Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis
Directory of Open Access Journals (Sweden)
Rita Marta
2014-10-01
Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.
Electronic Resource Management and Design
Abrams, Kimberly R.
2015-01-01
We have now reached a tipping point at which electronic resources comprise more than half of academic library budgets. Because of the increasing work associated with the ever-increasing number of e-resources, there is a trend to distribute work throughout the library even in the presence of an electronic resources department. In 2013, the author…
DEFF Research Database (Denmark)
Søndergaard, Katia Dupret
The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...
ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL
Directory of Open Access Journals (Sweden)
Berta Bekti Retnawati
2016-11-01
Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity
Electronic Resource Management Systems
Directory of Open Access Journals (Sweden)
Mark Ellingsen
2004-10-01
Full Text Available Computer applications which deal with electronic resource management (ERM are quite a recent development. They have grown out of the need to manage the burgeoning number of electronic resources particularly electronic journals. Typically, in the early years of e-journal acquisition, library staff provided an easy means of accessing these journals by providing an alphabetical list on a web page. Some went as far as categorising the e-journals by subject and then grouping the journals either on a single web page or by using multiple pages. It didn't take long before it was recognised that it would be more efficient to dynamically generate the pages from a database rather than to continually edit the pages manually. Of course, once the descriptive metadata for an electronic journal was held within a database the next logical step was to provide administrative forms whereby that metadata could be manipulated. This in turn led to demands for incorporating more information and more functionality into the developing application.
Electronic Resources Management Project Presentation 2012
Ramli, Rindra M.
2012-11-05
This presentation describes the electronic resources management project undertaken by the KAUST library. The objectives of this project is to migrate information from MS Sharepoint to Millennium ERM module. One of the advantages of this migration is to consolidate all electronic resources into a single and centralized location. This would allow for better information sharing among library staff.
PRINCIPLES OF CONTENT FORMATION EDUCATIONAL ELECTRONIC RESOURCE
Directory of Open Access Journals (Sweden)
О Ю Заславская
2017-12-01
Full Text Available The article considers modern possibilities of information and communication technologies for the design of electronic educational resources. The conceptual basis of the open educational multimedia system is based on the modular architecture of the electronic educational resource. The content of the electronic training module can be implemented in several versions of the modules: obtaining information, practical exercises, control. The regularities in the teaching process in modern pedagogical theory are considered: general and specific, and the principles for the formation of the content of instruction at different levels are defined, based on the formulated regularities. On the basis of the analysis, the principles of the formation of the electronic educational resource are determined, taking into account the general and didactic patterns of teaching.As principles of the formation of educational material for obtaining information for the electronic educational resource, the article considers: the principle of methodological orientation, the principle of general scientific orientation, the principle of systemic nature, the principle of fundamentalization, the principle of accounting intersubject communications, the principle of minimization. The principles of the formation of the electronic training module of practical studies in the article include: the principle of systematic and dose based consistency, the principle of rational use of study time, the principle of accessibility. The principles of the formation of the module for monitoring the electronic educational resource can be: the principle of the operationalization of goals, the principle of unified identification diagnosis.
Implementing CORAL: An Electronic Resource Management System
Whitfield, Sharon
2011-01-01
A 2010 electronic resource management survey conducted by Maria Collins of North Carolina State University and Jill E. Grogg of University of Alabama Libraries found that the top six electronic resources management priorities included workflow management, communications management, license management, statistics management, administrative…
Managing electronic resources a LITA guide
Weir, Ryan O
2012-01-01
Informative, useful, current, Managing Electronic Resources: A LITA Guide shows how to successfully manage time, resources, and relationships with vendors and staff to ensure personal, professional, and institutional success.
Directory of Open Access Journals (Sweden)
Jingbo Zhang
2018-01-01
Full Text Available In the field of cognitive radio spectrum sensing, the adaptive silence period management mechanism (ASPM has improved the problem of the low time-resource utilization rate of the traditional silence period management mechanism (TSPM. However, in the case of the low signal-to-noise ratio (SNR, the ASPM algorithm will increase the probability of missed detection for the primary user (PU. Focusing on this problem, this paper proposes an improved adaptive silence period management (IA-SPM algorithm which can adaptively adjust the sensing parameters of the current period in combination with the feedback information from the data communication with the sensing results of the previous period. The feedback information in the channel is achieved with frequency resources rather than time resources in order to adapt to the parameter change in the time-varying channel. The Monte Carlo simulation results show that the detection probability of the IA-SPM is 10–15% higher than that of the ASPM under low SNR conditions.
DEFF Research Database (Denmark)
Dupret, Katia
2018-01-01
static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...
Gender Analysis Of Electronic Information Resource Use: The Case ...
African Journals Online (AJOL)
Based on the findings the study concluded that access and use of electronic information resources creates a “social digital divide” along gender lines. The study ... Finally, the library needs to change its marketing strategies on the availability of electronic information resources to increase awareness of these resources.
Users satisfaction with electronic information resources and services ...
African Journals Online (AJOL)
This study investigated users satisfaction on the use of electronic information resources and services in MTN Net libraries in ABU & UNIBEN. Two objectives and one null hypotheses were formulated and tested with respect to the users' satisfaction on electronic information resources and services in MTN Net libraries in ...
Organizational matters of competition in electronic educational resources
Directory of Open Access Journals (Sweden)
Ирина Карловна Войтович
2015-12-01
Full Text Available The article examines the experience of the Udmurt State University in conducting competitions of educational publications and electronic resources. The purpose of such competitions is to provide methodological support to educational process. The main focus is on competition of electronic educational resources. The technology of such contests is discussed through detailed analysis of the main stages of the contest. It is noted that the main task of the preparatory stage of the competition is related to the development of regulations on competition and the definition of criteria for selection of the submitted works. The paper also proposes a system of evaluation criteria of electronic educational resources developed by members of the contest organizing committee and jury members. The article emphasizes the importance of not only the preparatory stages of the competition, but also measures for its completion, aimed at training teachers create quality e-learning resources.
"Listening Silence" and Its Discursive Effects
Applebaum, Barbara
2016-01-01
While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…
CHALLENGES OF ELECTRONIC INFORMATION RESOURCES IN ...
African Journals Online (AJOL)
This paper discusses the role of policy for proper and efficient library services in the electronic era. It points out some of the possible dangers of embarking in electronic resources without a proper focus at hand. Thus, it calls for today's librarians and policy makers to brainstorm and come up with working policies suitable to ...
Use of Electronic Resources in a Private University in Nigeria ...
African Journals Online (AJOL)
The study examined awareness and constraints in the use of electronic resources by lecturers and students of Ajayi Crowther University, Oyo, Nigeria. It aimed at justifying the resources expended in the provision of electronic resources in terms of awareness, patronage and factors that may be affecting awareness and use ...
Electronic Resources Management System: Recommendation Report 2017
Ramli, Rindra M.
2017-05-01
This recommendation report provides an overview of the selection process for the new Electronic Resources Management System. The library has decided to move away from Innovative Interfaces Millennium ERM module. The library reviewed 3 system as potential replacements namely: Proquest 360 Resource Manager, Ex Libris Alma and Open Source CORAL ERMS. After comparing and trialling the systems, it was decided to go for Proquest 360 Resource Manager.
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
use of electronic resources by graduate students of the department
African Journals Online (AJOL)
respondent's access electronic resources from the internet via Cybercafé .There is a high ... KEY WORDS: Use, Electronic Resources, Graduate Students, Cybercafé. INTRODUCTION ... Faculty of Education, University of Uyo, Uyo. Olu Olat ...
Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional
Retnawati, Berta Bekti
2003-01-01
There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...
Electronic resource management practical perspectives in a new technical services model
Elguindi, Anne
2012-01-01
A significant shift is taking place in libraries, with the purchase of e-resources accounting for the bulk of materials spending. Electronic Resource Management makes the case that technical services workflows need to make a corresponding shift toward e-centric models and highlights the increasing variety of e-formats that are forcing new developments in the field.Six chapters cover key topics, including: technical services models, both past and emerging; staffing and workflow in electronic resource management; implementation and transformation of electronic resource management systems; the ro
Utilization of electronic information resources by academic staff at ...
African Journals Online (AJOL)
The study investigated the utilization of Electronic Information resources by the academic staff of Makerere University in Uganda. It examined the academic staff awareness of the resources available, the types of resources provided by the Makerere University Library, the factors affecting resource utilization. The study was ...
Electronic Resources Management Project Presentation 2012
Ramli, Rindra M.
2012-01-01
This presentation describes the electronic resources management project undertaken by the KAUST library. The objectives of this project is to migrate information from MS Sharepoint to Millennium ERM module. One of the advantages of this migration
Directory of Open Access Journals (Sweden)
Luciano Marcondes Godoy
1999-01-01
Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.
Voice and silence in organizations
Directory of Open Access Journals (Sweden)
Moaşa, H.
2011-01-01
Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.
Practical guide to electronic resources in the humanities
Dubnjakovic, Ana
2010-01-01
From full-text article databases to digitized collections of primary source materials, newly emerging electronic resources have radically impacted how research in the humanities is conducted and discovered. This book, covering high-quality, up-to-date electronic resources for the humanities, is an easy-to-use annotated guide for the librarian, student, and scholar alike. It covers online databases, indexes, archives, and many other critical tools in key humanities disciplines including philosophy, religion, languages and literature, and performing and visual arts. Succinct overviews of key eme
Utilisation of Electronic Information Resources By Lecturers in ...
African Journals Online (AJOL)
This study assesses the use of information resources, specifically, electronic databases by lecturers/teachers in Universities and Colleges of Education in South Western Nigeria. Information resources are central to teachers' education. It provides lecturers/teachers access to information that enhances research and ...
Directory of Open Access Journals (Sweden)
Sanna Torma
2004-01-01
Full Text Available This study elaborated relations between digital library use by university faculty, users' discipline and the availability of key resources in the Finnish National Electronic Library (FinELib, Finnish national digital library, by using nationwide representative survey data. The results show that the perceived availability of key electronic resources by researchers in FinELib was a stronger predictor of the frequency and purpose of use of its services than users' discipline. Regardless of discipline a good perceived provision of central resources led to a more frequent use of FinELib. The satisfaction with the services did not vary with the discipline, but with the perceived availability of resources.
The Role of the Acquisitions Librarian in Electronic Resources Management
Pomerantz, Sarah B.
2010-01-01
With the ongoing shift to electronic formats for library resources, acquisitions librarians, like the rest of the profession, must adapt to the rapidly changing landscape of electronic resources by keeping up with trends and mastering new skills related to digital publishing, technology, and licensing. The author sought to know what roles…
Directory of Open Access Journals (Sweden)
Mehdi Aghamohammadi
2017-04-01
Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.
Analysis of Pedagogic Potential of Electronic Educational Resources with Elements of Autodidactics
Directory of Open Access Journals (Sweden)
Igor A.
2018-03-01
Full Text Available Introduction: in recent years didactic properties of electronic educational resources undergo considerable changes, nevertheless, the question of studying of such complete phenomenon as “an electronic educational resource with autodidactics elements” remains open, despite sufficient scientific base of researches of the terms making this concept. Article purpose – determination of essence of electronic educational resources with autodidactics elements. Materials and Methods: the main method of research was the theoretical analysis of the pedagogical and psychological literature on the problem under study. We used the theoretical (analysis, synthesis, comparison and generalization methods, the method of interpretation, pedagogical modeling, and empirical methods (observation, testing, conversation, interview, analysis of students’ performance, pedagogical experiment, peer review. Results: we detected the advantages of electronic educational resources in comparison with traditional ones. The concept of autodidactics as applied to the subject of research is considered. Properties of electronic educational resources with a linear and nonlinear principle of construction are studied.The influence of the principle of construction on the development of the learners’ qualities is shown. We formulated an integral definition of electronic educational resources with elements of autodidactics, namely, the variability, adaptivity and cyclicity of training. A model of the teaching-learning process with electronic educational resources is developed. Discussion and Conclusions: further development of a problem will allow to define whether electronic educational resources with autodidactics elements pedagogical potential for realization of educational and self-educational activity of teachers have, to modify technological procedures taking into account age features of students, their specialties and features of the organization of process of training of
Preservation and conservation of electronic information resources of ...
African Journals Online (AJOL)
The major holdings of the broadcast libraries of the Nigerian Television Authority (NTA) are electronic information resources; therefore, providing safe places for general management of these resources have aroused interest in the industry in Nigeria for sometimes. The need to study the preservation and conservation of ...
Building an electronic resource collection a practical guide
Lee, Stuart D
2004-01-01
This practical book guides information professionals step-by-step through building and managing an electronic resource collection. It outlines the range of electronic products currently available in abstracting and indexing, bibliographic, and other services and then describes how to effectively select, evaluate and purchase them.
Analysis of Human Resources Management Strategy in China Electronic Commerce Enterprises
Shao, Fang
The paper discussed electronic-commerce's influence on enterprise human resources management, proposed and proved the human resources management strategy which electronic commerce enterprise should adopt from recruitment strategy to training strategy, keeping talent strategy and other ways.
Ombuds’ corner: Employee silence
Vincent Vuillemin
2013-01-01
Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct. For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...
Using XML Technologies to Organize Electronic Reference Resources
Huser, Vojtech; Del Fiol, Guilherme; Rocha, Roberto A.
2005-01-01
Provision of access to reference electronic resources to clinicians is becoming increasingly important. We have created a framework for librarians to manage access to these resources at an enterprise level, rather than at the individual hospital libraries. We describe initial project requirements, implementation details, and some preliminary results.
Electronic Resources and Mission Creep: Reorganizing the Library for the Twenty-First Century
Stachokas, George
2009-01-01
The position of electronic resources librarian was created to serve as a specialist in the negotiation of license agreements for electronic resources, but mission creep has added more functions to the routine work of electronic resources such as cataloging, gathering information for collection development, and technical support. As electronic…
Millenson, Michael L
2003-01-01
Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.
Electronic Resources Management System: Recommendation Report 2017
Ramli, Rindra M.
2017-01-01
This recommendation report provides an overview of the selection process for the new Electronic Resources Management System. The library has decided to move away from Innovative Interfaces Millennium ERM module. The library reviewed 3 system
How Silent is the Right to Silence?
Directory of Open Access Journals (Sweden)
Katherine Biber
2012-11-01
Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.
Egle, Jonathan P; Smeenge, David M; Kassem, Kamal M; Mittal, Vijay K
2015-01-01
Electronic sources of medical information are plentiful, and numerous studies have demonstrated the use of the Internet by patients and the variable reliability of these sources. Studies have investigated neither the use of web-based resources by residents, nor the reliability of the information available on these websites. A web-based survey was distributed to surgical residents in Michigan and third- and fourth-year medical students at an American allopathic and osteopathic medical school and a Caribbean allopathic school regarding their preferred sources of medical information in various situations. A set of 254 queries simulating those faced by medical trainees on rounds, on a written examination, or during patient care was developed. The top 5 electronic resources cited by the trainees were evaluated for their ability to answer these questions accurately, using standard textbooks as the point of reference. The respondents reported a wide variety of overall preferred resources. Most of the 73 responding medical trainees favored textbooks or board review books for prolonged studying, but electronic resources are frequently used for quick studying, clinical decision-making questions, and medication queries. The most commonly used electronic resources were UpToDate, Google, Medscape, Wikipedia, and Epocrates. UpToDate and Epocrates had the highest percentage of correct answers (47%) and Wikipedia had the lowest (26%). Epocrates also had the highest percentage of wrong answers (30%), whereas Google had the lowest percentage (18%). All resources had a significant number of questions that they were unable to answer. Though hardcopy books have not been completely replaced by electronic resources, more than half of medical students and nearly half of residents prefer web-based sources of information. For quick questions and studying, both groups prefer Internet sources. However, the most commonly used electronic resources fail to answer clinical queries more than half
Judicial review of administrative silence
Directory of Open Access Journals (Sweden)
Radošević Ratko S.
2015-01-01
Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.
Durability of timber silencers at Wairakei geothermal steam field
Energy Technology Data Exchange (ETDEWEB)
Hedley, M E
1979-02-01
After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.
ANALYTICAL REVIEW OF ELECTRONIC RESOURCES FOR THE STUDY OF LATIN
Directory of Open Access Journals (Sweden)
Olena Yu. Balalaieva
2014-04-01
Full Text Available The article investigates the current state of development of e-learning content in the Latin language. It is noted that the introduction of ICT in the educational space has expanded the possibility of studying Latin, opened access to digital libraries resources, made it possible to use scientific and educational potential and teaching Latin best practices of world's leading universities. A review of foreign and Ukrainian information resources and electronic editions for the study of Latin is given. Much attention was paid to the didactic potential of local and online multimedia courses of Latin, electronic textbooks, workbooks of interactive tests and exercises, various dictionaries and software translators, databases and digital libraries. Based on analysis of the world market of educational services and products the main trends in the development of information resources and electronic books are examined. It was found that multimedia courses with interactive exercises or workbooks with interactive tests, online dictionaries and translators are the most widely represented and demanded. The noticeable lagging of Ukrainian education and computer linguistics in quantitative and qualitative measures in this industry is established. The obvious drawback of existing Ukrainian resources and electronic editions for the study of Latin is their noninteractive nature. The prospects of e-learning content in Latin in Ukraine are outlined.
Elektronik Bilgi Kaynaklarının Seçimi / Selection of Electronic Information Resources
Directory of Open Access Journals (Sweden)
Pınar Al
2003-04-01
Full Text Available For many years, library users have used only from the printed media in order to get the information that they have needed. Today with the widespread use of the Web and the addition of electronic information resources to library collections, the use of information in the electronic environment as well as in printed media is started to be used. In time, such types of information resources as, electronic journals, electronic books, electronic encyclopedias, electronic dictionaries and electronic theses have been added to library collections. In this study, selection criteria that can be used for electronic information resources are discussed and suggestions are provided for libraries that try to select electronic information resources for their collections.
Access to electronic resources by visually impaired people
Directory of Open Access Journals (Sweden)
Jenny Craven
2003-01-01
Full Text Available Research into access to electronic resources by visually impaired people undertaken by the Centre for Research in Library and Information Management has not only explored the accessibility of websites and levels of awareness in providing websites that adhere to design for all principles, but has sought to enhance understanding of information seeking behaviour of blind and visually impaired people when using digital resources.
Library training to promote electronic resource usage
DEFF Research Database (Denmark)
Frandsen, Tove Faber; Tibyampansha, Dativa; Ibrahim, Glory
2017-01-01
Purpose: Increasing the usage of electronic resources is an issue of concern for many libraries all over the world. Several studies stress the importance of information literacy and instruction in order to increase the usage. Design/methodology/approach: The present article presents the results...
