RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

CDK9-dependent RNA polymerase II pausing controls transcription initiation.

Science.gov (United States)

Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

2017-10-10

Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

RNA polymerase II collision interrupts convergent transcription

DEFF Research Database (Denmark)

Hobson, David J; Wei, Wu; Steinmetz, Lars M

2012-01-01

Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

Directory of Open Access Journals (Sweden)

Boissière-Michot Florence

2009-04-01

Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

Directory of Open Access Journals (Sweden)

C Coelho

2003-06-01

Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

RNA Polymerase II–The Transcription Machine

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.

2014-01-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

KAUST Repository

Ariel, Federico D.

2014-08-01

The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

Directory of Open Access Journals (Sweden)

Marcos Lázaro Moreli

2004-10-01

Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

Science.gov (United States)

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

Science.gov (United States)

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Properties of the reverse transcription reaction in mRNA quantification

DEFF Research Database (Denmark)

Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

2004-01-01

BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

Real-time observation of the initiation of RNA polymerase II transcription.

Science.gov (United States)

Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M

2015-09-10

Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

Science.gov (United States)

Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

2014-01-01

Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

2011-11-01

Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

Science.gov (United States)

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Chromosomal loop/nuclear matrix organization of transcriptionally active and inactive RNA polymerases in HeLa nuclei.

Science.gov (United States)

Roberge, M; Dahmus, M E; Bradbury, E M

1988-06-05

The relative distribution of transcriptionally active and inactive RNA polymerases I and II between the nuclear matrix/scaffold and chromosomal loops of HeLa cells was determined. Total RNA polymerase was assessed by immunoblotting and transcribing RNA polymerase by a photoaffinity labeling technique in isolated nuclei. Nuclear matrix/scaffold was isolated by three methods using high-salt, intermediate-salt or low-salt extraction. The distribution of RNA polymerases I and II were very similar within each of the methods, but considerable differences in distributions were found between the different preparation methods. Either intermediate-salt or high-salt treatment of DNase I-digested nuclei showed significant association of RNA polymerases with the nuclear matrix. However, intermediate-salt followed by high-salt treatment released all transcribing and non-transcribing RNA polymerases. Nuclear scaffolds isolated with lithium diiodosalicylate (low-salt) contained very little of the RNA polymerases. This treatment, however, caused the dissociation of RNA polymerase II transcription complexes. These results show unambiguously that RNA polymerases, both in their active and inactive forms, are not nuclear matrix proteins. The data support models in which the transcriptional machinery moves around DNA loops during transcription.

Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

DEFF Research Database (Denmark)

Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

1999-01-01

A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

Fixing the model for transcription: the DNA moves, not the polymerase.

Science.gov (United States)

Papantonis, Argyris; Cook, Peter R

2011-01-01

The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.

Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong

2014-11-01

Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

Science.gov (United States)

Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

2015-05-26

DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

DEFF Research Database (Denmark)

Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

2011-01-01

and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

Science.gov (United States)

Magill, C P; Jackson, S P; Bell, S D

2001-12-14

Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus

DEFF Research Database (Denmark)

Dukes, J.P.; King, D.P.; Alexandersen, Søren

2006-01-01

Speed is paramount in the diagnosis of foot-and-mouth disease (FMD) and simplicity is required if a test is to be deployed in the field. The development of a one-step, reverse transcription loop-mediated amplification (RT-LAMP) assay enables FMD virus (FMDV) to be detected in under an hour...... in a single tube without thermal cycling. A fragment of the 3D RNA polymerase gene of the virus is amplified at 65 degrees C in the presence of a primer mixture and both reverse transcriptase and Bst DNA polymerase. Compared with real-time RT-PCR, RT-LAMP was consistently faster, and ten copies of FMDV...... vesicular diseases and from that of genetically related picornaviruses. Diagnostic sensitivity was validated by the amplification of reference FMDV strains and archival material from field cases of FMD. In comparison with the performance of the established diagnostic TaqMan (R) assay, RT-LAMP appears...

Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

1987-01-01

The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein

Development of mRNA-based body fluid identification using reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Satoh, Tetsuya; Kouroki, Seiya; Ogawa, Keita; Tanaka, Yorika; Matsumura, Kazutoshi; Iwase, Susumu

2018-04-25

Identifying body fluids from forensic samples can provide valuable evidence for criminal investigations. Messenger RNA (mRNA)-based body fluid identification was recently developed, and highly sensitive parallel identification using reverse transcription polymerase chain reaction (RT-PCR) has been described. In this study, we developed reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a simple, rapid assay for identifying three common forensic body fluids, namely blood, semen, and saliva, and evaluated its specificity and sensitivity. Hemoglobin beta (HBB), transglutaminase 4 (TGM4), and statherin (STATH) were selected as marker genes for blood, semen, and saliva, respectively. RT-LAMP could be performed in a single step including both reverse transcription and DNA amplification under an isothermal condition within 60 min, and detection could be conveniently performed via visual fluorescence. Marker-specific amplification was performed in each assay, and no cross-reaction was observed among five representative forensically relevant body fluids. The detection limits of the assays were 0.3 nL, 30 nL, and 0.3 μL for blood, semen, and saliva, respectively, and their sensitivities were comparable with those of RT-PCR. Furthermore, RT-LAMP assays were applicable to forensic casework samples. It is considered that RT-LAMP is useful for body fluid identification.

Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hamed Rezaeejam

2015-01-01

Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

Science.gov (United States)

Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

2013-07-10

The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

Science.gov (United States)

Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

2017-08-15

Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

Science.gov (United States)

Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

2014-01-01

Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Directory of Open Access Journals (Sweden)

Cui Shang-jin

2010-05-01

Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Science.gov (United States)

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

Archaeal RNA polymerase arrests transcription at DNA lesions.

Science.gov (United States)

Gehring, Alexandra M; Santangelo, Thomas J

2017-01-01

Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

Science.gov (United States)

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

Science.gov (United States)

Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

2012-02-01

Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

The Mediator Complex: At the Nexus of RNA Polymerase II Transcription.

Science.gov (United States)

Jeronimo, Célia; Robert, François

2017-10-01

Mediator is an essential, large, multisubunit, transcriptional co-activator highly conserved across eukaryotes. Mediator interacts with gene-specific transcription factors at enhancers as well as with the RNA polymerase II (RNAPII) transcription machinery bound at promoters. It also interacts with several other factors involved in various aspects of transcription, chromatin regulation, and mRNA processing. Hence, Mediator is at the nexus of RNAPII transcription, regulating its many steps and connecting transcription with co-transcriptional events. To achieve this flexible role, Mediator, which is divided into several functional modules, reorganizes its conformation and composition while making transient contacts with other components. Here, we review the mechanisms of action of Mediator and propose a unifying model for its function. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.

Science.gov (United States)

Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

2014-01-01

Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

Science.gov (United States)

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications

Science.gov (United States)

Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong

2016-01-01

Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

Science.gov (United States)

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

Science.gov (United States)

Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

2017-02-14

Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II

NARCIS (Netherlands)

B. Steurer (Barbara); J.A. Marteijn (Jurgen)

2016-01-01

textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The

Regulation of nucleolus assembly by non-coding RNA polymerase II transcripts.

Science.gov (United States)

Caudron-Herger, Maïwen; Pankert, Teresa; Rippe, Karsten

2016-05-03

The nucleolus is a nuclear subcompartment for tightly regulated rRNA production and ribosome subunit biogenesis. It also acts as a cellular stress sensor and can release enriched factors in response to cellular stimuli. Accordingly, the content and structure of the nucleolus change dynamically, which is particularly evident during cell cycle progression: the nucleolus completely disassembles during mitosis and reassembles in interphase. Although the mechanisms that drive nucleolar (re)organization have been the subject of a number of studies, they are only partly understood. Recently, we identified Alu element-containing RNA polymerase II transcripts (aluRNAs) as important for nucleolar structure and rRNA synthesis. Integrating these findings with studies on the liquid droplet-like nature of the nucleolus leads us to propose a model on how RNA polymerase II transcripts could regulate the assembly of the nucleolus in response to external stimuli and during cell cycle progression.

The Transcription Bubble of the RNA Polymerase-Promoter Open Complex Exhibits Conformational Heterogeneity and Millisecond-Scale Dynamics : Implications for Transcription Start-Site Selection

NARCIS (Netherlands)

Robb, Nicole C.; Cordes, Thorben; Hwang, Ling Chin; Gryte, Kristofer; Duchi, Diego; Craggs, Timothy D.; Santoso, Yusdi; Weiss, Shimon; Ebright, Richard H.; Kapanidis, Achillefs N.

2013-01-01

Bacterial transcription is initiated after RNA polymerase (RNAP) binds to promoter DNA, melts similar to 14 bp around the transcription start site and forms a single-stranded "transcription bubble" within a catalytically active RNAP-DNA open complex (RPo). There is significant flexibility in the

Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

Science.gov (United States)

Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

2016-01-01

Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

Science.gov (United States)

Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

2014-10-01

Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.

Transcriptional analysis of left-sided colitis, pancolitis, and ulcerative colitis-associated dysplasia

DEFF Research Database (Denmark)

Bjerrum, Jacob T; Nielsen, Ole H; Riis, Lene B

2014-01-01

to identify potential biomarkers and transcripts of importance for the carcinogenic behavior of chronic inflammation. METHODS: The Affymetrix GeneChip Human Genome U133 Plus 2.0 was applied on colonic biopsies from UC patients with left-sided UC, pancolitis, dysplasia, and controls. Reverse transcription...... polymerase chain reaction and immunohistochemistry were performed for validating selected transcripts in the initial cohort and in 2 independent cohorts of patients with UC. Microarray data were analyzed by principal component analysis, and reverse transcription polymerase chain reaction...... and immunohistochemistry data by the Wilcoxon's rank-sum test. RESULTS: The principal component analysis results revealed separate clusters for left-sided UC, pancolitis, dysplasia, and controls. Close clustering of dysplastic and pancolitic samples indicated similarities in gene expression. Indeed, 101 and 656 parallel...

Comparison of multiplex reverse transcription-PCR-enzyme ...

African Journals Online (AJOL)

Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

Crowding-induced transcriptional bursts dictate polymerase and nucleosome density profiles along genes

NARCIS (Netherlands)

van den Berg, A.A.; Depken, S.M.

2017-01-01

During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a

Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions

NARCIS (Netherlands)

Berkhout, B.; van Wamel, J.; Klaver, B.

1995-01-01

Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA

FACT facilitates chromatin transcription by RNA polymerases I and III

DEFF Research Database (Denmark)

Birch, Joanna L; Tan, Bertrand C-M; Panov, Kostya I

2009-01-01

Efficient transcription elongation from a chromatin template requires RNA polymerases (Pols) to negotiate nucleosomes. Our biochemical analyses demonstrate that RNA Pol I can transcribe through nucleosome templates and that this requires structural rearrangement of the nucleosomal core particle....... The subunits of the histone chaperone FACT (facilitates chromatin transcription), SSRP1 and Spt16, co-purify and co-immunoprecipitate with mammalian Pol I complexes. In cells, SSRP1 is detectable at the rRNA gene repeats. Crucially, siRNA-mediated repression of FACT subunit expression in cells results...... in a significant reduction in 47S pre-rRNA levels, whereas synthesis of the first 40 nt of the rRNA is not affected, implying that FACT is important for Pol I transcription elongation through chromatin. FACT also associates with RNA Pol III complexes, is present at the chromatin of genes transcribed by Pol III...

