is equivalent in stage III compared with nonfailing right ventricular heart disease. Tissue inhibitors of metalloproteinase (TIMP-1, TIMP-3, and TIMP-4) are downregulated in stage III compared with nonfailing right ventricular heart disease (P = .0047, P = .013 and P = .013, respectively). Matrix metalloproteinases (MMP-2, MMP-9) are similar between nonfailing single ventricular heart disease and failing single ventricular heart disease, and between stage III heart disease and nonfailing right ventricular heart disease. There is no difference in the prevalence of right ventricular fibrosis by histology in subjects with single ventricular failure heart disease with right ventricular failure (18%) compared with those with normal right

  12. Tagging microsatellite marker to a blast resistance gene in the irrigated rice cultivar Cica-8

    Directory of Open Access Journals (Sweden)

    Thiago Martins Pinheiro

    2012-09-01

    Full Text Available The rice cultivar Cica-8 exhibit differential reaction to several pathotypes of Magnaporthe oryzae. The objective of the present investigation was to determine the number of alleles involved in the expression of resistance to leaf blast and identify microsatellite markers linked to these alleles. A cross between cultivar Metica-1 and Cica-8 susceptible and resistant, respectively, to pathotype IB-1 (Py1049 was made to obtain F1, F2, BC1:1 and BC1:2 progenies. Greenhouse tests for leaf blast reaction showed that resistance is controlled by a monogenic dominant gene. For testing microsatellite markers, DNA of both resistant and susceptible parents and F1 and F2 populations was extracted. As expected for single dominant gene the F2 populations segregated at a ratio of 3:1. Of the 11 microsatellite markers tested, one marker RM 7102 was found to be closely linked to the resistant allele at a distance of 2.7 cM, in the cultivar Cica-8 to pathotype IB-1.

  13. Molecular mapping of a sunflower rust resistance gene from HAR6.

    Science.gov (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A

    2013-03-01

    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  14. A single exposure to a sublethal pediocin concentration initiates a resistance-associated temporal cell envelope and general stress response in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Laursen, Martin Frederik; Bahl, Martin Iain; Licht, Tine Rask

    2015-01-01

    was to determine if exposure to sublethal concentrations of pediocin-containing Lactobacillus plantarum WHE 92 supernatant could prime L. monocytogenes for resistance. By transcriptomic analysis, we found two, 55 and 539 genes differentially expressed after 10, 60 and 180 min of exposure to L. plantarum WHE 92...... resistant than wild types to L. plantarum WHE 92 supernatant. LisRK, SigB and SigL regulation and genes associated with resistance are involved in the temporal adaptive response to pediocin and all three regulatory systems affect pediocin resistance. Thus, a single exposure to a sublethal pediocin...

  15. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  16. Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.

    Science.gov (United States)

    López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V

    2003-08-01

    Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.

  17. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  18. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

    Science.gov (United States)

    Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-01-01

    A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

  19. The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

    Science.gov (United States)

    Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

    2016-03-01

    Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

  20. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  1. Life-threatening infectious diseases of childhood: single-gene inborn errors of immunity?

    Science.gov (United States)

    Alcaïs, Alexandre; Quintana-Murci, Lluis; Thaler, David S; Schurr, Erwin; Abel, Laurent; Casanova, Jean-Laurent

    2010-12-01

    The hypothesis that inborn errors of immunity underlie infectious diseases is gaining experimental support. However, the apparent modes of inheritance of predisposition or resistance differ considerably among diseases and among studies. A coherent genetic architecture of infectious diseases is lacking. We suggest here that life-threatening infectious diseases in childhood, occurring in the course of primary infection, result mostly from individually rare but collectively diverse single-gene variations of variable clinical penetrance, whereas the genetic component of predisposition to secondary or reactivation infections in adults is more complex. This model is consistent with (i) the high incidence of most infectious diseases in early childhood, followed by a steady decline; (ii) theoretical modeling of the impact of monogenic or polygenic predisposition on the incidence distribution of infectious diseases before reproductive age; (iii) available molecular evidence from both monogenic and complex genetics of infectious diseases in children and adults; (iv) current knowledge of immunity to primary and secondary or latent infections; (v) the state of the art in the clinical genetics of noninfectious pediatric and adult diseases; and (vi) evolutionary data for the genes underlying single-gene and complex disease risk. With the recent advent of new-generation deep resequencing, this model of single-gene variations underlying severe pediatric infectious diseases is experimentally testable. © 2010 New York Academy of Sciences.

  2. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  3. Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

    Science.gov (United States)

    Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

    2016-06-01

    Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

  4. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  5. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  6. Spatial reconstruction of single-cell gene expression

    Science.gov (United States)

    Satija, Rahul; Farrell, Jeffrey A.; Gennert, David; Schier, Alexander F.; Regev, Aviv

    2015-01-01

    Spatial localization is a key determinant of cellular fate and behavior, but spatial RNA assays traditionally rely on staining for a limited number of RNA species. In contrast, single-cell RNA-seq allows for deep profiling of cellular gene expression, but established methods separate cells from their native spatial context. Here we present Seurat, a computational strategy to infer cellular localization by integrating single-cell RNA-seq data with in situ RNA patterns. We applied Seurat to spatially map 851 single cells from dissociated zebrafish (Danio rerio) embryos, inferring a transcriptome-wide map of spatial patterning. We confirmed Seurat’s accuracy using several experimental approaches, and used it to identify a set of archetypal expression patterns and spatial markers. Additionally, Seurat correctly localizes rare subpopulations, accurately mapping both spatially restricted and scattered groups. Seurat will be applicable to mapping cellular localization within complex patterned tissues in diverse systems. PMID:25867923

  7. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  8. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  9. A new gene, developed through mutagenesis with thermal neutrons, for resistance of rice to bacterial leaf blight

    International Nuclear Information System (INIS)

    Nakai, H.; Shimozawa, H.; Saito, M.

    1992-01-01

    Dry seed lots of a rice variety, Harebare, susceptible to bacterial leaf blight (BLB), were treated with thermal neutrons with and without pre-treatment of the seeds by boron-enrichment, gamma-rays and nitroso-methyl-urea (NMU). The selections were made on M 2 -M 3 materials by inoculation of Japanese BLB race III, with the result that several BLB resistant mutants to race III and the other differential races could be obtained. Mutagenic efficiency of thermal neutrons to the seeds without boron-enrichment for induction of BLB resistant mutants was found to be significantly higher than that of the other mutagens. Four mutant lines of all the selected ones were analyzed for genes for BLB resistance through cross tests between the mutants and the original variety. Harebare, indicating that the resistance in the mutants was conditioned by single recessive gene(s). The mutant designated 86M95 was especially noted for its gene conferring complete (or durable) resistance to multiple BLB races. The 86M95 mutant or the gene may be of practical value for breeding of rice for BLB resistance. (author)

  10. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  11. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  12. Isolation and Manipulation of Quantitative Tra it Loci for DIsease Resistance in Rice Using a Candid ate Gene Approach

    Institute of Scientific and Technical Information of China (English)

    Ke-Ming Hu; De-Yun Qiu; Xiang-Ling Shen; Xiang-Hua Li; Shi-Ping Wang

    2008-01-01

    Bacterial blight caused by Xanthomonas oryzae pv.oryzae and fungal blast caused by Magnaporthe grisea result in heavy production losses in rice,a main staple food for approximately 50%of the world's population.Application of host resistance to these pathogens iS the most economical and environment-friendly approach to solve this problem.Quantitative trait loci(QTLs)controlling quantitative resistance are valuable sources for broad.spectrum and durable disease resistance.Although large numbers of QTLs for bacteriaI blight and blast resistance have been identified.these sources have not been used effectively in rice improvement because of the complex genetic controI of quantitative resistance and because the genes underlying resistance QTLs are unknown.To isolate disease resistance QTLs,we established a candidate gene strategy that integrates linkage map,expression profile,and functionaI complementation analyses.This strategy has proven to be applicable for identifying the genes underlying minor resistance QTLs in rice-Xoo and rice-M grisea systems and it may also help to shed light on disease resistance QTLs of other cereals.Our results also suggest that a single minor QTL can be used in rice improvement by modulating the expression of the gene underlying the QTL.Pyramiding two or three minor QTL genes,whose expression can be managed and that function in different defense signaI transduction pathways,may allow the breeding of rice cultivars that are highly resistant to bacteriaI blight and blast.

  13. Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

    DEFF Research Database (Denmark)

    Castberg, Dorte Heidi Højland; Kristensen, Michael

    2017-01-01

    strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

  14. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  15. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Energy Technology Data Exchange (ETDEWEB)

    Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

    2004-01-13

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

  16. Major vault protein (MVP) gene polymorphisms and drug resistance in mesial temporal lobe epilepsy with hippocampal sclerosis.

    Science.gov (United States)

    Balan, Shabeesh; Radhab, Saradalekshmi Koramannil; Radha, Koramannil; Sathyan, Sanish; Vijai, Joseph; Banerjee, Moinak; Radhakrishnan, Kurupath

    2013-09-10

    The human major vault protein (MVP) has been implicated in the development of drug resistance in cancer cells. Over expression of MVP has also been reported in brain tissue samples from antiepileptic drug (AED)-resistant human focal epilepsies. To investigate the relationship between single nucleotide polymorphisms (SNPs) involving the MVP gene and AED-resistance, we compared the distribution of three SNPs in the MVP gene, rs4788187, rs3815824 and rs3815823, among 220 patients with mesial temporal lobe epilepsy with hippocampal sclerosis (MTLE-HS) (prototype of AED-resistant epilepsy syndrome), 201 patients with juvenile myoclonic epilepsy (JME) (prototype of AED-responsive epilepsy syndrome) and 213 ethnically matched non-epilepsy controls. All the patients and controls were residents of the South Indian state of Kerala for more than three generations. We did not find any significant difference in allele and genotypic frequencies of the studied SNPs between AED-resistant and AED-responsive cohorts, and between AED-resistant and AED-responsive cohorts independently and pooled together when compared with the controls. We conclude that rs4788187, rs3815824, rs3815823 variants of the MVP gene are associated neither with predisposition for epilepsy nor with AED-resistance in the population that we have studied. Our results suggest the need for further research into the link between MVP and AED-resistance. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

    Science.gov (United States)

    Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

    2014-02-22

    Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

  18. Inheritance and Gene Mapping of Resistance to Soybean Mosaic Virus Strain SC14 in Soybean

    Institute of Scientific and Technical Information of China (English)

    Hai-Chao Li; Hai-Jian Zhi; Jun-Yi Gai; Dong-Quan Guo; Yan-Wei Wang; Kai Li; Li Bai; Hua Yang

    2006-01-01

    Soybean mosaic virus (SMV) is one of the most broadly distributed diseases worldwide. It causes severe yield loss and seed quality deficiency in soybean (Glycine max (L.) Merr.). SMV Strain SC14 isolated from Shanxi Province, China, was a newly identified virulent strain and can infect Kefeng No. 1, a source with wide spectrum resistance. In the present study, soybean accessions, PI96983, Qihuang No. 1 and Qihuang No. 22 were identified to be resistant (R) and Nannong 1138-2, Pixianchadou susceptible (S) to SC14. Segregation analysis of PI96983 × Nannong 1138-2 indicated that a single dominant gene (designated as Rsc14) controlled the resistance to SC14 at both V2 and R1 developmental stages. The same results were obtained for the crosses of Qihuang No. 1 × Nannong 1138-2 and Qihuang No. 22 × Nannong 1138-2 as in PI96983 × Nannong 1138-2 at V2 stage, but at R1 stage,the F1 performed as necrosis (a susceptible symptom other than mosaic), F2 segregated in a ratio of 1R:2N:1S,and the progenies of necrotic (N) F2 individuals segregated also in R, N and S. It indicated that a single gene (designated as Rsc14o, to be different from that of PI96983) controlled the resistance to SC14, its dominance was the same as in PI96983 × Nannong 1138-2 (without symptoms) at V2 stage and not the same at R1 stage. The tightly linked co-dominant simple sequence repeat (SSR) marker Satt334 indicated that all the heterozygous bands were completely corresponding to the necrotic F2 individuals, or all the necrotic F2 individuals were heterozygotes.It was inferred that necrosis might be due to the interaction among SMV strains, resistance genes, genetic background of the resistance genes, and plant development stage. Furthermore, the bulked segregant analysis (BSA) of SSR markers was conducted to map the resistance genes. In F2 of PI96983 × Nannong 1138-2, five SSR markers, Sat_297, Sat_234, Sat_154, Sct_033 and Sat_120, were found closely linked to Rsc14, with genetic distances of 14

  19. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  20. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bac......The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram......-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across.......6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor– encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance...

  1. Avirulence (AVR) Gene-Based Diagnosis Complements Existing Pathogen Surveillance Tools for Effective Deployment of Resistance (R) Genes Against Rice Blast Disease.

    Science.gov (United States)

    Selisana, S M; Yanoria, M J; Quime, B; Chaipanya, C; Lu, G; Opulencia, R; Wang, G-L; Mitchell, T; Correll, J; Talbot, N J; Leung, H; Zhou, B

    2017-06-01

    Avirulence (AVR) genes in Magnaporthe oryzae, the fungal pathogen that causes the devastating rice blast disease, have been documented to be major targets subject to mutations to avoid recognition by resistance (R) genes. In this study, an AVR-gene-based diagnosis tool for determining the virulence spectrum of a rice blast pathogen population was developed and validated. A set of 77 single-spore field isolates was subjected to pathotype analysis using differential lines, each containing a single R gene, and classified into 20 virulent pathotypes, except for 4 isolates that lost pathogenicity. In all, 10 differential lines showed low frequency (95%), inferring the effectiveness of R genes present in the respective differential lines. In addition, the haplotypes of seven AVR genes were determined by polymerase chain reaction amplification and sequencing, if applicable. The calculated frequency of different AVR genes displayed significant variations in the population. AVRPiz-t and AVR-Pii were detected in 100 and 84.9% of the isolates, respectively. Five AVR genes such as AVR-Pik-D (20.5%) and AVR-Pik-E (1.4%), AVRPiz-t (2.7%), AVR-Pita (0%), AVR-Pia (0%), and AVR1-CO39 (0%) displayed low or even zero frequency. The frequency of AVR genes correlated almost perfectly with the resistance frequency of the cognate R genes in differential lines, except for International Rice Research Institute-bred blast-resistant lines IRBLzt-T, IRBLta-K1, and IRBLkp-K60. Both genetic analysis and molecular marker validation revealed an additional R gene, most likely Pi19 or its allele, in these three differential lines. This can explain the spuriously higher resistance frequency of each target R gene based on conventional pathotyping. This study demonstrates that AVR-gene-based diagnosis provides a precise, R-gene-specific, and differential line-free assessment method that can be used for determining the virulence spectrum of a rice blast pathogen population and for predicting the

  2. A single gene (yes controls pigmentation of eyes and scales in Heliothis virescens

    Directory of Open Access Journals (Sweden)

    Thomas M. Brown

    2001-02-01

    Full Text Available A yellow-eyed mutant was discovered in a strain of Heliothis virescens, the tobacco budworm, that already exhibited a mutation for yellow scale, y. We investigated the inheritance of these visible mutations as candidate markers for transgenesis. Yellow eye was controlled by a single, recessive, autosomal factor, the same type of inheritance previously known for y. Presence of the recombinant mutants with yellow scales with wild type eyes in test crosses indicated independent segregation of genes for these traits. The recombinant class with wild type scales and yellow eyes was completely absent and there was a corresponding increase of the double mutant parental class having yellow scales and yellow eyes. These results indicated that a single factor for yellow eye also controls yellow scales independently of y. This gene was named yes, for yellow eye and scale. We hypothesize that yes controls both eye and scale color through a deficiency in transport of pigment precursors in both the ommochrome and melanin pathways. The unlinked gene y likely controls an enzyme affecting the melanin pathway only. Both y and yes segregated independently of AceIn, acetylcholinesterase insensitivity, and sodium channel hscp, which are genes related to insecticide resistance.

  3. Antimicrobial Susceptibility of Bordetella bronchiseptica Isolates from Swine and Companion Animals and Detection of Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Sandra Prüller

    Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.

  4. Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

    Science.gov (United States)

    Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

    2016-01-01

    In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

  5. Amplification of a cytochrome P450 gene is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae.

    Science.gov (United States)

    Puinean, Alin M; Foster, Stephen P; Oliphant, Linda; Denholm, Ian; Field, Linda M; Millar, Neil S; Williamson, Martin S; Bass, Chris

    2010-06-24

    The aphid Myzus persicae is a globally significant crop pest that has evolved high levels of resistance to almost all classes of insecticide. To date, the neonicotinoids, an economically important class of insecticides that target nicotinic acetylcholine receptors (nAChRs), have remained an effective control measure; however, recent reports of resistance in M. persicae represent a threat to the long-term efficacy of this chemical class. In this study, the mechanisms underlying resistance to the neonicotinoid insecticides were investigated using biological, biochemical, and genomic approaches. Bioassays on a resistant M. persicae clone (5191A) suggested that P450-mediated detoxification plays a primary role in resistance, although additional mechanism(s) may also contribute. Microarray analysis, using an array populated with probes corresponding to all known detoxification genes in M. persicae, revealed constitutive over-expression (22-fold) of a single P450 gene (CYP6CY3); and quantitative PCR showed that the over-expression is due, at least in part, to gene amplification. This is the first report of a P450 gene amplification event associated with insecticide resistance in an agriculturally important insect pest. The microarray analysis also showed over-expression of several gene sequences that encode cuticular proteins (2-16-fold), and artificial feeding assays and in vivo penetration assays using radiolabeled insecticide provided direct evidence of a role for reduced cuticular penetration in neonicotinoid resistance. Conversely, receptor radioligand binding studies and nucleotide sequencing of nAChR subunit genes suggest that target-site changes are unlikely to contribute to resistance to neonicotinoid insecticides in M. persicae.