Why and How to Measure the Use of Electronic Resources
Directory of Open Access Journals (Sweden)
Jean Bernon
2008-11-01
Full Text Available A complete overview of library activity implies a complete and reliable measurement of the use of both electronic resources and printed materials. This measurement is based on three sets of definitions: document types, use types and user types. There is a common model of definitions for printed materials, but a lot of questions and technical issues remain for electronic resources. In 2006 a French national working group studied these questions. It relied on the COUNTER standard, but found it insufficient and pointed out the need for local tools such as web markers and deep analysis of proxy logs. Within the French national consortium COUPERIN, a new working group is testing ERMS, SUSHI standards, Shibboleth authentication, along with COUNTER standards, to improve the counting of the electronic resources use. At this stage this counting is insufficient and its improvement will be a European challenge for the future.
Breaching cultural silence: enhancing resilience among Ugandan ...
African Journals Online (AJOL)
Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...
Euler European Libraries and Electronic Resources in Mathematical Sciences
The Euler Project. Karlsruhe
The European Libraries and Electronic Resources (EULER) Project in Mathematical Sciences provides the EulerService site for searching out "mathematical resources such as books, pre-prints, web-pages, abstracts, proceedings, serials, technical reports preprints) and NetLab (for Internet resources), this outstanding engine is capable of simple, full, and refined searches. It also offers a browse option, which responds to entries in the author, keyword, and title fields. Further information about the Project is provided at the EULER homepage.
Organizational Silence in Sports Employees
Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker
2016-01-01
Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…
Bhukuvhani, Crispen; Chiparausha, Blessing; Zuvalinyenga, Dorcas
2012-01-01
Lecturers use various electronic resources at different frequencies. The university library's information literacy skills workshops and seminars are the main sources of knowledge of accessing electronic resources. The use of electronic resources can be said to have positively affected lecturers' pedagogical practices and their work in general. The…
Calcium signalling silencing in atrial fibrillation.
Greiser, Maura
2017-06-15
Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
Aghamohammadi, Mehdi
2017-01-01
One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Small RNA-Mediated Epigenetic Myostatin Silencing
Directory of Open Access Journals (Sweden)
Thomas C Roberts
2012-01-01
Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.
Chinanteco children’s silences in different classroom situations
Directory of Open Access Journals (Sweden)
Valeria Rebolledo Angulo
2016-01-01
Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.
Electronic Commerce Resource Centers. An Industry--University Partnership.
Gulledge, Thomas R.; Sommer, Rainer; Tarimcilar, M. Murat
1999-01-01
Electronic Commerce Resource Centers focus on transferring emerging technologies to small businesses through university/industry partnerships. Successful implementation hinges on a strategic operating plan, creation of measurable value for customers, investment in customer-targeted training, and measurement of performance outputs. (SK)
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Choosing Silence for Equality in and through Schooling
Lees, Helen E.
2016-01-01
This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…
[E. M. Jellinek's silenced and silencing transgenerational story].
Kelemen, Gábor; Márk, Mónika
2013-01-01
Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.
Directory of Open Access Journals (Sweden)
Đerić Gordana
2007-01-01
Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.
Transcriptional Silencing of Retroviral Vectors
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M.; Pedersen, F.S.
1996-01-01
. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...
Listen and the question of silence
DEFF Research Database (Denmark)
Doubinsky, Sebastien
2018-01-01
Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...
The ethics of silence: Does conflict of interest explain employee silence?
Anderson, James
2018-03-01
Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.
Silence as a Response to Everyday Violence
DEFF Research Database (Denmark)
Gammeltoft, Tine
2016-01-01
Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
USE OF ELECTRONIC EDUCATIONAL RESOURCES WHEN TRAINING IN WORK WITH SPREADSHEETS
Directory of Open Access Journals (Sweden)
Х А Гербеков
2017-12-01
Full Text Available Today the tools for maintaining training courses based on opportunities of information and communication technologies are developed. Practically in all directions of preparation and on all subject matters electronic textbook and self-instruction manuals are created. Nevertheless the industry of computer educational and methodical materials actively develops and gets more and more areas of development and introduction. In this regard more and more urgent is a problem of development of the electronic educational resources adequate to modern educational requirements. Creation and the organization of training courses with use of electronic educational resources in particular on the basis of Internet technologies remains a difficult methodical task.In article the questions connected with development of electronic educational resources for use when studying the substantial line “Information technologies” of a school course of informatics in particular for studying of spreadsheets are considered. Also the analysis of maintenance of a school course and the unified state examination from the point of view of representation of task in him corresponding to the substantial line of studying “Information technologies” on mastering technology of information processing in spreadsheets and the methods of visualization given by means of charts and schedules is carried out.
Mutuality, Self-Silencing, and Disordered Eating in College Women
Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.
2006-01-01
The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…
After the Blackbird Whistles: Listening to Silence in Classrooms
Schultz, Katherine
2010-01-01
Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…
Directory of Open Access Journals (Sweden)
Sandra Patricia Arenas Grisales
2012-08-01
Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Organizational Silence in Universities as the Predictor of Organizational Culture
Directory of Open Access Journals (Sweden)
Erkan YAMAN
2014-04-01
Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela
2013-02-01
Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Directory of Open Access Journals (Sweden)
Louise E Atkinson
2013-02-01
Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.
Tospovirus : induction and suppression of RNA silencing
Hedil, Marcio
2016-01-01
While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,
Analytical Study of Usage of Electronic Information Resources at Pharmacopoeial Libraries in India
Directory of Open Access Journals (Sweden)
Sunil Tyagi
2014-02-01
Full Text Available The objective of this study is to know the rate and purpose of the use of e-resource by the scientists at pharmacopoeial libraries in India. Among other things, this study examined the preferences of the scientists toward printed books and journals, electronic information resources, and pattern of using e-resources. Non-probability sampling specially accidental and purposive technique was applied in the collection of primary data through administration of user questionnaire. The sample respondents chosen for the study consists of principle scientific officer, senior scientific officer, scientific officer, and scientific assistant of different division of the laboratories, namely, research and development, pharmaceutical chemistry, pharmacovigilance, pharmacology, pharmacogonosy, and microbiology. The findings of the study reveal the personal experiences and perceptions they have had on practice and research activity using e-resource. The major findings indicate that of the total anticipated participants, 78% indicated that they perceived the ability to use computer for electronic information resources. The data analysis shows that all the scientists belonging to the pharmacopoeial libraries used electronic information resources to address issues relating to drug indexes and compendia, monographs, drugs obtained through online databases, e-journals, and the Internet sources—especially polices by regulatory agencies, contacts, drug promotional literature, and standards.
Page 170 Use of Electronic Resources by Undergraduates in Two ...
African Journals Online (AJOL)
undergraduate students use electronic resources such as NUC virtual library, HINARI, ... web pages articles from magazines, encyclopedias, pamphlets and other .... of Nigerian university libraries have Internet connectivity, some of the system.
Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers
Ussher, Jane M.; Perz, Janette
2010-01-01
This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…
Conifers have a unique small RNA silencing signature
Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.
2008-01-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
The physics of chromatin silencing: Bi-stability and front propagation
Sedighi, Mohammad
A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.
Model of e-learning with electronic educational resources of new generation
Directory of Open Access Journals (Sweden)
A. V. Loban
2017-01-01
Full Text Available Purpose of the article: improving of scientific and methodical base of the theory of the е-learning of variability. Methods used: conceptual and logical modeling of the е-learning of variability process with electronic educational resource of new generation and system analysis of the interconnection of the studied subject area, methods, didactics approaches and information and communication technologies means. Results: the formalization complex model of the е-learning of variability with electronic educational resource of new generation is developed, conditionally decomposed into three basic components: the formalization model of the course in the form of the thesaurusclassifier (“Author of e-resource”, the model of learning as management (“Coordination. Consultation. Control”, the learning model with the thesaurus-classifier (“Student”. Model “Author of e-resource” allows the student to achieve completeness, high degree of didactic elaboration and structuring of the studied material in triples of variants: modules of education information, practical task and control tasks; the result of the student’s (author’s of e-resource activity is the thesaurus-classifier. Model of learning as management is based on the principle of personal orientation of learning in computer environment and determines the logic of interaction between the lecturer and the student when determining the triple of variants individually for each student; organization of a dialogue between the lecturer and the student for consulting purposes; personal control of the student’s success (report generation and iterative search for the concept of the class assignment in the thesaurus-classifier before acquiring the required level of training. Model “Student” makes it possible to concretize the learning tasks in relation to the personality of the student and to the training level achieved; the assumption of the lecturer about the level of training of a
A survey of the use of electronic scientific information resources among medical and dental students
Directory of Open Access Journals (Sweden)
Aarnio Matti
2006-05-01
Full Text Available Abstract Background To evaluate medical and dental students' utilization of electronic information resources. Methods A web survey sent to 837 students (49.9% responded. Results Twenty-four per cent of medical students and ninteen per cent of dental students searched MEDLINE 2+ times/month for study purposes, and thiry-two per cent and twenty-four per cent respectively for research. Full-text articles were used 2+ times/month by thirty-three per cent of medical and ten per cent of dental students. Twelve per cent of respondents never utilized either MEDLINE or full-text articles. In multivariate models, the information-searching skills among students were significantly associated with use of MEDLINE and full-text articles. Conclusion Use of electronic resources differs among students. Forty percent were non-users of full-text articles. Information-searching skills are correlated with the use of electronic resources, but the level of basic PC skills plays not a major role in using these resources. The student data shows that adequate training in information-searching skills will increase the use of electronic information resources.
Control of thermoacoustic instability with a drum-like silencer
Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng
2017-10-01
Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.
Access to electronic information resources by students of federal ...
African Journals Online (AJOL)
The paper discusses access to electronic information resources by students of Federal Colleges of Education in Eha-Amufu and Umunze. Descriptive survey design was used to investigate sample of 526 students. Sampling technique used was a Multi sampling technique. Data for the study were generated using ...
Adoption and use of electronic information resources by medical ...
African Journals Online (AJOL)
This study investigated the adoption and use of electronic information resources by medical science students of the University of Benin. The descriptive survey research design was adopted for the study and 390 students provided the data. Data collected were analysed with descriptive Statistics(Simple percentage and ...
Histone Methylation and Epigenetic Silencing in Breast Cancer
National Research Council Canada - National Science Library
Simon, Jeffrey A; Lange, Carol A
2008-01-01
.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.
No-Big-Silence teeb klubituuri / Urmas Hännile
Hännile, Urmas
2009-01-01
Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar
Where Do Electronic Books Fit in the College Research Arsenal of Resources?
Barbier, Patricia
2007-01-01
Student use of electronic books has become an accepted supplement to traditional resources. Student use and satisfaction was monitored through an online course discussion board. Increased use of electronic books indicate this service is an accepted supplement to the print book collection.
DEFF Research Database (Denmark)
Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette
2012-01-01
and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...
DEFF Research Database (Denmark)
Nielsen, Troels T; Nielsen, Jørgen E
2013-01-01
Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...
Toward a science of silence: The consequences of leaving a memory unsaid
DEFF Research Database (Denmark)
Stone, Charles; Coman, Alin; Brown, Adam
2012-01-01
of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...
Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.
Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian
2018-06-01
Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2004-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2005-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2006-01-01
...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...
Strategic Planning for Electronic Resources Management: A Case Study at Gustavus Adolphus College
Hulseberg, Anna; Monson, Sarah
2009-01-01
Electronic resources, the tools we use to manage them, and the needs and expectations of our users are constantly evolving; at the same time, the roles, responsibilities, and workflow of the library staff who manage e-resources are also in flux. Recognizing a need to be more intentional and proactive about how we manage e-resources, the…
Directory of Open Access Journals (Sweden)
Anton M. Avramchuk
2015-09-01
Full Text Available Today the problem of designing multimedia electronic educational resources from language disciplines in Moodle is very important. This system has a lot of different, powerful resources, plugins to facilitate the learning of students with language disciplines. This article presents an overview and comparative analysis of the five Moodle plugins for designing multimedia electronic educational resources from language disciplines. There have been considered their key features and functionality in order to choose the best for studying language disciplines in the Moodle. Plugins are compared by a group of experts according to the criteria: efficiency, functionality and easy use. For a comparative analysis of the plugins it is used the analytic hierarchy process.
Modern ICT Tools: Online Electronic Resources Sharing Using Web ...
African Journals Online (AJOL)
Modern ICT Tools: Online Electronic Resources Sharing Using Web 2.0 and Its Implications For Library And Information Practice In Nigeria. ... The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more ...
Antiviral RNA silencing viral counter defense in plants
Bucher, E.C.
2006-01-01
The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing
Anti-viral RNA silencing: do we look like plants ?
Directory of Open Access Journals (Sweden)
Lecellier Charles-Henri
2006-01-01
Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.
Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David
2014-01-01
Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370
Directory of Open Access Journals (Sweden)
Anton M. Avramchuk
2017-10-01
Full Text Available The article is devoted to the problem of developing the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system. The concept of "the competence of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system" is justified and defined. Identified and characterized the components by which the levels of the competency development of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system should be assessed. Developed a model for the development of the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system, which is based on the main scientific approaches, used in adult education, and consists of five blocks: target, informative, technological, diagnostic and effective.
Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald
2016-10-01
Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Kachaluba, Sarah Buck; Brady, Jessica Evans; Critten, Jessica
2014-01-01
This article is based on quantitative and qualitative research examining humanities scholars' understandings of the advantages and disadvantages of print versus electronic information resources. It explores how humanities' faculty members at Florida State University (FSU) use print and electronic resources, as well as how they perceive these…
The dynamics and efficacy of antiviral RNA silencing: A model study
Directory of Open Access Journals (Sweden)
Hogeweg Paulien
2008-03-01
Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.
The organisational silence of midwives and nurses: reasons and results.
Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra
2016-07-01
The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.
The RNA silencing pathway: the bits and pieces that matter.
Directory of Open Access Journals (Sweden)
2005-07-01
Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.
Directory of Open Access Journals (Sweden)
Ximena Suárez
2017-10-01
Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Suppressors of RNA silencing encoded by tomato leaf curl ...
Indian Academy of Sciences (India)
2013-01-06
Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Electronic resource management systems a workflow approach
Anderson, Elsa K
2014-01-01
To get to the bottom of a successful approach to Electronic Resource Management (ERM), Anderson interviewed staff at 11 institutions about their ERM implementations. Among her conclusions, presented in this issue of Library Technology Reports, is that grasping the intricacies of your workflow-analyzing each step to reveal the gaps and problems-at the beginning is crucial to selecting and implementing an ERM. Whether the system will be used to fill a gap, aggregate critical data, or replace a tedious manual process, the best solution for your library depends on factors such as your current soft
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.
Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo
2016-12-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.
Electronic Resource Management System. Vernetzung von Lizenzinformationen
Directory of Open Access Journals (Sweden)
Michaela Selbach
2014-12-01
Full Text Available In den letzten zehn Jahren spielen elektronische Ressourcen im Bereich der Erwerbung eine zunehmend wichtige Rolle: Eindeutig lässt sich hier ein Wandel in den Bibliotheken (fort vom reinen Printbestand zu immer größeren E-Only-Beständen feststellen. Die stetig wachsende Menge an E-Ressourcen und deren Heterogenität stellt Bibliotheken vor die Herausforderung, die E-Ressourcen effizient zu verwalten. Nicht nur Bibliotheken, sondern auch verhandlungsführende Institutionen von Konsortial- und Allianzlizenzen benötigen ein geeignetes Instrument zur Verwaltung von Lizenzinformationen, welches den komplexen Anforderungen moderner E-Ressourcen gerecht wird. Die Deutsche Forschungsgemeinschaft (DFG unterstützt ein Projekt des Hochschulbibliothekszentrums des Landes Nordrhein-Westfalen (hbz, der Universitätsbibliothek Freiburg, der Verbundzentrale des Gemeinsamen Bibliotheksverbundes (GBV und der Universitätsbibliothek Frankfurt, in dem ein bundesweit verfügbares Electronic Ressource Managementsystem (ERMS aufgebaut werden soll. Ein solches ERMS soll auf Basis einer zentralen Knowledge Base eine einheitliche Nutzung von Daten zur Lizenzverwaltung elektronischer Ressourcen auf lokaler, regionaler und nationaler Ebene ermöglichen. Statistische Auswertungen, Rechteverwaltung für alle angeschlossenen Bibliotheken, kooperative Datenpflege sowie ein über standardisierte Schnittstellen geführter Datenaustausch stehen bei der Erarbeitung der Anforderungen ebenso im Fokus wie die Entwicklung eines Daten- und Funktionsmodells. In the last few years the importance of electronic resources in library acquisitions has increased significantly. There has been a shift from mere print holdings to both e- and print combinations and even e-only subscriptions. This shift poses a double challenge for libraries: On the one hand they have to provide their e-resource collections to library users in an appealing way, on the other hand they have to manage these
The Electron Microscopy Outreach Program: A Web-based resource for research and education.
Sosinsky, G E; Baker, T S; Hand, G; Ellisman, M H
1999-01-01
We have developed a centralized World Wide Web (WWW)-based environment that serves as a resource of software tools and expertise for biological electron microscopy. A major focus is molecular electron microscopy, but the site also includes information and links on structural biology at all levels of resolution. This site serves to help integrate or link structural biology techniques in accordance with user needs. The WWW site, called the Electron Microscopy (EM) Outreach Program (URL: http://emoutreach.sdsc.edu), provides scientists with computational and educational tools for their research and edification. In particular, we have set up a centralized resource containing course notes, references, and links to image analysis and three-dimensional reconstruction software for investigators wanting to learn about EM techniques either within or outside of their fields of expertise. Copyright 1999 Academic Press.
Technical Communicator: A New Model for the Electronic Resources Librarian?
Hulseberg, Anna
2016-01-01
This article explores whether technical communicator is a useful model for electronic resources (ER) librarians. The fields of ER librarianship and technical communication (TC) originated and continue to develop in relation to evolving technologies. A review of the literature reveals four common themes for ER librarianship and TC. While the…
Stability of RNA silencing-based traits after virus infection
DEFF Research Database (Denmark)
Jørgensen, Bodil; Albrechtsen, Merete
2007-01-01
with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:
Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity
Directory of Open Access Journals (Sweden)
Dawn Llewellyn
2016-06-01
Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.
Bodies, Spaces, Voices, Silences
Directory of Open Access Journals (Sweden)
Donatella Mazzoleni
2013-07-01
Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.
MODEL OF AN ELECTRONIC EDUCATIONAL RESOURCE OF NEW GENERATION
Directory of Open Access Journals (Sweden)
Anatoliy V. Loban
2016-01-01
Full Text Available The mathematical structure of the modular architecture of an electronic educational resource (EER of new generation, which allows to decompose the process of studying the subjects of the course at a hierarchically ordered set of data (knowledge and procedures for manipulating them, to determine the roles of participants of process of training of and technology the development and use of EOR in the study procrate.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
Directory of Open Access Journals (Sweden)
Sizolwenkosi Mlotshwa
2008-03-01
Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.