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

Science.gov (United States)

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Detection of enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification.

Science.gov (United States)

Wang, D; Wang, X; Geng, Y; An, C

2014-01-01

The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR) and real-time PCR. A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

Science.gov (United States)

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

HIV-1 reverse transcription initiation: a potential target for novel antivirals?

NARCIS (Netherlands)

Abbink, Truus E. M.; Berkhout, Ben

2008-01-01

Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

International Nuclear Information System (INIS)

Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

1987-01-01

DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

Directory of Open Access Journals (Sweden)

Joojin Jeong

2015-09-01

Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

Semi-quantitative SPECT for anterior dislocation of the disc in the temporo-mandibular joint

Energy Technology Data Exchange (ETDEWEB)

Oesterreich, F.U.; Jend-Rossmann, I.; Jend, H.H.; Triebel, H.J.

1987-01-01

SPECT-examination of the TMJ using 99m-Tc-MDP was performed in 43 patients with arthrographically proven anterior dislocation of the disc and in 30 normals. The results were evaluated visually and also in a semi-quantitative manner that took account of relative 99m Tc activity in the TMJ and of the age of the patient. In the presence of arthrographically proven anterior, but reversible, disc dislocation, the semi-quantitative method proved positive in 75% of cases (28 cases). In joints with fixed anterior dislocation (29 cases), bone changes were demonstrated in 26%. Visual evaluation was positive in 50% of reversible, and in 72% of non-reversible dislocations. Semi-quantitative SPECT of the TMJ is excellent for demonstrating bone reaction resulting from TMJ dysfunction and for indicating the severity of the joint abnormality.

SAF-A forms a complex with BRG1 and both components are required for RNA polymerase II mediated transcription.

Directory of Open Access Journals (Sweden)

Dzeneta Vizlin-Hodzic

Full Text Available BACKGROUND: Scaffold attachment factor A (SAF-A participates in the regulation of gene expression by organizing chromatin into transcriptionally active domains and by interacting directly with RNA polymerase II. METHODOLOGY: Here we use co-localization, co-immunoprecipitation (co-IP and in situ proximity ligation assay (PLA to identify Brahma Related Gene 1 (BRG1, the ATP-driven motor of the human SWI-SNF chromatin remodeling complex, as another SAF-A interaction partner in mouse embryonic stem (mES cells. We also employ RNA interference to investigate functional aspects of the SAF-A/BRG1 interaction. PRINCIPAL FINDINGS: We find that endogenous SAF-A protein interacts with endogenous BRG1 protein in mES cells, and that the interaction does not solely depend on the presence of mRNA. Moreover the interaction remains intact when cells are induced to differentiate. Functional analyses reveal that dual depletion of SAF-A and BRG1 abolishes global transcription by RNA polymerase II, while the nucleolar RNA polymerase I transcription machinery remains unaffected. CONCLUSIONS: We demonstrate that SAF-A interacts with BRG1 and that both components are required for RNA Polymerase II Mediated Transcription.

SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

Science.gov (United States)

Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

2015-01-01

Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

D Wang

2014-01-01

Full Text Available Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD for an early treatment by using loop-mediated isothermal amplification (LAMP technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conventional reverse-transcription polymerase chain reaction (RT-PCR and real-time PCR. Results : A total of 116 clinical specimens from the suspected HFMD individual were detected with the RT-LAMP. The detection rate for EV71 was 56.89% by RT-LAMP, 41.38% by real-time PCR and 34.48% by RT-PCR. The minimum detection limit of RT-LAMP was 0.01 PFU, both of RT-PCR and real-time PCR was 0.1PFU. Non-cross-reactive amplification with other enteroviruses was detected in the survey reports. Conclusions : The effectiveness of RT-LAMP is higher than RT-PCR and real-time PCR. The protocol is easy to operate and time saving. It was not an expensive instrument, which was needed; it is an applicable method for rapid diagnosis of the disease, especially in resource-poor countries or in developing countries.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

Directory of Open Access Journals (Sweden)

David Warrilow

Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

Science.gov (United States)

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Influenza Virus Mounts a Two-Pronged Attack on Host RNA Polymerase II Transcription.

Science.gov (United States)

Bauer, David L V; Tellier, Michael; Martínez-Alonso, Mónica; Nojima, Takayuki; Proudfoot, Nick J; Murphy, Shona; Fodor, Ervin

2018-05-15

Influenza virus intimately associates with host RNA polymerase II (Pol II) and mRNA processing machinery. Here, we use mammalian native elongating transcript sequencing (mNET-seq) to examine Pol II behavior during viral infection. We show that influenza virus executes a two-pronged attack on host transcription. First, viral infection causes decreased Pol II gene occupancy downstream of transcription start sites. Second, virus-induced cellular stress leads to a catastrophic failure of Pol II termination at poly(A) sites, with transcription often continuing for tens of kilobases. Defective Pol II termination occurs independently of the ability of the viral NS1 protein to interfere with host mRNA processing. Instead, this termination defect is a common effect of diverse cellular stresses and underlies the production of previously reported downstream-of-gene transcripts (DoGs). Our work has implications for understanding not only host-virus interactions but also fundamental aspects of mammalian transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Endoplasmic reticulum stress-responsive transcription factor ATF6α directs recruitment of the Mediator of RNA polymerase II transcription and multiple histone acetyltransferase complexes.

Science.gov (United States)

Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C

2012-06-29

The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.

Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.

Science.gov (United States)

Steurer, Barbara; Marteijn, Jurgen A

2017-10-27

The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

Directory of Open Access Journals (Sweden)

Mika Ohta

2011-01-01

Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

Science.gov (United States)

Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

2016-10-15

 The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

The role of RNA polymerase I transcription and embryonic genome activation in nucleolar development in bovine preimplantation embryos

DEFF Research Database (Denmark)

Østrup, Olga; Strejcek, F.; Petrovicova, I.

2008-01-01

The aim of the present study was to investigate the role of RNA polymerase I (RPI) transcription in nucleolar development during major transcriptional activation (MTA) in cattle. Late eight-cell embryos were cultured in the absence (control group) or presence of actinomycin D (AD) (RPI inhibition...

Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

Directory of Open Access Journals (Sweden)

Marilia Farignoli Romeiro

2016-06-01

Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

Science.gov (United States)

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

Science.gov (United States)

Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

2006-04-28

Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2000-05-01

We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

Science.gov (United States)

Nishiura, T; Abe, K

1999-01-01

The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

RNA polymerase III transcription - regulated by chromatin structure and regulator of nuclear chromatin organization.

Science.gov (United States)

Pascali, Chiara; Teichmann, Martin

2013-01-01

RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

Science.gov (United States)

Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

2001-07-06

c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

Directory of Open Access Journals (Sweden)

Clément Monot

2013-05-01

Full Text Available L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP first uses its endonuclease (EN to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A tail, a process known as target-primed reverse transcription (TPRT. Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.

Science.gov (United States)

Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël

2013-05-01

L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.

Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

DEFF Research Database (Denmark)

Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

2006-01-01

oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

APOBEC3G inhibits elongation of HIV-1 reverse transcripts.

Directory of Open Access Journals (Sweden)

Kate N Bishop

2008-12-01

Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.

Transcriptional Regulation in Ebola Virus: Effects of Gene Border Structure and Regulatory Elements on Gene Expression and Polymerase Scanning Behavior.

Science.gov (United States)

Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke

2016-02-15

The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis

Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

Science.gov (United States)

Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

2016-05-01

Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

International Nuclear Information System (INIS)

Voronin, Yegor A.; Pathak, Vinay K.

2003-01-01

Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W; Sidow, Arend

2013-01-01

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF's direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF's motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Transcription-factor occupancy at HOT regions quantitatively predicts RNA polymerase recruitment in five human cell lines.

KAUST Repository

Foley, Joseph W

2013-10-20

BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF\\'s direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF\\'s motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.

Factor C*, the specific initiation component of the mouse RNA polymerase I holoenzyme, is inactivated early in the transcription process.

OpenAIRE

Brun, R P; Ryan, K; Sollner-Webb, B

1994-01-01

Factor C* is the component of the RNA polymerase I holoenzyme (factor C) that allows specific transcriptional initiation on a factor D (SL1)- and UBF-activated rRNA gene promoter. The in vitro transcriptional capacity of a preincubated rDNA promoter complex becomes exhausted very rapidly upon initiation of transcription. This is due to the rapid depletion of C* activity. In contrast, C* activity is not unstable in the absence of transcription, even in the presence of nucleoside triphosphates ...

Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

Science.gov (United States)

Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

2012-12-01

Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

OpenAIRE

Matsutani Sachiko

2004-01-01

Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

Science.gov (United States)

Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

2015-07-13

We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases.

Science.gov (United States)

Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

2016-04-20

DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

Directory of Open Access Journals (Sweden)

K. Nithin Prabhu

2018-02-01

Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

Science.gov (United States)

Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

2018-02-28

Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.

Science.gov (United States)

NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina

2016-12-27

Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

Science.gov (United States)

de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

2010-09-20

Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

Polymerase chain reaction amplification fails to detect aromatase cytochrome P450 transcripts in normal human endometrium or decidua.

Science.gov (United States)

Bulun, S E; Mahendroo, M S; Simpson, E R

1993-06-01

It has been proposed that the biosynthesis of estrogens by the human endometrium may be of physiological significance during the menstrual cycle. Local estrogen production was also suggested to be important in the development of endometrial cancer; however, the presence or absence of aromatase enzyme activity in normal human endometrium is controversial. To address this issue, we used a sensitive technique capable of detecting mRNA transcripts present in only very low copy number. The polymerase chain reaction linked to reverse transcription (RT-PCR) was used to evaluate the presence or absence of aromatase cytochrome P450 (P450arom) transcripts in endometrial tissues (n = 7) and endometrial stromal cells (n = 9) under various culture conditions. RNA was isolated from four proliferative and three secretory tissue samples and from cultured endometrial stromal cells isolated from seven proliferative and two secretory endometria. Five sets of cultures were treated with medroxyprogesterone acetate (MPA), estradiol (E2), and forskolin. Additionally, RNA was isolated from decidualized endometrium obtained from a patient with tubal pregnancy. A single stranded cDNA was synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase and a P450arom-specific oligonucleotide. The single stranded cDNA was used as a template for PCR and was amplified for 20-35 cycles using P450arom-specific primers. RNA from adipose tissue and placenta was amplified to provide positive controls, whereas myometrial RNA was used as a negative control. In two experiments involving two endometrial tissues and three sets of cells in culture, a rat P450arom cRNA was coamplified in each sample as an internal control to demonstrate that the remote possibility of RT-PCR failures in individual test samples cannot account for our negative results. By Southern or slot blot hybridization of the amplified fragments using human and rat P450arom-specific probes, we found no evidence for

Normalization of Reverse Transcription Quantitative PCR Data During Ageing in Distinct Cerebral Structures.