  6. Expressed sequence enrichment for candidate gene analysis of citrus tristeza virus resistance.

    Science.gov (United States)

    Bernet, G P; Bretó, M P; Asins, M J

    2004-02-01

    Several studies have reported markers linked to a putative resistance gene from Poncirus trifoliata ( Ctv-R) located at linkage group 4 that confers resistance against one of the most important citrus pathogens, citrus tristeza virus (CTV). To be successful in both marker-assisted selection and transformation experiments, its accurate mapping is needed. Several factors may affect its localization, among them two are considered here: the definition of resistance and the genetic background of progeny. Two progenies derived from P. trifoliata, by self-pollination and by crossing with sour orange ( Citrus aurantium), a citrus rootstock well-adapted to arid and semi-arid areas, were used for linkage group-4 marker enrichment. Two new methodologies were used to enrich this region with expressed sequences. The enrichment of group 4 resulted in the fusion of several C. aurantium linkage groups. The new one A(7+3+4) is now saturated with 48 markers including expressed sequences. Surprisingly, sour orange was as resistant to the CTV isolate tested as was P. trifoliata, and three hybrids that carry Ctv-R, as deduced from its flanking markers, are susceptible to CTV. The new linkage maps were used to map Ctv-R under the hypothesis of monogenic inheritance. Its position on linkage group 4 of P. trifoliata differs from the location previously reported in other progenies. The genetic analysis of virus-plant interaction in the family derived from C. aurantium after a CTV chronic infection showed the segregation of five types of interaction, which is not compatible with the hypothesis of a single gene controlling resistance. Two major issues are discussed: another type of genetic analysis of CTV resistance is needed to avoid the assumption of monogenic inheritance, and transferring Ctv-R from P. trifoliata to sour orange might not avoid the CTV decline of sweet orange trees.

  7. Functional characterization of carboxylesterase gene mutations involved in Aphis gossypii resistance to organophosphate insecticides.

    Science.gov (United States)

    Gong, Y-H; Ai, G-M; Li, M; Shi, X-Y; Diao, Q-Y; Gao, X-W

    2017-12-01

    Carboxylesterases (CarEs) play an important role in detoxifying insecticides in insects. Over-expression and structural modification of CarEs have been implicated in the development of organophosphate (OP) insecticide resistance in insects. A previous study identified four nonsynonymous mutations (resulting in four amino acid residue substitutions) in the open reading frame of the carboxylesterase gene of resistant cotton aphids compared to the omethoate susceptible strain, which has possibly influenced the development of resistance to omethoate (a systemic OP insecticide). The current study further characterized the function of these mutations, both alone and in combination, in the hydrolysis of OP insecticides. The metabolism results suggest that the combination of four mutations, mainly existing in the laboratory-selected OP-resistant cotton aphid population, increased the OP hydrolase activity (approximately twofold) at the cost of detectable carboxylesterase activity. The functional studies of single or multiple mutations suggest the positive effect of H104R, A128V and T333P on the acquisition of OP hydrolase activity, especially the combination of H104R with A128V or T333P. K484R substitution decreased both the OP hydrolase activity and the CarE activity, indicating that this mutation primarily drives the negative effect on the acquisition of OP hydrolase activity amongst these four mutations in the resistant strain. The modelling and docking results are basically consistent with the metabolic results, which strongly suggest that the structural gene modification is the molecular basis for the OP resistance in this laboratory-selected cotton aphid strain. © 2017 The Royal Entomological Society.

  8. Label-free screening of single biomolecules through resistive pulse sensing technology for precision medicine applications

    Science.gov (United States)

    Harrer, S.; Kim, S. C.; Schieber, C.; Kannam, S.; Gunn, N.; Moore, S.; Scott, D.; Bathgate, R.; Skafidas, S.; Wagner, J. M.

    2015-05-01

    Employing integrated nano- and microfluidic circuits for detecting and characterizing biological compounds through resistive pulse sensing technology is a vibrant area of research at the interface of biotechnology and nanotechnology. Resistive pulse sensing platforms can be customized to study virtually any particle of choice which can be threaded through a fluidic channel and enable label-free single-particle interrogation with the primary read-out signal being an electric current fingerprint. The ability to perform label-free molecular screening with single-molecule and even single binding site resolution makes resistive pulse sensing technology a powerful tool for analyzing the smallest units of biological systems and how they interact with each other on a molecular level. This task is at the core of experimental systems biology and in particular ‘omics research which in combination with next-generation DNA-sequencing and next-generation drug discovery and design forms the foundation of a novel disruptive medical paradigm commonly referred to as personalized medicine or precision medicine. DNA-sequencing has approached the 1000-Dollar-Genome milestone allowing for decoding a complete human genome with unmatched speed and at low cost. Increased sequencing efficiency yields massive amounts of genomic data. Analyzing this data in combination with medical and biometric health data eventually enables understanding the pathways from individual genes to physiological functions. Access to this information triggers fundamental questions for doctors and patients alike: what are the chances of an outbreak for a specific disease? Can individual risks be managed and if so how? Which drugs are available and how should they be applied? Could a new drug be tailored to an individual’s genetic predisposition fast and in an affordable way? In order to provide answers and real-life value to patients, the rapid evolvement of novel computing approaches for analyzing big data in

  9. Label-free screening of single biomolecules through resistive pulse sensing technology for precision medicine applications.

    Science.gov (United States)

    Harrer, S; Kim, S C; Schieber, C; Kannam, S; Gunn, N; Moore, S; Scott, D; Bathgate, R; Skafidas, S; Wagner, J M

    2015-05-08

    Employing integrated nano- and microfluidic circuits for detecting and characterizing biological compounds through resistive pulse sensing technology is a vibrant area of research at the interface of biotechnology and nanotechnology. Resistive pulse sensing platforms can be customized to study virtually any particle of choice which can be threaded through a fluidic channel and enable label-free single-particle interrogation with the primary read-out signal being an electric current fingerprint. The ability to perform label-free molecular screening with single-molecule and even single binding site resolution makes resistive pulse sensing technology a powerful tool for analyzing the smallest units of biological systems and how they interact with each other on a molecular level. This task is at the core of experimental systems biology and in particular 'omics research which in combination with next-generation DNA-sequencing and next-generation drug discovery and design forms the foundation of a novel disruptive medical paradigm commonly referred to as personalized medicine or precision medicine. DNA-sequencing has approached the 1000-Dollar-Genome milestone allowing for decoding a complete human genome with unmatched speed and at low cost. Increased sequencing efficiency yields massive amounts of genomic data. Analyzing this data in combination with medical and biometric health data eventually enables understanding the pathways from individual genes to physiological functions. Access to this information triggers fundamental questions for doctors and patients alike: what are the chances of an outbreak for a specific disease? Can individual risks be managed and if so how? Which drugs are available and how should they be applied? Could a new drug be tailored to an individual's genetic predisposition fast and in an affordable way? In order to provide answers and real-life value to patients, the rapid evolvement of novel computing approaches for analyzing big data in

  10. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line.

    Science.gov (United States)

    Hou, Liyuan; Zhang, Xiaojun; Li, Xin; Jia, Juqing; Yang, Huizhen; Zhan, Haixian; Qiao, Linyi; Guo, Huijuan; Chang, Zhijian

    2015-07-28

    Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68-0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  11. Identification of a RAPD marker linked to the Co-6 anthracnose resistant gene in common bean cultivar AB 136

    Directory of Open Access Journals (Sweden)

    Alzate-Marin Ana Lilia

    2000-01-01

    Full Text Available The pathogenic variability of the fungus Colletotrichum lindemuthianum represents an obstacle for the creation of resistant common bean (Phaseolus vulgaris L. varieties. Gene pyramiding is an alternative strategy for the development of varieties with durable resistance. RAPD markers have been proposed as a means to facilitate pyramiding of resistance genes without the need for multiple inoculations of the pathogens. The main aims of this work were to define the inheritance pattern of resistance present in common bean cultivar AB 136 in segregating populations derived from crosses with cultivar Rudá (susceptible to most C. lindemuthianum races and to identify RAPD markers linked to anthracnose resistance. The two progenitors, populations F1 and F2, F2:3 families and backcross-derived plants were inoculated with race 89 of C. lindemuthianum under environmentally controlled greenhouse conditions. The results indicate that a single dominant gene, Co-6, controls common bean resistance to this race, giving a segregation ratio between resistant and susceptible plants of 3:1 in the F2, 1:0 in the backcrosses to AB 136 and 1:1 in the backcross to Rudá. The segregation ratio of F2:3 families derived from F2 resistant plants was 1:2 (homozygous to heterozygous resistant. Molecular marker analyses in the F2 population identified a DNA band of approximately 940 base pairs (OPAZ20(940, linked in coupling phase at 7.1 cM of the Co-6 gene. This marker is being used in our backcross breeding program to develop Rudá-derived common bean cultivars resistant to anthracnose and adapted to central Brazil.

  12. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line

    Directory of Open Access Journals (Sweden)

    Liyuan Hou

    2015-07-01

    Full Text Available Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt, is a globally serious disease adversely affecting wheat production. The Bgt-resistant wheat breeding line CH09W89 was derived after backcrossing a Bgt resistant wheat-Thinopyrum intermedium partial amphiploid TAI7045 with susceptible wheat cultivars. At the seedling stage, CH09W89 exhibited immunity or high resistance to Bgt pathotypes E09, E20, E21, E23, E26, Bg1, and Bg2, similar to its donor line TAI7045 and Th. intermedium. No Th. intermedium chromatin was detected based on genomic in situ hybridization of mitotic chromosomes. To determine the mode of inheritance of the Bgt resistance and the chromosomal location of the resistance gene, CH09W89 was crossed with two susceptible wheat cultivars. The results of the genetic analysis showed that the adult resistance to Bgt E09 in CH09W89 was controlled by a single recessive gene, which was tentatively designated as pmCH89. Two polymorphic SSR markers, Xwmc310 and Xwmc125, were linked to the resistance gene with genetic distances 3.1 and 2.7 cM, respectively. Using the Chinese Spring aneuploid and deletion lines, the resistance gene and its linked markers were assigned to chromosome arm 4BL in the bin 0.68–0.78. Due to its unique position on chromosome 4BL, pmCH89 appears to be a new locus for resistance to powdery mildew. These results will be of benefit for improving powdery mildew resistance in wheat breeding programs.

  13. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  14. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  15. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    International Nuclear Information System (INIS)

    Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

    2010-01-01

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  16. Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

    Energy Technology Data Exchange (ETDEWEB)

    Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

    2010-06-15

    This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

  17. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  18. Strategy of gene silencing in cassava for validation of resistance genes

    International Nuclear Information System (INIS)

    Cortes, Simon; Lopez, Camilo

    2010-01-01

    Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

  19. Functional screen for genes responsible for tamoxifen resistance in human breast cancer cells

    NARCIS (Netherlands)

    Meijer, Danielle; van Agthoven, Ton; Bosma, Peter T.; Nooter, Kees; Dorssers, Lambert C. J.

    2006-01-01

    Antiestrogens, such as tamoxifen, are widely used for endocrine treatment of estrogen receptor-positive breast cancer. However, as breast cancer progresses, development of tamoxifen resistance is inevitable. The mechanisms underlying this resistance are not well understood. To identify genes

  20. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  1. A maize resistance gene functions against bacterial streak disease in rice

    OpenAIRE

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

  2. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E.; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops. PMID:29672525

  3. Comparative genomic and transcriptomic analysis of selected fatty acid biosynthesis genes and CNL disease resistance genes in oil palm.

    Science.gov (United States)

    Rosli, Rozana; Amiruddin, Nadzirah; Ab Halim, Mohd Amin; Chan, Pek-Lan; Chan, Kuang-Lim; Azizi, Norazah; Morris, Priscilla E; Leslie Low, Eng-Ti; Ong-Abdullah, Meilina; Sambanthamurthi, Ravigadevi; Singh, Rajinder; Murphy, Denis J

    2018-01-01

    Comparative genomics and transcriptomic analyses were performed on two agronomically important groups of genes from oil palm versus other major crop species and the model organism, Arabidopsis thaliana. The first analysis was of two gene families with key roles in regulation of oil quality and in particular the accumulation of oleic acid, namely stearoyl ACP desaturases (SAD) and acyl-acyl carrier protein (ACP) thioesterases (FAT). In both cases, these were found to be large gene families with complex expression profiles across a wide range of tissue types and developmental stages. The detailed classification of the oil palm SAD and FAT genes has enabled the updating of the latest version of the oil palm gene model. The second analysis focused on disease resistance (R) genes in order to elucidate possible candidates for breeding of pathogen tolerance/resistance. Ortholog analysis showed that 141 out of the 210 putative oil palm R genes had homologs in banana and rice. These genes formed 37 clusters with 634 orthologous genes. Classification of the 141 oil palm R genes showed that the genes belong to the Kinase (7), CNL (95), MLO-like (8), RLK (3) and Others (28) categories. The CNL R genes formed eight clusters. Expression data for selected R genes also identified potential candidates for breeding of disease resistance traits. Furthermore, these findings can provide information about the species evolution as well as the identification of agronomically important genes in oil palm and other major crops.

  4. The diversity of antimicrobial resistance genes among staphylococci of animal origin.

    Science.gov (United States)

    Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

    2013-08-01

    Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. Historical introgression of the downy mildew resistance gene Rpv12 from the Asian species Vitis amurensis into grapevine varieties.

    Directory of Open Access Journals (Sweden)

    Silvia Venuti

    Full Text Available The Amur grape (Vitis amurensis Rupr. thrives naturally in cool climates of Northeast Asia. Resistance against the introduced pathogen Plasmopara viticola is common among wild ecotypes that were propagated from Manchuria into Chinese vineyards or collected by Soviet botanists in Siberia, and used for the introgression of resistance into wine grapes (Vitis vinifera L.. A QTL analysis revealed a dominant gene Rpv12 that explained 79% of the phenotypic variance for downy mildew resistance and was inherited independently of other resistance genes. A Mendelian component of resistance-a hypersensitive response in leaves challenged with P. viticola-was mapped in an interval of 0.2 cM containing an array of coiled-coil NB-LRR genes on chromosome 14. We sequenced 10-kb genic regions in the Rpv12(+ haplotype and identified polymorphisms in 12 varieties of V. vinifera using next-generation sequencing. The combination of two SNPs in single-copy genes flanking the NB-LRR cluster distinguished the resistant haplotype from all others found in 200 accessions of V. vinifera, V. amurensis, and V. amurensis x V. vinifera crosses. The Rpv12(+ haplotype is shared by 15 varieties, the most ancestral of which are the century-old 'Zarja severa' and 'Michurinets'. Before this knowledge, the chromosome segment around Rpv12(+ became introgressed, shortened, and pyramided with another downy mildew resistance gene from North American grapevines (Rpv3 only by phenotypic selection. Rpv12(+ has an additive effect with Rpv3(+ to protect vines against natural infections, and confers foliar resistance to strains that are virulent on Rpv3(+ plants.

  6. Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

    Directory of Open Access Journals (Sweden)

    Getahun E Agga

    Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

  7. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  8. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  9. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Detection of mutations in mtrR gene in quinolone resistant strains of N.gonorrhoeae isolated from India

    Directory of Open Access Journals (Sweden)

    S V Kulkarni

    2015-01-01

    Full Text Available Background and Objectives: Emergence of multi-drug resistant Neisseria gonorrhoeae resulting from new genetic mutation is a serious threat in controlling gonorrhea. This study was undertaken to identify and characterise mutations in the mtrR genes in N.gonorrhoeae isolates resistant to six different antibiotics in the quinolone group. Materials and Methods: The Minimum inhibitory concentrations (MIC of five quinolones for 64 N.gonorrhoeae isolates isolated during Jan 2007-Jun 2009 were determined by E-test method. Mutations in MtrR loci were examined by deoxyribonucleic acid (DNA sequencing. Results: The proportion of N.gonorrhoeae strains resistant to anti-microbials was 98.4% for norfloxacin and ofloxacin, 96.8% for enoxacin and ciprofloxacin, 95.3% for lomefloxacin. Thirty-one (48.4% strains showed mutation (single/multiple in mtrR gene. Ten different mutations were observed and Gly-45 → Asp, Tyr-105 → His being the most common observed mutation. Conclusion: This is the first report from India on quinolone resistance mutations in MtrRCDE efflux system in N.gonorrhoeae. In conclusion, the high level of resistance to quinolone and single or multiple mutations in mtrR gene could limit the drug choices for gonorrhoea.

  11. Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

    Directory of Open Access Journals (Sweden)

    Baozhu Guo

    2011-06-01

    Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

  12. Absence of association between major vault protein (MVP) gene polymorphisms and drug resistance in Chinese Han patients with partial epilepsy.