The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence
Directory of Open Access Journals (Sweden)
Michael Gary Duncan
2012-03-01
Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.
Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.
Suhor, Charles
1991-01-01
Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)
Strategy of gene silencing in cassava for validation of resistance genes
International Nuclear Information System (INIS)
Cortes, Simon; Lopez, Camilo
2010-01-01
Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced
The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA
Directory of Open Access Journals (Sweden)
Logan M. Decker
2017-04-01
Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.
Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.
Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki
2011-01-01
Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Active compressor engine silencer reduces exhaust noise
International Nuclear Information System (INIS)
Denenberg, J.N.; Miller, S.K.; Jay, M.A.
1994-01-01
An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project
Marie Nimier, au cœur du silence
Directory of Open Access Journals (Sweden)
Joëlle Papillon
2012-01-01
Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.
Directory of Open Access Journals (Sweden)
Saeedeh Shafiee Nahrkhalaji
2013-05-01
Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.
Communicative Silences: Forms and Functions
Bruneau, Thomas J.
1973-01-01
The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)
Haskins, Cathleen
2011-01-01
Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…
Simultaneous Silencing of Xylanase Genes in Botrytis cinerea
Directory of Open Access Journals (Sweden)
Néstor García
2017-12-01
Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.
Strategies underlying RNA silencing suppression by negative strand RNA viruses
Hemmes, J.C.
2007-01-01
The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double
Directory of Open Access Journals (Sweden)
Galina P. Lavrentieva
2014-05-01
Full Text Available The article highlights the causes of insufficient effective use of electronic learning resources and sets out the guidelines on ways to solve the aforementioned problems. The set of didactic, methodical, psychological, pedagogical, design and ergonomic quality requirements is considered for evaluation, selection and application of information and communication technologies in the educational process. The most appropriate mechanisms for the ICT introduction into the learning process are disclosed as it should meet the specific learning needs of the student and the objectives of the educational process. The guidance for psycho-educational assessment of quality of electronic educational resources is provided. It is argued that the effectiveness of the ICT use is to be improved by means of quality evaluation mechanisms involved into the educational process.
Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester
Directory of Open Access Journals (Sweden)
Amelia Peral Crespo
2015-11-01
Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word
Directory of Open Access Journals (Sweden)
Dare Samuel Adeleke
2017-12-01
Full Text Available Availability, awareness and use of electronic resources provide access to authoritative, reliable, accurate and timely access to information. The use of electronic information resources (EIRs can enable innovation in teaching and increase timeliness in research of postgraduate students which will eventual result into encouragement of the expected research-led enquiry in this digital age. The study adopted a descriptive survey design. Samples of 300 of postgraduate students within seven out 13 Faculties were randomly selected. Data were collected using questionnaire designed to elicit response from respondents and data were analyzed using descriptive statistics methods percentages, mean, and standard deviation. Results indicated that internet was ranked most available and used in the university. Low level of usage of electronic resources, in particular, full texts data bases is linked to a number of constraints: Interrupted power supply was ranked highest among other factors as speed and capacity of computers, retrieval of records with high recall and low precision, retrieving records relevant to information need, lack of knowledge of search techniques to retrieve information effectively, non possession of requisite IT skills and problems accessing the internet. The study recommended that usage of electronic resources be made compulsory, intensifying awareness campaigns concerning the availability, training on use of electronic resources and the problem of power outage be addressed.
Noh, Younghee
2010-01-01
This study aimed to improve the current state of electronic resource evaluation in libraries. While the use of Web DB, e-book, e-journal, and other e-resources such as CD-ROM, DVD, and micro materials is increasing in libraries, their use is not comprehensively factored into the general evaluation of libraries and may diminish the reliability of…
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.
Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women
Shouse, Sarah H.; Nilsson, Johanna
2011-01-01
Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…
L’architecture du silence de la Shoah dans les fictions de Sylvie Germain
Directory of Open Access Journals (Sweden)
José Luis Arráez Llobregat
2015-11-01
Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
The molecular basis for stability of heterochromatin-mediated silencing in mammals.
Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard
2009-11-04
The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
The molecular basis for stability of heterochromatin-mediated silencing in mammals
Directory of Open Access Journals (Sweden)
Hiragami-Hamada Kyoko
2009-11-01
Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
Precedents and consequences of prosocial behaviors of voice and silence
Directory of Open Access Journals (Sweden)
Alicia Omar
2015-09-01
Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization.
RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION
Directory of Open Access Journals (Sweden)
Fitnat Nazlı Sayğan
2011-07-01
Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
Gas turbine exhaust system silencing design
International Nuclear Information System (INIS)
Ozgur, D.
1991-01-01
Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting
Anton M. Avramchuk
2017-01-01
The article is devoted to the problem of developing the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system. The concept of "the competence of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system" is justified and defined. Identified and characterized the components by which the levels of the competency development of teachers of language disciplines on designing ...
Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.
Directory of Open Access Journals (Sweden)
Oliver A Zill
Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.
Papi, Ahmad; Ghazavi, Roghayeh; Moradi, Salimeh
2015-01-01
Understanding of the medical society's from the types of information resources for quick and easy access to information is an imperative task in medical researches and management of the treatment. The present study was aimed to determine the level of awareness of the physicians in using various electronic information resources and the factors affecting it. This study was a descriptive survey. The data collection tool was a researcher-made questionnaire. The study population included all the physicians and specialty physicians of the teaching hospitals affiliated to Isfahan University of Medical Sciences and numbered 350. The sample size based on Morgan's formula was set at 180. The content validity of the tool was confirmed by the library and information professionals and the reliability was 95%. Descriptive statistics were used including the SPSS software version 19. On reviewing the need of the physicians to obtain the information on several occasions, the need for information in conducting the researches was reported by the maximum number of physicians (91.9%) and the usage of information resources, especially the electronic resources, formed 65.4% as the highest rate with regard to meeting the information needs of the physicians. Among the electronic information databases, the maximum awareness was related to Medline with 86.5%. Among the various electronic information resources, the highest awareness (43.3%) was related to the E-journals. The highest usage (36%) was also from the same source. The studied physicians considered the most effective deterrent in the use of electronic information resources as being too busy and lack of time. Despite the importance of electronic information resources for the physician's community, there was no comprehensive knowledge of these resources. This can lead to less usage of these resources. Therefore, careful planning is necessary in the hospital libraries in order to introduce the facilities and full capabilities of the
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins
Directory of Open Access Journals (Sweden)
Marcio Hedil
2016-07-01
Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.
Hedil, Marcio; Kormelink, Richard
2016-07-23
The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Downey, Kay
2012-01-01
Kent State University has developed a centralized system that manages the communication and work related to the review and selection of commercially available electronic resources. It is an automated system that tracks the review process, provides selectors with price and trial information, and compiles reviewers' feedback about the resource. It…
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
Adaptation of the Four Forms of Employee Silence Scale in a Polish sample
Directory of Open Access Journals (Sweden)
Krystyna Adamska
2017-06-01
Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.
End-of-life resource recovery from emerging electronic products
DEFF Research Database (Denmark)
Parajuly, Keshav; Habib, Komal; Cimpan, Ciprian
2016-01-01
Integrating product design with appropriate end-of-life (EoL) processing is widely recognized to have huge potentials in improving resource recovery from electronic products. In this study, we investigate both the product characteristics and EoL processing of robotic vacuum cleaner (RVC), as a case...... of emerging electronic product, in order to understand the recovery fate of different materials and its linkage to product design. Ten different brands of RVC were dismantled and their material composition and design profiles were studied. Another 125 RVCs (349 kg) were used for an experimental trial...... at a conventional ‘shred-and-separate’ type preprocessing plant in Denmark. A detailed material flow analysis was performed throughout the recycling chain. The results show a mismatch between product design and EoL processing, and the lack of practical implementation of ‘Design for EoL’ thinking. In the best...
Decreasing erucic acid level by RNAi-mediated silencing of fatty ...
African Journals Online (AJOL)
To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...
Eyles, H; Rodgers, A; Ni Mhurchu, C
2010-02-01
Nutrition education may be most effective when personally tailored. Individualised electronic supermarket sales data offer opportunities to tailor nutrition education using shopper's usual food purchases. The present study aimed to use individualised electronic supermarket sales data to tailor nutrition resources for an ethnically diverse population in a large supermarket intervention trial in New Zealand. Culturally appropriate nutrition education resources (i.e. messages and shopping lists) were developed with the target population (through two sets of focus groups) and ethnic researchers. A nutrient database of supermarket products was developed using retrospective sales data and linked to participant sales to allow tailoring by usual food purchases. Modified Heart Foundation Tick criteria were used to identify 'healthier' products in the database suitable for promotion in the resources. Rules were developed to create a monthly report listing the tailored and culturally targeted messages to be sent to each participant, and to produce automated, tailored shopping lists. Culturally targeted nutrition messages (n = 864) and shopping lists (n = 3 formats) were developed. The food and nutrient database (n = 3000 top-selling products) was created using 12 months of retrospective sales data, and comprised 60%'healthier' products. Three months of baseline sales data were used to determine usual food purchases. Tailored resources were successfully mailed to 123 Māori, 52 Pacific and 346 non-Māori non-Pacific participants over the 6-month trial intervention period. Electronic supermarket sales data can be used to tailor nutrition education resources for a large number of ethnically diverse supermarket shoppers.
RNA silencing is required for Arabidopsis defence against Verticillium wilt disease
Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.
2009-01-01
RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,
Driving in unheard silence: Disability and the politics of shutting up.
Lourens, Heidi
2018-03-01
The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.
Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict
Directory of Open Access Journals (Sweden)
Line Kikkenborg Christensen
2018-02-01
Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.
Flexible tools for gene expression and silencing in tomato.
Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre
2009-12-01
As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.
Amusa, Oyintola Isiaka; Atinmo, Morayo
2016-01-01
(Purpose) This study surveyed the level of availability, use and constraints to use of electronic resources among law lecturers in Nigeria. (Methodology) Five hundred and fifty-two law lecturers were surveyed and four hundred and forty-two responded. (Results) Data analysis revealed that the level of availability of electronic resources for the…
Brescó de Luna, Ignacio
2018-05-04
This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.
Silence in liturgy as the space for the Holy Ghost’s activity
Directory of Open Access Journals (Sweden)
Adelajda Sielepin
2006-06-01
Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.
McHenry, Megan S; Fischer, Lydia J; Chun, Yeona; Vreeman, Rachel C
2017-08-01
The objective of this study is to conduct a systematic review of the literature of how portable electronic technologies with offline functionality are perceived and used to provide health education in resource-limited settings. Three reviewers evaluated articles and performed a bibliography search to identify studies describing health education delivered by portable electronic device with offline functionality in low- or middle-income countries. Data extracted included: study population; study design and type of analysis; type of technology used; method of use; setting of technology use; impact on caregivers, patients, or overall health outcomes; and reported limitations. Searches yielded 5514 unique titles. Out of 75 critically reviewed full-text articles, 10 met inclusion criteria. Study locations included Botswana, Peru, Kenya, Thailand, Nigeria, India, Ghana, and Tanzania. Topics addressed included: development of healthcare worker training modules, clinical decision support tools, patient education tools, perceptions and usability of portable electronic technology, and comparisons of technologies and/or mobile applications. Studies primarily looked at the assessment of developed educational modules on trainee health knowledge, perceptions and usability of technology, and comparisons of technologies. Overall, studies reported positive results for portable electronic device-based health education, frequently reporting increased provider/patient knowledge, improved patient outcomes in both quality of care and management, increased provider comfort level with technology, and an environment characterized by increased levels of technology-based, informal learning situations. Negative assessments included high investment costs, lack of technical support, and fear of device theft. While the research is limited, portable electronic educational resources present promising avenues to increase access to effective health education in resource-limited settings, contingent
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.
Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M
2017-10-10
The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.
Identification and characterization of two RNA silencing suppressors encoded by ophioviruses
Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura
2017-01-01
Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the
Directory of Open Access Journals (Sweden)
Cem KAHYA
2015-06-01
Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.
Directory of Open Access Journals (Sweden)
Zeenia Jagga
Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a
Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu
2016-11-01
Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.
Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide
Directory of Open Access Journals (Sweden)
Dacheng Liang
2014-12-01
Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.
Directory of Open Access Journals (Sweden)
Sheri L Lewis
Full Text Available Public health surveillance is undergoing a revolution driven by advances in the field of information technology. Many countries have experienced vast improvements in the collection, ingestion, analysis, visualization, and dissemination of public health data. Resource-limited countries have lagged behind due to challenges in information technology infrastructure, public health resources, and the costs of proprietary software. The Suite for Automated Global Electronic bioSurveillance (SAGES is a collection of modular, flexible, freely-available software tools for electronic disease surveillance in resource-limited settings. One or more SAGES tools may be used in concert with existing surveillance applications or the SAGES tools may be used en masse for an end-to-end biosurveillance capability. This flexibility allows for the development of an inexpensive, customized, and sustainable disease surveillance system. The ability to rapidly assess anomalous disease activity may lead to more efficient use of limited resources and better compliance with World Health Organization International Health Regulations.
Use and Cost of Electronic Resources in Central Library of Ferdowsi University Based on E-metrics
Directory of Open Access Journals (Sweden)
Mohammad Reza Davarpanah
2012-07-01
Full Text Available The purpose of this study was to investigate the usage of electronic journals in Ferdowsi University, Iran based on e-metrics. The paper also aimed to emphasize the analysis of cost-benefit and the correlation between the journal impact factors and the usage data. In this study experiences of Ferdowsi University library on licensing and usage of electronic resources was evaluated by providing a cost-benefit analysis based on the cost and usage statistics of electronic resources. Vendor-provided data were also compared with local usage data. The usage data were collected by tracking web-based access locally, and by collecting vender-provided usage data. The data sources were one-year of vendor-supplied e-resource usage data such as Ebsco, Elsevier, Proquest, Emerald, Oxford and Springer and local usage data collected from the Ferdowsi university web server. The study found that actual usage values differ for vendor-provided data and local usage data. Elsevier has got the highest usage degree in searches, sessions and downloads. Statistics also showed that a small number of journals satisfy significant amount of use while the majority of journals were used less frequent and some were never used at all. The users preferred the PDF rather than HTML format. The data in subject profile suggested that the provided e-resources were best suited to certain subjects. There was no correlation between IF and electronic journal use. Monitoring the usage of e-resources gained increasing importance for acquisition policy and budget decisions. The article provided information about local metrics for the six surveyed vendors/publishers, e.g. usage trends, requests per package, cost per use as related to the scientific specialty of the university.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-10-01
Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-12-01
Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
A conversation analysis of the function of silence in writing conferences
Directory of Open Access Journals (Sweden)
Milad Mirzaee
2016-07-01
Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.
DEFF Research Database (Denmark)
Bengtsson, Tea Torbenfeldt; Fynbo, Lars
2017-01-01
In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing
Directory of Open Access Journals (Sweden)
Adriana F. Fusaro
2017-10-01
Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.
Is our knowledge of voice and silence in organizations growing?
DEFF Research Database (Denmark)
Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine
2016-01-01
This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...
Sahu, H. K.; Singh, S. N.
2015-04-01
This paper discusses and presents a comparative case study of two libraries in Pune, India, Inter-University Centre for Astronomy and Astrophysics and Information Centre and Library of National Institute of Virology (Indian Council of Medical Research). It compares how both libraries have managed their e-resource collections, including acquisitions, subscriptions, and consortia arrangements, while also developing a collection of their own resources, including pre-prints and publications, video lectures, and other materials in an institutional repository. This study illustrates how difficult it is to manage electronic resources in a developing country like India, even though electronic resources are used more than print resources. Electronic resource management can be daunting, but with a systematic approach, various problems can be solved, and use of the materials will be enhanced.
Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.
Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan
2018-04-06
The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...
DEFF Research Database (Denmark)
Foote, Jonathan
2016-01-01
In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....
Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry
Directory of Open Access Journals (Sweden)
Mehdi Afkhami Ardakani
2015-05-01
Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and
Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.
Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E
2010-12-15
N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.
Veiled Word(s) – Sacred Silence
DEFF Research Database (Denmark)
Isar, Nicoletta
2014-01-01
or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Gómez-Tello, V; Latour-Pérez, J; Añón Elizalde, J M; Palencia-Herrejón, E; Díaz-Alersi, R; De Lucas-García, N
2006-01-01
Estimate knowledge and use habits of different electronic resources in a sample of Spanish intensivists: Internet, E-mail, distribution lists, and use of portable electronic devices. Self-applied questionnaire. A 50-question questionnaire was distributed among Spanish intensivists through the hospital marketing delegates of a pharmaceutical company and of electronic forums. A total of 682 questionnaires were analyzed (participation: 74%). Ninety six percent of those surveyed used Internet individually: 67% admitted training gap. Internet was the second source of clinical consultations most used (61%), slightly behind consultation to colleagues (65%). The pages consulted most were bibliographic databases (65%) and electronic professional journals (63%), with limited use of Evidence Based Medicine pages (19%). Ninety percent of those surveyed used e-mail regularly in the practice of their profession, although 25% admitted that were not aware of its possibilities. The use of E-mail decreased significantly with increase in age. A total of 62% of the intensivists used distribution lists. Of the rest, 42% were not aware of its existence and 32% admitted they had insufficient training to handle them. Twenty percent of those surveyed had portable electronic devices and 64% considered it useful, basically due to its rapid consultation at bedside. Female gender was a negative predictive factor of its use (OR 0.35; 95% CI 0.2-0.63; p=0.0002). A large majority of the Spanish intensivists use Internet and E-mail. E-mail lists and use of portable devices are still underused resources. There are important gaps in training and infrequent use of essential pages. There are specific groups that require directed educational policies.
Model of e-learning with electronic educational resources of new generation
A. V. Loban; D. A. Lovtsov
2017-01-01
Purpose of the article: improving of scientific and methodical base of the theory of the е-learning of variability. Methods used: conceptual and logical modeling of the е-learning of variability process with electronic educational resource of new generation and system analysis of the interconnection of the studied subject area, methods, didactics approaches and information and communication technologies means. Results: the formalization complex model of the е-learning of variability with elec...