Science.gov (United States)

Bruckert, G; Vivien, D; Docagne, F; Roussel, B D

2016-04-01

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) has become a routine method in many laboratories. Normalization of data from experimental conditions is critical for data processing and is usually achieved by the use of a single reference gene. Nevertheless, as pointed by the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, several reference genes should be used for reliable normalization. Ageing is a physiological process that results in a decline of many expressed genes. Reliable normalization of RT-qPCR data becomes crucial when studying ageing. Here, we propose a RT-qPCR study from four mouse brain regions (cortex, hippocampus, striatum and cerebellum) at different ages (from 8 weeks to 22 months) in which we studied the expression of nine commonly used reference genes. With the use of two different algorithms, we found that all brain structures need at least two genes for a good normalization step. We propose specific pairs of gene for efficient data normalization in the four brain regions studied. These results underline the importance of reliable reference genes for specific brain regions in ageing.

Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

Science.gov (United States)

Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

2014-01-01

Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

Science.gov (United States)

Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

2014-07-01

A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

Science.gov (United States)

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Normalization with Corresponding Naïve Tissue Minimizes Bias Caused by Commercial Reverse Transcription Kits on Quantitative Real-Time PCR Results.

Directory of Open Access Journals (Sweden)

Andreas Garcia-Bardon

Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

Science.gov (United States)

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

External Quality Assessment for the Detection of Measles Virus by Reverse Transcription-PCR Using Armored RNA.

Directory of Open Access Journals (Sweden)

Dong Zhang

Full Text Available In recent years, nucleic acid tests for detection of measles virus RNA have been widely applied in laboratories belonging to the measles surveillance system of China. An external quality assessment program was established by the National Center for Clinical Laboratories to evaluate the performance of nucleic acid tests for measles virus. The external quality assessment panel, which consisted of 10 specimens, was prepared using armored RNAs, complex of noninfectious MS2 bacteriophage coat proteins encapsulated RNA of measles virus, as measles virus surrogate controls. Conserved sequences amplified from a circulating measles virus strain or from a vaccine strain were encapsulated into these armored RNAs. Forty-one participating laboratories from 15 provinces, municipalities, or autonomous regions that currently conduct molecular detection of measles virus enrolled in the external quality assessment program, including 40 measles surveillance system laboratories and one diagnostic reagent manufacturer. Forty laboratories used commercial reverse transcription-quantitative PCR kits, with only one laboratory applying a conventional PCR method developed in-house. The results indicated that most of the participants (38/41, 92.7% were able to accurately detect the panel with 100% sensitivity and 100% specificity. Although a wide range of commercially available kits for nucleic acid extraction and reverse transcription polymerase chain reaction were used by the participants, only two false-negative results and one false-positive result were generated; these were generated by three separate laboratories. Both false-negative results were obtained with tests performed on specimens with the lowest concentration (1.2 × 104 genomic equivalents/mL. In addition, all 18 participants from Beijing achieved 100% sensitivity and 100% specificity. Overall, we conclude that the majority of the laboratories evaluated have reliable diagnostic capacities for the detection

Inference of RNA polymerase II transcription dynamics from chromatin immunoprecipitation time course data.

Directory of Open Access Journals (Sweden)

Ciira wa Maina

2014-05-01

Full Text Available Gene transcription mediated by RNA polymerase II (pol-II is a key step in gene expression. The dynamics of pol-II moving along the transcribed region influence the rate and timing of gene expression. In this work, we present a probabilistic model of transcription dynamics which is fitted to pol-II occupancy time course data measured using ChIP-Seq. The model can be used to estimate transcription speed and to infer the temporal pol-II activity profile at the gene promoter. Model parameters are estimated using either maximum likelihood estimation or via Bayesian inference using Markov chain Monte Carlo sampling. The Bayesian approach provides confidence intervals for parameter estimates and allows the use of priors that capture domain knowledge, e.g. the expected range of transcription speeds, based on previous experiments. The model describes the movement of pol-II down the gene body and can be used to identify the time of induction for transcriptionally engaged genes. By clustering the inferred promoter activity time profiles, we are able to determine which genes respond quickly to stimuli and group genes that share activity profiles and may therefore be co-regulated. We apply our methodology to biological data obtained using ChIP-seq to measure pol-II occupancy genome-wide when MCF-7 human breast cancer cells are treated with estradiol (E2. The transcription speeds we obtain agree with those obtained previously for smaller numbers of genes with the advantage that our approach can be applied genome-wide. We validate the biological significance of the pol-II promoter activity clusters by investigating cluster-specific transcription factor binding patterns and determining canonical pathway enrichment. We find that rapidly induced genes are enriched for both estrogen receptor alpha (ERα and FOXA1 binding in their proximal promoter regions.

BRF1 mutations alter RNA polymerase III–dependent transcription and cause neurodevelopmental anomalies

Science.gov (United States)

Hög, Friederike; Dentici, Maria Lisa; Tan, Perciliz L.; Sowada, Nadine; Medeira, Ana; Gueneau, Lucie; Thiele, Holger; Kousi, Maria; Lepri, Francesca; Wenzeck, Larissa; Blumenthal, Ian; Radicioni, Antonio; Schwarzenberg, Tito Livio; Mandriani, Barbara; Fischetto, Rita; Morris-Rosendahl, Deborah J.; Altmüller, Janine; Reymond, Alexandre; Nürnberg, Peter; Merla, Giuseppe; Dallapiccola, Bruno; Katsanis, Nicholas; Cramer, Patrick; Kubisch, Christian

2015-01-01

RNA polymerase III (Pol III) synthesizes tRNAs and other small noncoding RNAs to regulate protein synthesis. Dysregulation of Pol III transcription has been linked to cancer, and germline mutations in genes encoding Pol III subunits or tRNA processing factors cause neurogenetic disorders in humans, such as hypomyelinating leukodystrophies and pontocerebellar hypoplasia. Here we describe an autosomal recessive disorder characterized by cerebellar hypoplasia and intellectual disability, as well as facial dysmorphic features, short stature, microcephaly, and dental anomalies. Whole-exome sequencing revealed biallelic missense alterations of BRF1 in three families. In support of the pathogenic potential of the discovered alleles, suppression or CRISPR-mediated deletion of brf1 in zebrafish embryos recapitulated key neurodevelopmental phenotypes; in vivo complementation showed all four candidate mutations to be pathogenic in an apparent isoform-specific context. BRF1 associates with BDP1 and TBP to form the transcription factor IIIB (TFIIIB), which recruits Pol III to target genes. We show that disease-causing mutations reduce Brf1 occupancy at tRNA target genes in Saccharomyces cerevisiae and impair cell growth. Moreover, BRF1 mutations reduce Pol III–related transcription activity in vitro. Taken together, our data show that BRF1 mutations that reduce protein activity cause neurodevelopmental anomalies, suggesting that BRF1-mediated Pol III transcription is required for normal cerebellar and cognitive development. PMID:25561519

Transcription pattern of UL131A-128 mRNA in clinical strains of ...

Indian Academy of Sciences (India)

Human cytomegalovirus (HCMV) mRNA was obtained from human embryonic lung fibroblast cells infected by HCMV clinical strains from urine samples of infants at different kinetic periods. The cDNA of UL131A-128 mRNAs was amplified using reverse transcription-polymerase chain reaction (RT-PCR) and analysed by ...

Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

Science.gov (United States)

Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

2015-03-01

African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

Directory of Open Access Journals (Sweden)

Stephen B. Hughes

2013-08-01

Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

Intracytoplasmic maturation of the human immunodeficiency virus type 1 reverse transcription complexes determines their capacity to integrate into chromatin

Directory of Open Access Journals (Sweden)

Kashanchi Fatah

2006-01-01

Full Text Available Abstract Background The early events of the HIV-1 life cycle include entry of the viral core into target cell, assembly of the reverse transcription complex (RTCs performing reverse transcription, its transformation into integration-competent complexes called pre-integration complexes (PICs, trafficking of complexes into the nucleus, and finally integration of the viral DNA into chromatin. Molecular details and temporal organization of these processes remain among the least investigated and most controversial problems in the biology of HIV. Results To quantitatively evaluate maturation and nuclear translocation of the HIV-1 RTCs, nucleoprotein complexes isolated from the nucleus (nRTC and cytoplasm (cRTC of HeLa cells infected with MLV Env-pseudotyped HIV-1 were analyzed by real-time PCR. While most complexes completed reverse transcription in the cytoplasm, some got into the nucleus before completing DNA synthesis. The HIV-specific RNA complexes could get into the nucleus when reverse transcription was blocked by reverse transcriptase inhibitor, although nuclear import of RNA complexes was less efficient than of DNA-containing RTCs. Analysis of the RTC nuclear import in synchronized cells infected in the G2/M phase of the cell cycle showed enrichment in the nuclei of RTCs containing incomplete HIV-1 DNA compared to non-synchronized cells, where RTCs with complete reverse transcripts prevailed. Immunoprecipitation assays identified viral proteins IN, Vpr, MA, and cellular Ini1 and PML associated with both cRTCs and nRTCs, whereas CA was detected only in cRTCs and RT was diminished in nRTCs. Cytoplasmic maturation of the complexes was associated with increased immunoreactivity with anti-Vpr and anti-IN antibodies, and decreased reactivity with antibodies to RT. Both cRTCs and nRTCs carried out endogenous reverse transcription reaction in vitro. In contrast to cRTCs, in vitro completion of reverse transcription in nRTCs did not increase their

Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

International Nuclear Information System (INIS)

Zhang, H.; Wang, J.C.; Liu, L.F.

1988-01-01

Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

Backtracking dynamics of RNA polymerase: pausing and error correction

International Nuclear Information System (INIS)

Sahoo, Mamata; Klumpp, Stefan

2013-01-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield–Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates. (paper)

Backtracking dynamics of RNA polymerase: pausing and error correction

Science.gov (United States)

Sahoo, Mamata; Klumpp, Stefan

2013-09-01

Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

Structures of RNA Polymerase Closed and Intermediate Complexes Reveal Mechanisms of DNA Opening and Transcription Initiation.

Science.gov (United States)

Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong

2017-07-06

Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

Directory of Open Access Journals (Sweden)

W. Ali

2017-06-01

Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants.

Science.gov (United States)

Shis, David L; Bennett, Matthew R

2013-03-26

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host's native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits.

Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

Science.gov (United States)

Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

2012-04-01

Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

Multiplex, Quantitative, Reverse Transcription PCR Detection of Influenza Viruses Using Droplet Microfluidic Technology

Directory of Open Access Journals (Sweden)

Ravi Prakash

2014-12-01

Full Text Available Quantitative, reverse transcription, polymerase chain reaction (qRT-PCR is facilitated by leveraging droplet microfluidic (DMF system, which due to its precision dispensing and sample handling capabilities at microliter and lower volumes has emerged as a popular method for miniaturization of the PCR platform. This work substantially improves and extends the functional capabilities of our previously demonstrated single qRT-PCR micro-chip, which utilized a combination of electrostatic and electrowetting droplet actuation. In the reported work we illustrate a spatially multiplexed micro-device that is capable of conducting up to eight parallel, real-time PCR reactions per usage, with adjustable control on the PCR thermal cycling parameters (both process time and temperature set-points. This micro-device has been utilized to detect and quantify the presence of two clinically relevant respiratory viruses, Influenza A and Influenza B, in human samples (nasopharyngeal swabs, throat swabs. The device performed accurate detection and quantification of the two respiratory viruses, over several orders of RNA copy counts, in unknown (blind panels of extracted patient samples with acceptably high PCR efficiency (>94%. The multi-stage qRT-PCR assays on eight panel patient samples were accomplished within 35–40 min, with a detection limit for the target Influenza virus RNAs estimated to be less than 10 RNA copies per reaction.

Cdc15 Phosphorylates the C-terminal Domain of RNA Polymerase II for Transcription during Mitosis.

Science.gov (United States)

Singh, Amit Kumar; Rastogi, Shivangi; Shukla, Harish; Asalam, Mohd; Rath, Srikanta Kumar; Akhtar, Md Sohail

2017-03-31

In eukaryotes, the basal transcription in interphase is orchestrated through the regulation by kinases (Kin28, Bur1, and Ctk1) and phosphatases (Ssu72, Rtr1, and Fcp1), which act through the post-translational modification of the C-terminal domain (CTD) of the largest subunit of RNA polymerase II. The CTD comprises the repeated Tyr-Ser-Pro-Thr-Ser-Pro-Ser motif with potential epigenetic modification sites. Despite the observation of transcription and periodic expression of genes during mitosis with entailing CTD phosphorylation and dephosphorylation, the associated CTD specific kinase(s) and its role in transcription remains unknown. Here we have identified Cdc15 as a potential kinase phosphorylating Ser-2 and Ser-5 of CTD for transcription during mitosis in the budding yeast. The phosphorylation of CTD by Cdc15 is independent of any prior Ser phosphorylation(s). The inactivation of Cdc15 causes reduction of global CTD phosphorylation during mitosis and affects the expression of genes whose transcript levels peak during mitosis. Cdc15 also influences the complete transcription of clb2 gene and phosphorylates Ser-5 at the promoter and Ser-2 toward the 3' end of the gene. The observation that Cdc15 could phosphorylate Ser-5, as well as Ser-2, during transcription in mitosis is in contrast to the phosphorylation marks put by the kinases in interphase (G 1 , S, and G 2 ), where Cdck7/Kin28 phosphorylates Ser-5 at promoter and Bur1/Ctk1 phosphorylates Ser-2 at the 3' end of the genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

Science.gov (United States)

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription

Engineering of a DNA Polymerase for Direct m6 A Sequencing.

Science.gov (United States)

Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

2018-01-08

Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro

Directory of Open Access Journals (Sweden)

Gronenborn Angela M

2010-05-01

Full Text Available Abstract Background Lemay et al recently reported that the RNA binding protein HuR directly interacts with the ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT and influences the efficiency of viral reverse transcription (Lemay et al., 2008, Retrovirology 5:47. HuR is a member of the embryonic lethal abnormal vision protein family and contains 3 RNA recognition motifs (RRMs that bind AU-rich elements (AREs. To define the structural determinants of the HuR-RT interaction and to elucidate the mechanism(s by which HuR influences HIV-1 reverse transcription activity in vitro, we cloned and purified full-length HuR as well as three additional protein constructs that contained the N-terminal and internal RRMs, the internal and C-terminal RRMs, or the C-terminal RRM only. Results All four HuR proteins were purified and characterized by biophysical methods. They are well structured and exist as monomers in solution. No direct protein-protein interaction between HuR and HIV-1 RT was detected using NMR titrations with 15N labeled HuR variants or the 15N labeled RNase H domain of HIV-1 RT. Furthermore, HuR did not significantly affect the kinetics of HIV-1 reverse transcription in vitro, even on RNA templates that contain AREs. Conclusions Our results suggest that HuR does not impact HIV-1 replication through a direct protein-protein interaction with the viral RT.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.

2010-01-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.

2010-05-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

Targeting miR-423-5p Reverses Exercise Training-Induced HCN4 Channel Remodeling and Sinus Bradycardia

DEFF Research Database (Denmark)

D'Souza, Alicia; Pearman, Charles M.; Wang, Yanwen

2017-01-01

-generation sequencing and quantitative real-time reverse transcription polymerase chain reaction showed remodeling of miRs in the sinus node of swim-trained mice. Computational predictions highlighted a prominent role for miR-423-5p. Interaction between miR-423-5p and HCN4 was confirmed by a dose-dependent reduction...

In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

DEFF Research Database (Denmark)

Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren

2000-01-01

An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

Science.gov (United States)

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

Science.gov (United States)

Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

2014-01-01

Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

Towards the molecular bases of polymerase dynamics

International Nuclear Information System (INIS)

Chela Flores, J.

1991-03-01

One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells.

Science.gov (United States)

Froldi, Francesca; Szuperak, Milan; Weng, Chen-Fang; Shi, Wei; Papenfuss, Anthony T; Cheng, Louise Y

2015-01-15

Cellular dedifferentiation is the regression of a cell from a specialized state to a more multipotent state and is implicated in cancer. However, the transcriptional network that prevents differentiated cells from reacquiring stem cell fate is so far unclear. Neuroblasts (NBs), the Drosophila neural stem cells, are a model for the regulation of stem cell self-renewal and differentiation. Here we show that the Drosophila zinc finger transcription factor Nervous fingers 1 (Nerfin-1) locks neurons into differentiation, preventing their reversion into NBs. Following Prospero-dependent neuronal specification in the ganglion mother cell (GMC), a Nerfin-1-specific transcriptional program maintains differentiation in the post-mitotic neurons. The loss of Nerfin-1 causes reversion to multipotency and results in tumors in several neural lineages. Both the onset and rate of neuronal dedifferentiation in nerfin-1 mutant lineages are dependent on Myc- and target of rapamycin (Tor)-mediated cellular growth. In addition, Nerfin-1 is required for NB differentiation at the end of neurogenesis. RNA sequencing (RNA-seq) and chromatin immunoprecipitation (ChIP) analysis show that Nerfin-1 administers its function by repression of self-renewing-specific and activation of differentiation-specific genes. Our findings support the model of bidirectional interconvertibility between neural stem cells and their post-mitotic progeny and highlight the importance of the Nerfin-1-regulated transcriptional program in neuronal maintenance. © 2015 Froldi et al.; Published by Cold Spring Harbor Laboratory Press.

Active RNA polymerases: mobile or immobile molecular machines?

Directory of Open Access Journals (Sweden)

Argyris Papantonis

2010-07-01

Full Text Available It is widely assumed that active RNA polymerases track along their templates to produce a transcript. We test this using chromosome conformation capture and human genes switched on rapidly and synchronously by tumour necrosis factor alpha (TNFalpha; one is 221 kbp SAMD4A, which a polymerase takes more than 1 h to transcribe. Ten minutes after stimulation, the SAMD4A promoter comes together with other TNFalpha-responsive promoters. Subsequently, these contacts are lost as new downstream ones appear; contacts are invariably between sequences being transcribed. Super-resolution microscopy confirms that nascent transcripts (detected by RNA fluorescence in situ hybridization co-localize at relevant times. Results are consistent with an alternative view of transcription: polymerases fixed in factories reel in their respective templates, so different parts of the templates transiently lie together.

Reverse Transcription Errors and RNA-DNA Differences at Short Tandem Repeats.

Science.gov (United States)

Fungtammasan, Arkarachai; Tomaszkiewicz, Marta; Campos-Sánchez, Rebeca; Eckert, Kristin A; DeGiorgio, Michael; Makova, Kateryna D

2016-10-01

Transcript variation has important implications for organismal function in health and disease. Most transcriptome studies focus on assessing variation in gene expression levels and isoform representation. Variation at the level of transcript sequence is caused by RNA editing and transcription errors, and leads to nongenetically encoded transcript variants, or RNA-DNA differences (RDDs). Such variation has been understudied, in part because its detection is obscured by reverse transcription (RT) and sequencing errors. It has only been evaluated for intertranscript base substitution differences. Here, we investigated transcript sequence variation for short tandem repeats (STRs). We developed the first maximum-likelihood estimator (MLE) to infer RT error and RDD rates, taking next generation sequencing error rates into account. Using the MLE, we empirically evaluated RT error and RDD rates for STRs in a large-scale DNA and RNA replicated sequencing experiment conducted in a primate species. The RT error rates increased exponentially with STR length and were biased toward expansions. The RDD rates were approximately 1 order of magnitude lower than the RT error rates. The RT error rates estimated with the MLE from a primate data set were concordant with those estimated with an independent method, barcoded RNA sequencing, from a Caenorhabditis elegans data set. Our results have important implications for medical genomics, as STR allelic variation is associated with >40 diseases. STR nonallelic transcript variation can also contribute to disease phenotype. The MLE and empirical rates presented here can be used to evaluate the probability of disease-associated transcripts arising due to RDD. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

Science.gov (United States)

E, Chao; Duan, Baogen; Yu, Jin

2017-04-20

Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

Visual detection of the human metapneumovirus using reverse transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye

Directory of Open Access Journals (Sweden)

Wang Xiang

2012-07-01

Full Text Available Abstract Background Human metapneumovirus (hMPV is a major cause of acute respiratory infections ranging from wheezing to bronchiolitis and pneumonia in children worldwide. The objective of this study is to develop a visual reverse transcription loop-mediated isothermal amplification (RT-LAMP assay for the detection of hMPV and applied to the clinical samples. Results In this study, visual RT-LAMP assay for hMPV was performed in one step with the addition of hydroxynaphthol blue (HNB, and were used to detect respiratory samples. Six primers, including two outer primers (F3 and B3, two inner primers (FIP, BIP and two loop primers (LF and LB, were designed for hMPV N gene by the online software. Moreover, the RT-LAMP assay showed good specificity and no cross-reactivity was observed with human rhinovirus (HRV, human respiratory syncytial Virus (RSV, or influenza virus A/PR/8/34 (H1N1. The detection limit of the RT-LAMP assay was approximately ten viral RNA copies, lower than that of traditional reverse transcriptase polymerase chain reaction (RT-PCR 100 RNA copies. In the 176 nasopharyngeal samples, 23 (13.1% were conformed as hMPV positive by RT-LAMP, but 18 (10.2% positive by RT-PCR. Conclusion Compared with conventional RT-PCR, the visual hMPV RT-LAMP assay performed well in the aspect of detect time, sensitivity, specificity and visibility. It is anticipated that the RT-LAMP will be used for clinical tests in hospital or field testing during outbreaks and in emergency.