    Science.gov (United States)

    Zhou, Luo; Zhang, Mengqi; Long, Hongyu; Long, Lili; Xie, Yuanyuan; Liu, Zhaoqian; Kang, Jin; Chen, Qihua; Feng, Li; Xiao, Bo

    2015-11-15

    Drug resistance in epilepsy is common despite many antiepileptic drugs (AEDs) available for treatment. The development of drug resistant epilepsy may be a result of multiple factors. Several previous studies reported that the major vault protein (MVP) was significantly increased in epileptogenic brain tissues resected from patients with partial-onset seizures, indicating the possible involvement of MVP in drug resistance. In this article, we aimed to identify the association between single nucleotide polymorphisms (SNPs) of MVP gene and drug resistance of partial epilepsy in a Chinese Han population. A total of 510 patients with partial-onset seizures and 206 healthy controls were recruited. Among the patients, 222 were drug resistant and 288 were responsive. The selection of tagging SNPs was based on the Hapmap database and Haploview software and the genotyping was conducted on the Sequenom MassARRAY iPLEX platform. For the selected loci rs12149746, rs9938630 and rs4788186 in the MVP gene, there was no significant difference in allele or genotype distribution between the drug resistant and responsive groups, or between all of the patients and healthy controls. Linkage disequilibrium between any two loci was detected but there was no significant difference in haplotype frequency between the drug resistant and responsive groups. Our results suggest that MVP genetic polymorphisms and haplotypes may not be associated with drug resistance of partial epilepsy in the Chinese Han population. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Physical size of the donor locus and transmission of Haemophilus influenzae ampicillin resistance genes by deoxyribonucleic acid-mediated transformation

    International Nuclear Information System (INIS)

    Bendler, J.W. III

    1976-01-01

    The properties of donor deoxyribonucleic acid (DNA) from three clinical isolates and its ability to mediate the transformation of competent Rd strains to ampicillin resistance were examined. A quantitative technique for determining the resistance of individual Haemophilus influenzae cells to ampicillin was developed. When this technique was used, sensitive cells failed to tolerate levels of ampicillin greater than 0.1 to 0.2 μg/ml, whereas three resistant type b β-lactamase-producing strains could form colonies 1- to 3-μg/ml levels of the antibiotic. DNA extracted from the resistant strains elicited transformation of the auxotrophic genes in a multiply auxotrophic Rd strain. For two of the donors, transformation to ampicillin resistance occurred after the uptake of a single DNA molecule approximately 10 4 -fold less frequently than transformation of auxotrophic loci and was not observed to occur at all with the third. The frequency of transformation to ampicillin resistance was two- to fivefold higher in strain BC200 (Okinaka and Barnhart, 1974), which was cured of a defective prophage. All three clinical ampicillin-resistant strains were poor recipients, but the presence of the ampicillin resistant genes in strain BC200 did not reduce its competence

  14. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  15. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  16. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  17. Genotyping-by-sequencing targeting of a novel downy mildew resistance gene Pl 20 from wild Helianthus argophyllus for sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Markell, S G; Song, Q J; Qi, L L

    2017-07-01

    Genotyping-by-sequencing revealed a new downy mildew resistance gene, Pl 20 , from wild Helianthus argophyllus located on linkage group 8 of the sunflower genome and closely linked to SNP markers that facilitate the marker-assisted selection of resistance genes. Downy mildew (DM), caused by Plasmopara halstedii, is one of the most devastating and yield-limiting diseases of sunflower. Downy mildew resistance identified in wild Helianthus argophyllus accession PI 494578 was determined to be effective against the predominant and virulent races of P. halstedii occurring in the United States. The evaluation of 114 BC 1 F 2:3 families derived from the cross between HA 89 and PI 494578 against P. halstedii race 734 revealed that single dominant gene controls downy mildew resistance in the population. Genotyping-by-sequencing analysis conducted in the BC 1 F 2 population indicated that the DM resistance gene derived from wild H. argophyllus PI 494578 is located on the upper end of the linkage group (LG) 8 of the sunflower genome, as was determined single nucleotide polymorphism (SNP) markers associated with DM resistance. Analysis of 11 additional SNP markers previously mapped to this region revealed that the resistance gene, named Pl 20 , co-segregated with four markers, SFW02745, SFW09076, S8_11272025, and S8_11272046, and is flanked by SFW04358 and S8_100385559 at an interval of 1.8 cM. The newly discovered P. halstedii resistance gene has been introgressed from wild species into cultivated sunflower to provide a novel gene with DM resistance. The homozygous resistant individuals were selected from BC 2 F 2 progenies with the use of markers linked to the Pl 20 gene, and these lines should benefit the sunflower community for Helianthus improvement.

  18. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Science.gov (United States)

    Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

    2018-01-01

    Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  19. QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

    Directory of Open Access Journals (Sweden)

    Jansen Rodrigo Pereira Santos

    Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

  20. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  1. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  2. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    International Nuclear Information System (INIS)

    Yamaguchi, Tomoya; Koike, Setsuo

    2000-01-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of β-1 and β-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  3. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, Tomoya; Koike, Setsuo [Tohoku National Agricultural Experiment Station, Morioka (Japan)

    2000-02-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of {beta}-1 and {beta}-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  4. Antibiotic Resistant Bacteria And Their Associated Resistance Genes in a Conventional Municipal Wastewater Treatment Plant

    KAUST Repository

    Aljassim, Nada I.

    2013-12-01

    With water scarcity as a pressing issue in Saudi Arabia and other Middle Eastern countries, the treatment and reuse of municipal wastewater is increasingly being used as an alternative water source to supplement country water needs. Standards are in place to ensure a safe treated wastewater quality, however they do not regulate pathogenic bacteria and emerging contaminants. Information is lacking on the levels of risk to public health associated with these factors, the efficiency of conventional treatment strategies in removing them, and on wastewater treatment in Saudi Arabia in general. In this study, a municipal wastewater treatment plant in Saudi Arabia is investigated to assess the efficiency of conventional treatment in meeting regulations and removing pathogens and emerging contaminants. The study found pathogenic bacterial genera, antibiotic resistance genes and antibiotic resistant bacteria, many of which were multi-resistant in plant discharges. It was found that although the treatments are able to meet traditional quality guidelines, there remains a risk from the discussed contaminants with wastewater reuse. A deeper understanding of this risk, and suggestions for more thorough guidelines and monitoring are needed.

  5. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  6. The powdery mildew resistance gene Pm8 derived from rye is suppressed by its wheat ortholog Pm3.

    Science.gov (United States)

    Hurni, Severine; Brunner, Susanne; Stirnweis, Daniel; Herren, Gerhard; Peditto, David; McIntosh, Robert A; Keller, Beat

    2014-09-01

    The powdery mildew resistance gene Pm8 derived from rye is located on a 1BL.1RS chromosome translocation in wheat. However, some wheat lines with this translocation do not show resistance to isolates of the wheat powdery mildew pathogen avirulent to Pm8 due to an unknown genetically dominant suppression mechanism. Here we show that lines with suppressed Pm8 activity contain an intact and expressed Pm8 gene. Therefore, the absence of Pm8 function in certain 1BL.1RS-containing wheat lines is not the result of gene loss or mutation but is based on suppression. The wheat gene Pm3, an ortholog of rye Pm8, suppressed Pm8-mediated powdery mildew resistance in lines containing Pm8 in a transient single-cell expression assay. This result was further confirmed in transgenic lines with combined Pm8 and Pm3 transgenes. Expression analysis revealed that suppression is not the result of gene silencing, either in wheat 1BL.1RS translocation lines carrying Pm8 or in transgenic genotypes with both Pm8 and Pm3 alleles. In addition, a similar abundance of the PM8 and PM3 proteins in single or double homozygous transgenic lines suggested that a post-translational mechanism is involved in suppression of Pm8. Co-expression of Pm8 and Pm3 genes in Nicotiana benthamiana leaves followed by co-immunoprecipitation analysis showed that the two proteins interact. Therefore, the formation of a heteromeric protein complex might result in inefficient or absent signal transmission for the defense reaction. These data provide a molecular explanation for the suppression of resistance genes in certain genetic backgrounds and suggest ways to circumvent it in future plant breeding. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  7. A Review of ERCC1 Gene in Bladder Cancer: Implications for Carcinogenesis and Resistance to Chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Atsunari Kawashima

    2012-01-01

    Full Text Available The excision repair cross-complementing group 1 (ERCC1 gene performs a critical incision step in DNA repair and is reported to be correlated with carcinogenesis and resistance to drug or ionizing radiation therapy. We reviewed the correlation between ERCC1 and bladder cancer. In carcinogenesis, several reports discussed the relation between ERCC1 single nucleotide polymorphisms and carcinogenesis in bladder cancer only in case-control studies. Regarding the relation between ERCC1 and resistance to chemoradiotherapy, in vitro and clinical studies indicate that ERCC1 might be related to resistance to radiation therapy rather than cisplatin therapy. It is controversial whether ERCC1 predicts prognosis of bladder cancer treated with cisplatin-based chemotherapy. Tyrosine kinase receptors or endothelial-mesenchymal transition are reported to regulate the expression of ERCC1, and further study is needed to clarify the mechanism of ERCC1 expression and resistance to chemoradiotherapy in vitro and to discover novel therapies for advanced and metastatic bladder cancer.

  8. A Review of ERCC1 Gene in Bladder Cancer: Implications for Carcinogenesis and Resistance to Chemoradiotherapy.

    Science.gov (United States)

    Kawashima, Atsunari; Takayama, Hitoshi; Tsujimura, Akira

    2012-01-01

    The excision repair cross-complementing group 1 (ERCC1) gene performs a critical incision step in DNA repair and is reported to be correlated with carcinogenesis and resistance to drug or ionizing radiation therapy. We reviewed the correlation between ERCC1 and bladder cancer. In carcinogenesis, several reports discussed the relation between ERCC1 single nucleotide polymorphisms and carcinogenesis in bladder cancer only in case-control studies. Regarding the relation between ERCC1 and resistance to chemoradiotherapy, in vitro and clinical studies indicate that ERCC1 might be related to resistance to radiation therapy rather than cisplatin therapy. It is controversial whether ERCC1 predicts prognosis of bladder cancer treated with cisplatin-based chemotherapy. Tyrosine kinase receptors or endothelial-mesenchymal transition are reported to regulate the expression of ERCC1, and further study is needed to clarify the mechanism of ERCC1 expression and resistance to chemoradiotherapy in vitro and to discover novel therapies for advanced and metastatic bladder cancer.

  9. Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

    Science.gov (United States)

    Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

    2015-07-01

    The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

  10. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

    Science.gov (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

    2004-03-01

    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  11. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  12. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  13. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  14. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  15. Natural variation of rice blast resistance gene Pi-d2

    Science.gov (United States)

    Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

  16. Transport and transformation of genetic information in the critical zone: The case of antibiotic resistance genes

    Science.gov (United States)

    Zhu, Y. G.

    2015-12-01

    In addition to material and energy flows, the dynamics and functions of the Earth's critical zone are intensively mediated by biological actions performed by diverse organisms. These biological actions are modulated by the expression of functional genes and their translation into enzymes that catalyze geochemical reactions, such as nutrient turnover and pollutant biodegradation. Although geobiology, as an interdisciplinary research area, is playing and vital role in linking biological and geochemical processes at different temporal and spatial scales, the distribution and transport of functional genes have rarely been investigated from the Earth's critical zone perspectives. To illustrate the framework of studies on the transport and transformation of genetic information in the critical zone, antibiotic resistance is taken as an example. Antibiotic resistance genes are considered as a group of emerging contaminants, and their emergence and spread within the critical zone on one hand are induced by anthropogenic activities, and on other hand are threatening human health worldwide. The transport and transformation of antibiotic resistance genes are controlled by both horizontal gene transfer between bacterial cells and the movement of bacteria harboring antibiotic resistance genes. In this paper, the fate and behavior of antibiotic resistance genes will be discussed in the following aspects: 1) general overview of environmental antibiotic resistance; 2) high through quantification of the resistome in various environmental media; 3) pathways of resistance gene flow within the critical zone; and 4) potential strategies in mitigating antibiotic resistance, particularly from the critical zone perspectives.

  17. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  18. An AFLP marker linked to turnip mosaic virus resistance gene in pak ...

    African Journals Online (AJOL)

    An AFLP marker linked to turnip mosaic virus resistance gene in pak-choi. W Xinhua, C Huoying, Z Yuying, H Ruixian. Abstract. Pak-choi is one of the most important vegetable crops in China. Turnip mosaic virus (TuMV) is one of its main pathogen. Screening the molecular marker linked to the TuMV resistance gene is an ...

  19. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  20. Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance.

    Science.gov (United States)

    Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes

    2007-11-01

    The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.

  1. Single-shell tank riser resistance to ground test plan

    International Nuclear Information System (INIS)

    Kiewert, L.R.

    1996-01-01

    This Test Procedure provides the general directions for conducting Single-Shell Tank Riser to Earth Measurements which will be used by engineering as a step towards providing closure for the Lightning Hazard Issue

  2. Marker-assisted pyramiding of brown planthopper (Nilaparvata lugens Stål) resistance genes Bph1 and Bph2 on rice chromosome 12.

    Science.gov (United States)

    Sharma, Prem N; Torii, Akihide; Takumi, Shigeo; Mori, Naoki; Nakamura, Chiharu

    2004-01-01

    Brown planthopper (BPH) (Nilaparvata lugens Stål) is a significant insect pest of rice (Oryza sativa L.). We constructed a gene-pyramided japonica line, in which two BPH resistance genes Bph1 and Bph2 on the long arm of chromosome 12 independently derived from two indica resistance lines were combined through the recombinant selection. The gene-pyramiding was achieved based on the previously constructed high-resolution linkage maps of the two genes. Two co-dominant and four dominant PCR-based markers flanking the loci were used to select for a homozygous recombinant line in a segregating population that was derived from a cross between the parental homozygous single-gene introgression lines. BPH bioassay showed that the resistance level of the pyramided line was equivalent to that of the Bph1-single introgression line, which showed a higher level of resistance than the Bph2-single introgression line. The pyramid line should provide a useful experimental means for studying the fine structure of the chromosomal region covering these two major BPH resistance genes.

  3. Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

    Science.gov (United States)

    Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

    2015-12-01

    Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

  4. Single muscle fiber gene expression with run taper.

    Directory of Open Access Journals (Sweden)

    Kevin Murach

    Full Text Available This study evaluated gene expression changes in gastrocnemius slow-twitch myosin heavy chain I (MHC I and fast-twitch (MHC IIa muscle fibers of collegiate cross-country runners (n = 6, 20±1 y, VO₂max = 70±1 ml•kg-1•min-1 during two distinct training phases. In a controlled environment, runners performed identical 8 kilometer runs (30:18±0:30 min:s, 89±1% HRmax while in heavy training (∼72 km/wk and following a 3 wk taper. Training volume during the taper leading into peak competition was reduced ∼50% which resulted in improved race times and greater cross-section and improved function of MHC IIa fibers. Single muscle fibers were isolated from pre and 4 hour post run biopsies in heavily trained and tapered states to examine the dynamic acute exercise response of the growth-related genes Fibroblast growth factor-inducible 14 (FN14, Myostatin (MSTN, Heat shock protein 72 (HSP72, Muscle ring-finger protein-1 (MURF1, Myogenic factor 6 (MRF4, and Insulin-like growth factor 1 (IGF1 via qPCR. FN14 increased 4.3-fold in MHC IIa fibers with exercise in the tapered state (P<0.05. MSTN was suppressed with exercise in both fiber types and training states (P<0.05 while MURF1 and HSP72 responded to running in MHC IIa and I fibers, respectively, regardless of training state (P<0.05. Robust induction of FN14 (previously shown to strongly correlate with hypertrophy and greater overall transcriptional flexibility with exercise in the tapered state provides an initial molecular basis for fast-twitch muscle fiber performance gains previously observed after taper in competitive endurance athletes.

  5. The expression of antibiotic resistance genes in antibiotic-producing bacteria.

    Science.gov (United States)

    Mak, Stefanie; Xu, Ye; Nodwell, Justin R

    2014-08-01

    Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

  6. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  7. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

    Science.gov (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

    2016-06-01

    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  8. Mapping, isolation and characterization of genes responsible for late blight resistance in potato

    NARCIS (Netherlands)

    Pel, M.

    2010-01-01

    Late blight (LB), caused by the oomycete Phytophthora infestans, is one of the most
    devastating diseases on potato. Resistance (R) genes from the wild species Solanum demissum
    have been used by breeders to generate late blight resistant cultivars, but resistance was soon
    overcome

  9. In Silico Assigned Resistance Genes Confer Bifidobacterium with Partial Resistance to Aminoglycosides but Not to Β-Lactams

    Science.gov (United States)

    Fouhy, Fiona; O’Connell Motherway, Mary; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; van Sinderen, Douwe; Cotter, Paul D.

    2013-01-01

    Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria. PMID:24324818

  10. In silico assigned resistance genes confer Bifidobacterium with partial resistance to aminoglycosides but not to β-lactams.

    Directory of Open Access Journals (Sweden)

    Fiona Fouhy

    Full Text Available Bifidobacteria have received significant attention due to their contribution to human gut health and the use of specific strains as probiotics. It is thus not surprising that there has also been significant interest with respect to their antibiotic resistance profile. Numerous culture-based studies have demonstrated that bifidobacteria are resistant to the majority of aminoglycosides, but are sensitive to β-lactams. However, limited research exists with respect to the genetic basis for the resistance of bifidobacteria to aminoglycosides. Here we performed an in-depth in silico analysis of putative Bifidobacterium-encoded aminoglycoside resistance proteins and β-lactamases and assess the contribution of these proteins to antibiotic resistance. The in silico-based screen detected putative aminoglycoside and β-lactam resistance proteins across the Bifidobacterium genus. Laboratory-based investigations of a number of representative bifidobacteria strains confirmed that despite containing putative β-lactamases, these strains were sensitive to β-lactams. In contrast, all strains were resistant to the aminoglycosides tested. To assess the contribution of genes encoding putative aminoglycoside resistance proteins in Bifidobacterium sp. two genes, namely Bbr_0651 and Bbr_1586, were targeted for insertional inactivation in B. breve UCC2003. As compared to the wild-type, the UCC2003 insertion mutant strains exhibited decreased resistance to gentamycin, kanamycin and streptomycin. This study highlights the associated risks of relying on the in silico assignment of gene function. Although several putative β-lactam resistance proteins are located in bifidobacteria, their presence does not coincide with resistance to these antibiotics. In contrast however, this approach has resulted in the identification of two loci that contribute to the aminoglycoside resistance of B. breve UCC2003 and, potentially, many other bifidobacteria.

  11. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

    Science.gov (United States)

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

    2014-06-01

    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  12. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  13. Output pulse-shapes of position-sensitive proportional counters using high resistance single wire

    International Nuclear Information System (INIS)

    Iwatani, Kazuo; Nishiyama, Fumitaka; Hasai, Hiromi

    1980-01-01

    The measurements and model analysis of the output pulse-shapes from a single wire proportional counter (SWPC) which has a high resistance anode are described. The characteristics of the observed pulse-shapes are determined by only one parameter which is a function of anode resistance and load resistance and they are reproduced by a simple model. Using this model, the methods for position read-out are discussed in a systematical way. (author)

  14. The tetracycline resistance determinant Tet 39 and the sulphonamide resistance gene sulII are common among resistant Acinetobacter spp. isolated from integrated fish farms in Thailand

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Petersen, Andreas

    2007-01-01

    Objectives: To determine the genetic basis for tetracycline and sulphonamide resistance and the prevalence of class I and II integrons in oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Methods: A total of 222 isolates were screened for tetracycline resistance...... and Southern blots with sulII and tet(39) probes were performed on selected isolates. Results: The recently identified tetracycline resistance gene tet(39) was demonstrated in 75% (166/222) of oxytetracycline-resistant Acinetobacter spp. from integrated fish farms in Thailand. Isolates that were also...