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
Goodman, Kenneth; Grad, Roland; Pluye, Pierre; Nowacki, Amy; Hickner, John
2012-01-01
Introduction: Electronic knowledge resources have the potential to rapidly provide answers to clinicians' questions. We sought to determine clinicians' reasons for searching these resources, the rate of finding relevant information, and the perceived clinical impact of the information they retrieved. Methods: We asked general internists, family…
Electronic Document Management: A Human Resource Management Case Study
Directory of Open Access Journals (Sweden)
Thomas Groenewald
2004-11-01
Full Text Available This case study serve as exemplar regarding what can go wrong with the implementation of an electronic document management system. Knowledge agility and knowledge as capital, is outlined against the backdrop of the information society and knowledge economy. The importance of electronic document management and control is sketched thereafter. The literature review is concluded with the impact of human resource management on knowledge agility, which includes references to the learning organisation and complexity theory. The intervention methodology, comprising three phases, follows next. The results of the three phases are presented thereafter. Partial success has been achieved with improving the human efficacy of electronic document management, however the client opted to discontinue the system in use. Opsomming Die gevalle studie dien as voorbeeld van wat kan verkeerd loop met die implementering van ’n elektroniese dokumentbestuur sisteem. Teen die agtergrond van die inligtingsgemeenskap en kennishuishouding word kennissoepelheid en kennis as kapitaal bespreek. Die literatuurstudie word afgesluit met die inpak van menslikehulpbronbestuur op kennissoepelheid, wat ook die verwysings na die leerorganisasie en kompleksietydsteorie insluit. Die metodologie van die intervensie, wat uit drie fases bestaan, volg daarna. Die resultate van die drie fases word vervolgens aangebied. Slegs gedeelte welslae is behaal met die verbetering van die menslike doeltreffendheid ten opsigte van elektroniese dokumentbestuur. Die klient besluit egter om nie voort te gaan om die huidige sisteem te gebruik nie.
The effects of sedative music, arousal music, and silence on electrocardiography signals.
Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid
2011-01-01
Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.
Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S
2004-02-01
The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.
Directory of Open Access Journals (Sweden)
Soto Giselle
2008-11-01
Full Text Available Abstract Background Infectious disease surveillance is a primary public health function in resource-limited settings. In 2003, an electronic disease surveillance system (Alerta was established in the Peruvian Navy with support from the U.S. Naval Medical Research Center Detachment (NMRCD. Many challenges arose during the implementation process, and a variety of solutions were applied. The purpose of this paper is to identify and discuss these issues. Methods This is a retrospective description of the Alerta implementation. After a thoughtful evaluation according to the Centers for Disease Control and Prevention (CDC guidelines, the main challenges to implementation were identified and solutions were devised in the context of a resource-limited setting, Peru. Results After four years of operation, we have identified a number of challenges in implementing and operating this electronic disease surveillance system. These can be divided into the following categories: (1 issues with personnel and stakeholders; (2 issues with resources in a developing setting; (3 issues with processes involved in the collection of data and operation of the system; and (4 issues with organization at the central hub. Some of the challenges are unique to resource-limited settings, but many are applicable for any surveillance system. For each of these challenges, we developed feasible solutions that are discussed. Conclusion There are many challenges to overcome when implementing an electronic disease surveillance system, not only related to technology issues. A comprehensive approach is required for success, including: technical support, personnel management, effective training, and cultural sensitivity in order to assure the effective deployment of an electronic disease surveillance system.
The Role of Silence at the Retreats of a Buddhist Community
Directory of Open Access Journals (Sweden)
Orsolya Huszár
2016-12-01
Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.
The Application of Coconut Fiber as Dissipative Silencer
Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.
2017-01-01
Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.
Silencing Deafness: Displacing Disability in the Nineteenth Century
Directory of Open Access Journals (Sweden)
Esme Cleall
2015-03-01
Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.
Directory of Open Access Journals (Sweden)
Carlos R. Morales
2014-01-01
Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.
Friction coefficient measurements of silencers on specialized duct tract
Directory of Open Access Journals (Sweden)
Sehnalek Stanislav
2016-01-01
Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.
Energy Technology Data Exchange (ETDEWEB)
Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)
2013-05-10
Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.
Silence in the second language classroom
King, J
2013-01-01
Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing; Zhu, Jian-Kang
2010-01-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.
Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N
2018-02-01
Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Hale, LaDonna S; Wallace, Michelle M; Adams, Courtney R; Kaufman, Michelle L; Snyder, Courtney L
2015-09-01
Selecting resources to support didactic courses is a critical decision, and the advantages and disadvantages must be carefully considered. During clinical rotations, students not only need to possess strong background knowledge but also are expected to be proficient with the same evidence-based POC resources used by clinicians. Students place high value on “real world” learning and therefore may place more value on POC resources that they know practicing clinicians use as compared with medical textbooks. The condensed nature of PA education requires students to develop background knowledge and information literacy skills over a short period. One way to build that knowledge and those skills simultaneously is to use POC resources in lieu of traditional medical textbooks during didactic training. Electronic POC resources offer several advantages over traditional textbooks and should be considered as viable options in PA education.
Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio
2013-01-01
.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing
Directory of Open Access Journals (Sweden)
Elisabeth H. Vollmann
2017-06-01
Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Zlamparet, Gabriel I; Tan, Quanyin; Stevels, A B; Li, Jinhui
2018-03-01
This comparative research represents an example for a better conservation of resources by reducing the amount of waste (kg) and providing it more value under the umbrella of remanufacturing. The three discussed cases will expose three issues already addressed separately in the literature. The generation of waste electrical and electronic equipment (WEEE) interacts with the environmental depletion. In this article, we gave the examples of addressed issues under the concept of remanufacturing. Online collection opportunity eliminating classical collection, a business to business (B2B) implementation for remanufactured servers and medical devices. The material reuse (recycling), component sustainability, reuse (part harvesting), product reuse (after repair/remanufacturing) indicates the recovery potential using remanufacturing tool for a better conservation of resources adding more value to the products. Our findings can provide an overview of new system organization for the general collection, market potential and the technological advantages using remanufacturing instead of recycling of WEEE or used electrical and electronic equipment. Copyright © 2017. Published by Elsevier Ltd.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing
2010-05-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.
Directory of Open Access Journals (Sweden)
Sirjana Devi Shrestha
Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.
Directory of Open Access Journals (Sweden)
Chux Gervase Iwu
2016-09-01
Full Text Available This study set out to examine the effect of e-hrm systems in assisting human resource practitioners to execute their duties and responsibilities. In comparison to developed economies of the world, information technology adoption in sub-Saharan Africa has not been without certain glitches. Some of the factors that are responsible for these include poor need identification, sustainable funding, and insufficient skills. Besides these factors, there is also the issue of change management and users sticking to what they already know. Although, the above factors seem negative, there is strong evidence that information systems such as electronic human resource management present benefits to an organization. To achieve this, a dual research approach was utilized. Literature assisted immensely in both the development of the conceptual framework upon which the study hinged as well as in the development of the questionnaire items. The study also made use of an interview checklist to guide the participants. The findings reveal a mix of responses that indicate that while there are gains in adopting e-hrm systems, it is wiser to consider supporting resources as well as articulate the needs of the university better before any investment is made.
Electronic human resource management: Enhancing or entrancing?
Directory of Open Access Journals (Sweden)
Paul Poisat
2017-07-01
Full Text Available Orientation: This article provides an investigation into the current level of development of the body of knowledge related to electronic human resource management (e-HRM by means of a qualitative content analysis. Several aspects of e-HRM, namely definitions of e-HRM, the theoretical perspectives around e-HRM, the role of e-HRM, the various types of e-HRM and the requirements for successful e-HRM, are examined. Research purpose: The purpose of the article was to determine the status of e-HRM and examine the studies that report on the link between e-HRM and organisational productivity. Motivation for the study: e-HRM has the capacity to improve organisational efficiency and leverage the role of human resources (HR as a strategic business partner. Main findings: The notion that the implementation of e-HRM will lead to improved organisational productivity is commonly assumed; however, empirical evidence in this regard was found to be limited. Practical/managerial implications: From the results of this investigation it is evident that more research is required to gain a greater understanding of the influence of e-HRM on organisational productivity, as well as to develop measures for assessing this influence. Contribution: This article proposes additional areas to research and measure when investigating the effectiveness of e-HRM. It provides a different lens from which to view e-HRM assessment whilst keeping it within recognised HR measurement parameters (the HR value chain. In addition, it not only provides areas for measuring e-HRM’s influence but also provides important clues as to how the measurements may be approached.
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Development of a gene silencing DNA vector derived from a broad host range geminivirus
Directory of Open Access Journals (Sweden)
Hancock Leandria C
2009-07-01
Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.
Thompson, Hilaire J; Belza, Basia; Baker, Margaret; Christianson, Phyllis; Doorenbos, Ardith; Nguyen, Huong
2014-01-01
Enhancing existing curricula to meet newly published adult-gerontology advanced practice registered nurse (APRN) competencies in an efficient manner presents a challenge to nurse educators. Incorporating shared, published electronic learning resources (ELRs) in existing or new courses may be appropriate in order to assist students in achieving competencies. The purposes of this project were to (a) identify relevant available ELR for use in enhancing geriatric APRN education and (b) to evaluate the educational utility of identified ELRs based on established criteria. A multilevel search strategy was used. Two independent team members reviewed identified ELR against established criteria to ensure utility. Only resources meeting all criteria were retained. Resources were found for each of the competency areas and included formats such as podcasts, Web casts, case studies, and teaching videos. In many cases, resources were identified using supplemental strategies and not through traditional search or search of existing geriatric repositories. Resources identified have been useful to advanced practice educators in improving lecture and seminar content in a particular topic area and providing students and preceptors with additional self-learning resources. Addressing sustainability within geriatric APRN education is critical for sharing of best practices among educators and for sustainability of teaching and related resources. © 2014.
Rattanaumpawan, Pinyo; Boonyasiri, Adhiratha; Vong, Sirenda; Thamlikitkul, Visanu
2018-02-01
Electronic surveillance of infectious diseases involves rapidly collecting, collating, and analyzing vast amounts of data from interrelated multiple databases. Although many developed countries have invested in electronic surveillance for infectious diseases, the system still presents a challenge for resource-limited health care settings. We conducted a systematic review by performing a comprehensive literature search on MEDLINE (January 2000-December 2015) to identify studies relevant to electronic surveillance of infectious diseases. Study characteristics and results were extracted and systematically reviewed by 3 infectious disease physicians. A total of 110 studies were included. Most surveillance systems were developed and implemented in high-income countries; less than one-quarter were conducted in low-or middle-income countries. Information technologies can be used to facilitate the process of obtaining laboratory, clinical, and pharmacologic data for the surveillance of infectious diseases, including antimicrobial resistance (AMR) infections. These novel systems require greater resources; however, we found that using electronic surveillance systems could result in shorter times to detect targeted infectious diseases and improvement of data collection. This study highlights a lack of resources in areas where an effective, rapid surveillance system is most needed. The availability of information technology for the electronic surveillance of infectious diseases, including AMR infections, will facilitate the prevention and containment of such emerging infectious diseases. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].
Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie
2012-12-01
To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.
Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.
2016-01-01
The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…
Ramli, Rindra M.
2017-01-01
An overview of the Recommendation Study and the subsequent Implementation of a new Electronic Resources Management system ERMS in an international graduate research university in the Kingdom of Saudi Arabia. It covers the timeline, deliverables
Optical silencing of C. elegans cells with arch proton pump.
Directory of Open Access Journals (Sweden)
Ayako Okazaki
Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
Van der Heijden, Ingrid; Swartz, Sharlene
2010-04-01
In addressing the psychosocial effects of the HIV and AIDS pandemic among vulnerable children, the issue of bereavement appears inadequately addressed. Amid the global discourse on children orphaned and made vulnerable by HIV and AIDS, this paper explores how cultural contexts and social environments in South Africa shape children's experience of grief. The argument draws on a number of qualitative studies and uses empirical evidence from an evaluation of a peer-led HIV/AIDS-prevention strategy aimed at providing psychosocial support for 10- to 13-year-old South African children living in resource-poor communities. The paper reveals a central paradox regarding how the intervention's objective of talking about death and eliciting memories of deceased loved ones with young children is confounded by cultural practices located in notions of silence and the need to protect children. The paper acknowledges the 'culture of silence' surrounding death in some African contexts, but concludes that peer-led strategies have the potential to naturally circumvent these cultural taboos, simultaneously creating a much-needed space for young children to cry and talk among themselves, even if remaining silent at home in the presence of adults.
PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.
Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong
2017-02-01
Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong
2016-05-01
Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Epigenetic silencing of CYP24 in the tumor microenvironment
Johnson, Candace S.; Chung, Ivy; Trump, Donald L.
2010-01-01
Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059
F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function
Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique
2006-01-01
Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454
Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.
Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio
2016-09-01
We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.
Directory of Open Access Journals (Sweden)
Jiexiong Feng
Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.
Excavating silences and tensions of agency|passivity in science education reform
Rivera Maulucci, Maria S.
2010-12-01
I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.
Open-Source Electronic Health Record Systems for Low-Resource Settings: Systematic Review.
Syzdykova, Assel; Malta, André; Zolfo, Maria; Diro, Ermias; Oliveira, José Luis
2017-11-13
Despite the great impact of information and communication technologies on clinical practice and on the quality of health services, this trend has been almost exclusive to developed countries, whereas countries with poor resources suffer from many economic and social issues that have hindered the real benefits of electronic health (eHealth) tools. As a component of eHealth systems, electronic health records (EHRs) play a fundamental role in patient management and effective medical care services. Thus, the adoption of EHRs in regions with a lack of infrastructure, untrained staff, and ill-equipped health care providers is an important task. However, the main barrier to adopting EHR software in low- and middle-income countries is the cost of its purchase and maintenance, which highlights the open-source approach as a good solution for these underserved areas. The aim of this study was to conduct a systematic review of open-source EHR systems based on the requirements and limitations of low-resource settings. First, we reviewed existing literature on the comparison of available open-source solutions. In close collaboration with the University of Gondar Hospital, Ethiopia, we identified common limitations in poor resource environments and also the main requirements that EHRs should support. Then, we extensively evaluated the current open-source EHR solutions, discussing their strengths and weaknesses, and their appropriateness to fulfill a predefined set of features relevant for low-resource settings. The evaluation methodology allowed assessment of several key aspects of available solutions that are as follows: (1) integrated applications, (2) configurable reports, (3) custom reports, (4) custom forms, (5) interoperability, (6) coding systems, (7) authentication methods, (8) patient portal, (9) access control model, (10) cryptographic features, (11) flexible data model, (12) offline support, (13) native client, (14) Web client,(15) other clients, (16) code
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
Bibby, Chris; Hodgson, Murray
2017-01-01
The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.
Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio
2012-01-01
RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Directory of Open Access Journals (Sweden)
Ebrahim Parcham
2017-01-01
Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
The great silence science and philosophy of Fermi's paradox
Cirkovic, Milan M
2018-01-01
The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.
Surface functionalisation of PLGA nanoparticles for gene silencing
DEFF Research Database (Denmark)
Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob
2010-01-01
. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
Stiltner, G.J.
1990-01-01
In 1987, the Water Resources Division of the U.S. Geological Survey undertook three pilot projects to evaluate electronic report processing systems as a means to improve the quality and timeliness of reports pertaining to water resources investigations. The three projects selected for study included the use of the following configuration of software and hardware: Ventura Publisher software on an IBM model AT personal computer, PageMaker software on a Macintosh computer, and FrameMaker software on a Sun Microsystems workstation. The following assessment criteria were to be addressed in the pilot studies: The combined use of text, tables, and graphics; analysis of time; ease of learning; compatibility with the existing minicomputer system; and technical limitations. It was considered essential that the camera-ready copy produced be in a format suitable for publication. Visual improvement alone was not a consideration. This report consolidates and summarizes the findings of the electronic report processing pilot projects. Text and table files originating on the existing minicomputer system were successfully transformed to the electronic report processing systems in American Standard Code for Information Interchange (ASCII) format. Graphics prepared using a proprietary graphics software package were transferred to all the electronic report processing software through the use of Computer Graphic Metafiles. Graphics from other sources were entered into the systems by scanning paper images. Comparative analysis of time needed to process text and tables by the electronic report processing systems and by conventional methods indicated that, although more time is invested in creating the original page composition for an electronically processed report , substantial time is saved in producing subsequent reports because the format can be stored and re-used by electronic means as a template. Because of the more compact page layouts, costs of printing the reports were 15% to 25
Directory of Open Access Journals (Sweden)
Adrian Valli
Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Directory of Open Access Journals (Sweden)
Sajad Zare
2017-08-01
Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.
An investigation of noise produced by unsteady gas flow through silencer elements
Mawhinney, Graeme Hugh
This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.
Conifers have a unique small RNA silencing signature.
Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J
2008-08-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.
A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.
Directory of Open Access Journals (Sweden)
Pengfei Ding
2015-06-01
Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.
Directory of Open Access Journals (Sweden)
Velmurugan Chandran
2013-12-01
Full Text Available The present study aims to explore the use and user perception of electronic resources in Siva Institute of Frontier Technology, India. A total number of 123 users were taken into account for the study through a questionnaire-based survey method. A well-structured questionnaire was designed and distributed to the selected 200 students and staff members. 123 copies of the questionnaires were returned dully filled in and the overall response rate was 61.50 percent. The questionnaire contained both open- and close-ended questions. The collected data were classified, analyzed, and tabulated by using simple statistical methods. This study covers the impact of electronic resources on students and faculty in their academic pursuit.
International Nuclear Information System (INIS)
Oguchi, Masahiro; Murakami, Shinsuke; Sakanakura, Hirofumi; Kida, Akiko; Kameya, Takashi
2011-01-01
Highlights: → End-of-life electrical and electronic equipment (EEE) as secondary metal resources. → The content and the total amount of metals in specific equipment are both important. → We categorized 21 EEE types from contents and total amounts of various metals. → Important equipment types as secondary resources were listed for each metal kind. → Collectability and possible collection systems of various EEE types were discussed. - Abstract: End-of-life electrical and electronic equipment (EEE) has recently received attention as a secondary source of metals. This study examined characteristics of end-of-life EEE as secondary metal resources to consider efficient collection and metal recovery systems according to the specific metals and types of EEE. We constructed an analogy between natural resource development and metal recovery from end-of-life EEE and found that metal content and total annual amount of metal contained in each type of end-of-life EEE should be considered in secondary resource development, as well as the collectability of the end-of-life products. We then categorized 21 EEE types into five groups and discussed their potential as secondary metal resources. Refrigerators, washing machines, air conditioners, and CRT TVs were evaluated as the most important sources of common metals, and personal computers, mobile phones, and video games were evaluated as the most important sources of precious metals. Several types of small digital equipment were also identified as important sources of precious metals; however, mid-size information and communication technology (ICT) equipment (e.g., printers and fax machines) and audio/video equipment were shown to be more important as a source of a variety of less common metals. The physical collectability of each type of EEE was roughly characterized by unit size and number of end-of-life products generated annually. Current collection systems in Japan were examined and potentially appropriate collection
Tacit Authorization : A Legal Solution for Administrative Silence
Hoogstra, Nicole; de Graaf, K.J.