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Artemisia desertorum Spreng; drought tolerance; mRNA differential display; RING zinc ... Semi-quantitative reverse-transcriptase-polymerase chain reaction ... College of Life Sciences, National Key Laboratory of Protein Engineering and Plant ...

Ubiquitylation and degradation of elongating RNA polymerase II

DEFF Research Database (Denmark)

Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q

2013-01-01

During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....

Improved detection limit in rapid detection of human enterovirus 71 and coxsackievirus A16 by a novel reverse transcription-isothermal multiple-self-matching-initiated amplification assay.

Science.gov (United States)

Ding, Xiong; Nie, Kai; Shi, Lei; Zhang, Yong; Guan, Li; Zhang, Dan; Qi, Shunxiang; Ma, Xuejun

2014-06-01

Rapid detection of human enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) is important in the early phase of hand-foot-and-mouth disease (HFMD). In this study, we developed and evaluated a novel reverse transcription-isothermal multiple-self-matching-initiated amplification (RT-IMSA) assay for the rapid detection of EV71 and CVA16 by use of reverse transcriptase, together with a strand displacement DNA polymerase. Real-time RT-IMSA assays using a turbidimeter and visual RT-IMSA assays to detect EV71 and CVA16 were established and completed in 1 h, and the reported corresponding real-time reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assays targeting the same regions of the VP1 gene were adopted as parallel tests. Through testing VP1 RNAs transcribed in vitro, the real-time RT-IMSA assays exhibited better linearity of quantification, with R(2) values of 0.952 (for EV71) and 0.967 (for CVA16), than the real-time RT-LAMP assays, which had R(2) values of 0.803 (for EV71) and 0.904 (for CVA16). Additionally, the detection limits of the real-time RT-IMSA assays (approximately 937 for EV71 and 67 for CVA16 copies/reaction) were higher than those of real-time RT-LAMP assays (approximately 3,266 for EV71 and 430 for CVA16 copies/reaction), and similar results were observed in the visual RT-IMSA assays. The new approaches also possess high specificities for the corresponding targets, with no cross-reactivity observed. In clinical assessment, compared to commercial reverse transcription-quantitative PCR (qRT-PCR) kits, the diagnostic sensitivities of the real-time RT-IMSA assays (96.4% for EV71 and 94.6% for CVA16) were higher than those of the real-time RT-LAMP assays (91.1% for EV71 and 90.8% for CVA16). The visual RT-IMSA assays also exhibited the same results. In conclusion, this proof-of-concept study suggests that the novel RT-IMSA assay is superior to the RT-LAMP assay in terms of detection limit and has the potential to rapidly detect EV71

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Emerging Functions of Transcription Factors in Malaria Parasite

Directory of Open Access Journals (Sweden)

Renu Tuteja

2011-01-01

Full Text Available Transcription is a process by which the genetic information stored in DNA is converted into mRNA by enzymes known as RNA polymerase. Bacteria use only one RNA polymerase to transcribe all of its genes while eukaryotes contain three RNA polymerases to transcribe the variety of eukaryotic genes. RNA polymerase also requires other factors/proteins to produce the transcript. These factors generally termed as transcription factors (TFs are either associated directly with RNA polymerase or add in building the actual transcription apparatus. TFs are the most common tools that our cells use to control gene expression. Plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. It shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in P. falciparum somehow differ from those of other eukaryotes. In this article we describe the studies on the main TFs such as myb protein, high mobility group protein and ApiA2 family proteins from malaria parasite. These studies show that these TFs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.

Generation and comprehensive analysis of an influenza virus polymerase cellular interaction network.

Science.gov (United States)

Tafforeau, Lionel; Chantier, Thibault; Pradezynski, Fabrine; Pellet, Johann; Mangeot, Philippe E; Vidalain, Pierre-Olivier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent

2011-12-01

The influenza virus transcribes and replicates its genome inside the nucleus of infected cells. Both activities are performed by the viral RNA-dependent RNA polymerase that is composed of the three subunits PA, PB1, and PB2, and recent studies have shown that it requires host cell factors to transcribe and replicate the viral genome. To identify these cellular partners, we generated a comprehensive physical interaction map between each polymerase subunit and the host cellular proteome. A total of 109 human interactors were identified by yeast two-hybrid screens, whereas 90 were retrieved by literature mining. We built the FluPol interactome network composed of the influenza virus polymerase (PA, PB1, and PB2) and the nucleoprotein NP and 234 human proteins that are connected through 279 viral-cellular protein interactions. Analysis of this interactome map revealed enriched cellular functions associated with the influenza virus polymerase, including host factors involved in RNA polymerase II-dependent transcription and mRNA processing. We confirmed that eight influenza virus polymerase-interacting proteins are required for virus replication and transcriptional activity of the viral polymerase. These are involved in cellular transcription (C14orf166, COPS5, MNAT1, NMI, and POLR2A), translation (EIF3S6IP), nuclear transport (NUP54), and DNA repair (FANCG). Conversely, we identified PRKRA, which acts as an inhibitor of the viral polymerase transcriptional activity and thus is required for the cellular antiviral response.

Actin is closely associated with RNA polymerase II and involved in activation of gene transcription

International Nuclear Information System (INIS)

Zhu Xiaojuan; Zeng Xianlu; Huang Baiqu; Hao, Shui

2004-01-01

Biochemical and morphological studies have demonstrated the presence of actin in the nucleus of different eukaryotic cells, whereas its role remains unclear. In this work, we studied the interaction and the functional relationship between nuclear actin and RNA polymerase II (RNAP II). The immunofluorescence study demonstrated a clear co-localization of nuclear actin with RNAP II in HeLa cells. Meanwhile, actin can be immunoprecipitated by anti-RNAP II antibody, indicating that they could interact with each other. Treatment of cells with α-amanitin induced the formation of actin bundle network in the nucleoplasm. Blocking of the formation of filamentous actin (F-actin) by cytochalasin B modified the distribution of actin. Although the actin content remained unchanged in resting and concanavalinA stimulated mouse lymphocytes, the actin content in the nuclei showed a progressive increase after stimulation. Furthermore, the antibody against actin blocked RNA synthesis in a eukaryotic in vitro transcription system. These observations implicate that nuclear actin interacts with RNAP II and may have function on the RNAP II-mediated transcription

Both semiquantitative degree of rest Tl-201 uptake and reversibility at 24 hour-delay were needed to predict wall motion improvement after bypass surgery

International Nuclear Information System (INIS)

Lee, D. S.; Yoon, S. N.; Kim, K. B.; Jeong, Z. K.; Lee, M. C.; Ko, C. S.

1997-01-01

Controversy still exists about how to use the uptake at rest and 24 hour delay in rest redistribution Tl-201 SPECT to predict improvement of wall motion abnormality after bypass surgery. To find the best way to combine diagnostic efficacy of Tl-201 SPECT to predict myocardial viability, we studied the predictive values (positive: PPV, negative: NPV) of rest and 24 hour-delay Tl-201 SPECT in 21 patients. Wall motion was assessed comparing preoperative post-stress gated Tc-99m-MIBI SPECT with that of 3 months after surgery. Four point scoring system was used for 17 myocardial segments to asses uptakes ( 0 to 3 for normal to defect) at rest and 24 hour-delay and wall motion ( 0 to 3 for normal to dyskinesia). Ejection fraction improved after surgery (5011% vs 4313%). Intra-observer and inter-observer reproducibility of EF was 7 and 9% respectively when we used 3D Perfusion-Motion Map. Sixty seven segments showed wall motion abnormality before surgery. Predictive values of rest Tl-201 uptake decrease were as follows: 0: 15/15(100%), 1: 30/34(88%), 2: 6/11 (55%), 3: 3/7(43%). So PPV of mild decrease was 88%, and NPV of severe decrease was 50%. Delayed reversibility was evaluated in 37 segments (15 patients). Twenty seven segment had persistence or aggravation, but the other 10 segments improved at 24 hour delay. PPV of reversible 10 segments was 80%, and NPV of reversibility was only 46%. PPV of combination of rest Tl-201 uptake of mild degree and 24 hour reversibility was 86% (38/44) and NPV of neither one was 88%. We concluded that both semi-quantitative degree of Tl-201 uptake at rest and reversibility at 24 hour delay was the best to warrant or abandon postoperative improvement of abnormal wall motion found at preoperative post-stress gated myocardial SPECT

The level of embryonation influences detection of Ostertagia ostertagi eggs by semi-quantitative PCR

DEFF Research Database (Denmark)

Drag, Markus; Höglund, Johan; Nejsum, Peter

2016-01-01

The Internal Transcribed Spacer 2 (ITS2) is a candidate diagnostic marker of the pathogenic cattle nematode Ostertagia ostertagi. The aims of this study were: (i) to document and quantify how the development of O. ostertagi eggs affects ITS2 copies under different storage conditions, and (ii......) to suggest optimal storage conditions for faecal samples in a diagnostic pipeline that involves detection and semi-quantification by real-time semi-quantitative polymerase chain reaction (qPCR). Eggs of Ostertagia ostertagi were obtained from fresh faeces and stored at 4 °C or 25 °C under aerobic...

Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

Directory of Open Access Journals (Sweden)

Lee Yeon-Su

2010-05-01

Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

Inhibition of the 26S proteasome blocks progesterone receptor-dependent transcription through failed recruitment of RNA polymerase II.

Science.gov (United States)

Dennis, Andrew P; Lonard, David M; Nawaz, Zafar; O'Malley, Bert W

2005-03-01

In the present study, we investigated the involvement of protein degradation via the 26S proteasome during progesterone receptor (PR)-mediated transcription in T-47D cells containing a stably integrated MMTV-CAT reporter construct (CAT0 cells). Progesterone induced CAT and HSD11beta2 transcription while co-treatment with the proteasome inhibitor, MG132, blocked PR-induced transcription in a time-dependent fashion. MG132 treatment also inhibited transcription of beta-actin and cyclophilin, but not two proteasome subunit genes, PSMA1 and PSMC1, indicating that proteasome inhibition affects a subset of RNA polymerase II (RNAP(II))-regulated genes. Progesterone-mediated recruitment of RNAP(II) was blocked by MG132 treatment at time points later than 1 h that was not dependent on the continued presence of PR, associated cofactors, and components of the general transcription machinery, supporting the concept that proteasome-mediated degradation is needed for continued transcription. Surprisingly, progesterone-mediated acetylation of histone H4 was inhibited by MG132 with the concomitant recruitment of HDAC3, NCoR, and SMRT. We demonstrate that the steady-state protein levels of SMRT and NCoR are higher in the presence of MG132 in CAT0 cells, consistent with other reports that SMRT and NCoR are targets of the 26S proteasome. However, inhibition of histone deacetylation by trichostatin A (TSA) treatment or SMRT/NCoR knockdown by siRNA did not restore MG132-inhibited progesterone-dependent transcription. Therefore, events other than histone deacetylation and stability of SMRT and NCoR must also play a role in inhibition of PR-mediated transcription.