  15. Reclaimed water as a reservoir of antibiotic resistance genes: distribution system and irrigation implications

    Directory of Open Access Journals (Sweden)

    Nicole L Fahrenfeld

    2013-05-01

    Full Text Available Treated wastewater is increasingly being reused to achieve sustainable water management in arid regions. The objective of this study was to quantify the distribution of antibiotic resistance genes (ARGs in recycled water, particularly after it has passed through the distribution system, and to consider point-of-use implications for soil irrigation. Three separate reclaimed wastewater distribution systems in the western U.S. were examined. Quantitative polymerase chain reaction (qPCR was used to quantify ARGs corresponding to resistance to sulfonamides (sul1, sul2, macrolides (ermF, tetracycline (tet(A, tet(O, glycopeptides (vanA, and methicillin (mecA, in addition to genes present in waterborne pathogens Legionella pneumophila (Lmip, Escherichia coli (gadAB, and Pseudomonas aeruginosa (ecfx, gyrB. In a parallel lab study, the effect of irrigating an agricultural soil with secondary, chlorinated, or dechlorinated wastewater effluent was examined in batch microcosms. A broader range of ARGs were detected after the reclaimed water passed through the distribution systems, highlighting the importance of considering bacterial re-growth and the overall water quality at the point of use. Screening for pathogens with qPCR indicated presence of Lmip and gadAB genes, but not ecfx or gyrB. In the lab study, chlorination was observed to reduce 16S rRNA and sul2 gene copies in the wastewater effluent, while dechlorination had no apparent effect. ARGs levels did not change with time in soil slurries incubated after a single irrigation event with any of the effluents. However, when irrigated repeatedly with secondary wastewater effluent (not chlorinated or dechlorinated, elevated levels of sul1 and sul2 were observed. This study suggests that reclaimed water may be an important reservoir of ARGs, especially at the point of use, and that attention should be directed towards the fate of ARGs in irrigation water and the implications for human health.

  16. [Loading and strength of single- and multi-unit fixed dental prostheses. 1. Retention and resistance

    NARCIS (Netherlands)

    Baat, C. de; Witter, D.J.; Meijers, C.C.A.J.; Vergoossen, E.L.; Creugers, N.H.J.

    2014-01-01

    The degree to which single- and multi-unit fixed dental prostheses are able to withstand loading forces is dependent, among other things, on the quality of their retention and resistance. The quality of the retention and resistance of the configuration of an abutment tooth prepared for a metal and

  17. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  18. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    Directory of Open Access Journals (Sweden)

    Ana Belén Flórez

    2014-01-01

    Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

  19. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  20. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo

    Directory of Open Access Journals (Sweden)

    Ana Paula Matoso Teixeira

    2008-01-01

    Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.

  1. Fine mapping of the Bsr1 barley stripe mosaic virus resistance gene in the model grass Brachypodium distachyon.

    Directory of Open Access Journals (Sweden)

    Yu Cui

    Full Text Available The ND18 strain of Barley stripe mosaic virus (BSMV infects several lines of Brachypodium distachyon, a recently developed model system for genomics research in cereals. Among the inbred lines tested, Bd3-1 is highly resistant at 20 to 25 °C, whereas Bd21 is susceptible and infection results in an intense mosaic phenotype accompanied by high levels of replicating virus. We generated an F(6:7 recombinant inbred line (RIL population from a cross between Bd3-1 and Bd21 and used the RILs, and an F(2 population of a second Bd21 × Bd3-1 cross to evaluate the inheritance of resistance. The results indicate that resistance segregates as expected for a single dominant gene, which we have designated Barley stripe mosaic virus resistance 1 (Bsr1. We constructed a genetic linkage map of the RIL population using SNP markers to map this gene to within 705 Kb of the distal end of the top of chromosome 3. Additional CAPS and Indel markers were used to fine map Bsr1 to a 23 Kb interval containing five putative genes. Our study demonstrates the power of using RILs to rapidly map the genetic determinants of BSMV resistance in Brachypodium. Moreover, the RILs and their associated genetic map, when combined with the complete genomic sequence of Brachypodium, provide new resources for genetic analyses of many other traits.

  2. Fine Mapping of the Dominant Potyvirus Resistance Gene Pvr7 Reveals a Relationship with Pvr4 in Capsicum annuum.

    Science.gov (United States)

    Venkatesh, Jelli; An, Jeongtak; Kang, Won-Hee; Jahn, Molly; Kang, Byoung-Cheorl

    2018-01-01

    Pepper mottle virus (PepMoV) is the most common potyvirus infection of pepper plants and causes significant yield losses. The Pvr7 gene from Capsicum chinense PI159236 and the Pvr4 gene from C. annuum CM334 both have been reported to confer dominant resistance to PepMoV. The Pvr7 locus conferring resistance to PepMoV in C. annuum '9093' was previously mapped to chromosome 10. To develop a high-resolution map of the Pvr7 locus in 9093, we constructed an intraspecific F 2 mapping population consisting of 916 individuals by crossing PepMoV-resistant C. annuum '9093' and the PepMoV-susceptible C. annuum 'Jeju'. To delimit the Pvr7 target region, single-nucleotide polymorphism (SNP) markers derived from the Pvr4 region were used for genotyping the F 2 population. Molecular mapping delimited the Pvr7 locus to a physical interval of 258 kb, which was the same region as Pvr4 on chromosome 10. Three SNP markers derived from Pvr4 mapping perfectly cosegregated with PepMoV resistance. Sequencing analyses of the Pvr7 flanking markers and the Pvr4-specific gene indicated that Pvr7 and Pvr4 are the same gene. Resistance spectrum analysis of 9093 against pepper potyviruses showed that 9093 has a resistance spectrum similar to that of cultivar CM334. These combined results demonstrate that, unlike previously thought, the dominant PepMoV resistance in 9093 could be derived from C. annuum 'CM334', and that Pvr4 and Pvr7 should be considered as the same locus.

  3. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.

    Science.gov (United States)

    Baba, Tomoya; Ara, Takeshi; Hasegawa, Miki; Takai, Yuki; Okumura, Yoshiko; Baba, Miki; Datsenko, Kirill A; Tomita, Masaru; Wanner, Barry L; Mori, Hirotada

    2006-01-01

    We have systematically made a set of precisely defined, single-gene deletions of all nonessential genes in Escherichia coli K-12. Open-reading frame coding regions were replaced with a kanamycin cassette flanked by FLP recognition target sites by using a one-step method for inactivation of chromosomal genes and primers designed to create in-frame deletions upon excision of the resistance cassette. Of 4288 genes targeted, mutants were obtained for 3985. To alleviate problems encountered in high-throughput studies, two independent mutants were saved for every deleted gene. These mutants-the 'Keio collection'-provide a new resource not only for systematic analyses of unknown gene functions and gene regulatory networks but also for genome-wide testing of mutational effects in a common strain background, E. coli K-12 BW25113. We were unable to disrupt 303 genes, including 37 of unknown function, which are candidates for essential genes. Distribution is being handled via GenoBase (http://ecoli.aist-nara.ac.jp/).

  4. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

    Science.gov (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

    2016-10-01

    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  5. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  7. Parasitic resistive switching uncovered from complementary resistive switching in single active-layer oxide memory device

    Science.gov (United States)

    Zhu, Lisha; Hu, Wei; Gao, Chao; Guo, Yongcai

    2017-12-01

    This paper reports the reversible transition processes between the bipolar and complementary resistive switching (CRS) characteristics on the binary metal-oxide resistive memory devices of Pt/HfO x /TiN and Pt/TaO x /TiN by applying the appropriate bias voltages. More interestingly, by controlling the amplitude of the negative bias, the parasitic resistive switching effect exhibiting repeatable switching behavior is uncovered from the CRS behavior. The electrical observation of the parasitic resistive switching effect can be explained by the controlled size of the conductive filament. This work confirms the transformation and interrelationship among the bipolar, parasitic, and CRS effects, and thus provides new insight into the understanding of the physical mechanism of the binary metal-oxide resistive switching memory devices.

  8. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  10. A Genome-Wide Association Study Reveals Genes Associated with Fusarium Ear Rot Resistance in a Maize Core Diversity Panel

    Science.gov (United States)

    Zila, Charles T.; Samayoa, L. Fernando; Santiago, Rogelio; Butrón, Ana; Holland, James B.

    2013-01-01

    Fusarium ear rot is a common disease of maize that affects food and feed quality globally. Resistance to the disease is highly quantitative, and maize breeders have difficulty incorporating polygenic resistance alleles from unadapted donor sources into elite breeding populations without having a negative impact on agronomic performance. Identification of specific allele variants contributing to improved resistance may be useful to breeders by allowing selection of resistance alleles in coupling phase linkage with favorable agronomic characteristics. We report the results of a genome-wide association study to detect allele variants associated with increased resistance to Fusarium ear rot in a maize core diversity panel of 267 inbred lines evaluated in two sets of environments. We performed association tests with 47,445 single-nucleotide polymorphisms (SNPs) while controlling for background genomic relationships with a mixed model and identified three marker loci significantly associated with disease resistance in at least one subset of environments. Each associated SNP locus had relatively small additive effects on disease resistance (±1.1% on a 0–100% scale), but nevertheless were associated with 3 to 12% of the genotypic variation within or across environment subsets. Two of three identified SNPs colocalized with genes that have been implicated with programmed cell death. An analysis of associated allele frequencies within the major maize subpopulations revealed enrichment for resistance alleles in the tropical/subtropical and popcorn subpopulations compared with other temperate breeding pools. PMID:24048647

  11. Gene Expression Profiling of Cecropin B-Resistant Haemophilus parasuis

    NARCIS (Netherlands)

    Wang, Chunmei; Chen, Fangzhou; Hu, Han; Li, Wentao; Wang, Yang; Chen, Pin; Liu, Yingyu; Ku, Xugang; He, Qigai; Chen, Huanchun; Xue, Feiqun

    2014-01-01

    Synthetically designed antimicrobial peptides (AMPs) present the potential of replacing antibiotics in the treatment of bacterial infections. However, microbial resistance to AMPs has been reported and little is known regarding the underlying mechanism of such resistance. The naturally occurring AMP

  12. PCR detection of indicator genes in methicillin-resistant ...

    African Journals Online (AJOL)

    MRSA) isolated from three Saudi hospitals. ... Resistance towards eight antimicrobial agents revealed that most of the tested strains of Staphylococcus aureus showed resistance to the tested antimicrobials in the following order; Oxacillin 100% ...

  13. The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia

    Directory of Open Access Journals (Sweden)

    Gui Hong Fu

    2014-12-01

    Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.

  14. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  15. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  16. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    Nendran) cultivar. C6 was expressed only in resistant cultivar not in susceptible one. But there was no change in the expression of C2 and C3 in both resistant and susceptible cultivars. These results indicate that in depth study on C1, and C5 RGAs will be helpful for further improvement of P. coffeae resistance in banana.

  17. sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.

    Science.gov (United States)

    Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia

    2013-01-01

    The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.

  18. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  19. Structure of single-chain single crystals of isotactic polystyrene and their radiation resistance

    International Nuclear Information System (INIS)

    Bu Haishan; Cao Jie; Xu Shengyong; Zhang Ze

    1997-01-01

    The structure of the single-chain single crystals of isotactic polystyrene (i-PS) was investigated by electron diffraction (ED) and high resolution electron microscopy (HREM). The nano-scale single-chain single crystals were found to be very stable to electron irradiation. According to the unit cell of i-PS crystals, the reflection rings in ED pattern and the lattice fringes in HREM images could be indexed, but the lower-index diffractions were not found. It is proposed that the single-chain single crystals are very small, thus secondary electrons may be allowed to escape and radiation damage is highly reduced, and that there are less lower-index lattice planes in the single-chain single crystals to provide sufficient diffraction intensity for recording. HREM images can be achieved at room temperature in the case of single-chain single crystals because of its stability to electron irradiation, therefore, this might be a novel experimental approach to the study of crystal structure of macromolecules

  20. The transport of antibiotic resistance genes and residues in groundwater near swine production facilities

    Science.gov (United States)

    Lin, Y. F.; Yannarell, A. C.; Mackie, R. I.; Krapac, I. G.; Chee-Sanford, J. S.; Koike, S.

    2008-12-01

    The use of antibiotics at concentrated animal feeding operations (CAFOs) for disease prevention, disease treatment, and growth promotion can contribute to the spread of antibiotic compounds, their breakdown products, and antibiotic resistant bacteria and/or the genes that confer resistance. In addition, constitutive use of antibiotics at sub-therapeutic levels can select for antibiotic resistance among the bacteria that inhabit animal intestinal tracts, onsite manure treatment facilities, and any environments receiving significant inputs of manure (e.g. through waste lagoon leakage or fertilizer amendments to farm soils). If the antibiotic resistant organisms persist in these new environments, or if they participate in genetic exchanges with the native microflora, then CAFOs may constitute a significant reservoir for the spread of antibiotic resistance to the environment at large. Our results have demonstrated that leakage from waste treatment lagoons can influence the presence and persistence of tetracycline resistance genes in the shallow aquifer adjacent to swine CAFOs, and molecular phylogeny allowed us to distinguish "native" tetracycline resistance genes in control groundwater wells from manure-associated genes introduced from the lagoon. We have also been able to detect the presence of erythromycin resistance genes in CAFO surface and groundwater even though erythromycin is strictly reserved for use in humans and thus is not utilized at any of these sites. Ongoing research, including modeling of particle transport in groundwater, will help to determine the potential spatial and temporal extent of CAFO-derived antibiotic resistance.

  1. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  2. SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

    Science.gov (United States)

    de Man, Tom J B; Limbago, Brandi M

    2016-01-01

    We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

  3. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Directory of Open Access Journals (Sweden)

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  4. High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Ma, G J; Song, Q J; Markell, S G; Qi, L L

    2018-03-21

    A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

  5. Gene Expression Analysis of Plum pox virus (Sharka Susceptibility/Resistance in Apricot (Prunus armeniaca L..

    Directory of Open Access Journals (Sweden)

    Manuel Rubio

    Full Text Available RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925, which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein PPVres region could also be involved in the resistance.

  6. Gene Expression Analysis of Plum pox virus (Sharka) Susceptibility/Resistance in Apricot (Prunus armeniaca L.).

    Science.gov (United States)

    Rubio, Manuel; Ballester, Ana Rosa; Olivares, Pedro Manuel; Castro de Moura, Manuel; Dicenta, Federico; Martínez-Gómez, Pedro

    2015-01-01

    RNA-Seq has proven to be a very powerful tool in the analysis of the Plum pox virus (PPV, sharka disease)/Prunus interaction. This technique is an important complementary tool to other means of studying genomics. In this work an analysis of gene expression of resistance/susceptibility to PPV in apricot is performed. RNA-Seq has been applied to analyse the gene expression changes induced by PPV infection in leaves from two full-sib apricot genotypes, "Rojo Pasión" and "Z506-7", resistant and susceptible to PPV, respectively. Transcriptomic analyses revealed the existence of more than 2,000 genes related to the pathogen response and resistance to PPV in apricot. These results showed that the response to infection by the virus in the susceptible genotype is associated with an induction of genes involved in pathogen resistance such as the allene oxide synthase, S-adenosylmethionine synthetase 2 and the major MLP-like protein 423. Over-expression of the Dicer protein 2a may indicate the suppression of a gene silencing mechanism of the plant by PPV HCPro and P1 PPV proteins. On the other hand, there were 164 genes involved in resistance mechanisms that have been identified in apricot, 49 of which are located in the PPVres region (scaffold 1 positions from 8,050,804 to 8,244,925), which is responsible for PPV resistance in apricot. Among these genes in apricot there are several MATH domain-containing genes, although other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein; and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.

  7. Introgression and pyramiding into common bean market class fabada of genes conferring resistance to anthracnose and potyvirus.

    Science.gov (United States)

    Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón

    2012-03-01

    Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled

  8. Prevalence of antimicrobial resistance and the cfiA resistance gene in Danish Bacteroides fragilis group isolates since 1973

    DEFF Research Database (Denmark)

    Ferløv-Schwensen, Simon Andreas; Sydenham, Thomas Vognbjerg; Hansen, Kia Cirkeline Møller

    2017-01-01

    Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS) on the Biotyper platform. Antimicrobial resistance was determined using a disk diffusion screening method and commercial antibiotic gradient strips. Division I (cfiA-negative) and division II (cfiA-positive) B. fragilis strains were...... differentiated using MALDI-TOF MS and real-time polymerase chain reaction (PCR). RESULTS: From 1973-1980 to 2010-2015 the prevalence of antimicrobial resistance rose from 0% to 21.2%, 2.5%, and 1% for clindamycin, meropenem, and metronidazole, respectively. MALDI-TOF MS and real-time PCR identified 16 of 266 (6...... established in the recent decades in Europe. Resistance to meropenem, facilitated by expression of the cfiA resistance gene, seems to be increasing; therefore, it is imperative to monitor the occurrence of this gene, e.g. using MALDI-TOF MS....

  9. Molecular evolution of the rice blast resistance gene Pi-ta in invasive weedy rice in the USA.

    Directory of Open Access Journals (Sweden)

    Seonghee Lee

    Full Text Available The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus, which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH, suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta, not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing.

  10. Molecular Evolution of the Rice Blast Resistance Gene Pi-ta in Invasive Weedy Rice in the USA

    Science.gov (United States)

    Lee, Seonghee; Jia, Yulin; Jia, Melissa; Gealy, David R.; Olsen, Kenneth M.; Caicedo, Ana L.

    2011-01-01

    The Pi-ta gene in rice has been effectively used to control rice blast disease caused by Magnaporthe oryzae worldwide. Despite a number of studies that reported the Pi-ta gene in domesticated rice and wild species, little is known about how the Pi-ta gene has evolved in US weedy rice, a major weed of rice. To investigate the genome organization of the Pi-ta gene in weedy rice and its relationship to gene flow between cultivated and weedy rice in the US, we analyzed nucleotide sequence variation at the Pi-ta gene and its surrounding 2 Mb region in 156 weedy, domesticated and wild rice relatives. We found that the region at and around the Pi-ta gene shows very low genetic diversity in US weedy rice. The patterns of molecular diversity in weeds are more similar to cultivated rice (indica and aus), which have never been cultivated in the US, rather than the wild rice species, Oryza rufipogon. In addition, the resistant Pi-ta allele (Pi-ta) found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH), suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s) required for the Pi-ta mediated resistance may be missing in these accessions. Signatures of flanking sequences of the Pi-ta gene and SSR markers on chromosome 12 suggest that the susceptible pi-ta allele (pi-ta), not Pi-ta, has been introgressed from cultivated to weedy rice by out-crossing. PMID:22043312

  11. Analysis of cold resistance and identification of SSR markers linked to cold resistance genes in Brassica rapa L.

    Science.gov (United States)

    Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia

    2017-06-01

    Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.