2016-01-01
This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if
The Shadow of Silence on the Sexual Rights of Married Iranian Women
Directory of Open Access Journals (Sweden)
Roksana Janghorban
2015-01-01
Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.
PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun
2017-02-02
Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati
2000-01-01
Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"
Directory of Open Access Journals (Sweden)
Yixiang Han
Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.
Directory of Open Access Journals (Sweden)
Ольга Юрьевна Заславская
2018-12-01
Full Text Available The article considers the influence of the development of technical means of teaching on the effectiveness of educational and methodical resources. Modern opportunities of information and communication technologies allow creating electronic educational resources that represent educational information that automates the learning process, provide information assistance, if necessary, collect and process statistical information on the degree of development of the content of the school material by schoolchildren, set an individual trajectory of learning, and so on. The main principle of data organization is the division of the training course into separate sections on the thematic elements and components of the learning process. General regularities include laws that encompass the entire didactic system, and in specific (particular cases, those whose actions extend to a separate component (aspect of the system. From the standpoint of the existence of three types of electronic training modules in the aggregate content of the electronic learning resource - information, control and module of practical classes - the principles of the formation of the electronic learning resource, in our opinion, should regulate all these components. Each of the certain principles is considered in the groups: scientific orientation, methodological orientation, systemic nature, accounting of interdisciplinary connections, fundamentalization, systematic and dosage sequence, rational use of study time, accessibility, minimization, operationalization of goals, unified identification diagnosis.
What does it take to break the silence in teams: Authentic leadership or proactive followership?
Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua
2017-01-01
Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in
LNA-antisense rivals siRNA for gene silencing
DEFF Research Database (Denmark)
Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan
2004-01-01
Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...
Resounding Silences : Subtle Norm Regulation in Everyday Interactions
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.
In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
Ramli, Rindra M.
2017-05-17
An overview of the Recommendation Study and the subsequent Implementation of a new Electronic Resources Management system ERMS in an international graduate research university in the Kingdom of Saudi Arabia. It covers the timeline, deliverables and challenges as well as lessons learnt by the Project Team.
Directory of Open Access Journals (Sweden)
Vijayalakshmi H Nagaraj
Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.
Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni
2015-12-02
Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Krutova Anzhelika S.
2017-06-01
Full Text Available The aim of the article is to develop the theoretical bases for the classification and coding of economic information and the scientific justification of the content of information resources of an electronic commerce enterprise. The essence of information resources for management of electronic business entities is investigated. It is proved that the organization of accounting in e-commerce systems is advisable to be built on the basis of two circuits: accounting for financial flows and accounting associated with transformation of business factors in products and services as a result of production activities. There presented a sequence of accounting organization that allows to combine the both circuits in a single information system, which provides a possibility for the integrated replenishment and distributed simultaneous use of the e-commerce system by all groups of users. It is proved that the guarantee of efficient activity of the information management system of electronic commerce entities is a proper systematization of the aggregate of information resources on economic facts and operations of an enterprise in accordance with the management tasks by building the hierarchy of accounting nomenclatures. It is suggested to understand nomenclature as an objective, primary information aggregate concerning a certain fact of the economic activity of an enterprise, which is characterized by minimum requisites, is entered into the database of the information system and is to be reflected in the accounting system. It is proposed to build a database of e-commerce systems as a part of directories (constants, personnel, goods / products, suppliers, buyers and the hierarchy of accounting nomenclatures. The package of documents regulating the organization of accounting at an enterprise should include: the provision on the accounting services, the order on the accounting policy, the job descriptions, the schedules of information exchange, the report card and
PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.
Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur
2017-07-01
Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
Breaking Classroom Silences: A View from Linguistic Ethnography
Rampton, Ben; Charalambous, Constadina
2016-01-01
This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…
Breaking the Silence Surrounding Mental Health on Campus
Roper, Larry D.
2013-01-01
Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L
DEFF Research Database (Denmark)
Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon
2017-01-01
Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...
Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.
2004-01-01
RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing
Underground laboratories: Cosmic silence, loud science
Energy Technology Data Exchange (ETDEWEB)
Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)
2010-01-01
Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.
Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo
2017-08-15
Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Controlling user access to electronic resources without password
Smith, Fred Hewitt
2015-06-16
Described herein are devices and techniques for remotely controlling user access to a restricted computer resource. The process includes pre-determining an association of the restricted computer resource and computer-resource-proximal environmental information. Indicia of user-proximal environmental information are received from a user requesting access to the restricted computer resource. Received indicia of user-proximal environmental information are compared to associated computer-resource-proximal environmental information. User access to the restricted computer resource is selectively granted responsive to a favorable comparison in which the user-proximal environmental information is sufficiently similar to the computer-resource proximal environmental information. In at least some embodiments, the process further includes comparing user-supplied biometric measure and comparing it with a predetermined association of at least one biometric measure of an authorized user. Access to the restricted computer resource is granted in response to a favorable comparison.
Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots
Directory of Open Access Journals (Sweden)
Ida Bagus Andika
2016-09-01
Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.
Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.
Rober, Peter; Rosenblatt, Paul C
2017-03-01
A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.
Goodfellow, L M
2009-06-01
A worldwide repository of electronic theses and dissertations (ETDs) could provide worldwide access to the most up-to-date research generated by masters and doctoral students. Until that international repository is established, it is possible to access some of these valuable knowledge resources. ETDs provide a technologically advanced medium with endless multimedia capabilities that far exceed the print and bound copies of theses and dissertations housed traditionally in individual university libraries. CURRENT USE: A growing trend exists for universities worldwide to require graduate students to submit theses or dissertations as electronic documents. However, nurse scholars underutilize ETDs, as evidenced by perusing bibliographic citation lists in many of the research journals. ETDs can be searched for and retrieved through several digital resources such as the Networked Digital Library of Theses and Dissertations (http://www.ndltd.org), ProQuest Dissertations and Theses (http://www.umi.com), the Australasian Digital Theses Program (http://adt.caul.edu.au/) and through individual university web sites and online catalogues. An international repository of ETDs benefits the community of nurse scholars in many ways. The ability to access recent graduate students' research electronically from anywhere in the world is advantageous. For scholars residing in developing countries, access to these ETDs may prove to be even more valuable. In some cases, ETDs are not available for worldwide access and can only be accessed through the university library from which the student graduated. Public access to university library ETD collections is not always permitted. Nurse scholars from both developing and developed countries could benefit from ETDs.
47 CFR 80.304 - Watch requirement during silence periods.
2010-10-01
....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...
Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C
2011-12-01
Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Cummings, A.; Chang, I.-J.
1988-11-01
Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.
Library resources on the Internet
Buchanan, Nancy L.
1995-07-01
Library resources are prevalent on the Internet. Library catalogs, electronic books, electronic periodicals, periodical indexes, reference sources, and U.S. Government documents are available by telnet, Gopher, World Wide Web, and FTP. Comparatively few copyrighted library resources are available freely on the Internet. Internet implementations of library resources can add useful features, such as full-text searching. There are discussion lists, Gophers, and World Wide Web pages to help users keep up with new resources and changes to existing ones. The future will bring more library resources, more types of library resources, and more integrated implementations of such resources to the Internet.
Directory of Open Access Journals (Sweden)
Hanoch Goldshmidt
2010-01-01
Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.
Directory of Open Access Journals (Sweden)
Fangfang Li
2017-09-01
Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.
Directory of Open Access Journals (Sweden)
Maria D. Tukalo
2013-09-01
Full Text Available This article contains material of some modern electronic educational resources that can be used via the Internet to support the modern chemistry classes in specialized school. It was drawn attention to the educational chemical experiments as means of knowledge; simulated key motivational characteristics to enhance students interest for learning subjects, their cognitive and practical activity in the formation of self-reliance and self-creative; commented forecasts for creating of conditions to enhance the creative potential of students in a modern learning environment.
Selection and Evaluation of Electronic Resources
Directory of Open Access Journals (Sweden)
Doğan Atılgan
2013-11-01
Full Text Available Publication boom and issues related to controlling and accession of printed sources have created some problems after World War II. Consequently, publishing industry has encountered the problem of finding possible solution for emerged situation. Industry of electronic publishing has started to improve with the rapid increase of the price of printed sources as well as the problem of publication boom. The first effects of electronic publishing were appeared on the academic and scholarly publications then electronic publishing became a crucial part of all types of publications. As a result of these developments, collection developments and service policies of information centers were also significantly changed. In this article, after a general introduction about selection and evaluation processes of electronic publications, the subscribed databases by a state and a privately owned university in Turkey and their usage were examined.
On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence
Directory of Open Access Journals (Sweden)
Beatrice Nori
2017-07-01
Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author identifies the broken syntax and the combination of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonment of chronological time in linguistic terms conveys the subjective, circular, and illogical element of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their present experiences. The present work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.
Ramli, Rindra M.
2017-01-01
An Exploratory study on KAUST library use of LibAnswers in resolving electronic resources questions received in LibAnswers. It describes the findings of the questions received in LibAnswers. The author made suggestions based on the findings to improve the reference services in responding to e-resources questions.
Ramli, Rindra M.
2017-05-03
An Exploratory study on KAUST library use of LibAnswers in resolving electronic resources questions received in LibAnswers. It describes the findings of the questions received in LibAnswers. The author made suggestions based on the findings to improve the reference services in responding to e-resources questions.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Directory of Open Access Journals (Sweden)
Snježana Pivac
2014-12-01
Full Text Available Performing business according to contemporary requirements influences companies for continuous usage of modern managerial tools, such as a human resource information system (HRIS and electronic recruitment (ER. Human resources have been recognised as curtail resources and the main source of a competitive advantage in creation of successful business performance. In order to attract and select the top employees, companies use quality information software for attracting internal ones, and electronic recruitment for attracting the best possible external candidates. The main aim of this paper is to research the level of the usage of HRIS and ER within medium-size and large Croatian companies. Moreover, the additional aim of this paper is to evaluate the relationship among the usage of these modern managerial tools and the overall success of human resource management within these companies. For the purpose of this paper, primary and secondary research has been conducted in order to reveal the level of the usage of HRIS and ER as well as the overall success of human resource management in Croatian companies. The companies’ classification (HRIS and ER is done by using the non-hierarchical k-means cluster method as well as the nonparametric Kruskal Wallis test. Further, the companies are ranked by the multicriteria PROMETHEE method. Relevant nonparametric tests are used for testing the overall companies’ HRM. Finally, binary logistic regression is estimated, relating binary variable HRM and HRIS development. After detailed research, it can be concluded that large Croatian companies apply HRIS in majority (with a positive relation to HRM performance, but still require certain degrees of its development.
The electronic encapsulation of knowledge in hydraulics, hydrology and water resources
Abbott, Michael B.
The rapidly developing practice of encapsulating knowledge in electronic media is shown to lead necessarily to the restructuring of the knowledge itself. The consequences of this for hydraulics, hydrology and more general water-resources management are investigated in particular relation to current process-simulation, real-time control and advice-serving systems. The generic properties of the electronic knowledge encapsulator are described, and attention is drawn to the manner in which knowledge 'goes into hiding' through encapsulation. This property is traced in the simple situations of pure mathesis and in the more complex situations of taxinomia using one example each from hydraulics and hydrology. The consequences for systems architectures are explained, pointing to the need for multi-agent architectures for ecological modelling and for more general hydroinformatics systems also. The relevance of these developments is indicated by reference to ongoing projects in which they are currently being realised. In conclusion, some more general epistemological aspects are considered within the same context. As this contribution is so much concerned with the processes of signification and communication, it has been partly shaped by the theory of semiotics, as popularised by Eco ( A Theory of Semiotics, Indiana University, Bloomington, 1977).
Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C
2012-01-01
RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.
Directory of Open Access Journals (Sweden)
Jinhuan Pang
Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.
Directory of Open Access Journals (Sweden)
H. M. Kravtsov
2013-03-01
Full Text Available Communication improving of educational processes requires today new approaches to the management arrangements and forming of educational policy in the field of distance learning, which is based on the use of modern information and communication technologies. An important step in this process is the continuous monitoring of the development and implementation of information technology and, in particular, the distance learning systems in higher educational establishments. The main objective of the monitoring is the impact assessment on the development of distance learning following the state educational standards, curricula, methodical and technical equipment and other factors; factors revelation that influence the implementation and outcomes of distance learning; results comparison of educational institution functioning and distance education systems in order to determine the most efficient ways of its development. The paper presents the analysis results of the dependence of the quality of educational services on the electronic educational resources. Trends in educational services development was studied by comparing the quality influence of electronic educational resources on the quality of educational services of higher pedagogical educational institutions of Ukraine as of 2009-2010 and 2012-2013. Generally, the analysis of the survey results allows evaluating quality of the modern education services as satisfactory and it can be said that almost 70% of the success of their future development depends on the quality of the used electronic educational resources and distance learning systems in particular.
Speaking of Silence: Comments from an Irish Studies Perspective
DEFF Research Database (Denmark)
McQuaid, Sara Dybris; Beville, Maria
2012-01-01
argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...
Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing
Ullman, Jacqueline; Ferfolja, Tania
2015-01-01
National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…
Habib, Komal; Parajuly, Keshav; Wenzel, Henrik
2015-10-20
Recovery of resources, in particular, metals, from waste flows is widely seen as a prioritized option to reduce their potential supply constraints in the future. The current waste electrical and electronic equipment (WEEE) treatment system is more focused on bulk metals, where the recycling rate of specialty metals, such as rare earths, is negligible compared to their increasing use in modern products, such as electronics. This study investigates the challenges in recovering these resources in the existing WEEE treatment system. It is illustrated by following the material flows of resources in a conventional WEEE treatment plant in Denmark. Computer hard disk drives (HDDs) containing neodymium-iron-boron (NdFeB) magnets were selected as the case product for this experiment. The resulting output fractions were tracked until their final treatment in order to estimate the recovery potential of rare earth elements (REEs) and other resources contained in HDDs. The results further show that out of the 244 kg of HDDs treated, 212 kg comprising mainly of aluminum and steel can be finally recovered from the metallurgic process. The results further demonstrate the complete loss of REEs in the existing shredding-based WEEE treatment processes. Dismantling and separate processing of NdFeB magnets from their end-use products can be a more preferred option over shredding. However, it remains a technological and logistic challenge for the existing system.
Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato
Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo
2016-12-01
Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.
Silencing cinema: film censorship around the world
Biltereyst, Daniël; Vande Winkel, Roel
2013-01-01
Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...
Small silencing RNAs: an expanding universe.
Ghildiyal, Megha; Zamore, Phillip D
2009-02-01
Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
FXR silencing in human colon cancer by DNA methylation and KRAS signaling.
Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L
2014-01-01
Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.
Duplication of an upstream silencer of FZP increases grain yield in rice.
Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong
2017-11-01
Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
Directory of Open Access Journals (Sweden)
Dashuai Mu
Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.
Directory of Open Access Journals (Sweden)
Gyöngyi Munkácsy
2016-01-01
Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.
Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong
2014-01-01
We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.
Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique
2007-09-18
Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.
Performances of Student Activism: Sound, Silence, Gender, and Dis/ability
Pasque, Penny A.; Vargas, Juanita Gamez
2014-01-01
This chapter explores the various performances of activism by students through sound, silence, gender, and dis/ability and how these performances connect to social change efforts around issues such as human trafficking, homeless children, hunger, and children with varying abilities.
Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S
2012-03-01
Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.
International Nuclear Information System (INIS)
Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.
2012-01-01
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.
Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.
Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R
2017-05-01
Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Relationship between Organizational Mobbing and Silence Behavior among Teachers
Hüsrevsahi, Selda Polat
2015-01-01
This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing
Kelleher, Erin S.
2016-01-01
Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614
High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.
Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert
2018-01-01
Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.
Derambure, C; Dzangue-Tchoupou, G; Berard, C; Vergne, N; Hiron, M; D'Agostino, M A; Musette, P; Vittecoq, O; Lequerré, T
2017-05-25
In the current context of personalized medicine, one of the major challenges in the management of rheumatoid arthritis (RA) is to identify biomarkers that predict drug responsiveness. From the European APPRAISE trial, our main objective was to identify a gene expression profile associated with responsiveness to abatacept (ABA) + methotrexate (MTX) and to understand the involvement of this signature in the pathophysiology of RA. Whole human genome microarrays (4 × 44 K) were performed from a first subset of 36 patients with RA. Data validation by quantitative reverse-transcription (qRT)-PCR was performed from a second independent subset of 32 patients with RA. Gene Ontology and WikiPathways database allowed us to highlight the specific biological mechanisms involved in predicting response to ABA/MTX. From the first subset of 36 patients with RA, a combination including 87 transcripts allowed almost perfect separation between responders and non-responders to ABA/MTX. Next, the second subset of patients 32 with RA allowed validation by qRT-PCR of a minimal signature with only four genes. This latter signature categorized 81% of patients with RA with 75% sensitivity, 85% specificity and 85% negative predictive value. This combination showed a significant enrichment of genes involved in electron transport chain (ETC) pathways. Seven transcripts from ETC pathways (NDUFA6, NDUFA4, UQCRQ, ATP5J, COX7A2, COX7B, COX6A1) were significantly downregulated in responders versus non-responders to ABA/MTX. Moreover, dysregulation of these genes was independent of inflammation and was specific to ABA response. Pre-silencing of ETC genes is associated with future response to ABA/MTX and might be a crucial key to susceptibility to ABA response.
Directory of Open Access Journals (Sweden)
Jérôme Meizoz
2009-10-01
Full Text Available Après la parution de Postures littéraires (2007 cet article revient sur la visée méthodologique de la notion de « posture », en la confrontant à deux notions voisines, celles d’« ethos » et d’« image d’auteur ». Il propose de hiérarchiser ces trois notions dans un ensemble conceptuel. Une brève analyse du Silence de la mer (1942 de Vercors illustre cette réflexion.After the publication of Literary postures (2007, this article revisits the methodological approach based on the notion of “posture” by comparing it with two related notions, “ethos” and “author’s image”. It shows how these three notions can be organized into a hierarchy inside an integrated conceptual whole. A brief analysis of Vercors’ TheSilence of the Sea (1942 illustrates this proposition.
Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.
2011-01-01
Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310
Exon silencing by UAGG motifs in response to neuronal excitation.
Directory of Open Access Journals (Sweden)
Ping An
2007-02-01
Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.
Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla
2015-11-01
and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers. Electronic supplementary information (ESI) available: Non-fusogenic liposomes; cytotoxicity of naked siRNA and the empty vector; immunogenicity; low-magnification images; DOPE/DPPC liposomes. See DOI: 10.1039/c5nr04807a
ABCE1 is a highly conserved RNA silencing suppressor.
Directory of Open Access Journals (Sweden)
Kairi Kärblane
Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.
Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A
2016-06-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.