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

The Mediator complex: a central integrator of transcription

Science.gov (United States)

Allen, Benjamin L.; Taatjes, Dylan J.

2016-01-01

The RNA polymerase II (pol II) enzyme transcribes all protein-coding and most non-coding RNA genes and is globally regulated by Mediator, a large, conformationally flexible protein complex with variable subunit composition (for example, a four-subunit CDK8 module can reversibly associate). These biochemical characteristics are fundamentally important for Mediator's ability to control various processes important for transcription, including organization of chromatin architecture and regulation of pol II pre-initiation, initiation, re-initiation, pausing, and elongation. Although Mediator exists in all eukaryotes, a variety of Mediator functions appear to be specific to metazoans, indicative of more diverse regulatory requirements. PMID:25693131

Structural features in the HIV-1 repeat region facilitate strand transfer during reverse transcription

NARCIS (Netherlands)

Berkhout, B.; Vastenhouw, N. L.; Klasens, B. I.; Huthoff, H.

2001-01-01

Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer is facilitated by terminal repeat (R) elements in the viral genome. This strand-transfer reaction depends on base pairing between the cDNA of the 5'R and the 3'R. There

Expression of a splice variant of the platelet-activating factor receptor transcript 2 in various human cancer cell lines

Directory of Open Access Journals (Sweden)

Ibtissam Youlyouz

2002-01-01

Full Text Available Platelet-activating factor receptor (PAF-R transcripts were analysed by reverse transcriptase-polymerase chain reaction in five human cancer cell lines derived from the breast (BT20, SKBR3 and T47D cells, the pancreas (Miapaca cells and the bladder (5637 cells in order to confirm the existence of a splice variant of the PAF-R transcript 2. After cloning and sequencing, we confirmed its existence in all cell lines. It consisted of the PAF-R transcript 2 lengthening with 82 nucleotides from the 3' end of exon 1 of the PAF-R gene. The role of this elongated form of the tissue-type PAF-R transcript in cell physiology remains to be elucidated.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Rapid Genome-wide Recruitment of RNA Polymerase II Drives Transcription, Splicing, and Translation Events during T Cell Responses

Directory of Open Access Journals (Sweden)

Kathrin Davari

2017-04-01

Full Text Available Summary: Activation of immune cells results in rapid functional changes, but how such fast changes are accomplished remains enigmatic. By combining time courses of 4sU-seq, RNA-seq, ribosome profiling (RP, and RNA polymerase II (RNA Pol II ChIP-seq during T cell activation, we illustrate genome-wide temporal dynamics for ∼10,000 genes. This approach reveals not only immediate-early and posttranscriptionally regulated genes but also coupled changes in transcription and translation for >90% of genes. Recruitment, rather than release of paused RNA Pol II, primarily mediates transcriptional changes. This coincides with a genome-wide temporary slowdown in cotranscriptional splicing, even for polyadenylated mRNAs that are localized at the chromatin. Subsequent splicing optimization correlates with increasing Ser-2 phosphorylation of the RNA Pol II carboxy-terminal domain (CTD and activation of the positive transcription elongation factor (pTEFb. Thus, rapid de novo recruitment of RNA Pol II dictates the course of events during T cell activation, particularly transcription, splicing, and consequently translation. : Davari et al. visualize global changes in RNA Pol II binding, transcription, splicing, and translation. T cells change their functional program by rapid de novo recruitment of RNA Pol II and coupled changes in transcription and translation. This coincides with fluctuations in RNA Pol II phosphorylation and a temporary reduction in cotranscriptional splicing. Keywords: RNA Pol II, cotranscriptional splicing, T cell activation, ribosome profiling, 4sU, H3K36, Ser-5 RNA Pol II, Ser-2 RNA Pol II, immune response, immediate-early genes

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

Science.gov (United States)

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

Science.gov (United States)

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

Science.gov (United States)

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

aHIF but not HIF-1α transcript is a poor prognostic marker in human breast cancer

International Nuclear Information System (INIS)

Cayre, Anne; Rossignol, Fabrice; Clottes, Eric; Penault-Llorca, Frédérique

2003-01-01

Hypoxia-inducible factor-1α (HIF-1α) is part of a transcriptional factor that regulates genes involved in metabolic and vascular adaptation of tumours to oxygen restriction. A splicing variant lacking exon 14 (sHIF-1α) encodes a truncated protein that competes with the normal HIF-1α protein, decreasing its activity. A natural antisense transcript (aHIF) complementary to the 3'-untranslated region of HIF-1α mRNA was described recently. With a semiquantitative multiplex reverse transcriptase–PCR (RT–PCR) assay, we assessed transcript concentrations of HIF-1α, sHIF-1α and aHIF in 110 patients with invasive breast carcinoma. We found a strong positive association between HIF-1α and sHIF-1α, sHIF-1α and aHIF, and an inverse correlation between HIF-1α /sHIF-1α and aHIF. aHIF transcript expression was associated with poor disease-free survival in univariate (P = 0.0038) and multivariate (P = 0.0016) analyses in this series of high-risk primary breast carcinomas. In our series of breast cancer patients, aHIF, and not HIF-1α transcript, is a marker of poor prognosis

Generation and Comprehensive Analysis of an Influenza Virus Polymerase Cellular Interaction Network▿†§

Science.gov (United States)

Tafforeau, Lionel; Chantier, Thibault; Pradezynski, Fabrine; Pellet, Johann; Mangeot, Philippe E.; Vidalain, Pierre-Olivier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent

2011-01-01

The influenza virus transcribes and replicates its genome inside the nucleus of infected cells. Both activities are performed by the viral RNA-dependent RNA polymerase that is composed of the three subunits PA, PB1, and PB2, and recent studies have shown that it requires host cell factors to transcribe and replicate the viral genome. To identify these cellular partners, we generated a comprehensive physical interaction map between each polymerase subunit and the host cellular proteome. A total of 109 human interactors were identified by yeast two-hybrid screens, whereas 90 were retrieved by literature mining. We built the FluPol interactome network composed of the influenza virus polymerase (PA, PB1, and PB2) and the nucleoprotein NP and 234 human proteins that are connected through 279 viral-cellular protein interactions. Analysis of this interactome map revealed enriched cellular functions associated with the influenza virus polymerase, including host factors involved in RNA polymerase II-dependent transcription and mRNA processing. We confirmed that eight influenza virus polymerase-interacting proteins are required for virus replication and transcriptional activity of the viral polymerase. These are involved in cellular transcription (C14orf166, COPS5, MNAT1, NMI, and POLR2A), translation (EIF3S6IP), nuclear transport (NUP54), and DNA repair (FANCG). Conversely, we identified PRKRA, which acts as an inhibitor of the viral polymerase transcriptional activity and thus is required for the cellular antiviral response. PMID:21994455

Regulation of RNA polymerase III transcription during transformation of human IMR90 fibroblasts with defined genetic elements.

Science.gov (United States)

Durrieu-Gaillard, Stéphanie; Dumay-Odelot, Hélène; Boldina, Galina; Tourasse, Nicolas J; Allard, Delphine; André, Fabrice; Macari, Françoise; Choquet, Armelle; Lagarde, Pauline; Drutel, Guillaume; Leste-Lasserre, Thierry; Petitet, Marion; Lesluyes, Tom; Lartigue-Faustin, Lydia; Dupuy, Jean-William; Chibon, Frédéric; Roeder, Robert G; Joubert, Dominique; Vagner, Stéphan; Teichmann, Martin

2018-01-01

RNA polymerase (Pol) III transcribes small untranslated RNAs that are essential for cellular homeostasis and growth. Its activity is regulated by inactivation of tumor suppressor proteins and overexpression of the oncogene c-MYC, but the concerted action of these tumor-promoting factors on Pol III transcription has not yet been assessed. In order to comprehensively analyse the regulation of Pol III transcription during tumorigenesis we employ a model system that relies on the expression of five genetic elements to achieve cellular transformation. Expression of these elements in six distinct transformation intermediate cell lines leads to the inactivation of TP53, RB1, and protein phosphatase 2A, as well as the activation of RAS and the protection of telomeres by TERT, thereby conducting to full tumoral transformation of IMR90 fibroblasts. Transformation is accompanied by moderately enhanced levels of a subset of Pol III-transcribed RNAs (7SK; MRP; H1). In addition, mRNA and/or protein levels of several Pol III subunits and transcription factors are upregulated, including increased protein levels of TFIIIB and TFIIIC subunits, of SNAPC1 and of Pol III subunits. Strikingly, the expression of POLR3G and of SNAPC1 is strongly enhanced during transformation in this cellular transformation model. Collectively, our data indicate that increased expression of several components of the Pol III transcription system accompanied by a 2-fold increase in steady state levels of a subset of Pol III RNAs is sufficient for sustaining tumor formation.

Nuclear entry of poliovirus protease-polymerase precursor 3CD: implications for host cell transcription shut-off

International Nuclear Information System (INIS)

Sharma, Rakhi; Raychaudhuri, Santanu; Dasgupta, Asim

2004-01-01

Host cell transcription mediated by all three RNA polymerases is rapidly inhibited after infection of mammalian cells with poliovirus (PV). Both genetic and biochemical studies have shown that the virus-encoded protease 3C cleaves the TATA-binding protein and other transcription factors at glutamine-glycine sites and is directly responsible for host cell transcription shut-off. PV replicates in the cytoplasm of infected cells. To shut-off host cell transcription, 3C or a precursor of 3C must enter the nucleus of infected cells. Although the 3C protease itself lacks a nuclear localization signal (NLS), amino acid sequence examination of 3D identified a potential single basic type NLS, KKKRD, spanning amino acids 125-129 within this polypeptide. Thus, a plausible scenario is that 3C enters the nucleus in the form of its precursor, 3CD, which then generates 3C by auto-proteolysis ultimately leading to cleavage of transcription factors in the nucleus. Using transient transfection of enhanced green fluorescent protein (EGFP) fusion polypeptides, we demonstrate here that both 3CD and 3D are capable of entering the nucleus in PV-infected cells. However, both polypeptides remain in the cytoplasm in uninfected HeLa cells. Mutagenesis of the NLS sequence in 3D prevents nuclear entry of 3D and 3CD in PV-infected cells. We also demonstrate that 3CD can be detected in the nuclear fraction from PV-infected HeLa cells as early as 2 h postinfection. Significant amount of 3CD is found associated with the nuclear fraction by 3-4 h of infection. Taken together, these results suggest that both the 3D NLS and PV infection are required for the entry of 3CD into the nucleus and that this may constitute a means by which viral protease 3C is delivered into the nucleus leading to host cell transcription shut-off

Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

International Nuclear Information System (INIS)

Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

2013-01-01

In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

Science.gov (United States)

Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

2018-06-01

Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

Genome-wide mapping of boundary element-associated factor (BEAF) binding sites in Drosophila melanogaster links BEAF to transcription.