  12. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  13. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  14. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  15. PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

    Science.gov (United States)

    Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

    2013-04-01

    Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

  16. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria.

    Science.gov (United States)

    Alexander, Johannes; Bollmann, Anna; Seitz, Wolfram; Schwartz, Thomas

    2015-04-15

    The dissemination of medically relevant antibiotic resistance genes (ARGs) (blaVIM-1, vanA, ampC, ermB, and mecA) and opportunistic bacteria (Enterococcus faecium/faecalis, Pseudomonas aeruginosa, Enterobacteriaceae, Staphylococcus aureus, and CNS) was determined in different anthropogenically influenced aquatic habitats in a selected region of Germany. Over a period of two years, four differently sized wastewater treatment plants (WWTPs) with and without clinical influence, three surface waters, four rain overflow basins, and three groundwater sites were analyzed by quantitative Polymerase Chain Reaction (qPCR). Results were calculated in cell equivalents per 100 ng of total DNA extracted from water samples and per 100 mL sample volume, which seems to underestimate the abundance of antibiotic resistance and opportunistic bacteria. High abundances of opportunistic bacteria and ARG were quantified in clinical wastewaters and influents of the adjacent WWTP. The removal capacities of WWTP were up to 99% for some, but not all investigated bacteria. The abundances of most ARG targets were found to be increased in the bacterial population after conventional wastewater treatment. As a consequence, downstream surface water and also some groundwater compartments displayed high abundances of all four ARGs. It became obvious that the dynamics of the ARG differed from the fate of the opportunistic bacteria. This underlines the necessity of an advanced microbial characterization of anthropogenically influenced environments. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene

    NARCIS (Netherlands)

    van Veen, HW; Callaghan, R; Soceneantu, L; Sardini, A; Konings, WN; Higgins, CF

    1998-01-01

    Bacteria have developed many fascinating antibiotic-resistance mechanisms(1,2). A protein in Lactococcus lactis, LmrA, mediates antibiotic resistance by extruding amphiphilic compounds from the inner leaflet of the cytoplasmic membrane(3,4). Unlike other known bacterial multidrug-resistance

  18. Dysphonia – the single symptom of rifampicin resistant laryngeal tuberculosis

    Directory of Open Access Journals (Sweden)

    Paulauskienė Iveta

    2016-01-01

    Full Text Available Tuberculosis is still the most frequent granulomatous laryngeal disease. Absence of pathognomonic symptoms and change in clinical pattern frequently leads to misdiagnosis and delayed treatment. Hoarseness is the commonest symptom of laryngeal tuberculosis and constitutional symptoms are usually rare. However dysphonia can be caused by many other more common conditions. Hoarseness can be a symptom of organic (nodules and polyps of vocal folds, tumors, vocal fold paresis or functional (functional dysphonia, laryngeal conversion disorder, paradoxical vocal folds motion conditions. Rarely systemic diseases as amyloidosis, sarcoidosis, Wegener’s granulomatosis or tuberculosis can cause vocal dysfunction too. That is why laryngeal tuberculosis is often forgotten in case of persistent hoarseness. In this article, we present a case of a young previously healthy woman, complaining of persistent hoarseness with no other leading symptoms. Though endoscopic image suggested a malignancy, histology showed granulomatous lesion. Detailed examination revealed laryngeal and pulmonary tuberculosis resistant to rifampicin. Conclusion: Dysphonia can be the only one symptom of laryngeal tuberculosis. The disease should be taken into consideration when a patient complains of persistent hoarseness in order to avoid delays in treatment and spread of infection.

  19. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  20. Parallel evolution of tetrodotoxin resistance in three voltage-gated sodium channel genes in the garter snake Thamnophis sirtalis.

    Science.gov (United States)

    McGlothlin, Joel W; Chuckalovcak, John P; Janes, Daniel E; Edwards, Scott V; Feldman, Chris R; Brodie, Edmund D; Pfrender, Michael E; Brodie, Edmund D

    2014-11-01

    Members of a gene family expressed in a single species often experience common selection pressures. Consequently, the molecular basis of complex adaptations may be expected to involve parallel evolutionary changes in multiple paralogs. Here, we use bacterial artificial chromosome library scans to investigate the evolution of the voltage-gated sodium channel (Nav) family in the garter snake Thamnophis sirtalis, a predator of highly toxic Taricha newts. Newts possess tetrodotoxin (TTX), which blocks Nav's, arresting action potentials in nerves and muscle. Some Thamnophis populations have evolved resistance to extremely high levels of TTX. Previous work has identified amino acid sites in the skeletal muscle sodium channel Nav1.4 that confer resistance to TTX and vary across populations. We identify parallel evolution of TTX resistance in two additional Nav paralogs, Nav1.6 and 1.7, which are known to be expressed in the peripheral nervous system and should thus be exposed to ingested TTX. Each paralog contains at least one TTX-resistant substitution identical to a substitution previously identified in Nav1.4. These sites are fixed across populations, suggesting that the resistant peripheral nerves antedate resistant muscle. In contrast, three sodium channels expressed solely in the central nervous system (Nav1.1-1.3) showed no evidence of TTX resistance, consistent with protection from toxins by the blood-brain barrier. We also report the exon-intron structure of six Nav paralogs, the first such analysis for snake genes. Our results demonstrate that the molecular basis of adaptation may be both repeatable across members of a gene family and predictable based on functional considerations. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

    Science.gov (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

    2017-09-01

    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  2. Identification and mapping of two powdery mildew resistance genes in Triticum boeoticum L.

    Science.gov (United States)

    Chhuneja, Parveen; Kumar, Krishan; Stirnweis, Daniel; Hurni, Severine; Keller, Beat; Dhaliwal, Harcharan S; Singh, Kuldeep

    2012-04-01

    Powdery mildew (PM) caused by Blumeria graminis f. sp. tritici (Bgt), is one of the important foliar diseases of wheat that can cause serious yield losses. Breeding for cultivars with diverse resources of resistance is the most promising approach for combating this disease. The diploid A genome progenitor species of wheat are an important resource for new variability for disease resistance genes. An accession of Triticum boeoticum (A(b)A(b)) showed resistance against a number of Bgt isolates, when tested using detached leaf segments. Inheritance studies in a recombinant inbred line population (RIL), developed from crosses of PM resistant T. boeoticum acc. pau5088 with a PM susceptible T. monococcum acc. pau14087, indicated the presence of two powdery mildew resistance genes in T. boeoticum acc. pau5088. Analysis of powdery mildew infection and molecular marker data of the RIL population revealed that both powdery mildew resistance genes are located on the long arm of chromosome 7A. Mapping was conducted using an integrated linkage map of 7A consisting of SSR, RFLP, STS, and DArT markers. These powdery mildew resistance genes are tentatively designated as PmTb7A.1 and PmTb7A.2. The PmTb7A.2 is closely linked to STS markers MAG2185 and MAG1759 derived from RFLP probes which are linked to powdery mildew resistance gene Pm1. This indicated that PmTb7A.2 might be allelic to Pm1. The PmTb7A.1, flanked by a DArT marker wPt4553 and an SSR marker Xcfa2019 in a 4.3 cM interval, maps proximal to PmT7A.2. PmTb7A.1 is putatively a new powdery mildew resistance gene. The powdery mildew resistance genes from T. boeoticum are currently being transferred to cultivated wheat background through marker-assisted backcrossing, using T. durum as bridging species.

  3. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  4. Discovery of Putative Herbicide Resistance Genes and Its Regulatory Network in Chickpea Using Transcriptome Sequencing

    Directory of Open Access Journals (Sweden)

    Mir A. Iquebal

    2017-06-01

    Full Text Available Background: Chickpea (Cicer arietinum L. contributes 75% of total pulse production. Being cheaper than animal protein, makes it important in dietary requirement of developing countries. Weed not only competes with chickpea resulting into drastic yield reduction but also creates problem of harboring fungi, bacterial diseases and insect pests. Chemical approach having new herbicide discovery has constraint of limited lead molecule options, statutory regulations and environmental clearance. Through genetic approach, transgenic herbicide tolerant crop has given successful result but led to serious concern over ecological safety thus non-transgenic approach like marker assisted selection is desirable. Since large variability in tolerance limit of herbicide already exists in chickpea varieties, thus the genes offering herbicide tolerance can be introgressed in variety improvement programme. Transcriptome studies can discover such associated key genes with herbicide tolerance in chickpea.Results: This is first transcriptomic studies of chickpea or even any legume crop using two herbicide susceptible and tolerant genotypes exposed to imidazoline (Imazethapyr. Approximately 90 million paired-end reads generated from four samples were processed and assembled into 30,803 contigs using reference based assembly. We report 6,310 differentially expressed genes (DEGs, of which 3,037 were regulated by 980 miRNAs, 1,528 transcription factors associated with 897 DEGs, 47 Hub proteins, 3,540 putative Simple Sequence Repeat-Functional Domain Marker (SSR-FDM, 13,778 genic Single Nucleotide Polymorphism (SNP putative markers and 1,174 Indels. Randomly selected 20 DEGs were validated using qPCR. Pathway analysis suggested that xenobiotic degradation related gene, glutathione S-transferase (GST were only up-regulated in presence of herbicide. Down-regulation of DNA replication genes and up-regulation of abscisic acid pathway genes were observed. Study further reveals

  5. Antimicrobial Chemicals Are Associated with Elevated Antibiotic Resistance Genes in the Indoor Dust Microbiome.

    Science.gov (United States)

    Hartmann, Erica M; Hickey, Roxana; Hsu, Tiffany; Betancourt Román, Clarisse M; Chen, Jing; Schwager, Randall; Kline, Jeff; Brown, G Z; Halden, Rolf U; Huttenhower, Curtis; Green, Jessica L

    2016-09-20

    Antibiotic resistance is increasingly widespread, largely due to human influence. Here, we explore the relationship between antibiotic resistance genes and the antimicrobial chemicals triclosan, triclocarban, and methyl-, ethyl-, propyl-, and butylparaben in the dust microbiome. Dust samples from a mixed-use athletic and educational facility were subjected to microbial and chemical analyses using a combination of 16S rRNA amplicon sequencing, shotgun metagenome sequencing, and liquid chromatography tandem mass spectrometry. The dust resistome was characterized by identifying antibiotic resistance genes annotated in the Comprehensive Antibiotic Resistance Database (CARD) from the metagenomes of each sample using the Short, Better Representative Extract Data set (ShortBRED). The three most highly abundant antibiotic resistance genes were tet(W), blaSRT-1, and erm(B). The complete dust resistome was then compared against the measured concentrations of antimicrobial chemicals, which for triclosan ranged from 0.5 to 1970 ng/g dust. We observed six significant positive associations between the concentration of an antimicrobial chemical and the relative abundance of an antibiotic resistance gene, including one between the ubiquitous antimicrobial triclosan and erm(X), a 23S rRNA methyltransferase implicated in resistance to several antibiotics. This study is the first to look for an association between antibiotic resistance genes and antimicrobial chemicals in dust.

  6. Comparison of antimicrobial resistant genes in chicken gut microbiome grown on organic and conventional diet

    Directory of Open Access Journals (Sweden)

    Narasimha V. Hegde

    2016-12-01

    Full Text Available Antibiotics are widely used in chicken production for therapeutic purposes, disease prevention and growth promotion, and this may select for drug resistant microorganisms known to spread to humans through consumption of contaminated food. Raising chickens on an organic feed regimen, without the use of antibiotics, is increasingly popular with the consumers. In order to determine the effects of diet regimen on antibiotic resistant genes in the gut microbiome, we analyzed the phylotypes and identified the antimicrobial resistant genes in chicken, grown under conventional and organic dietary regimens. Phylotypes were analyzed from DNA extracted from fecal samples from chickens grown under these dietary conditions. While gut microbiota of chicken raised in both conventional and organic diet exhibited the presence of DNA from members of Proteobacteria and Bacteroidetes, organic diet favored the growth of members of Fusobacteria. Antimicrobial resistance genes were identified from metagenomic libraries following cloning and sequencing of DNA fragments from fecal samples and selecting for the resistant clones (n=340 on media containing different concentrations of eight antibiotics. The antimicrobial resistant genes exhibited diversity in their host distribution among the microbial population and expressed more in samples from chicken grown on a conventional diet at higher concentrations of certain antimicrobials than samples from chicken grown on organic diet. Further studies will elucidate if this phenomena is widespread and whether the antimicrobial resistance is indeed modulated by diet. This may potentially assist in defining strategies for intervention to reduce the prevalence and dissemination of antibiotic resistance genes in the production environment.

  7. Genetic mapping of a major dominant gene for resistance to Ralstonia solanacearum in eggplant.

    Science.gov (United States)

    Lebeau, A; Gouy, M; Daunay, M C; Wicker, E; Chiroleu, F; Prior, P; Frary, A; Dintinger, J

    2013-01-01

    Resistance of eggplant against Ralstonia solanacearum phylotype I strains was assessed in a F(6) population of recombinant inbred lines (RILs) derived from a intra-specific cross between S. melongena MM738 (susceptible) and AG91-25 (resistant). Resistance traits were determined as disease score, percentage of wilted plants, and stem-based bacterial colonization index, as assessed in greenhouse experiments conducted in Réunion Island, France. The AG91-25 resistance was highly efficient toward strains CMR134, PSS366 and GMI1000, but only partial toward the highly virulent strain PSS4. The partial resistance found against PSS4 was overcome under high inoculation pressure, with heritability estimates from 0.28 to 0.53, depending on the traits and season. A genetic map was built with 119 AFLP, SSR and SRAP markers positioned on 18 linkage groups (LG), for a total length of 884 cM, and used for quantitative trait loci (QTL) analysis. A major dominant gene, named ERs1, controlled the resistance to strains CMR134, PSS366, and GMI1000. Against strain PSS4, this gene was not detected, but a significant QTL involved in delay of disease progress was detected on another LG. The possible use of the major resistance gene ERs1 in marker-assisted selection and the prospects offered for academic studies of a possible gene for gene system controlling resistance to bacterial wilt in solanaceous plants are discussed.

  8. Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

    Directory of Open Access Journals (Sweden)

    Jason Gioia

    Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

  9. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  10. Overexpression of multiple detoxification genes in deltamethrin resistant Laodelphax striatellus (Hemiptera: Delphacidae in China.

    Directory of Open Access Journals (Sweden)

    Lu Xu

    Full Text Available BACKGROUND: The small brown planthopper (SBPH, Laodelphax striatellus (Fallén, is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. METHODOLOGY/PRINCIPAL FINDINGS: Deltamethrin resistant strains of SBPH (JH-del were derived from a field population by continuously selections (up to 30 generations in the laboratory, while a susceptible strain (JHS was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold in JH-del strains (G4 and G30 when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3-IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. CONCLUSION/SIGNIFICANCE: As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to

  11. Evaluation of Bt Corn with Pyramided Genes on Efficacy and Insect Resistance Management for the Asian Corn Borer in China.

    Directory of Open Access Journals (Sweden)

    Fan Jiang

    Full Text Available A Bt corn hybrid (AcIe with two Bt genes (cry1Ie and cry1Ac was derived by breeding stack from line expressing Cry1Ie and a line expressing Cry1Ac. Efficacy of this pyramided Bt corn hybrid against the Asian corn borer (ACB, Ostrinia furnacalis, was evaluated. We conducted laboratory bioassays using susceptible and resistant ACB strains fed on artificial diet or fresh plant tissues. We also conducted field trials with artificial infestations of ACB neonates at the V6 and silk stages. The toxin-diet bioassay data indicated that mixtures of Cry1Ac and Cry1Ie proteins had synergistic insecticidal efficacy. The plant tissue bioassay data indicated that Bt corn hybrids expressing either a single toxin (Cry1Ac or Cry1Ie or two toxins had high efficacy against susceptible ACB. Damage ratings in the field trials indicated that the Bt corn hybrids could effectively protect against 1st and the 2nd generation ACB in China. The hybrid line with two Bt genes showed a higher efficacy against ACB larvae resistant to Cry1Ac or CryIe than the hybrid containing one Bt gene, and the two gene hybrid would have increased potential for managing or delaying the evolution of ACB resistance to Bt corn plants.

  12. Evaluation of Bt Corn with Pyramided Genes on Efficacy and Insect Resistance Management for the Asian Corn Borer in China.

    Science.gov (United States)

    Jiang, Fan; Zhang, Tiantao; Bai, Shuxiong; Wang, Zhenying; He, Kanglai

    2016-01-01

    A Bt corn hybrid (AcIe) with two Bt genes (cry1Ie and cry1Ac) was derived by breeding stack from line expressing Cry1Ie and a line expressing Cry1Ac. Efficacy of this pyramided Bt corn hybrid against the Asian corn borer (ACB), Ostrinia furnacalis, was evaluated. We conducted laboratory bioassays using susceptible and resistant ACB strains fed on artificial diet or fresh plant tissues. We also conducted field trials with artificial infestations of ACB neonates at the V6 and silk stages. The toxin-diet bioassay data indicated that mixtures of Cry1Ac and Cry1Ie proteins had synergistic insecticidal efficacy. The plant tissue bioassay data indicated that Bt corn hybrids expressing either a single toxin (Cry1Ac or Cry1Ie) or two toxins had high efficacy against susceptible ACB. Damage ratings in the field trials indicated that the Bt corn hybrids could effectively protect against 1st and the 2nd generation ACB in China. The hybrid line with two Bt genes showed a higher efficacy against ACB larvae resistant to Cry1Ac or CryIe than the hybrid containing one Bt gene, and the two gene hybrid would have increased potential for managing or delaying the evolution of ACB resistance to Bt corn plants.

  13. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  14. [Analysis of resistant genes of beta-lactam antibiotics from Pseudomonas aeruginosa in pediatric patients].