Paul Leni’s Waxworks: Writing Images from Silence, through Media and Philosophy
Directory of Open Access Journals (Sweden)
Marcondes Ciro Inácio
2016-12-01
Full Text Available The so-called German Weimar Cinema encompasses a profusion of films that used frame narratives. In the case of Paul Leni’s Waxworks (Das Wachsfigurenkabinett, 1924, as the framing stems from a literary act (the stories are framed by the act of narration, the film proposes the mise-en-abyme technique as a sort of immersion into the intermedial when it deals with notions like speaking, writing, silence, image and cinema. In the case of silent cinema, and especially in Waxworks, the presence of a perverse relation with the medium of writing becomes noticeable (producing a fantasy of writing, since every effort to represent the literary act on film results in an infinite production of silent images, creating a parody effect and even postulating an act of aggression against writing. This confrontational relation between the writing code and the code of the mute image in silent cinema allows us to suggest that there is an inherent inflexibility in the language of silent cinema which does not allow the coexistence of written and spoken word as complementary codes. On the contrary, in silent cinema, the image and the silence of the film seem to work against the word, the spoken word being set forth against silence, and the written word against images.
Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M
2016-11-29
Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.
Directory of Open Access Journals (Sweden)
Belal Panahi
2012-04-01
Full Text Available Today, there is no doubt that in many organizations, many employees refuse to provide their opinions and comments about the organizational problems. In fact, in many organizations there is a created climate, which often makes employees feel their opinion is not valued. This phenomenon is examined as an organizational silence that by identifying the factors affecting on it we can effectively take steps to eliminate barriers to commenting staff in organizations. In this regard, this paper presents an empirical work conducted on data obtained from 260 employees Payame Noor University of East Azerbaijan Province. These data are analyzed by SPSS software and regression and path analysis tests. The results showed that there is a significant relationship between silence climate dimensions and employee organizational commitment with silence behavior employee. In addition, there is a positive correlation between higher management attitudes and supervisor’s attitudes with workers silent behavior. We have also observed that there is a negative correlation between communication opportunities and organizational commitment with employee silence behavior of employees.
Energy Technology Data Exchange (ETDEWEB)
Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)
2012-09-10
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
Directory of Open Access Journals (Sweden)
Amanda Ackley
2013-01-01
Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.
Using mobile electronic devices to deliver educational resources in developing countries.
Mazal, Jonathan Robert; Ludwig, Rebecca
2015-01-01
Developing countries have far fewer trained radiography professionals than developed countries, which exacerbates the limited access to imaging services. The lack of trained radiographers reflects, in part, limited availability of radiographer-specific educational resources. Historically, organizations that provided such resources in the developing world faced challenges related to the limited stock of current materials as well as expenses associated with shipping and delivery. Four mobile electronic devices (MEDs) were loaded with educational content (e-books, PDFs, and digital applications) spanning major radiography topics. The MEDs were distributed to 4 imaging departments in Ghana, India, Nepal, and Nigeria based on evidence of need for radiography-specific resources, as revealed by survey responses. A cost comparison of postal delivery vs digital delivery of educational content was performed. The effectiveness of delivering additional content via Wi-Fi transmission also was evaluated. Feedback was solicited on users' experience with the MEDs as a delivery tool for educational content. An initial average per e-book expense of $30.05, which included the cost of the device, was calculated for the MED delivery method compared with $15.56 for postal delivery of printed materials. The cost of the MED delivery method was reduced to an average of $10.05 for subsequent e-book deliveries. Additional content was successfully delivered via Wi-Fi transmission to all recipients during the 3-month follow-up period. Overall user feedback on the experience was positive, and ideas for enhancing the MED-based method were identified. Using MEDs to deliver radiography-specific educational content appears to be more cost effective than postal delivery of printed materials on a long-term basis. MEDs are more efficient for providing updates to educational materials. Customization of content to department needs, and using projector devices could enhance the usefulness of MEDs for
Shame and Silence | Janz | South African Journal of Philosophy
African Journals Online (AJOL)
Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M
2002-01-01
Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...
Fritz, Fleur; Tilahun, Binyam; Dugas, Martin
2015-03-01
Electronic medical record (EMR) systems have the potential of supporting clinical work by providing the right information at the right time to the right people and thus make efficient use of resources. This is especially important in low-resource settings where reliable data are also needed to support public health and local supporting organizations. In this systematic literature review, our objectives are to identify and collect literature about success criteria of EMR implementations in low-resource settings and to summarize them into recommendations. Our search strategy relied on PubMed queries and manual bibliography reviews. Studies were included if EMR implementations in low-resource settings were described. The extracted success criteria and measurements were summarized into 7 categories: ethical, financial, functionality, organizational, political, technical, and training. We collected 381 success criteria with 229 measurements from 47 articles out of 223 articles. Most papers were evaluations or lessons learned from African countries, published from 1999 to 2013. Almost half of the EMR systems served a specific disease area like human immunodeficiency virus (HIV). The majority of criteria that were reported dealt with the functionality, followed by organizational issues, and technical infrastructures. Sufficient training and skilled personnel were mentioned in roughly 10%. Political, ethical, and financial considerations did not play a predominant role. More evaluations based on reliable frameworks are needed. Highly reliable data handling methods, human resources and effective project management, as well as technical architecture and infrastructure are all key factors for successful EMR implementation. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The effects of thinking in silence on creativity and innovation
de Vet, A.J.
2007-01-01
This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju
2016-01-01
This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.
Directory of Open Access Journals (Sweden)
Yan Liang
2013-11-01
Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.
RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).
Dare, Andrew P; Hellens, Roger P
2013-08-01
Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.
International Nuclear Information System (INIS)
Liu Xiaoqun; Qiao Tiankui
2014-01-01
Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)
Wu, H; Zhang, J; Shi, H
2016-01-01
Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.
Identification of a maize chlorotic dwarf virus silencing suppressor protein
Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...
Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing
Directory of Open Access Journals (Sweden)
Chantelle Ahlenstiel
2015-01-01
Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.
Electronic Human Resources Management (e-HRM Adoption Studies: Past and Future Research
Directory of Open Access Journals (Sweden)
Winarto Winarto
2018-05-01
Full Text Available Electronic human resource management (e-HRM systems become more widely used by profit and non-profit organization. However, the field currently lacks sound theoretical frameworks that can be useful in addressing a key issue concerning the implementation of e-HRM systems, in particular to obtain a better understanding of the factors influencing the adoption of e-HRM systems. The objective of this paper is to provide a foundation towards the development of a theoretical framework for the implementation of e-HRM systems and develop a conceptual model that would reflect the nature of e-HRM systems’ adoption through systematic literature review. Adopting Crossan and Apaydin’s procedure of systematic review, this paper investigated 21 empirical papers of electronics human resources management, then categorized them into 4 characteristics which influence the adoption; System and technology characteristics; Organizational characteristics; User/individual characteristics, and Environmental and contextual characteristics. Finally, the e-HRM adoption research framework is drawn and based on the framework; avenues for future research are discussed. Bahasa Indonesia Abstrak: Manajemen sumber daya manusia elektronik (selanjutnya disebut dengan e-HRM semakin banyak digunakan oleh organisasi profit dan nonprofit. Namun, bidang dan topik ini belum memiliki kerangka teori yang mapan, yang dapat digunakan untuk menganalisis isu-isu terkait penerapan e-HRM, terutama mengenai faktor-faktor yang mempengaruhi adopsi sistem e-HRM. Tujuan penelitian ini adalah untuk memberikan landasan bagi pengembangan kerangka teoritis untuk implementasi sistem e-HRM dan mengembangkan model konseptual yang akan menggambarkan adopsi sistem e-HRM melalui tinjauan literatur sistematis. Mengadopsi prosedur dan metode Crossan dan Apaydin untuk melakukan telaah literatur secara sistematis, paper ini menyelidiki 21 publikasi empiris manajemen sumber daya manusia elektronik dari 2
Directory of Open Access Journals (Sweden)
Ellen Ramvi
2017-09-01
Full Text Available Background: Empirical studies on healthcare personnel indicate that professionals’ experiences with dying and death become silenced and unutterable within the healthcare service. Aim: To explore and interpret silence about encounters with death and dying among healthcare professionals in Norway. Method: The method used was theoretical exploration, using a psychosocial approach. Findings: This analysis reveals complex interrelations and two-way dynamics between subject-worlds, sociocultural and societal worlds when it comes to dealing with death and dying at work. A performance culture saturates these worlds, and may be implicated in silencing death within the healthcare institutions of the Norwegian welfare state. Conclusions: This article suggests that silence about death and dying among healthcare professionals is indicative of crucial emerging and unresolved tensions in the neoliberal episteme, accompanied and reinforced by the ineluctable basic conditions of life and intrapsychic defence against threats towards the self. Implications for practice: Silence about death and dying presents a serious challenge for dying patients and next of kin. Healthcare professionals should be enabled to acknowledge their thoughts and emotions about death in order to be able to support and contain patients and next of kin Learning activities such as peer support and supervision can help the processing of difficult psychological content and allow for emotional aspects of professionals’ work to be acknowledged and thought about in a way that encourages reflective and sound practice Clinical managers should address whether performance pressures induce shameful feelings in staff, who may believe that by providing appropriate levels of care they are compromising productivity. Shame in turn, may undermine professionals’ emotional wellbeing and ability to continue to provide attuned and adequate care for dying patients Creative approaches to facilitate
Silence is golden : keeping a lid on noise quiets opposition to oilpatch operations
International Nuclear Information System (INIS)
Macedo, R.
2006-01-01
Record levels of drilling activity have led to denser well spacings that are often close to residential areas. Many oil and gas operators are now investing in noise suppression technology in order to suppress public concern over noise levels. This article reviewed some new silencing technologies available to the oil and gas industry. Issues concerning permissible sound levels for remote facilities were discussed. Silencing equipment details were presented for turbine exhaust engines, turbo inlet systems, reciprocating engines, and specialty silencers for ventilation systems. Issues concerning acoustical systems and retrofits for existing buildings were also examined. It was noted that a new muffler has been acoustically engineered to provide engine exhaust noise removal along with an internal acoustic treatment to eliminate radiated noise from the muffler shell. The loudest noise source at a compression station is often the engine exhaust of large reciprocating engines. Various computer programs are now available that analyze noise, create models to predict noise levels in decibels for nearby residents, and help to engineer noise control plans. It was concluded that many of the new sound-proofing technologies for the walls and roofs of buildings and enclosures were developed during the design of new compression units built by TransCanada Pipeline on main pipelines across Canada. 2 figs
Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian
2012-07-01
HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.
Wang, Dong; Fan, Yuhong; Zhang, Jianjun
2013-01-01
Inhibition of neurite growth, which is in large part mediated by the Nogo-66 receptor, affects neural regeneration following bone marrow mesenchymal stem cell transplantation. The tissue engineering scaffold poly(D,L-lactide-co-glycolic acid) has good histocompatibility and can promote the growth of regenerating nerve fibers. The present study used small interfering RNA to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells and Schwann cells, which were subsequently transplanted with poly(D,L-lactide-co-glycolic acid) into the spinal cord lesion regions in rats. Simultaneously, rats treated with scaffold only were taken as the control group. Hematoxylin-eosin staining and immunohistochemistry revealed that at 4 weeks after transplantation, rats had good motor function of the hind limb after treatment with Nogo-66 receptor gene-silenced cells plus the poly(D,L-lactide-co-glycolic acid) scaffold compared with rats treated with scaffold only, and the number of bone marrow mesenchymal stem cells and neuron-like cells was also increased. At 8 weeks after transplantation, horseradish peroxidase tracing and transmission electron microscopy showed a large number of unmyelinated and myelinated nerve fibers, as well as intact regenerating axonal myelin sheath following spinal cord hemisection injury. These experimental findings indicate that transplantation of Nogo-66 receptor gene-silenced bone marrow mesenchymal stem cells and Schwann cells plus a poly(D,L-lactide-co-glycolic acid) scaffold can significantly enhance axonal regeneration of spinal cord neurons and improve motor function of the extremities in rats following spinal cord injury. PMID:25206713
Improving Electronic Resources through Holistic Budgeting
Kusik, James P.; Vargas, Mark A.
2009-01-01
To establish a more direct link between its collections and the educational goals of Saint Xavier University, the Byrne Memorial Library has adopted a "holistic" approach to collection development. This article examines how traditional budget practices influenced the library's selection of resources and describes how holistic collection…
Hush… : The Dangers of Silence in Academic Libraries
Directory of Open Access Journals (Sweden)
Jessica Schomberg
2017-04-01
Full Text Available In Brief This article critiques the idea that civility rhetoric decreases workplace bullying or discrimination. We use Critical Discourse Analysis (CDA to do a rhetorical analysis of a campus-wide civility campaign in contrast with literature about civility in libraries. To combat discrimination and bullying, we need to be attentive to systemic power dynamics and to rhetoric designed to enforce compliance and conformity. We conclude with recommendations about how to raise our voices instead of silencing our peers.
After Brown U.'s Report on Slavery, Silence (So Far)
Bartlett, Thomas
2006-01-01
This article, discusses Brown University's slavery report, a 106-page narrative examination of the early connections between Brown University and slavery, that has been greeted--so far--with silence. The report, done at the behest of Ruth J. Simmons, Brown's president and herself a descendant of slaves, is an unsparing look at a shameful side of…
Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C
2013-12-23
Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure
Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio
2006-10-01
Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.
Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.
2014-01-01
SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185
Directory of Open Access Journals (Sweden)
Martha Ingrid Preddie
2008-03-01
Full Text Available Objective – To determine if electronic information resources selected by primary care physicians improve their ability to answer simulated clinical questions.Design – An observational study utilizing hour‐long interviews and think‐aloud protocols.Setting – The offices and clinics of primary care physicians in Canada and the United States.Subjects – Twenty‐five primary care physicians of whom 4 were women, 17 were from Canada, 22 were family physicians,and 24 were board certified.Methods – Participants provided responses to 23 multiple‐choice questions. Each physician then chose two questions and looked for the answers utilizing information resources of their own choice. The search processes, chosen resources and search times were noted. These were analyzed along with data on the accuracy of the answers and certainties related to the answer to each clinical question prior to the search.Main results – Twenty‐three physicians sought answers to 46 simulated clinical questions. Utilizing only electronic information resources, physicians spent a mean of 13.0 (SD 5.5 minutes searching for answers to the questions, an average of 7.3(SD 4.0 minutes for the first question and 5.8 (SD 2.2 minutes to answer the second question. On average, 1.8 resources were utilized per question. Resources that summarized information, such as the Cochrane Database of Systematic Reviews, UpToDate and Clinical Evidence, were favored 39.2% of the time, MEDLINE (Ovid and PubMed 35.7%, and Internet resources including Google 22.6%. Almost 50% of the search and retrieval strategies were keyword‐based, while MeSH, subheadings and limiting were used less frequently. On average, before searching physicians answered 10 of 23 (43.5% questions accurately. For questions that were searched using clinician‐selected electronic resources, 18 (39.1% of the 46 answers were accurate before searching, while 19 (42.1% were accurate after searching. The difference of
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.
Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide
2017-10-13
Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Effects of neoliberal rationality in speeches on inclusion: the teacher’s silence
Directory of Open Access Journals (Sweden)
Leandra Boer Possa
2013-06-01
Full Text Available This text, which makes use of the National Policy on Special Education in the Perspective of Inclusive Education and the programs that embrace the training of teachers for diversity/ inclusion, puts the discursive effects of these documents in analytic sets. Without attempting at doing an exhaustive analysis, this study aims at problematizing the effect of teacher’s silence that the neoliberal policy has been producing on teachers who work in municipal and state education systems in Santa Maria area. The conceptual and methodological tool of governmentality is used in this enterprise in order to think that the discourses of inclusion have convinced and subjectivized teachers, because in the face of the irreducibility of this discursive network the silence is an effect of the production and consumption of the principle of inclusion and enterprise itself.
Friege, Henning
2012-09-01
For waste from electric and electronic equipment, the WEEE Directive stipulates the separate collection of electric and electronic waste. As to new electric and electronic devices, the Restriction of Hazardous Substances (RoHS) Directive bans the use of certain chemicals dangerous for man and environment. From the implementation of the WEEE directive, many unsolved problems have been documented: poor collection success, emission of dangerous substances during collection and recycling, irretrievable loss of valuable metals among others. As to RoHS, data from the literature show a satisfying success. The problems identified in the process can be reduced to some basic dilemmas at the borders between waste management, product policy and chemical safety. The objectives of the WEEE Directive and the specific targets for use and recycling of appliances are not consistent. There is no focus on scarce resources. Extended producer responsibility is not sufficient to guarantee sustainable waste management. Waste management reaches its limits due to problems of implementation but also due to physical laws. A holistic approach is necessary looking at all branch points and sinks in the stream of used products and waste from electric and electronic equipment. This may be done with respect to the general rules for sustainable management of material streams covering the three dimensions of sustainable policy. The relationships between the players in the field of electric and electronic devices have to be taken into account. Most of the problems identified in the implementation process will not be solved by the current amendment of the WEEE Directive.
Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit
2016-10-01
Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.
Hartnett, Eric; Beh, Eugenia; Resnick, Taryn; Ugaz, Ana; Tabacaru, Simona
2013-01-01
In 2010, after two previous unsuccessful attempts at electronic resources management system (ERMS) implementation, Texas A&M University (TAMU) Libraries set out once again to find an ERMS that would fit its needs. After surveying the field, TAMU Libraries selected the University of Notre Dame Hesburgh Libraries-developed, open-source ERMS,…
Idris, Ali
2010-12-01
A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna
2012-11-07
CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
International Nuclear Information System (INIS)
Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei
2012-01-01
Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.
Directory of Open Access Journals (Sweden)
Guillaume Jannot
2016-12-01
Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.
Strategic Silence as a Tool of Political Communication: A Reflection ...
African Journals Online (AJOL)
Politics is said to be a game of intrigues and part of that is the use of silence as a means of communication. This may sound strange as communication itself connotes the art of expression. However in politics, a political actor may chose to remain silent as a means of passing a message across to the public in a trouble ...
Directory of Open Access Journals (Sweden)
Mirali Seyednaghavi
2017-06-01
Full Text Available : In the first phase of this study a model for electronic human resource management in government agencies based on new public services was explored by using software MAXQDA, then in the second phase, relationship between the elements of the theory were tested using software Smart PLS2. So the aim of this study is to design a model of electronic human resource management’s implementation at the Ministry of Communications and Information Technology. In this regard, according to Strauss and Corbin’s structured plan, five hypotheses were tested. Quantitative data analysis indicates that the pressures of the policies and global perspectives cause to move toward e-HRM. Among the contextual conditions macro structural mechanisms, considerations of actors, governance considerations have a significant impact on the strategy of new public services and therefore lead to the consequences of its implementation in public organizations. The findings suggest that e-HRM does not have a positive and meaningful impact on new public services, and in our country, although the recent political developments have somehow removed the gap between public policy makers, administrators, and the public, but there is still a long way to go.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the
The Ebola virus VP35 protein is a suppressor of RNA silencing
Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.