Science.gov (United States)

Jiang, Nan; Emberly, Eldon; Cuvier, Olivier; Hart, Craig M

2009-07-01

Insulator elements play a role in gene regulation that is potentially linked to nuclear organization. Boundary element-associated factors (BEAFs) 32A and 32B associate with hundreds of sites on Drosophila polytene chromosomes. We hybridized DNA isolated by chromatin immunoprecipitation to genome tiling microarrays to construct a genome-wide map of BEAF binding locations. A distinct difference in the association of 32A and 32B with chromatin was noted. We identified 1,820 BEAF peaks and found that more than 85% were less than 300 bp from transcription start sites. Half are between head-to-head gene pairs. BEAF-associated genes are transcriptionally active as judged by the presence of RNA polymerase II, dimethylated histone H3 K4, and the alternative histone H3.3. Forty percent of these genes are also associated with the polymerase negative elongation factor NELF. Like NELF-associated genes, most BEAF-associated genes are highly expressed. Using quantitative reverse transcription-PCR, we found that the expression levels of most BEAF-associated genes decrease in embryos and cultured cells lacking BEAF. These results provide an unexpected link between BEAF and transcription, suggesting that BEAF plays a role in maintaining most associated promoter regions in an environment that facilitates high transcription levels.

Characterization of a Novel Class I Transcription Factor A (CITFA) Subunit That Is Indispensable for Transcription by the Multifunctional RNA Polymerase I of Trypanosoma brucei

KAUST Repository

Nguyen, T. N.

2012-10-26

Trypanosoma brucei is the only organism known to have evolved a multifunctional RNA polymerase I (pol I) system that is used to express the parasite\\'s ribosomal RNAs, as well as its major cell surface antigens, namely, the variant surface glycoprotein (VSG) and procyclin, which are vital for establishing successful infections in the mammalian host and the tsetse vector, respectively. Thus far, biochemical analyses of the T. brucei RNA pol I transcription machinery have elucidated the subunit structure of the enzyme and identified the class I transcription factor A (CITFA). CITFA binds to RNA pol I promoters, and its CITFA-2 subunit was shown to be absolutely essential for RNA pol I transcription in the parasite. Tandem affinity purification (TAP) of CITFA revealed the subunits CITFA-1 to -6, which are conserved only among kinetoplastid organisms, plus the dynein light chain DYNLL1. Here, by tagging CITFA-6 instead of CITFA-2, a complex was purified that contained all known CITFA subunits, as well as a novel proline-rich protein. Functional studies carried out in vivo and in vitro, as well as a colocalization study, unequivocally demonstrated that this protein is a bona fide CITFA subunit, essential for parasite viability and indispensable for RNA pol I transcription of ribosomal gene units and the active VSG expression site in the mammalian-infective life cycle stage of the parasite. Interestingly, CITFA-7 function appears to be species specific, because expression of an RNA interference (RNAi)-resistant CITFA-7 transgene from Trypanosoma cruzi could not rescue the lethal phenotype of silencing endogenous CITFA-7.

Targeted HIV-1 Latency Reversal Using CRISPR/Cas9-Derived Transcriptional Activator Systems.

Directory of Open Access Journals (Sweden)

Julia K Bialek

Full Text Available CRISPR/Cas9 technology is currently considered the most advanced tool for targeted genome engineering. Its sequence-dependent specificity has been explored for locus-directed transcriptional modulation. Such modulation, in particular transcriptional activation, has been proposed as key approach to overcome silencing of dormant HIV provirus in latently infected cellular reservoirs. Currently available agents for provirus activation, so-called latency reversing agents (LRAs, act indirectly through cellular pathways to induce viral transcription. However, their clinical performance remains suboptimal, possibly because reservoirs have diverse cellular identities and/or proviral DNA is intractable to the induced pathways. We have explored two CRISPR/Cas9-derived activator systems as targeted approaches to induce dormant HIV-1 proviral DNA. These systems recruit multiple transcriptional activation domains to the HIV 5' long terminal repeat (LTR, for which we have identified an optimal target region within the LTR U3 sequence. Using this target region, we demonstrate transcriptional activation of proviral genomes via the synergistic activation mediator complex in various in culture model systems for HIV latency. Observed levels of induction are comparable or indeed higher than treatment with established LRAs. Importantly, activation is complete, leading to production of infective viral particles. Our data demonstrate that CRISPR/Cas9-derived technologies can be applied to counteract HIV latency and may therefore represent promising novel approaches in the quest for HIV elimination.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

RNA polymerase activity of Ustilago maydis virus

Energy Technology Data Exchange (ETDEWEB)

Yie, S.W.

1986-01-01

Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

Science.gov (United States)

Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

2012-01-01

Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation

Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells.

Science.gov (United States)

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2010-05-01

Genome-wide occupancy profiles of five components of the RNA polymerase III (Pol III) machinery in human cells identified the expected tRNA and noncoding RNA targets and revealed many additional Pol III-associated loci, mostly near short interspersed elements (SINEs). Several genes are targets of an alternative transcription factor IIIB (TFIIIB) containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike nonexpressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner.

Histone H1 phosphorylation is associated with transcription by RNA polymerases I and II

Science.gov (United States)

Zheng, Yupeng; John, Sam; Pesavento, James J.; Schultz-Norton, Jennifer R.; Schiltz, R. Louis; Baek, Sonjoon; Nardulli, Ann M.; Hager, Gordon L.; Kelleher, Neil L.

2010-01-01

Histone H1 phosphorylation affects chromatin condensation and function, but little is known about how specific phosphorylations impact the function of H1 variants in higher eukaryotes. In this study, we show that specific sites in H1.2 and H1.4 of human cells are phosphorylated only during mitosis or during both mitosis and interphase. Antisera generated to individual H1.2/H1.4 interphase phosphorylations reveal that they are distributed throughout nuclei and enriched in nucleoli. Moreover, interphase phosphorylated H1.4 is enriched at active 45S preribosomal RNA gene promoters and is rapidly induced at steroid hormone response elements by hormone treatment. Our results imply that site-specific interphase H1 phosphorylation facilitates transcription by RNA polymerases I and II and has an unanticipated function in ribosome biogenesis and control of cell growth. Differences in the numbers, structure, and locations of interphase phosphorylation sites may contribute to the functional diversity of H1 variants. PMID:20439994

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

Science.gov (United States)

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

Science.gov (United States)

Qureshi, S A; Bell, S D; Jackson, S P

1997-05-15

Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.

Rapid and sensitive detection of potyvirus infecting tropical tuber ...

African Journals Online (AJOL)

A reverse transcription polymerase chain reaction assay using potyvirus specific primers designed from the core of the coat protein was carried out, and a cDNA fragment of 327 bp was obtained from most of the potyviruses infecting the tropical tuber crops. Reverse transcription polymerase chain reaction (RT-PCR) ...

Effect of captan on the exonuclease activities of DNA polymerase I from E. coli and reverse transcriptase from avian myeloblastosis virus

International Nuclear Information System (INIS)

Freeman-Wittig, M.J.B.

1986-01-01

The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan

Transcription factor-based biosensor

Science.gov (United States)

Dietrich, Jeffrey A; Keasling, Jay D

2013-10-08

The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

Genome-wide RNA polymerase II profiles and RNA accumulation reveal kinetics of transcription and associated epigenetic changes during diurnal cycles.

Directory of Open Access Journals (Sweden)

Gwendal Le Martelot

Full Text Available Interactions of cell-autonomous circadian oscillators with diurnal cycles govern the temporal compartmentalization of cell physiology in mammals. To understand the transcriptional and epigenetic basis of diurnal rhythms in mouse liver genome-wide, we generated temporal DNA occupancy profiles by RNA polymerase II (Pol II as well as profiles of the histone modifications H3K4me3 and H3K36me3. We used these data to quantify the relationships of phases and amplitudes between different marks. We found that rhythmic Pol II recruitment at promoters rather than rhythmic transition from paused to productive elongation underlies diurnal gene transcription, a conclusion further supported by modeling. Moreover, Pol II occupancy preceded mRNA accumulation by 3 hours, consistent with mRNA half-lives. Both methylation marks showed that the epigenetic landscape is highly dynamic and globally remodeled during the 24-hour cycle. While promoters of transcribed genes had tri-methylated H3K4 even at their trough activity times, tri-methylation levels reached their peak, on average, 1 hour after Pol II. Meanwhile, rhythms in tri-methylation of H3K36 lagged transcription by 3 hours. Finally, modeling profiles of Pol II occupancy and mRNA accumulation identified three classes of genes: one showing rhythmicity both in transcriptional and mRNA accumulation, a second class with rhythmic transcription but flat mRNA levels, and a third with constant transcription but rhythmic mRNAs. The latter class emphasizes widespread temporally gated posttranscriptional regulation in the mouse liver.

TAF(II)250: a transcription toolbox.

Science.gov (United States)

Wassarman, D A; Sauer, F

2001-08-01

Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.

Ultraviolet irradiation of herpes simplex virus (type 1): delayed transcription and comparative sensitivites of virus functions.

Science.gov (United States)

Eglin, R P; Gugerli, P; Wildy, P

1980-07-01

The delay in the replication of herpes simplex virus surviving u.v. irradiation occurs after the uncoating of virus, as judged by sensitivity to DNase. It occurs before translation, judged by the kinetics of appearance of various virus-specific proteins, and before transcription, judged by the detection of virus-specific RNA by in situ hybridization. Since the delays in both transcription and translation are reversed by photoreactivation, the simplest hypothesis is that pyrimidine dimers directly obstruct transcription;unless these are broken by photoreactivating enzymes, there will be transcriptional delay until reactivating processes have repaired the lesion. The u.v. sensitivities of the abilities to induce various enzymes (thymidine kinase, DNase and DNA polymerase) were only about four times less than that of infectivity. The The ability to induce the three enzymes was three times less sensitive than that of the structural antigen (Band II).

Ultraviolet irradiation of herpes simplex virus (type 1): delayed transcription and comparative sensitivities of virus functions

International Nuclear Information System (INIS)

Eglin, R.P.; Gugerli, P.; Wildy, P.

1980-01-01

The delay in the replication of herpes simplex virus surviving u.v. irradiation occurs after the uncoating of virus, as judged by sensitivity to DNase. It occurs before translation, judged by the kinetics of appearance of various virus-specific proteins, and before transcription, judged by the detection of virus-specific RNA by in situ hybridization. Since the delays in both transcription and translation are reversed by photoreactivation, the simplest hypothesis is that pyrimidine dimers directly obstruct transcription; unless these are broken by photoreactivating enzymes, there will be transcriptional delay until reactivating processes have repaired the lesion. The u.v. sensitivities of the abilities to induce various enzymes (thymidine kinase, DNase and DNA polymerase) were only about four times less than that of infectivity. The ability to induce the three enzymes was three times less sensitive than that of the structural antigen (Band II). (U.K.)

PRMT5 restricts hepatitis B virus replication through epigenetic repression of covalently closed circular DNA transcription and interference with pregenomic RNA encapsidation.