    Science.gov (United States)

    Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang

    2008-11-18

    To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.

  15. An eight-year study of Shigella species in Beijing, China: serodiversity, virulence genes, and antimicrobial resistance.

    Science.gov (United States)

    Qu, Mei; Zhang, Xin; Liu, Guirong; Huang, Ying; Jia, Lei; Liang, Weili; Li, Xitai; Wu, Xiaona; Li, Jie; Yan, Hanqiu; Kan, Biao; Wang, Quanyi

    2014-07-14

    This study was conducted to determine the prevalence of serotypes, virulence factors, and antimicrobial resistance patterns of Shigella spp. in Beijing, China, from 2004 to 2011. Real-time PCR assays were used to detect virulent genes, and the Kirby-Bauer disk diffusion method was used to evaluate antimicrobial resistance. Among the total of 1,652 Shigella isolates, S. sonnei (57.1%) was the predominant species, followed by S. flexneri (42.3%), S. dysenteriae (0.4%), and S. boydii (0.2%). Nineteen serotypes were discovered among S. flexneri strains. The virulence gene ipaH was the most frequent, followed by sen and set. The presence of set showed significant difference in two dominant serogroups, S. flexneri and S. sonnei. Over 90% of Shigella isolates showed resistance to at least three drugs with widened spectrum. High-level antimicrobial resistance to single and multiple antibiotics was more common among S. sonnei than S. flexneri. There was an obvious serotype change and a dramatic increase of antibiotic resistance in Shigella prevalence in Beijing.

  16. Tetracycline resistance genes persist in soil amended with cattle feces independently from chlortetracycline selection pressure

    NARCIS (Netherlands)

    Kyselkova, Martina; Kotrbova, Lucie; Bhumibhamon, Gamonsiri; Chronakova, Alica; Jirout, Jiri; Vrchotova, Nadezda; Schmitt, Heike; Elhottova, Dana

    Antibiotic residues and antibiotic resistance genes originating from animal waste represent environmental pollutants with possible human health consequences. In this study, we addressed the question whether chlortetracycline (CTC) residues in soils can act as selective pressure enhancing the

  17. Studies to identify genes and their expression for resistance to blast ...

    African Journals Online (AJOL)

    aps

    2013-06-26

    Jun 26, 2013 ... INTRODUCTION. Rice (Oryza sativa L.) is the staple food for more than ... disease under induced artificial epiphytotic conditions at SVP. University farm .... resistance is under the control of several additive genes having small ...

  18. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  19. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

    2016-01-01

    to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  20. Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

    Science.gov (United States)

    Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

    2015-05-01

    Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Characterisation of ALS genes in the polyploid species Schoenoplectus mucronatus and implications for resistance management.

    Science.gov (United States)

    Scarabel, Laura; Locascio, Antonella; Furini, Antonella; Sattin, Maurizio; Varotto, Serena

    2010-03-01

    The polyploid weed Schoenoplectus mucronatus (L.) Palla has evolved target-site resistance to ALS-inhibiting herbicides in Italian rice crops. Molecular and genetic characterisation of the resistance mechanism is relevant to the evolution and management of herbicide resistance. The authors aimed (a) to study the organisation of the target-site loci in two field-selected S. mucronatus populations with different cross-resistance patterns, (b) to identify the mutations endowing resistance to ALS inhibitors and determine the role of these mutations by using transgenesis and (c) to analyse the implications for the management of the S. mucronatus populations. Two complete ALS genes (ALS1 and ALS2) having an intron and a third partial intronless ALS gene (ALS3) were identified. The presence of multiple ALS genes was confirmed by Southern blot analyses, and ALS loci were characterised by examining cytosine methylation. In S. mucronatus leaves, the transcripts of ALS1, ALS2 and ALS3 were detected. Two mutations endowing resistance (Pro(197) to His and Trp(574) to Leu) were found in both resistant populations, but at different frequencies. Tobacco plants transformed with the two resistant alleles indicated that the Pro(197)-to-His substitution conferred resistance to SU and TP herbicides, while the allele with the Trp(574)-to-Leu substitution conferred cross-resistance to SU, TP, IMI and PTB herbicides. Schoenoplectus mucronatus has multiple ALS genes characterised by methylated sites that can influence the expression profile. The two mutated alleles proved to be responsible for ALS resistance. At population level, the resistance pattern depends on the frequency of various resistant genotypes, and this influences the efficacy of various ALS-inhibiting herbicides.

  2. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

  3. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics

    Science.gov (United States)

    Berglund, Björn

    2015-01-01

    Antibiotic resistance is a growing problem which threatens modern healthcare globally. Resistance has traditionally been viewed as a clinical problem, but recently non-clinical environments have been highlighted as an important factor in the dissemination of antibiotic resistance genes (ARGs). Horizontal gene transfer (HGT) events are likely to be common in aquatic environments; integrons in particular are well suited for mediating environmental dissemination of ARGs. A growing body of evidence suggests that ARGs are ubiquitous in natural environments. Particularly, elevated levels of ARGs and integrons in aquatic environments are correlated to proximity to anthropogenic activities. The source of this increase is likely to be routine discharge of antibiotics and resistance genes, for example, via wastewater or run-off from livestock facilities and agriculture. While very high levels of antibiotic contamination are likely to select for resistant bacteria directly, the role of sub-inhibitory concentrations of antibiotics in environmental antibiotic resistance dissemination remains unclear. In vitro studies have shown that low levels of antibiotics can select for resistant mutants and also facilitate HGT, indicating the need for caution. Overall, it is becoming increasingly clear that the environment plays an important role in dissemination of antibiotic resistance; further studies are needed to elucidate key aspects of this process. Importantly, the levels of environmental antibiotic contamination at which resistant bacteria are selected for and HGT is facilitated at should be determined. This would enable better risk analyses and facilitate measures for preventing dissemination and development of antibiotic resistance in the environment. PMID:26356096

  4. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González

    2017-11-01

    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  5. Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

    Science.gov (United States)

    Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

    2018-01-01

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

  6. Gene Profiling in Late Blight Resistance in Potato Genotype SD20

    Directory of Open Access Journals (Sweden)

    Xiaohui Yang

    2018-06-01

    Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

  7. Discovery and introgression of the wild sunflower-derived novel downy mildew resistance gene Pl 19 in confection sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Zhang, Z W; Ma, G J; Zhao, J; Markell, S G; Qi, L L

    2017-01-01

    A new downy mildew resistance gene, Pl 19 , was identified from wild Helianthus annuus accession PI 435414, introduced to confection sunflower, and genetically mapped to linkage group 4 of the sunflower genome. Wild Helianthus annuus accession PI 435414 exhibited resistance to downy mildew, which is one of the most destructive diseases to sunflower production globally. Evaluation of the 140 BC 1 F 2:3 families derived from the cross of CMS CONFSCLB1 and PI 435414 against Plasmopara halstedii race 734 revealed that a single dominant gene controls downy mildew resistance in the population. Bulked segregant analysis conducted in the BC 1 F 2 population with 860 simple sequence repeat (SSR) markers indicated that the resistance derived from wild H. annuus was associated with SSR markers located on linkage group (LG) 4 of the sunflower genome. To map and tag this resistance locus, designated Pl 19 , 140 BC 1 F 2 individuals were used to construct a linkage map of the gene region. Two SSR markers, ORS963 and HT298, were linked to Pl 19 within a distance of 4.7 cM. After screening 27 additional single nucleotide polymorphism (SNP) markers previously mapped to this region, two flanking SNP markers, NSA_003564 and NSA_006089, were identified as surrounding the Pl 19 gene at a distance of 0.6 cM from each side. Genetic analysis indicated that Pl 19 is different from Pl 17 , which had previously been mapped to LG4, but is closely linked to Pl 17 . This new gene is highly effective against the most predominant and virulent races of P. halstedii currently identified in North America and is the first downy mildew resistance gene that has been transferred to confection sunflower. The selected resistant germplasm derived from homozygous BC 2 F 3 progeny provides a novel gene for use in confection sunflower breeding programs.

  8. Does human activity impact the natural antibiotic resistance background? Abundance of antibiotic resistance genes in 21 Swiss lakes.

    Science.gov (United States)

    Czekalski, Nadine; Sigdel, Radhika; Birtel, Julia; Matthews, Blake; Bürgmann, Helmut

    2015-08-01

    Antibiotic resistance genes (ARGs) are emerging environmental contaminants, known to be continuously discharged into the aquatic environment via human and animal waste. Freshwater aquatic environments represent potential reservoirs for ARG and potentially allow sewage-derived ARG to persist and spread in the environment. This may create increased opportunities for an eventual contact with, and gene transfer to, human and animal pathogens via the food chain or drinking water. However, assessment of this risk requires a better understanding of the level and variability of the natural resistance background and the extent of the human impact. We have analyzed water samples from 21 Swiss lakes, taken at sampling points that were not under the direct influence of local contamination sources and analyzed the relative abundance of ARG using quantitative real-time PCR. Copy numbers of genes mediating resistance to three different broad-spectrum antibiotic classes (sulfonamides: sul1, sul2, tetracyclines: tet(B), tet(M), tet(W) and fluoroquinolones: qnrA) were normalized to copy numbers of bacterial 16S rRNA genes. We used multiple linear regression to assess if ARG abundance is related to human activities in the catchment, microbial community composition and the eutrophication status of the lakes. Sul genes were detected in all sampled lakes, whereas only four lakes contained quantifiable numbers of tet genes, and qnrA remained below detection in all lakes. Our data indicate higher abundance of sul1 in lakes with increasing number and capacity of wastewater treatment plants (WWTPs) in the catchment. sul2 abundance was rather related to long water residence times and eutrophication status. Our study demonstrates the potential of freshwater lakes to preserve antibiotic resistance genes, and provides a reference for ARG abundance from lake systems with low human impact as a baseline for assessing ARG contamination in lake water. Copyright © 2015 Elsevier Ltd. All rights

  9. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

    Science.gov (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

    2003-01-01

    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  10. Gene Expression Contributes to the Recent Evolution of Host Resistance in a Model Host Parasite System

    Directory of Open Access Journals (Sweden)

    Brian K. Lohman

    2017-09-01

    Full Text Available Heritable population differences in immune gene expression following infection can reveal mechanisms of host immune evolution. We compared gene expression in infected and uninfected threespine stickleback (Gasterosteus aculeatus from two natural populations that differ in resistance to a native cestode parasite, Schistocephalus solidus. Genes in both the innate and adaptive immune system were differentially expressed as a function of host population, infection status, and their interaction. These genes were enriched for loci controlling immune functions known to differ between host populations or in response to infection. Coexpression network analysis identified two distinct processes contributing to resistance: parasite survival and suppression of growth. Comparing networks between populations showed resistant fish have a dynamic expression profile while susceptible fish are static. In summary, recent evolutionary divergence between two vertebrate populations has generated population-specific gene expression responses to parasite infection, affecting parasite establishment and growth.

  11. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  12. Genome wide single cell analysis of chemotherapy resistant metastatic cells in a case of gastroesophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Hjortland, Geir Olav; Fodstad, Oystein; Smeland, Sigbjorn; Hovig, Eivind; Meza-Zepeda, Leonardo A; Beiske, Klaus; Ree, Anne H; Tveito, Siri; Hoifodt, Hanne; Bohler, Per J; Hole, Knut H; Myklebost, Ola

    2011-01-01

    Metastatic progression due to development or enrichment of therapy-resistant tumor cells is eventually lethal. Molecular characterization of such chemotherapy resistant tumor cell clones may identify markers responsible for malignant progression and potential targets for new treatment. Here, in a case of stage IV adenocarcinoma of the gastroesophageal junction, we report the successful genome wide analysis using array comparative genomic hybridization (CGH) of DNA from only fourteen tumor cells using a bead-based single cell selection method from a bone metastasis progressing during chemotherapy. In a case of metastatic adenocarcinoma of the gastroesophageal junction, the progression of bone metastasis was observed during a chemotherapy regimen of epirubicin, oxaliplatin and capecitabine, whereas lung-, liver and lymph node metastases as well as the primary tumor were regressing. A bone marrow aspirate sampled at the site of progressing metastasis in the right iliac bone was performed, and single cell molecular analysis using array-CGH of Epithelial Specific Antigen (ESA)-positive metastatic cells, and revealed two distinct regions of amplification, 12p12.1 and 17q12-q21.2 amplicons, containing the KRAS (12p) and ERBB2 (HER2/NEU) (17q) oncogenes. Further intrapatient tumor heterogeneity of these highlighted gene copy number changes was analyzed by fluorescence in situ hybridization (FISH) in all available primary and metastatic tumor biopsies, and ErbB2 protein expression was investigated by immunohistochemistry. ERBB2 was heterogeneously amplified by FISH analysis in the primary tumor, as well as liver and bone metastasis, but homogenously amplified in biopsy specimens from a progressing bone metastasis after three initial cycles of chemotherapy, indicating a possible enrichment of erbB2 positive tumor cells in the progressing bone marrow metastasis during chemotherapy. A similar amplification profile was detected for wild-type KRAS, although more heterogeneously

  13. Magnon contribution to electrical resistance of gadolinium-dysprosium alloy single crystals

    International Nuclear Information System (INIS)

    Nikitin, S.A.; Slobodchikov, S.S.; Solomkin, I.K.

    1978-01-01

    The magnon, phonon and interelectron collision contributions to the electric resistance of single crystals of gadolinium-dysprosium alloys were quantified. A relationship was found to exist between the electric resistance and the variation of the topology of the Fermi surface on melting of gadolinium with dysprosium. It was found that gadolinium-dysprosium alloys, which have no helicoidal magnetic structure in magnetically ordered state, feature a spin-spin helicoidal-type correlations in the paramagnetic field

  14. Performance of low-resistivity single and dual-gap RPCs for LHCb

    CERN Document Server

    Adinolfi, M; Messi, R; Pacciani, L; Paoluzi, L; Santovetti, E

    2000-01-01

    Resistive plate chambers (RPC) are strong candidates for the outer regions of the LHCb muon detector. We have tested single-gap and dual-gap detectors built with low-resistivity phenolic plates ( rho =9*10/sup 9/ Omega cm) and operated in avalanche mode. Measurements have been performed over a wide range of beam intensities and on the GIF at CERN. The results are presented and discussed, with special emphasis on the detection efficiency. (6 refs).

  15. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges

    Science.gov (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  16. Deep sequence analysis reveals the ovine rumen as a reservoir of antibiotic resistance genes.

    Science.gov (United States)

    Hitch, Thomas C A; Thomas, Ben J; Friedersdorff, Jessica C A; Ougham, Helen; Creevey, Christopher J

    2018-04-01

    Antibiotic resistance is an increasingly important environmental pollutant with direct consequences for human health. Identification of environmental sources of antibiotic resistance genes (ARGs) makes it possible to follow their evolution and prevent their entry into the clinical setting. ARGs have been found in environmental sources exogenous to the original source and previous studies have shown that these genes are capable of being transferred from livestock to humans. Due to the nature of farming and the slaughter of ruminants for food, humans interact with these animals in close proximity, and for this reason it is important to consider the risks to human health. In this study, we characterised the ARG populations in the ovine rumen, termed the resistome. This was done using the Comprehensive Antibiotic Resistance Database (CARD) to identify the presence of genes conferring resistance to antibiotics within the rumen. Genes were successfully mapped to those that confer resistance to a total of 30 different antibiotics. Daptomycin was identified as the most common antibiotic for which resistance is present, suggesting that ruminants may be a source of daptomycin ARGs. Colistin resistance, conferred by the gene pmrE, was also found to be present within all samples, with an average abundance of 800 counts. Due to the high abundance of some ARGs (against daptomycin) and the presence of rare ARGs (against colistin), we suggest further study and monitoring of the rumen resistome as a possible source of clinically relevant ARGs. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Does Nilaparvata lugens gain tolerance to rice resistance genes through conspecifics at shared feeding sites?

    NARCIS (Netherlands)

    Ferrater, Jedeliza B.; Horgan, Finbarr G.

    2016-01-01

    This study examines the possibility of horizontal and vertical transmission of virulence (the ability to tolerate a given resistant plant or resistance gene) between individuals from brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae), populations with distinct feeding abilities

  18. Inheritance and molecular mapping of anthracnose resistance genes present in sorghum line SC112-14

    Science.gov (United States)

    Anthracnose (Colletotrichum sublineolum) is one of the most destructive diseases of sorghum (Sorghum bicolor L. Moench) affecting all aerial tissues of the plant. The most effective strategy for its control is the incorporation of resistance genes. Therefore, the anthracnose resistance response pr...

  19. Mutations in rpoB and katG genes of multidrug resistant ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

  20. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

    NARCIS (Netherlands)

    Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.

    2014-01-01

    Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three

  1. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

    Science.gov (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

    2001-01-01

    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  2. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  3. Detection and characterisation of genes encoding antibiotic resistance in the cultivable oral microflora.

    OpenAIRE

    Villedieu, A.

    2006-01-01

    The emergence of antibiotic-resistant bacteria has become a major threat to public health. The increased use of antibiotics has selected for the dissemination of antibiotic resistance genes between organisms from different species and different genera. There is a large body of evidence that the indigenous microbiota can act as a reservoir of antibiotic-resistant bacteria. However little is known about the molecular basis for this in bacteria from the oral cavity. Therefore the aim of this wor...

  4. Fate of antibiotic resistance genes within the microbial communities of three waste water treatment plants

    OpenAIRE

    Di Cesare, Andrea; Eckert, Ester; D'Urso, Silvia; Doppelbauer, Julia; Corno, Gianluca

    2016-01-01

    Although Waste Water Treatment Plant (WWTP) are designed to reduce the biological pollution of urban waters, they lack a specific action against antibiotic resistance bacteria (ARB) or antibiotic resistance genes (ARGs). Nowadays, it is well documented that WWTPs constitute a reservoir of antibiotic resistances and, in some cases, they can be a favorable environment for the selection of ARB. This represent a serious concern for the public health, because the effluents of the WWTPs can be reus...