2007-01-01
RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is
ATR acts stage specifically to regulate multiple aspects of mammalian meiotic silencing
Royo, Hélène; Prosser, Haydn; Ruzankina, Yaroslava; Mahadevaiah, Shantha K.; Cloutier, Jeffrey M.; Baumann, Marek; Fukuda, Tomoyuki; Höög, Christer; Tóth, Attila; de Rooij, Dirk G.; Bradley, Allan; Brown, Eric J.; Turner, James M. A.
2013-01-01
In mammals, homologs that fail to synapse during meiosis are transcriptionally inactivated. This process, meiotic silencing, drives inactivation of the heterologous XY bivalent in male germ cells (meiotic sex chromosome inactivation [MSCI]) and is thought to act as a meiotic surveillance mechanism.
Zheng, Zhimin
2010-01-06
RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.
Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique
2015-10-02
Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN
Mei, Yu; Kernodle, Bliss M.; Hill, John H.
2016-01-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311
MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense
Directory of Open Access Journals (Sweden)
Sheng-Rui Liu
2017-09-01
Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.
Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity
DEFF Research Database (Denmark)
Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C
2011-01-01
expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...
Silenced uses and moral ideals in the exchange of Danish blood and plasma
DEFF Research Database (Denmark)
Sheikh, Zainab Afshan; Deleuran, Ida; Hoeyer, Klaus
2016-01-01
This article explores the interplay between cultural discourses, moral reasoning and silenced uses in the international exchange of Danish blood plasma. Campaigns, policymakers, health professionals working in the blood banks – and even donors – consistently refer to ideals portraying blood....... However, we find that available cultural discourses poorly capture the moral reasoning among many donors. In fact, when informed about the existing forms of tender, plasma trade sounds like a good idea to most of them. Furthermore, they are not particularly interested in information. We argue...... that the silencing of trade is infusing the system with an unnecessary vulnerability that could easily be avoided with a different communication strategy towards donors. To arrive at new and better strategies, however, one must move beyond the immediate words and reactions of donors contemplating trade and seek...
Directory of Open Access Journals (Sweden)
Paul McVeigh
2014-09-01
Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control
Directory of Open Access Journals (Sweden)
Liu X
2016-04-01
Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial
Directory of Open Access Journals (Sweden)
Ольга Николаевна Крылова
2009-06-01
Full Text Available The article introduces some results of research, which were devoted to evaluation of tearches' mobility to introduce innovations in the contents of education. The author considers innovative potential of modules of the methodical support for system of electronic educational resources.
Excavating Silences and Tensions of Agency|Passivity in Science Education Reform
Rivera Maulucci, Maria S.
2010-01-01
I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve…
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Directory of Open Access Journals (Sweden)
Tanurdzic Milos
2004-04-01
Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
Directory of Open Access Journals (Sweden)
Praveen Guleria
Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.
Selective memory retrieval in social groups: When silence is golden and when it is not.
Abel, Magdalena; Bäuml, Karl-Heinz T
2015-07-01
Previous research has shown that the selective remembering of a speaker and the resulting silences can cause forgetting of related, but unmentioned information by a listener (Cuc, Koppel, & Hirst, 2007). Guided by more recent work that demonstrated both detrimental and beneficial effects of selective memory retrieval in individuals, the present research explored the effects of selective remembering in social groups when access to the encoding context at retrieval was maintained or impaired. In each of three experiments, selective retrieval by the speaker impaired recall of the listener when access to the encoding context was maintained, but it improved recall of the listener when context access was impaired. The results suggest the existence of two faces of selective memory retrieval in social groups, with a detrimental face when the encoding context is still active at retrieval and a beneficial face when it is not. The role of silence in social recall thus seems to be more complex than was indicated in prior work, and mnemonic silences on the part of a speaker can be "golden" for the memories of a listener under some circumstances, but not be "golden" under others. Copyright © 2015 Elsevier B.V. All rights reserved.
Akussah, Maxwell; Asante, Edward; Adu-Sarkodee, Rosemary
2015-01-01
The study investigates the relationship between impact of electronic resources and its usage in academic libraries in Ghana: evidence from Koforidua Polytechnic & All Nations University College, Ghana. The study was a quantitative approach using questionnaire to gather data and information. A valid response rate of 58.5% was assumed. SPSS…
Directory of Open Access Journals (Sweden)
Jose C Garcia-Garcia
2009-06-01
Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.
Dillard, Caroline; Narbonne-Reveau, Karine; Foppolo, Sophie; Lanet, Elodie; Maurange, Cédric
2018-01-25
Whether common principles regulate the self-renewing potential of neural stem cells (NSCs) throughout the developing central nervous system is still unclear. In the Drosophila ventral nerve cord and central brain, asymmetrically dividing NSCs, called neuroblasts (NBs), progress through a series of sequentially expressed transcription factors that limits self-renewal by silencing a genetic module involving the transcription factor Chinmo. Here, we find that Chinmo also promotes neuroepithelium growth in the optic lobe during early larval stages by boosting symmetric self-renewing divisions while preventing differentiation. Neuroepithelium differentiation in late larvae requires the transcriptional silencing of chinmo by ecdysone, the main steroid hormone, therefore allowing coordination of neural stem cell self-renewal with organismal growth. In contrast, chinmo silencing in NBs is post-transcriptional and does not require ecdysone. Thus, during Drosophila development, humoral cues or tissue-intrinsic temporal specification programs respectively limit self-renewal in different types of neural progenitors through the transcriptional and post-transcriptional regulation of the same transcription factor. © 2018. Published by The Company of Biologists Ltd.
Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin
2014-06-01
To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.
Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun
Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.
Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.
Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand
2011-05-01
There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.
Efficient transformation and artificial miRNA gene silencing in Lemna minor.
Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R
2015-01-01
Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.
Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455
Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W
Lou, Yonggen; Baldwin, Ian T.
2006-01-01
Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381
DEFF Research Database (Denmark)
Daniel, Sarah Ingrid Franksdatter; Folke, Sofie; Lunn, Susanne
2018-01-01
Objective: The association between in-session silences and client attachment, therapeutic alliance, and treatment outcome was investigated in two treatments for bulimia nervosa. Method: 69 women and one man were randomized to two years of psychoanalytic psychotherapy (PPT) or 20 sessions of cogni......Objective: The association between in-session silences and client attachment, therapeutic alliance, and treatment outcome was investigated in two treatments for bulimia nervosa. Method: 69 women and one man were randomized to two years of psychoanalytic psychotherapy (PPT) or 20 sessions...
Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M
2014-10-01
Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing
Owolabi, Sola; Idowu, Oluwafemi A.; Okocha, Foluke; Ogundare, Atinuke Omotayo
2016-01-01
The study evaluated utilization of electronic information resources by undergraduates in the Faculties of Education and the Social Sciences in University of Ibadan. The study adopted a descriptive survey design with a study population of 1872 undergraduates in the Faculties of Education and the Social Sciences in University of Ibadan, from which a…
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Shaping the Electronic Library--The UW-Madison Approach.
Dean, Charles W., Ed.; Frazier, Ken; Pope, Nolan F.; Gorman, Peter C.; Dentinger, Sue; Boston, Jeanne; Phillips, Hugh; Daggett, Steven C.; Lundquist, Mitch; McClung, Mark; Riley, Curran; Allan, Craig; Waugh, David
1998-01-01
This special theme section describes the University of Wisconsin-Madison's experience building its Electronic Library. Highlights include integrating resources and services; the administrative framework; the public electronic library, including electronic publishing capability and access to World Wide Web-based and other electronic resources;…
The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens
International Nuclear Information System (INIS)
Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki
2004-01-01
Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms
The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.
Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki
2004-03-01
Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.
Epigenetic silencing of serine protease HTRA1 drives polyploidy
International Nuclear Information System (INIS)
Schmidt, Nina; Irle, Inga; Ripkens, Kamilla; Lux, Vanda; Nelles, Jasmin; Johannes, Christian; Parry, Lee; Greenow, Kirsty; Amir, Sarah; Campioni, Mara; Baldi, Alfonso; Oka, Chio; Kawaichi, Masashi; Clarke, Alan R.; Ehrmann, Michael
2016-01-01
Increased numbers and improperly positioned centrosomes, aneuploidy or polyploidy, and chromosomal instability are frequently observed characteristics of cancer cells. While some aspects of these events and the checkpoint mechanisms are well studied, not all players have yet been identified. As the role of proteases other than the proteasome in tumorigenesis is an insufficiently addressed question, we investigated the epigenetic control of the widely conserved protease HTRA1 and the phenotypes of deregulation. Mouse embryonal fibroblasts and HCT116 and SW480 cells were used to study the mechanism of epigenetic silencing of HTRA1. In addition, using cell biological and genetic methods, the phenotypes of downregulation of HTRA1 expression were investigated. HTRA1 is epigenetically silenced in HCT116 colon carcinoma cells via the epigenetic adaptor protein MBD2. On the cellular level, HTRA1 depletion causes multiple phenotypes including acceleration of cell growth, centrosome amplification and polyploidy in SW480 colon adenocarcinoma cells as well as in primary mouse embryonic fibroblasts (MEFs). Downregulation of HTRA1 causes a number of phenotypes that are hallmarks of cancer cells suggesting that the methylation state of the HtrA1 promoter may be used as a biomarker for tumour cells or cells at risk of transformation. The online version of this article (doi:10.1186/s12885-016-2425-8) contains supplementary material, which is available to authorized users
A Day of Silence, a Day of Truth, and a Lawsuit
Fusarelli, Bonnie C.; Eaton, Lucy E.
2011-01-01
This case study focuses on issues of freedom of speech and freedom of religion in public schools. It involves a rural, southern high school where a group of students participated in a Day of Silence. The school allowed the students to participate based on the principal's understanding of the students' First Amendment rights. However, the next day,…
Breaking the culture of silence in checkmating HIV/AIDS as a ...
African Journals Online (AJOL)
In my investigation I set out to break the HIV/AIDS culture of silence and emphasize the role of the teacher as a researcher and critical change agent in an HIV/AIDS challenged society. My work demonstrates how teachers could play such a role by encouraging learners' participation in sport. The sport, I focussed on in my ...
Public privacy: Reciprocity and Silence
Directory of Open Access Journals (Sweden)
Jenny Kennedy
2014-10-01
Full Text Available In his 1958 poem 'Dedication to my Wife' TS Eliot proclaims "these are private words addressed to you in public". Simultaneously written for his wife, Valerie Fletcher, and to the implied you of a discourse network, Eliot's poem helps to illustrate the narrative voices and silences that are constitutive of an intimate public sphere. This paper situates reciprocity as a condition of possibility for public privacy. It shows how reciprocity is enabled by systems of code operating through material and symbolic registers. Code promises to control communication, to produce neutral, systemic forms of meaning. Yet such automation is challenged by uneven and fragmented patterns of reciprocity. Moreover, examining the media of public privacy reveals historical trajectories important for understanding contemporary sociotechnical platforms of reciprocity. To explore the implicit requirement of reciprocity in publicly private practices, three sites of communication are investigated framed by a media archaeology perspective: postal networks, the mailart project PostSecret and the anonymous zine 'You'.
Controlling user access to electronic resources without password
Smith, Fred Hewitt
2017-08-22
Described herein are devices and techniques for remotely controlling user access to a restricted computer resource. The process includes obtaining an image from a communication device of a user. An individual and a landmark are identified within the image. Determinations are made that the individual is the user and that the landmark is a predetermined landmark. Access to a restricted computing resource is granted based on the determining that the individual is the user and that the landmark is the predetermined landmark. Other embodiments are disclosed.
Kamel Boulos, M N; Roudsari, A V; Gordon, C; Muir Gray, J A
2001-01-01
In 1998, the U.K. National Health Service Information for Health Strategy proposed the implementation of a National electronic Library for Health to provide clinicians, healthcare managers and planners, patients and the public with easy, round the clock access to high quality, up-to-date electronic information on health and healthcare. The Virtual Branch Libraries are among the most important components of the National electronic Library for Health. They aim at creating online knowledge based communities, each concerned with some specific clinical and other health-related topics. This study is about the envisaged Dermatology Virtual Branch Libraries of the National electronic Library for Health. It aims at selecting suitable dermatology Web resources for inclusion in the forthcoming Virtual Branch Libraries after establishing preliminary quality benchmarking rules for this task. Psoriasis, being a common dermatological condition, has been chosen as a starting point. Because quality is a principal concern of the National electronic Library for Health, the study includes a review of the major quality benchmarking systems available today for assessing health-related Web sites. The methodology of developing a quality benchmarking system has been also reviewed. Aided by metasearch Web tools, candidate resources were hand-selected in light of the reviewed benchmarking systems and specific criteria set by the authors. Over 90 professional and patient-oriented Web resources on psoriasis and dermatology in general are suggested for inclusion in the forthcoming Dermatology Virtual Branch Libraries. The idea of an all-in knowledge-hallmarking instrument for the National electronic Library for Health is also proposed based on the reviewed quality benchmarking systems. Skilled, methodical, organized human reviewing, selection and filtering based on well-defined quality appraisal criteria seems likely to be the key ingredient in the envisaged National electronic Library for
Towards a Poetry of Silence: Stéphane Mallarmé and Juan Ramón Jiménez
Directory of Open Access Journals (Sweden)
Mervyn Coke-Enguídanos
1983-01-01
Full Text Available In an era of apparent dissolution, "la Obra" of Juan Ramón Jiménez, like "l'Oeuvre" of Stéphane Mallarmé, has for its goal the attainment of timelessness. In both poets, the concept of absolute Time—the timelessness of eternal Time—is yoked with the ideal of silence. But this is no ordinary silence, and certainly not the kind that results from inadequacy of expression. It is the silence of perfection, the expression of the ineffable: pure Poetry. Since the poetic language is the silent language of thought, both Mallarmé and Juan Ramón seek to convey the pure idea. In so doing, both must stringently eliminate whatever is not essential in their poetry. The astonishing paradox, central to Mallarmé and Juan Ramón alike, is the urge to create an "unwritten" poetry.
Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng
2018-01-01
The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Annie M. Hughes
2013-03-01
Full Text Available Objective – To provide an analysis of the impact of expenditures on electronic resourcesand gate counts on the increase or decrease in reference transactions.Design – Analysis of results of existing survey data from the National Center for Educational Statistics (NCES 2006 Academic Library Survey(ALS.Setting – Academic libraries in the United States.Subjects – 3925 academic library respondents.Methods – The author chose to use survey data collected from the 2006 ALS conducted bythe NCES. The survey included data on various topics related to academic libraries, but in the case of this study, the author chose to analyze three of the 193 variables included. The three variables: electronic books expenditure, computer hardware and software, and expenditures on bibliographic utilities, were combined into one variable called electronic resource expenditure. Gate counts were also considered as a variable. Electronic resource expenditure was also split as a variable into three groups: low, medium, and high. Multiple regression analysis and general linear modeling, along with tests of reliability, were employed. Main Results – The author determined that low, medium, and high spenders with regard to electronic resources exhibited differences in gate counts, and gate counts have an effect on reference transactions in any given week. Gate counts tend to not have much of an effect on reference transactions for the higher spenders, and higher spenders tend to have a higher number of reference transactions overall. Low spenders have lower gate counts and also a lower amount of reference transactions.Conclusion – The findings from this study show that academic libraries spending more on electronic resources also tend to have an increase with regard to reference transactions. The author also concludes that library spaces are no longer the determining factor with regard to number of reference transactions. Spending more on electronic resources is
Guleria, Praveen; Yadav, Sudesh Kumar
2013-01-01
Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961
What Are Business Schools for? On Silence and Voice in Management Education.
Grey, Christopher
2002-01-01
The purpose of business schools seems not to be training effective managers but rather socializing them and legitimizing management, leading to silence about the reality of working conditions. Critical management education would expose students to problematic management issues related to gender, ethnicity, power, the environment, and others.…
Electronic resources access and usage among the postgraduates of ...
African Journals Online (AJOL)
... and usage among the postgraduates of a Nigerian University of Technology. ... faced by postgraduates in using e-resources include takes too much time to find, ... Resources, Access, Use, Postgraduat, Students, University, Technology, Nigeria ... By Country · List All Titles · Free To Read Titles This Journal is Open Access.
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Foda, Bardees M; Singh, Upinder
2015-08-21
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar
2017-08-01
This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.
Directory of Open Access Journals (Sweden)
Papacchioli Velia
2006-06-01
Full Text Available Abstract Background Potato is a major staple food, and modification of its provitamin content is a possible means for alleviating nutritional deficiencies. beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein, antheraxanthin, violaxanthin, and of xanthophyll esters. None of these carotenoids have provitamin A activity. Results We silenced the first dedicated step in the beta-epsilon- branch of carotenoid biosynthesis, lycopene epsilon cyclase (LCY-e, by introducing, via Agrobacterium-mediated transformation, an antisense fragment of this gene under the control of the patatin promoter. Real Time measurements confirmed the tuber-specific silencing of Lcy-e. Antisense tubers showed significant increases in beta-beta-carotenoid levels, with beta-carotene showing the maximum increase (up to 14-fold. Total carotenoids increased up to 2.5-fold. These changes were not accompanied by a decrease in lutein, suggesting that LCY-e is not rate-limiting for lutein accumulation. Tuber-specific changes in expression of several genes in the pathway were observed. Conclusion The data suggest that epsilon-cyclization of lycopene is a key regulatory step in potato tuber carotenogenesis. Upon tuber-specific silencing of the corresponding gene, beta-beta-carotenoid and total carotenoid levels are increased, and expression of several other genes in the pathway is modified.
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Electronic Safety Resource Tools -- Supporting Hydrogen and Fuel Cell Commercialization
Energy Technology Data Exchange (ETDEWEB)
Barilo, Nick F.
2014-09-29
The Pacific Northwest National Laboratory (PNNL) Hydrogen Safety Program conducted a planning session in Los Angeles, CA on April 1, 2014 to consider what electronic safety tools would benefit the next phase of hydrogen and fuel cell commercialization. A diverse, 20-person team led by an experienced facilitator considered the question as it applied to the eight most relevant user groups. The results and subsequent evaluation activities revealed several possible resource tools that could greatly benefit users. The tool identified as having the greatest potential for impact is a hydrogen safety portal, which can be the central location for integrating and disseminating safety information (including most of the tools identified in this report). Such a tool can provide credible and reliable information from a trustworthy source. Other impactful tools identified include a codes and standards wizard to guide users through a series of questions relating to application and specific features of the requirements; a scenario-based virtual reality training for first responders; peer networking tools to bring users from focused groups together to discuss and collaborate on hydrogen safety issues; and a focused tool for training inspectors. Table ES.1 provides results of the planning session, including proposed new tools and changes to existing tools.
Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?
Directory of Open Access Journals (Sweden)
Subhasis Banerjee
2001-01-01
Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.
Directory of Open Access Journals (Sweden)
Xianqi Zhao
2015-06-01
Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.
Silencing effect of shRNA expression vectors with stem length of 21 ...
African Journals Online (AJOL)
Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...
Sexuality and 'silence' among Khasi youth of Meghalaya, Northeast India.
War, Ryntihlin Jennifer; Albert, Sandra
2013-01-01
The importance of sex education has been well documented in the literature, but there exists a lack of research involving indigenous youth in India. This paper describes perceptions, knowledge and attitudes towards sex education, sexuality, pre-marital sex, rape and homosexuality among indigenous students from the matrilineal Khasi tribe attending a university in Meghalaya in northeast India. Qualitative and quantitative data were collected during and after reproductive health, sexuality and life skills courses. Despite the impression of sexual permissiveness of indigenous peoples that exists in India, students reported a societal silence on issues related to sexuality. Lack of appropriate words in the indigenous language potentially contributes to this silence. Although co-habitation is common and culturally acceptable, students disapproved of pre-marital sex. The influence of Christianisation was also perceived in the frequent reference to sin and guilt associated with masturbation, homosexuality, pre-marital sex and abortion. Students reported that the sex education received in school was 'childish' and inadequate for their adult needs. Many had unrealistic images of what constituted 'normal' sex and also blamed women for rape. The majority of indigenous students expressed the need for non-judgmental fora for discussions on sexual health and for sexuality education.
Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco
An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...
Directory of Open Access Journals (Sweden)
Andrei A. Fedoseev
2014-01-01
Full Text Available The article analyzes effective electronic tutorials creation and application based on the theory of pedagogy. Herewith the issues of necessary electronic tutorial functional, ways of the educational process organization with the use of information and communication technologies and the logistics of electronic educational resources are touched upon.
Tang, Wei; Newton, Ronald J; Weidner, Douglas A
2007-01-01
An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.
Gated audiovisual speech identification in silence vs. noise: effects on time and accuracy
Moradi, Shahram; Lidestam, Björn; Rönnberg, Jerker
2013-01-01
This study investigated the degree to which audiovisual presentation (compared to auditory-only presentation) affected isolation point (IPs, the amount of time required for the correct identification of speech stimuli using a gating paradigm) in silence and noise conditions. The study expanded on the findings of Moradi et al. (under revision), using the same stimuli, but presented in an audiovisual instead of an auditory-only manner. The results showed that noise impeded the identification of consonants and words (i.e., delayed IPs and lowered accuracy), but not the identification of final words in sentences. In comparison with the previous study by Moradi et al., it can be concluded that the provision of visual cues expedited IPs and increased the accuracy of speech stimuli identification in both silence and noise. The implication of the results is discussed in terms of models for speech understanding. PMID:23801980
Czech Academy of Sciences Publication Activity Database
Nitsche, Martin
2011-01-01
Roč. 765, č. 1 (2011), s. 74-79 ISSN 1407-2157 Institutional research plan: CEZ:AV0Z90090514 Keywords : Heidegger * contributions to philosophy * phenomenology * language * reticence in silence Subject RIV: AA - Philosophy ; Religion
Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo
2015-01-01
Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.
Directory of Open Access Journals (Sweden)
Changho Eun
Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.
Sibling violence silenced: rivalry, competition, wrestling, playing, roughhousing, benign.
Phillips, Debby A; Phillips, Kate H; Grupp, Kitty; Trigg, Lisa J
2009-01-01
In this article, sibling violence and the silence surrounding it is explicated through professional literature and research findings, exemplars from clinical practice, and statistics. Theoretical positions and discourse analysis have been used to help explain how regular broken bones, bruises, lacerations, and verbal humiliation can be minimized as normal sibling rivalry or roughhousing, which does not cause serious consequences. Nursing should be on the front lines of ending practices of violence. Recognizing sibling violence as such is part of this work and is a social justice issue.
Directory of Open Access Journals (Sweden)
Hristov Nebojša
2015-02-01
Full Text Available Simulation and measurements of muzzle blast overpressure and its physical manifestations are studied in this paper. The use of a silencer can have a great influence on the overpressure intensity. A silencer is regarded as an acoustic transducer and a waveguide. Wave equations for an acoustic dotted source of directed effect are used for physical interpretation of overpressure as an acoustic phenomenon. Decomposition approach has proven to be suitable to describe the formation of the output wave of the wave transducer. Electroacoustic analogies are used for simulations. A measurement chain was used to compare the simulation results with the experimental ones.
Directory of Open Access Journals (Sweden)
Howard Amanda
2005-03-01
Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.
H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases
DEFF Research Database (Denmark)
Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath
2011-01-01
organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....
Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...
DEFF Research Database (Denmark)
Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina
2002-01-01
background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....
DEFF Research Database (Denmark)
Ellabban, Omar S.; Abu-Rub, Haitham A.; Blaabjerg, Frede
2014-01-01
Electric energy security is essential, yet the high cost and limited sources of fossil fuels, in addition to the need to reduce greenhouse gasses emission, have made renewable resources attractive in world energy-based economies. The potential for renewable energy resources is enormous because...... they can, in principle, exponentially exceed the world's energy demand; therefore, these types of resources will have a significant share in the future global energy portfolio, much of which is now concentrating on advancing their pool of renewable energy resources. Accordingly, this paper presents how...... renewable energy resources are currently being used, scientific developments to improve their use, their future prospects, and their deployment. Additionally, the paper represents the impact of power electronics and smart grid technologies that can enable the proportionate share of renewable energy...
Directory of Open Access Journals (Sweden)
Shailendra Kumar
2013-06-01
Full Text Available This paper aims to determine the preference and use of electronic information and resources by blind/visually impaired users in the leading National Capital Region (NCR libraries of India. Survey methodology has been used as the basic research tool for data collection with the help of questionnaires. The 125 in total users surveyed in all the five libraries were selected randomly on the basis of willingness of the users with experience of working in digital environments to participate in the survey. The survey results were tabulated and analyzed with descriptive statistics methods using Excel software and 'Stata version 11'. The findings reveal that ICT have a positive impact in the lives of people with disabilities as it helps them to work independently and increases the level of confidence among them. The Internet is the most preferred medium of access to information among the majority of blind/visually impaired users. The 'Complexity of content available on the net' is found as the major challenge faced during Internet use by blind users of NCR libraries. 'Audio books on CDs/DVDs and DAISY books' are the most preferred electronic resources among the majority of blind/visually impaired users. This study will help the library professionals and organizations/institutions serving people with disabilities to develop effective library services for blind/visually impaired users in the digital environment on the basis of findings on information usage behavior in the study.
Charles I et la voix silencieuse de Eikon Basilike : le silence comme moyen d'expression
Chaise-Brun, Vanessa
2017-01-01
La parole de Charles I, de son vivant, reste, malgré ses efforts, une parole vide et non entendue. Le bruit, qu’il s’agisse des cris de la foule ou bien les querelles engendrées par ses opposants, étouffe sa parole. Son discours est un cri face à la foule et à ses opposants, mais un cri impuissant. Pourtant, peut-on affirmer que la parole de Charles I est inexistante ? Eikon Basilike est une parole écrite, un silence qui crie l’innocence du roi. « Faire silence » ne signifie pas se taire mais...
Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong
2017-09-26
Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.
Czech Academy of Sciences Publication Activity Database
Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš
2003-01-01
Roč. 133, č. 3 (2003), s. 1240-1250 ISSN 0032-0889 R&D Projects: GA ČR GA521/01/0037; GA ČR GP521/01/P042 Institutional research plan: CEZ:AV0Z5004920 Keywords : tobacco * gene silencing * transgenic plant Subject RIV: BO - Biophysics Impact factor: 5.634, year: 2003
Yangin, Demet; Elma, Cevat
2017-01-01
The purpose of this study was to determine the relationship between the manager trust and interactional justice perceptions and organizational silence behaviors of those teachers who work in primary and secondary schools. The research is based on the survey model and the population consists of 4761 teachers who worked in Samsun, Turkey. The sample…
Regulatory role of neuron-restrictive silencing factor in expression of TRPC1
International Nuclear Information System (INIS)
Ohba, Takayoshi; Watanabe, Hiroyuki; Takahashi, Yoichiro; Suzuki, Takashi; Miyoshi, Ichiro; Nakayama, Shinnsuke; Satoh, Eisaku; Iino, Kenji; Sasano, Hironobu; Mori, Yasuo; Kuromitsu, Sadao; Imagawa, Keiichi; Saito, Yoshihiko; Iijima, Toshihiko; Ito, Hiroshi; Murakami, Manabu
2006-01-01
Neuron-restrictive silencer factor (NRSF) binds its consensus element to repress the transcription of various genes. The dominant-negative form (dnNRSF) has a hypertrophic effect on cardiogenesis through an unidentified mechanism. We examined the involvement of transient receptor potential (TRP) channel proteins, using transgenic mice overexpressing dnNRSF (dnNRSF mice). Electrophoretic mobility-shift assays revealed an interaction between NRSF and a neuron-restrictive silencer element-like sequence in intron 4 of TRPC1 genomic DNA. According to RT-PCR and Western analyses, TRPC1 was up-regulated in dnNRSF mouse heart. Transient overexpression of TRPC1 in HEK 293T cells increased the activity of the nuclear factor in activated T cells (NFAT) promoter and stimulated store-operated Ca 2+ channel (SOCC)-mediated Ca 2+ entry. Transfection of TRPC1 into primary cardiomyocytes increased NFAT activity, indicating a major role for TRPC1 in NFAT activation. Our findings strongly suggest that NRSF regulates TRP1 gene expression and causes changes in the levels of calcium entry through SOCCs
CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs
DEFF Research Database (Denmark)
Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.
2016-01-01
repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...
Effects of gene silencing of CypB on gastric cancer cells.
Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun
2015-04-01
To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain
Directory of Open Access Journals (Sweden)
Julia F Alterman
2015-01-01
Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.
MicroRNA silencing in primates: towards development of novel therapeutics
DEFF Research Database (Denmark)
Petri, Andreas; Lindow, Morten; Kauppinen, Sakari
2009-01-01
MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....
Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis
Directory of Open Access Journals (Sweden)
Zhimin Zheng
2015-05-01
Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.
Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo
Directory of Open Access Journals (Sweden)
Tasleem Arif
2014-01-01
Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.
Directory of Open Access Journals (Sweden)
Keshava Mysore
2015-11-01
Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.
In trans silencing properties of a tobacco transgene locus depend on its epigenetic state
Czech Academy of Sciences Publication Activity Database
Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš
2004-01-01
Roč. 26, č. 3 (2004), s. 147 ISSN 0137-5881. [Congress of the Federation of European Societies of Plant Biology /14./. 23.08.2004-27.08.2004, Cracow] Keywords : plant transgenes * gene expression * silencing Subject RIV: BO - Biophysics
The Silencing of the Knowledge-Base in Early Childhood Education and Care Professionalism
Campbell-Barr, Verity
2018-01-01
It is widely accepted that the early childhood education and care (ECEC) workforce is central to the quality of services. Modernist constructs of quality signal the importance of qualifications for quality, but the preoccupation with qualification levels silences questions about the knowledge required of ECEC professionals. Postmodern perspectives…
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.
Directory of Open Access Journals (Sweden)
Stella Marie Reamon-Buettner
Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.
Directory of Open Access Journals (Sweden)
Ana Neves-Costa
2009-12-01
Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.
Alfisyahrin; Isranuri, I.
2018-02-01
Active Noise Control is a technique to overcome noisy with noise or sound countered with sound in scientific terminology i.e signal countered with signals. This technique can be used to dampen relevant noise in accordance with the wishes of the engineering task and reducing automotive muffler noise to a minimum. Objective of this study is to develop a Active Noise Control which should cancel the noise of automotive Exhaust (Silencer) through Signal Processing Simulation methods. Noise generator of Active Noise Control is to make the opponent signal amplitude and frequency of the automotive noise. The steps are: Firstly, the noise of automotive silencer was measured to characterize the automotive noise that its amplitude and frequency which intended to be expressed. The opposed sound which having similar character with the signal source should be generated by signal function. A comparison between the data which has been completed with simulation calculations Fourier transform field data is data that has been captured on the muffler (noise silencer) Toyota Kijang Capsule assembly 2009. MATLAB is used to simulate how the signal processing noise generated by exhaust (silencer) using FFT. This opponent is inverted phase signal from the signal source 180° conducted by Instruments of Signal Noise Generators. The process of noise cancelation examined through simulation using computer software simulation. The result is obtained that attenuation of sound (noise cancellation) has a difference of 33.7%. This value is obtained from the comparison of the value of the signal source and the signal value of the opponent. So it can be concluded that the noisy signal can be attenuated by 33.7%.
Directory of Open Access Journals (Sweden)
B. Franklin
2004-01-01
Full Text Available This paper examines the methodology and results from Web-based surveys of more than 15,000 networked electronic services users in the United States between July 1998 and June 2003 at four academic health sciences libraries and two large main campus libraries serving a variety of disciplines. A statistically valid methodology for administering simultaneous Web-based and print-based surveys using the random moments sampling technique is discussed and implemented. Results from the Web-based surveys showed that at the four academic health sciences libraries, there were approximately four remote networked electronic services users for each in-house user. This ratio was even higher for faculty, staff, and research fellows at the academic health sciences libraries, where more than five remote users for each in-house user were recorded. At the two main libraries, there were approximately 1.3 remote users for each in-house user of electronic information. Sponsored research (grant funded research accounted for approximately 32% of the networked electronic services activity at the health sciences libraries and 16% at the main campus libraries. Sponsored researchers at the health sciences libraries appeared to use networked electronic services most intensively from on-campus, but not from in the library. The purpose of use for networked electronic resources by patrons within the library is different from the purpose of use of those resources by patrons using the resources remotely. The implications of these results on how librarians reach decisions about networked electronic resources and services are discussed.
Swathi, S; Ramesh, A; Nagapoornima, M; Fernandes, Lavina M; Jisina, C; Rao, P N Suman; Swarnarekha, A
2014-01-01
The aim of this study was to generate a substantive theory explaining how the staff in a resource-limited neonatal intensive care unit (NICU) of a developing nation manage to ensure adherence to behavioral modification components of a noise reduction protocol (NsRP) during nonemergency situations. The study was conducted after implementation of an NsRP in a level III NICU of south India. The normal routine of the NICU is highly dynamic because of various categories of staff conducting clinical rounds followed by care-giving activities. This is unpredictably interspersed with very noisy emergency management of neonates who suddenly fall sick. In-depth interviews were conducted with 36 staff members of the NICU (20 staff nurses, six nursing aides, and 10 physicians). Group discussions were conducted with 20 staff nurses and six nursing aides. Data analysis was done in line with the reformulated grounded theory approach, which was based on inductive examination of textual information. The results of the analysis showed that the main concern was to ensure adherence to behavioral modification components of the NsRP. This was addressed by using strategies to "sustain a culture of silence in NICU during nonemergency situations" (core category). The main strategies employed were building awareness momentum, causing awareness percolation, developing a sense of ownership, expansion of caring practices, evolution of adherence, and displaying performance indicators. The "culture of silence" reconditions the existing staff and conditions new staff members joining the NICU. During emergency situations, a "noisy culture" prevailed because of pragmatic neglect of behavioral modification when life support overrode all other concerns. In addition to this, the process of operant conditioning should be formally conducted once every 18 months. The results of this study may be adapted to create similar strategies and establish context specific NsRPs in NICUs with resource constraints.
Directory of Open Access Journals (Sweden)
Katherine S. Bridge
2017-07-01
Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.
Silent God in a Wordy World. Silence in Ignatian Spirituality
García de Castro Valdés, S.J., José
2016-01-01
The Society of Jesus is an apostolic religious order involved in many different activities and missions. Jesuits live far away from monasteries and strict contemplative life. Nevertheless, one of the most well-known peculiarities of the Ignatian Spiritual Exercises is that a complete and absolute silence is required during the time of the retreat. Where and how should we place “silence” in the life of an Ignatian spiritual and mystical experience?
Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.
2010-01-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs
Directory of Open Access Journals (Sweden)
І. К. Журавльова
2014-12-01
Full Text Available The article describes tasks that electronic collections of rare books fulfill: broad access for readers to rare and valuable editions providing, preservation of ensuring of the original. On the example of the electronic collection of the Central Scientific Library of the V.N. Karazin Kharkiv National University – «eScriptorium: electronic archive of rare books and manuscripts for research and education» the possibility of the full-text resources of the valuable editions using is shown. The principles of creation, structure, chronological frameworks, directions of adding the documents to the archive are represented. The perspectives of the project development are outlined as well as examples of the digital libraries of the European countries and Ukraine are provided, the actual task of preserving the originals of the rare books of the country is raised, the innovative approaches to serving users with electronic resources are considered. The evidences of cooperation of the Central Scientific Library of the V.N. Karazin Kharkiv National University with the largest world digital libraries: World Digital Library and Europeana are provided.
Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming
2016-02-01
Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Dismantling the Silence: LGBTQ Aging Emerging From the Margins
Fredriksen-Goldsen, Karen I.
2017-01-01
Historical, environmental, and cultural contexts intersect with aging, sexuality, and gender across communities and generations. My scholarship investigates health and well-being over the life course across marginalized communities, including LGBTQ (lesbian, gay, bisexual, transgender, and queer) midlife and older adults, native communities experiencing cardiovascular risk, and families in China living with HIV, in order to balance the realities of unique lives in contemporary society. By probing the intersection of age, sexuality, and gender, my analysis is informed by both personal and professional experiences. With the death of my partner occurring at a time of profound invisibility and silence before HIV/AIDS, I found my life out of sync, experiencing a loss without a name. My life was thrust into a paradox: My relationship was defined by a world that refused to recognize it. This essay provides an opportunity for me to weave together how such critical turning points in my own life helped shape my approach to gerontology and how gerontology has informed my work and life. Reflecting on this journey, I illustrate the ways in which historical, structural, environmental, psychosocial, and biological factors affect equity, and the health-promoting and adverse pathways to health and well-being across marginalized communities. Although gerontology as a discipline has historically silenced the lives of marginalized older adults, it has much to learn from these communities. The growing and increasingly diverse older adult population provides us with unique opportunities to better understand both cultural variations and shared experiences in aging over the life course. PMID:28053011
Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun
2016-01-01
ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors
Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping
2016-11-15
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate
Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.
Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G
2015-01-14
In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.
FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Julia Brun
Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.