  5. Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

    OpenAIRE

    Zhang Ping; Zhang Zhiyuan; Zhou Xiaojian; Qiu Weiliu; Chen Fangan; Chen Wantao

    2006-01-01

    Abstract Background Cisplatin is widely used for chemotherapy of head and neck squamous cell carcinoma. However, details of the molecular mechanism responsible for cisplatin resistance are still unclear. The aim of this study was to identify the expression of genes related to cisplatin resistance in oral squamous cell carcinoma cells. Methods A cisplatin-resistant cell line, Tca/cisplatin, was established from a cisplatin-sensitive cell line, Tca8113, which was derived from moderately-differe...

  6. Bias voltage induced resistance switching effect in single-molecule magnets' tunneling junction.

    Science.gov (United States)

    Zhang, Zhengzhong; Jiang, Liang

    2014-09-12

    An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be 'read out' by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

  7. Bias voltage induced resistance switching effect in single-molecule magnets’ tunneling junction

    Science.gov (United States)

    Zhang, Zhengzhong; Jiang, Liang

    2014-09-01

    An electric-pulse-induced reversible resistance change effect in a molecular magnetic tunneling junction, consisting of a single-molecule magnet (SMM) sandwiched in one nonmagnetic and one ferromagnetic electrode, is theoretically investigated. By applying a time-varying bias voltage, the SMM's spin orientation can be manipulated with large bias voltage pulses. Moreover, the different magnetic configuration at high-resistance/low-resistance states can be ‘read out’ by utilizing relative low bias voltage. This device scheme can be implemented with current technologies (Khajetoorians et al 2013 Science 339 55) and has potential application in molecular spintronics and high-density nonvolatile memory devices.

  8. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  9. Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

    DEFF Research Database (Denmark)

    Guardabassi, L.; Christensen, H.; Hasman, Henrik

    2004-01-01

    Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

  10. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  11. Isolation and characterization of resistant gene analogs in cassava ...

    African Journals Online (AJOL)

    These candidate sequences mapped to the draft cassava genome with high sequence similarity to predicted NBS-LRR genes. These novel sequences may serve as a stepping stone for further characterization and experimental validation of predicted R genes in the draft cassava genome, ultimately leading to the ...

  12. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  13. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    the wheat production in Asia, North America, Europe and other wheat growing areas. China is the largest ..... A history of wheat breeding. ... and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260.

  14. EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

    Science.gov (United States)

    Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  16. Association between antimicrobial resistance and virulence genes in Escherichia coli obtained from blood and faeces

    DEFF Research Database (Denmark)

    Bagger-Skjøt, Line; Sandvang, Dorthe; Frimodt-Møller, Niels

    2007-01-01

    Escherichia coli isolates obtained from faeces (n = 85) and blood (n = 123) were susceptibility tested against 17 antimicrobial agents and the presence of 9 virulence genes was determined by PCR. Positive associations between several antimicrobial resistances and 2 VF genes (iutA and traT) were...

  17. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Science.gov (United States)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  18. Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

    Science.gov (United States)

    Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

    2017-08-01

    This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

  19. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  20. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)

    2013-08-06

    Aug 6, 2013 ... Institute of Plant Protection, Chinese Academy of Agriculture Science, No 2, West ... The molecular marker Xbarc59 closely linked to the gene YrSD could be ... and a minor resistance gene postulated in it (Calonnec et al.

  1. Position on mouse chromosome 1 of a gene that controls resistance to Salmonella typhimurium.

    Science.gov (United States)

    Taylor, B A; O'Brien, A D

    1982-06-01

    Ity is a gene which regulates the magnitude of Salmonella typhimurium growth in murine tissues and, hence, the innate salmonella resistance of mice. The results of a five-point backcross clearly showed that the correct gene order on chromosome 1 is fz-Idh-1-Ity-ln-Pep-3.

  2. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  3. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  4. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population.

    Science.gov (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

    2016-06-02

    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Pooled Enrichment Sequencing Identifies Diversity and Evolutionary Pressures at NLR Resistance Genes within a Wild Tomato Population

    Science.gov (United States)

    Stam, Remco; Scheikl, Daniela; Tellier, Aurélien

    2016-01-01

    Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991

  6. Patterns of resistance and transgression in Eastern Indonesia: single women's practices of clandestine courtship and cohabitation.

    Science.gov (United States)

    Bennett, Linda Rae

    2005-03-01

    This paper explores how single women in the regional Indonesian city of Mataram express sexual desire in a social, cultural and political climate that idealizes the confinement of female sexuality within marriage. It is based on 21 months of ethnographic fieldwork conducted with single women, their families and health care providers. Success for young women in negotiating sexual desire is dependent upon their ability to maintain a faultless public reputation and mediate between their desires and those of men. Many single women find ways to pursue their desires by bending the rules of courtship conventions, performing sexual purity in public, while resisting from within the hegemonic sexual culture. However, women who visibly transgress dominant sexual ideals (and in doing so offend the status quo) are stigmatized and ostracized. Single women's practice of resistance and sexual transgression in premarital relationships are represented using the examples of pacaran backstreet (clandestine courtship) and cohabitation prior to marriage.

  7. Galactosemia, a single gene disorder with epigenetic consequences.

    LENUS (Irish Health Repository)

    Coman, David J

    2010-03-01

    Long-term outcomes of classic galactosemia (GAL) remain disappointing. It is unclear if the complications result mainly from prenatal-neonatal toxicity or persistent glycoprotein and glycolipid synthesis abnormalities. We performed gene expression profiling (T transcriptome) to characterize key-altered genes and gene clusters of four patients with GAL with variable outcomes maintained on a galactose-restricted diet, compared with controls. Significant perturbations of multiple cell signaling pathways were observed including mitogen-activated protein kinase (MAPK) signaling, regulation of the actin cytoskeleton, focal adhesion, and ubiquitin mediated proteolysis. A number of genes significantly altered were further investigated in the GAL cohort including SPARC (osteonectin) and S100A8 (S100 calcium-binding protein). The whole serum N-glycan profile and IgG glycosylation status of 10 treated patients with GAL were compared with healthy control serum and IgG using a quantitative high-throughput analytical HPLC platform. Increased levels of agalactosylated and monogalactosylated structures and decreases in certain digalactosylated structures were identified in the patients. The persistent abnormal glycosylation of serum glycoproteins seen with the microarray data indicates persisting metabolic dyshomeostasis and gene dysregulation in "treated" GAL. Strict restriction of dietary galactose is clearly life saving in the neonatal period; long-term severe galactose restriction may contribute to ongoing systemic abnormalities.

  8. Association between selected antimicrobial resistance genes and antimicrobial exposure in Danish pig farms

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Hisham Beshara Halasa, Tariq; Græsbøll, Kaare

    2017-01-01

    Bacterial antimicrobial resistance (AMR) in pigs is an important public health concern due to its possible transfer to humans. We aimed at quantifying the relationship between the lifetime exposure of antimicrobials and seven antimicrobial resistance genes in Danish slaughter pig farms. AMR gene...... levels were quantified by qPCR of total-community DNA in faecal samples obtained from 681 batches of slaughter pigs. The lifetime exposure to antimicrobials was estimated at batch level for the piglet, weaner, and finisher periods individually for the sampled batches. We showed that the effect...... of antimicrobial exposure on the levels of AMR genes was complex and unique for each individual gene. Several antimicrobial classes had both negative and positive correlations with the AMR genes. From 10-42% of the variation in AMR gene levels could be explained in the final regression models, indicating...

  9. Antibiotic Resistance Genes and Correlations with Microbial Community and Metal Resistance Genes in Full-Scale Biogas Reactors As Revealed by Metagenomic Analysis

    DEFF Research Database (Denmark)

    Luo, Gang; Li, Bing; Li, Li-Guan

    2017-01-01

    resistance genes (MRGs). The total abundance of ARGs in all the samples varied from 7 × 10-3 to 1.08 × 10-1 copy of ARG/copy of 16S-rRNA gene, and the samples obtained from thermophilic biogas reactors had a lower total abundance of ARGs, indicating the superiority of thermophilic anaerobic digestion......Digested residues from biogas plants are often used as biofertilizers for agricultural crops cultivation. The antibiotic resistance genes (ARGs) in digested residues pose a high risk to public health due to their potential spread to the disease-causing microorganisms and thus reduce...... the susceptibility of disease-causing microorganisms to antibiotics in medical treatment. A high-throughput sequencing (HTS)-based metagenomic approach was used in the present study to investigate the variations of ARGs in full-scale biogas reactors and the correlations of ARGs with microbial communities and metal...

  10. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  11. Drosophila olfactory memory: single genes to complex neural circuits.

    Science.gov (United States)

    Keene, Alex C; Waddell, Scott

    2007-05-01

    A central goal of neuroscience is to understand how neural circuits encode memory and guide behaviour. Studying simple, genetically tractable organisms, such as Drosophila melanogaster, can illuminate principles of neural circuit organization and function. Early genetic dissection of D. melanogaster olfactory memory focused on individual genes and molecules. These molecular tags subsequently revealed key neural circuits for memory. Recent advances in genetic technology have allowed us to manipulate and observe activity in these circuits, and even individual neurons, in live animals. The studies have transformed D. melanogaster from a useful organism for gene discovery to an ideal model to understand neural circuit function in memory.

  12. Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China.

    Science.gov (United States)

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong

    2012-03-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

  13. GENE EXPRESSION DYNAMICS IN PATIENTS WITH SEVERE THERAPY-RESISTANT ASTHMA DURING TREATMENT PERIOD

    Directory of Open Access Journals (Sweden)

    Ye. S. Kulikov

    2014-01-01

    Full Text Available Introduction: The leading mechanisms and causes of severe therapy resistant asthma are poorly understood. The aim of this study was to define global patterns of gene expression in adults with severe therapy-resistant asthma in dynamic during treatment period.Methods: Performed 24-week prospective interventional study in parallel groups. Severe asthma patients was aposterior divided at therapy sensitive and resistant patients according to ATS criteria. Global transcriptome profile was characterized using the Affymetrix HuGene ST1.0 chip. Cluster analysis was performed.Results and conclusion: According to our data several mechanisms of therapy resistance may be considered: increased levels of nitric oxide and beta2-agonists nitration, dysregulation of endogenous steroids secretion and involvement in the pathogenesis of Staphylococcus aureus. Absence of suppression of gene expression KEGG-pathway “asthma" may reflect the low efficiency or long period of anti-inflammatory therapy effect realization.

  14. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients

    DEFF Research Database (Denmark)

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke

    2016-01-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven...... inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown...... in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying....

  15. Involvement of hepatic xenobiotic related genes in bromadiolone resistance in wild Norway rats, Rattus norvegicus (Berk.)

    DEFF Research Database (Denmark)

    Markussen, Mette Drude; Heiberg, Ann-Charlotte; Alsbo, Carsten

    2007-01-01

    To examine the role of xenobiotic relevant genes in bromadiolone resistance in wild Norway rats (Rattus norvegicus) we compared the constitutive liver gene expression and expression upon bromadiolone administration in bromadiolone resistant and anticoagulant susceptible female rats using a LNA...... expressed in resistant than susceptible rats upon bromadiolone exposure. To establish how bromadiolone affected xenobiotic gene expression in the two strains we compared bromadiolone expression profiles to saline profiles of both strains. Bromadiolone mediated significant up-regulation of Cyp2e1 and Cyp3a3...... expression in the resistant rats whereas the rodenticide conferred down-regulation of Cyp2e1, Cyp3a3 and Gpox1 and induction of Cyp2c12 expression in susceptible rats. Cyp2c13 and Cyp3a2 expression were markedly suppressed in both strains upon treatment. This suggests that xenobiotic relevant enzymes play...

  16. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  17. Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087

    Science.gov (United States)

    Ciric, Lena; Mullany, Peter; Roberts, Adam P.

    2011-01-01

    Objectives Tn916-like elements are one of the most common types of integrative and conjugative element (ICE). In this study we aimed to determine whether novel accessory genes, i.e. genes whose products are not involved in mobility or regulation, were present on a Tn916-like element (Tn6087) isolated from Streptococcus oralis from the human oral cavity. Methods A minocycline-resistant isolate was analysed using restriction fragment length polymorphism (RFLP) analysis on amplicons derived from Tn916 and DNA sequencing to determine whether there were genetic differences in Tn6087 compared with Tn916. Mutational analysis was used to determine whether the novel accessory gene found was responsible for an observed extra phenotype. Results A novel Tn916-like element, Tn6087, is described that encodes both antibiotic and antiseptic resistance. The antiseptic resistance protein is encoded by a novel small multidrug resistance gene, designated qrg, that was shown to encode resistance to cetyltrimethylammonium bromide (CTAB), also known as cetrimide bromide. Conclusions This is the first Tn916-like element described that confers both antibiotic and antiseptic resistance, suggesting that selection of either antibiotic or antiseptic resistance will also select for the other and further highlights the need for prudent use of both types of compound. PMID:21816764

  18. Detection of antibiotic resistance genes in samples from acute and chronic endodontic infections and after treatment.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2013-09-01

    The purpose of this study was twofold: survey samples from acute and chronic endodontic infections for the presence of genes encoding resistance to beta-lactams, tetracycline and erythromycin, and evaluate the ability of treatment to eliminate these genes from root canals. DNA extracts from samples of abscess aspirates (n=25) and root canals of teeth with asymptomatic apical periodontitis (n=24) were used as template for direct detection of the genes blaTEM, cfxA, tetM, tetQ, tetW, and ermC using real-time polymerase chain reaction (PCR). Bacterial presence was determined using PCR with universal bacterial primers. Root canals of the asymptomatic cases were also sampled and evaluated after chemomechanical procedures using NiTi instruments with 2.5% NaOCl irrigation. All abscess and initial root canal samples were positive for bacteria. At least one of the target resistance genes was found in 36% of the abscess samples and 67% of the asymptomatic cases. The most prevalent genes in abscesses were blaTEM (24%) and ermC (24%), while tetM (42%) and tetW (29%) prevailed in asymptomatic cases. The blaTEM gene was significantly associated with acute cases (p=0.02). Conversely, tetM was significantly more prevalent in asymptomatic cases (p=0.008). Treatment eliminated resistance genes from most cases. Acute and chronic endodontic infections harboured resistance genes for 3 classes of widely used antibiotics. In most cases, treatment was effective in eliminating these genes, but there were a few cases in which they persisted. The implications of persistence are unknown. Direct detection of resistance genes in abscesses may be a potential method for rapid diagnosis and establishment of proactive antimicrobial therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

    Science.gov (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

    2018-01-04

    The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Genetics and mapping of a novel downy mildew resistance gene, Pl(18), introgressed from wild Helianthus argophyllus into cultivated sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Foley, M E; Cai, X W; Gulya, T J

    2016-04-01

    A novel downy mildew resistance gene, Pl(18), was introgressed from wild Helianthus argophyllus into cultivated sunflower and genetically mapped to linkage group 2 of the sunflower genome. The new germplasm, HA-DM1, carrying Pl(18) has been released to the public. Sunflower downy mildew (DM) is considered to be the most destructive foliar disease that has spread to every major sunflower-growing country of the world, except Australia. A new dominant downy mildew resistance gene (Pl 18) transferred from wild Helianthus argophyllus (PI 494573) into cultivated sunflower was mapped to linkage group (LG) 2 of the sunflower genome using bulked segregant analysis with 869 simple sequence repeat (SSR) markers. Phenotyping 142 BC1F2:3 families derived from the cross of HA 89 and H. argophyllus confirmed the single gene inheritance of resistance. Since no other Pl gene has been mapped to LG2, this gene was novel and designated as Pl (18). SSR markers CRT214 and ORS203 flanked Pl(18) at a genetic distance of 1.1 and 0.4 cM, respectively. Forty-six single nucleotide polymorphism (SNP) markers that cover the Pl(18) region were surveyed for saturation mapping of the region. Six co-segregating SNP markers were 1.2 cM distal to Pl(18), and another four co-segregating SNP markers were 0.9 cM proximal to Pl(18). The new BC2F4-derived germplasm, HA-DM1, carrying Pl(18) has been released to the public. This new line is highly resistant to all Plasmopara halstedii races identified in the USA providing breeders with an effective new source of resistance against downy mildew in sunflower. The molecular markers that were developed will be especially useful in marker-assisted selection and pyramiding of Pl resistance genes because of their close proximity to the gene and the availability of high-throughput SNP detection assays.

  1. Allele mining in barley genetic resources reveals genes of race-nonspecific powdery mildew resistance

    Directory of Open Access Journals (Sweden)

    Annika eSpies

    2012-01-01

    Full Text Available Race-nonspecific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL and therefore difficult to handle in practice. Knowing the genes that underlie race-nonspecific resistance would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worlwide collection of spring barley accessions for candidate genes of race-nonspecific resistance to the powdery mildew fungus Blumeria graminis f.sp. hordei (Bgh and combined data with results from QTL-mapping- as well as functional-genomics approaches. This led to the idenfication of 11 associated genes with converging evidence for an important role in race-nonspecific resistance in the presence of the Mlo-gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches accelerates the discovery of genes underlying race-nonspecific resistance in barley and other crop plants.

  2. Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

    Directory of Open Access Journals (Sweden)

    Wan Hongjian

    2010-08-01

    Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

  3. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2014-08-11

    Aug 11, 2014 ... of chemical measures for the control and management of blast, which are not .... tion of genetic components of variation, epistasis model and gene effects in two .... and environmental variance is estimated from mean variance.

  4. Plasmid-Mediated Quinolone Resistance Genes in Escherichia coli ...

    African Journals Online (AJOL)

    Erah

    PMQR) genes and the prevalence of extended spectrum β-lactamase (ESBL) types in Escherichia coli clinical isolates. Methods: Sixty-one ESBL-producing urinary E. coli isolates were studied. An antibiotic susceptibility test was performed ...

  5. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Real-time polymerase chain reaction (PCR) showed that. CreV8 was expressed .... Two housekeeping genes (GAPDH and actin) were used as interior references for accuracy ..... Future world supply and demand. Loivoisier ...

  6. Association of single nucleotide polymorphisms in genes coding ...

    African Journals Online (AJOL)

    The insulin-like growth factor 1 system plays a central role in the growth and development of the mammary gland. Insulin-like growth factor 1 (IGF1) and insulin-like growth factor 1 receptor (IGF1R) have been proposed as candidate genes for milk production traits. This study involved a population of 163 Montbeliarde cows.

  7. Antimicrobial resistance and antimicrobial resistance genes in marine bacteria from salmon aquaculture and non-aquaculture sites.

    Science.gov (United States)

    Shah, Syed Q A; Cabello, Felipe C; L'abée-Lund, Trine M; Tomova, Alexandra; Godfrey, Henry P; Buschmann, Alejandro H; Sørum, Henning

    2014-05-01

    Antimicrobial resistance (AR) detected by disc diffusion and antimicrobial resistance genes detected by DNA hybridization and polymerase chain reaction with amplicon sequencing were studied in 124 marine bacterial isolates from a Chilean salmon aquaculture site and 76 from a site without aquaculture 8 km distant. Resistance to one or more antimicrobials was present in 81% of the isolates regardless of site. Resistance to tetracycline was most commonly encoded by tetA and tetG; to trimethoprim, by dfrA1, dfrA5 and dfrA12; to sulfamethizole, by sul1 and sul2; to amoxicillin, by blaTEM ; and to streptomycin, by strA-strB. Integron integrase intl1 was detected in 14 sul1-positive isolates, associated with aad9 gene cassettes in two from the aquaculture site. intl2 Integrase was only detected in three dfrA1-positive isolates from the aquaculture site and was not associated with gene cassettes in any. Of nine isolates tested for conjugation, two from the aquaculture site transferred AR determinants to Escherichia coli. High levels of AR in marine sediments from aquaculture and non-aquaculture sites suggest that dispersion of the large amounts of antimicrobials used in Chilean salmon aquaculture has created selective pressure in areas of the marine environment far removed from the initial site of use of these agents. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

    OpenAIRE

    Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

    2013-01-01

    The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high lev...

  9. A disulphide isomerase gene (PDI-V) from Haynaldia villosa contributes to powdery mildew resistance in common wheat.

    Science.gov (United States)

    Faheem, Muhammad; Li, Yingbo; Arshad, Muhammad; Jiangyue, Cheng; Jia, Zhao; Wang, Zongkuan; Xiao, Jin; Wang, Haiyan; Cao, Aizhong; Xing, Liping; Yu, Feifei; Zhang, Ruiqi; Xie, Qi; Wang, Xiue

    2016-04-13

    In this study, we report the contribution of a PDI-like gene from wheat wild relative Haynaldia villosa in combating powdery mildew. PDI-V protein contains two conserved thioredoxin (TRX) active domains (a and a') and an inactive domain (b). PDI-V interacted with E3 ligase CMPG1-V protein, which is a positive regulator of powdery mildew response. PDI-V was mono-ubiquitinated by CMPG1-V without degradation being detected. PDI-V was located on H. villosa chromosome 5V and encoded for a protein located in the endoplasmic reticulum. Bgt infection in leaves of H. villosa induced PDI-V expression. Virus induced gene silencing of PDIs in a T. durum-H. villosa amphiploid compromised the resistance. Single cell transient over-expression of PDI-V or a truncated version containing the active TXR domain a decreased the haustorial index in moderately susceptible wheat cultivar Yangmai 158. Stable transgenic lines over-expressing PDI-V in Yangmai 158 displayed improved powdery mildew resistance at both the seedling and adult stages. By contrast over-expression of point-mutated PDI-V(C57A) did not increase the level of resistance in Yangmai 158. The above results indicate a pivotal role of PDI-V in powdery mildew resistance and showed that conserved TRX domain a is critical for its function.

  10. Who possesses drug resistance genes in the aquatic environment?: sulfamethoxazole (SMX) resistance genes among the bacterial community in water environment of Metro-Manila, Philippines.

    Science.gov (United States)

    Suzuki, Satoru; Ogo, Mitsuko; Miller, Todd W; Shimizu, Akiko; Takada, Hideshige; Siringan, Maria Auxilia T

    2013-01-01

    Recent evidence has shown that antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in "colony forming bacterial assemblages" and "natural bacterial assemblages." Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX) is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86% of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10(-5)-10(-2) copy/16S) but not sul3. Among the natural bacterial assemblage, all sul1, sul2, and sul3 were detected (10(-5)-10(-3) copy/16S), whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  11. Who Possesses Drug Resistance Genes in the Aquatic Environment? : Sulfamethoxazole (SMX Resistance Genes among the Bacterial Community in Water Environment of Metro-Manila, Philippines

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki

    2013-04-01

    Full Text Available Recent evidence has shown that antibiotic resistant bacteria (ARB and antibiotic resistance genes (ARG are ubiquitous in natural environments, including sites considered pristine. To understand the origin of ARGs and their dynamics, we must first define their actual presence in the natural bacterial assemblage. Here we found varying distribution profiles of sul genes in colony forming bacterial assemblages and natural bacterial assemblages. Our monitoring for antibiotic contamination revealed that sulfamethoxazole (SMX is a major contaminant in aquatic environments of Metro-Manila, which would have been derived from human and animal use, and subsequently decreased through the process of outflow from source to the sea. The SMX-resistant bacterial rate evaluated by the colony forming unit showed 10 to 86 % of the total colony numbers showed higher rates from freshwater sites compared to marine sites. When sul genes were quantified by qPCR, colony-forming bacteria conveyed sul1 and sul2 genes in freshwater and seawater (10-5-10-2 copy/16S but not sul3. Among the natural bacterial assemblage, all sul1, sul2 and sul3 were detected (10-5-10-3 copy/16S, whereas all sul genes were at an almost non-detectable level in the freshwater assemblage. This study suggests that sul1 and sul2 are main sul genes in culturable bacteria, whereas sul3 is conveyed by non-culturable bacteria in the sea. As a result marine bacteria possess sul1, sul2 and sul3 genes in the marine environment.

  12. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L..

    Directory of Open Access Journals (Sweden)

    Jing An

    Full Text Available BACKGROUND: Goosegrass (Eleusine indica L., a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. RESULTS: The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. CONCLUSION: This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  13. Transcriptome profiling to discover putative genes associated with paraquat resistance in goosegrass (Eleusine indica L.).

    Science.gov (United States)

    An, Jing; Shen, Xuefeng; Ma, Qibin; Yang, Cunyi; Liu, Simin; Chen, Yong

    2014-01-01

    Goosegrass (Eleusine indica L.), a serious annual weed in the world, has evolved resistance to several herbicides including paraquat, a non-selective herbicide. The mechanism of paraquat resistance in weeds is only partially understood. To further study the molecular mechanism underlying paraquat resistance in goosegrass, we performed transcriptome analysis of susceptible and resistant biotypes of goosegrass with or without paraquat treatment. The RNA-seq libraries generated 194,716,560 valid reads with an average length of 91.29 bp. De novo assembly analysis produced 158,461 transcripts with an average length of 1153.74 bp and 100,742 unigenes with an average length of 712.79 bp. Among these, 25,926 unigenes were assigned to 65 GO terms that contained three main categories. A total of 13,809 unigenes with 1,208 enzyme commission numbers were assigned to 314 predicted KEGG metabolic pathways, and 12,719 unigenes were categorized into 25 KOG classifications. Furthermore, our results revealed that 53 genes related to reactive oxygen species scavenging, 10 genes related to polyamines and 18 genes related to transport were differentially expressed in paraquat treatment experiments. The genes related to polyamines and transport are likely potential candidate genes that could be further investigated to confirm their roles in paraquat resistance of goosegrass. This is the first large-scale transcriptome sequencing of E. indica using the Illumina platform. Potential genes involved in paraquat resistance were identified from the assembled sequences. The transcriptome data may serve as a reference for further analysis of gene expression and functional genomics studies, and will facilitate the study of paraquat resistance at the molecular level in goosegrass.

  14. Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition.

    Directory of Open Access Journals (Sweden)

    Bin He

    Full Text Available Oryza meyeriana (O. meyeriana, with a GG genome type (2n = 24, accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93-11 genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26 differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease

  15. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  16. Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

    Science.gov (United States)

    Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

    2017-06-14

    Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

  17. Normal state resistivity of single crystalline V3Si as a function of neutron irradiation

    International Nuclear Information System (INIS)

    Caton, R.; Viswanathan, R.

    1978-01-01

    Analysis of the normal state resistivity of a neutron damaged single crystal of V 3 Si shows two different regions of behavior: one for T/sub c/ equal to or greater than 10 0 K and another for T/sub c/ equal to or less than 10 0 K

  18. The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes.

    Science.gov (United States)

    Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J

    2014-05-01

    The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

  19. The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

    Science.gov (United States)

    Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

    2015-01-01

    The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. High terbinafine resistance in Trichophyton interdigitale isolates in Delhi, India harbouring mutations in the squalene epoxidase gene.

    Science.gov (United States)

    Singh, Ashutosh; Masih, Aradhana; Khurana, Ananta; Singh, Pradeep Kumar; Gupta, Meenakshi; Hagen, Ferry; Meis, Jacques F; Chowdhary, Anuradha

    2018-03-25

    In the last few years, infections caused by dermatophytes along with a concomitant increase in the number of difficult to treat cases have increasingly been recognised, indicating that dermatophytosis remains a challenging public health problem. The majority of infections are caused by Trichophyton rubrum and Trichophyton mentagrophytes complex. Terbinafine, an allylamine antifungal used orally and topically is considered to be a first-line drug in the therapy of dermatophyte infections. Terbinafine resistance has been predominately attributed to point mutations in the squalene epoxidase (SQLE) target gene a key enzyme in the ergosterol biosynthetic pathway leading to single amino acid substitutions. Here, we report the largest series of 20 terbinafine-resistant Trichophyton interdigitale isolates obtained predominately from cases of tinea corporis/cruris in three hospitals in Delhi, India exhibiting elevated MICs (4 to ≥32 μg/mL) to terbinafine and all harbouring single-point mutations Leu393Phe or Phe397Leu in the SQLE gene. In 12 (60%) T. interdigitale isolates, the Phe397Leu substitution was observed, whereas in the remaining 8 (40%) isolates the substitution Leu393Phe was reported for the first time in T. interdigitale. Furthermore, 10 susceptible T. interdigitale isolates (0.125-2 μg/mL) had a wild-type genotype. Remarkably, considerably high terbinafine resistance rate of 32% was observed among 63 T. interdigitale isolates identified by sequencing of the internal transcribed spacer region. This high level of terbinafine resistance of Indian dermatophyte isolates is worrisome warranting antifungal susceptibility testing and mutation analysis for monitoring this emerging resistance. © 2018 Blackwell Verlag GmbH.

  1. Proportional odds model applied to mapping of disease resistance genes in plants

    Directory of Open Access Journals (Sweden)

    Maria Helena Spyrides-Cunha

    2000-03-01

    Full Text Available Molecular markers have been used extensively to map quantitative trait loci (QTL controlling disease resistance in plants. Mapping is usually done by establishing a statistical association between molecular marker genotypes and quantitative variations in disease resistance. However, most statistical approaches require a continuous distribution of the response variable, a requirement not always met since evaluation of disease resistance is often done using visual ratings based on an ordinal scale of disease severity. This paper discusses the application of the proportional odds model to the mapping of disease resistance genes in plants amenable to expression as ordinal data. The model was used to map two resistance QTL of maize to Puccinia sorghi. The microsatellite markers bngl166 and bngl669, located on chromosomes 2 and 8, respectively, were used to genotype F2 individuals from a segregating population. Genotypes at each marker locus were then compared by assessing disease severity in F3 plants derived from the selfing of each genotyped F2 plant based on an ordinal scale severity. The residual deviance and the chi-square score statistic indicated a good fit of the model to the data and the odds had a constant proportionality at each threshold. Single-marker analyses detected significant differences among marker genotypes at both marker loci, indicating that these markers were linked to disease resistance QTL. The inclusion of the interaction term after single-marker analysis provided strong evidence of an epistatic interaction between the two QTL. These results indicate that the proportional odds model can be used as an alternative to traditional methods in cases where the response variable consists of an ordinal scale, thus eliminating the problems of heterocedasticity, non-linearity, and the non-normality of residuals often associated with this type of data.Marcadores moleculares têm sido extensivamente usados para o mapeamento de loci de

  2. Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

    Science.gov (United States)

    Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

    2015-01-01

    Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

  3. Survey of rice blast race identity for blast resistance gene identification in the USA and Puerto Rico

    Science.gov (United States)

    Rice blast disease is a significant threat to stable rice production in the USA and worldwide. The major resistance gene (Pi-ta) located within a cluster of resistance genes on rice chromosome 12 has been demonstrated to confer resistance to the rice blast disease. Katy, a rice cultivar released in ...

  4. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

    2013-01-01

    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  5. Coral thermal tolerance: tuning gene expression to resist thermal stress.

    Directory of Open Access Journals (Sweden)

    Anthony J Bellantuono

    Full Text Available The acclimatization capacity of corals is a critical consideration in the persistence of coral reefs under stresses imposed by global climate change. The stress history of corals plays a role in subsequent response to heat stress, but the transcriptomic changes associated with these plastic changes have not been previously explored. In order to identify host transcriptomic changes associated with acquired thermal tolerance in the scleractinian coral Acropora millepora, corals preconditioned to a sub-lethal temperature of 3°C below bleaching threshold temperature were compared to both non-preconditioned corals and untreated controls using a cDNA microarray platform. After eight days of hyperthermal challenge, conditions under which non-preconditioned corals bleached and preconditioned corals (thermal-tolerant maintained Symbiodinium density, a clear differentiation in the transcriptional profiles was revealed among the condition examined. Among these changes, nine differentially expressed genes separated preconditioned corals from non-preconditioned corals, with 42 genes differentially expressed between control and preconditioned treatments, and 70 genes between non-preconditioned corals and controls. Differentially expressed genes included components of an apoptotic signaling cascade, which suggest the inhibition of apoptosis in preconditioned corals. Additionally, lectins and genes involved in response to oxidative stress were also detected. One dominant pattern was the apparent tuning of gene expression observed between preconditioned and non-preconditioned treatments; that is, differences in expression magnitude were more apparent than differences in the identity of genes differentially expressed. Our work revealed a transcriptomic signature underlying the tolerance associated with coral thermal history, and suggests that understanding the molecular mechanisms behind physiological acclimatization would be critical for the modeling of reefs

  6. Cloning of resistance gene analogs located on the alien chromosome in an addition line of wheat-Thinopyrum intermedium.

    Science.gov (United States)

    Jiang, Shu-Mei; Hu, Jun; Yin, Wei-Bo; Chen, Yu-Hong; Wang, Richard R-C; Hu, Zan-Min

    2005-09-01

    Homology-based gene/gene-analog cloning method has been extensively applied in isolation of RGAs (resistance gene analogs) in various plant species. However, serious interference of sequences on homoeologous chromosomes in polyploidy species usually occurred when cloning RGAs in a specific chromosome. In this research, the techniques of chromosome microdissection combined with homology-based cloning were used to clone RGAs from a specific chromosome of Wheat-Thinopyrum alien addition line TAi-27, which was derived from common wheat and Thinopyrum intermedium with a pair of chromosomes from Th. intermedium. The alien chromosomes carry genes for resistance to BYDV. The alien chromosome in TAi-27 was isolated by a glass needle and digested with proteinase K. The DNA of the alien chromosome was amplified by two rounds of Sau3A linker adaptor-mediated PCR. RGAs were amplified by PCR with the degenerated primers designed based on conserved domains of published resistance genes (R genes) by using the alien chromosome DNA, genomic DNA and cDNA of Th. intermedium, TAi-27 and 3B-2 (a parent of TAi-27) as templates. A total of seven RGAs were obtained and sequenced. Of which, a constitutively expressed single-copy NBS-LRR type RGA ACR 3 was amplified from the dissected alien chromosome of TAi-27, TcDR 2 and TcDR 3 were from cDNA of Th. intermedium, AcDR 3 was from cDNA of TAi-27, FcDR 2 was from cDNA of 3B-2, AR 2 was from genomic DNA of TAi-27 and TR 2 was from genomic DNA of Th. intermedium. Sequence homology analyses showed that the above RGAs were highly homologous with known resistance genes or resistance gene analogs and belonged to NBS-LRR type of R genes. ACR 3 was recovered by PCR from genomic DNA and cDNA of Th. intermedium and TAi-27, but not from 3B-2. Southern hybridization using the digested genomic DNA of Th. intermedium, TAi-27 and 3B-2 as the template and ACR 3 as the probe showed that there is only one copy of ACR 3 in the genome of Th. intermedium and TAi

  7. Eukaryotic translation initiation factor 2B-beta (eIF2Bβ), a new class of plant virus resistance gene.

    Science.gov (United States)

    Shopan, Jannat; Mou, Haipeng; Zhang, Lili; Zhang, Changtong; Ma, Weiwei; Walsh, John A; Hu, Zhongyuan; Yang, Jinghua; Zhang, Mingfang

    2017-06-01

    Recessive resistances to plant viruses in the Potyvirus genus have been found to be based on mutations in the plant eukaryotic translation initiation factors, eIF4E and eIF4G or their isoforms. Here we report that natural, monogenic recessive resistance to the Potyvirus Turnip mosaic virus (TuMV) has been found in a number of mustard (Brassica juncea) accessions. Bulked segregant analysis and sequencing of resistant and susceptible plant lines indicated the resistance is controlled by a single recessive gene, recessive TuMV resistance 03 (retr03), an allele of the eukaryotic translation initiation factor 2B-beta (eIF2Bβ). Silencing of eIF2Bβ in a TuMV-susceptible mustard plant line and expression of eIF2Bβ from a TuMV-susceptible line in a TuMV-resistant mustard plant line confirmed the new resistance mechanism. A functional copy of a specific allele of eIF2Bβ is required for efficient TuMV infection. eIF2Bβ represents a new class of virus resistance gene conferring resistance to any pathogen. eIF2B acts as a guanine nucleotide exchange factor (GEF) for its GTP-binding protein partner eIF2 via interaction with eIF2·GTP at an early step in translation initiation. Further genotyping indicated that a single non-synonymous substitution (A120G) in the N-terminal region of eIF2Bβ was responsible for the TuMV resistance. A reproducible marker has been developed, facilitating marker-assisted selection for TuMV resistance in B. juncea. Our findings provide a new target for seeking natural resistance to potyviruses and new opportunities for the control of potyviruses using genome editing techniques targeted on eIF2Bβ. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  8. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  9. (SRAP) markers linked to bacterial wilt resistance genes i