Science.gov (United States)

Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong

2017-08-01

Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host

Relationship between human cytomegalovirus transcription and symptomatic apical periodontitis in Iran.

Science.gov (United States)

Yazdi, K A; Sabeti, M; Jabalameli, F; Eman eini, M; Kolahdouzan, S A; Slots, J

2008-12-01

Apical periodontitis of endodontic origin may develop as a result of cooperative interactions among herpesviruses, specific pathogenic bacteria and tissue-destructive inflammatory mediators. This study sought to identify the presence of Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) transcripts in symptomatic and asymptomatic periapical lesions of individuals living in Iran. Fifty endodontic patients (28 with symptomatic periapical lesions and 22 with asymptomatic periapical lesions) were included in the study. In each study subject, a microbiological periapical sample was collected using a curette in conjunction with periapical surgery. A reverse transcription-polymerase chain reaction assay was used to identify transcripts of EBV and HCMV. Human cytomegalovirus transcript was detected in 15 of the 28 (53.6%) symptomatic and in six of the 22 (27.3%) asymptomatic periapical study lesions (significant difference between symptomatic and asymptomatic lesions; P = 0.03, chi-square test). Epstein-Barr virus transcript was identified in one symptomatic and in two asymptomatic periapical lesions. This study establishes that HCMV transcription is common in apical periodontitis and is most frequent in symptomatic lesions. The high frequency of active herpesvirus infections in severe apical periodontitis changes the pathogenic paradigm of the disease and may also have preventive and therapeutic implications.

Transcription-based model for the induction of chromosomal exchange events by ionising radiation

International Nuclear Information System (INIS)

Radford, I.A.

2003-01-01

The mechanistic basis for chromosomal aberration formation, following exposure of mammalian cells to ionising radiation, has long been debated. Although chromosomal aberrations are probably initiated by DNA double-strand breaks (DSB), little is understood about the mechanisms that generate and modulate DNA rearrangement. Based on results from our laboratory and data from the literature, a novel model of chromosomal aberration formation has been suggested (Radford 2002). The basic postulates of this model are that: (1) DSB, primarily those involving multiple individual damage sites (i.e. complex DSB), are the critical initiating lesion; (2) only those DSB occurring in transcription units that are associated with transcription 'factories' (complexes containing multiple transcription units) induce chromosomal exchange events; (3) such DSB are brought into contact with a DNA topoisomerase I molecule through RNA polymerase II catalysed transcription and give rise to trapped DNA-topo I cleavage complexes; and (4) trapped complexes interact with another topo I molecule on a temporarily inactive transcription unit at the same transcription factory leading to DNA cleavage and subsequent strand exchange between the cleavage complexes. We have developed a method using inverse PCR that allows the detection and sequencing of putative ionising radiation-induced DNA rearrangements involving different regions of the human genome (Forrester and Radford 1998). The sequences detected by inverse PCR can provide a test of the prediction of the transcription-based model that ionising radiation-induced DNA rearrangements occur between sequences in active transcription units. Accordingly, reverse transcriptase PCR was used to determine if sequences involved in rearrangements were transcribed in the test cells. Consistent with the transcription-based model, nearly all of the sequences examined gave a positive result to reverse transcriptase PCR (Forrester and Radford unpublished)

Expression Profile of IL-35 mRNA in Gingiva of Chronic Periodontitis and Aggressive Periodontitis Patients: A Semiquantitative RT-PCR Study

Directory of Open Access Journals (Sweden)

Nagaraj B. Kalburgi

2013-01-01

Full Text Available Background. Proinflammatory and anti-inflammatory cytokines play a key role in the pathogenesis of periodontal diseases. Secretion of bioactive IL-35 has been described by T regulatory cells ( and is required for their maximal suppressive activity. are involved in the modulation of local immune response in chronic periodontitis patients. Objective. Hence, the present study was aimed to investigate the expression of IL-35 mRNA in chronic periodontitis and aggressive periodontitis patients. Materials and Methods. The present study was carried out in 60 subjects, which included 20 chronic periodontitis patients, 20 aggressive periodontitis patients, and 20 periodontally healthy controls. IL-35 mRNA expression in gingival tissue samples of all subjects was semiquantitatively analyzed using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR. Results. The present study demonstrated the expression of IL-35 mRNA in gingival tissues of all the three groups. IL-35 mRNA expression was highest in chronic periodontitis subjects ( as compared to the aggressive periodontitis group ( and least seen in healthy patients (. Conclusion. The increased expression of IL-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis. Future studies done on large samples with intervention will strengthen our result.

Reverse engineering a mouse embryonic stem cell-specific transcriptional network reveals a new modulator of neuronal differentiation.

Science.gov (United States)

De Cegli, Rossella; Iacobacci, Simona; Flore, Gemma; Gambardella, Gennaro; Mao, Lei; Cutillo, Luisa; Lauria, Mario; Klose, Joachim; Illingworth, Elizabeth; Banfi, Sandro; di Bernardo, Diego

2013-01-01

Gene expression profiles can be used to infer previously unknown transcriptional regulatory interaction among thousands of genes, via systems biology 'reverse engineering' approaches. We 'reverse engineered' an embryonic stem (ES)-specific transcriptional network from 171 gene expression profiles, measured in ES cells, to identify master regulators of gene expression ('hubs'). We discovered that E130012A19Rik (E13), highly expressed in mouse ES cells as compared with differentiated cells, was a central 'hub' of the network. We demonstrated that E13 is a protein-coding gene implicated in regulating the commitment towards the different neuronal subtypes and glia cells. The overexpression and knock-down of E13 in ES cell lines, undergoing differentiation into neurons and glia cells, caused a strong up-regulation of the glutamatergic neurons marker Vglut2 and a strong down-regulation of the GABAergic neurons marker GAD65 and of the radial glia marker Blbp. We confirmed E13 expression in the cerebral cortex of adult mice and during development. By immuno-based affinity purification, we characterized protein partners of E13, involved in the Polycomb complex. Our results suggest a role of E13 in regulating the division between glutamatergic projection neurons and GABAergic interneurons and glia cells possibly by epigenetic-mediated transcriptional regulation.

Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

Directory of Open Access Journals (Sweden)

Keshab Rijal

2016-08-01

Full Text Available The ability of RNA polymerase (RNAP III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC; they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease.

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

Science.gov (United States)

Leem, S H; Ropp, P A; Sugino, A

1994-08-11

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

The transcription fidelity factor GreA impedes DNA break repair.

Science.gov (United States)

Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

2017-10-12

Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

Comparison of two methods for the detection of hepatitis A virus in clam samples (Tapes spp.) by reverse transcription-nested PCR.

Science.gov (United States)

Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen

2004-03-01

The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.

The chemical structure of DNA sequence signals for RNA transcription

Science.gov (United States)

George, D. G.; Dayhoff, M. O.

1982-01-01

The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

Science.gov (United States)

Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

2015-03-31

Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL.

Science.gov (United States)

Della Gatta, Giusy; Palomero, Teresa; Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Bansal, Mukesh; Carpenter, Zachary W; De Keersmaecker, Kim; Sole, Xavier; Xu, Luyao; Paietta, Elisabeth; Racevskis, Janis; Wiernik, Peter H; Rowe, Jacob M; Meijerink, Jules P; Califano, Andrea; Ferrando, Adolfo A

2012-02-26

The TLX1 and TLX3 transcription factor oncogenes have a key role in the pathogenesis of T cell acute lymphoblastic leukemia (T-ALL). Here we used reverse engineering of global transcriptional networks to decipher the oncogenic regulatory circuit controlled by TLX1 and TLX3. This systems biology analysis defined T cell leukemia homeobox 1 (TLX1) and TLX3 as master regulators of an oncogenic transcriptional circuit governing T-ALL. Notably, a network structure analysis of this hierarchical network identified RUNX1 as a key mediator of the T-ALL induced by TLX1 and TLX3 and predicted a tumor-suppressor role for RUNX1 in T cell transformation. Consistent with these results, we identified recurrent somatic loss-of-function mutations in RUNX1 in human T-ALL. Overall, these results place TLX1 and TLX3 at the top of an oncogenic transcriptional network controlling leukemia development, show the power of network analyses to identify key elements in the regulatory circuits governing human cancer and identify RUNX1 as a tumor-suppressor gene in T-ALL.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

Energy Technology Data Exchange (ETDEWEB)

Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

2011-10-25

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

International Nuclear Information System (INIS)

Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

2011-01-01

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II.

Directory of Open Access Journals (Sweden)

Dominik M Meinel

2013-11-01

Full Text Available Messenger RNA (mRNA synthesis and export are tightly linked, but the molecular mechanisms of this coupling are largely unknown. In Saccharomyces cerevisiae, the conserved TREX complex couples transcription to mRNA export and mediates mRNP formation. Here, we show that TREX is recruited to the transcription machinery by direct interaction of its subcomplex THO with the serine 2-serine 5 (S2/S5 diphosphorylated CTD of RNA polymerase II. S2 and/or tyrosine 1 (Y1 phosphorylation of the CTD is required for TREX occupancy in vivo, establishing a second interaction platform necessary for TREX recruitment in addition to RNA. Genome-wide analyses show that the occupancy of THO and the TREX components Sub2 and Yra1 increases from the 5' to the 3' end of the gene in accordance with the CTD S2 phosphorylation pattern. Importantly, in a mutant strain, in which TREX is recruited to genes but does not increase towards the 3' end, the expression of long transcripts is specifically impaired. Thus, we show for the first time that a 5'-3' increase of a protein complex is essential for correct expression of the genome. In summary, we provide insight into how the phospho-code of the CTD directs mRNP formation and export through TREX recruitment.

Recruitment of TREX to the transcription machinery by its direct binding to the phospho-CTD of RNA polymerase II.

Science.gov (United States)

Meinel, Dominik M; Burkert-Kautzsch, Cornelia; Kieser, Anja; O'Duibhir, Eoghan; Siebert, Matthias; Mayer, Andreas; Cramer, Patrick; Söding, Johannes; Holstege, Frank C P; Sträßer, Katja

2013-11-01

Messenger RNA (mRNA) synthesis and export are tightly linked, but the molecular mechanisms of this coupling are largely unknown. In Saccharomyces cerevisiae, the conserved TREX complex couples transcription to mRNA export and mediates mRNP formation. Here, we show that TREX is recruited to the transcription machinery by direct interaction of its subcomplex THO with the serine 2-serine 5 (S2/S5) diphosphorylated CTD of RNA polymerase II. S2 and/or tyrosine 1 (Y1) phosphorylation of the CTD is required for TREX occupancy in vivo, establishing a second interaction platform necessary for TREX recruitment in addition to RNA. Genome-wide analyses show that the occupancy of THO and the TREX components Sub2 and Yra1 increases from the 5' to the 3' end of the gene in accordance with the CTD S2 phosphorylation pattern. Importantly, in a mutant strain, in which TREX is recruited to genes but does not increase towards the 3' end, the expression of long transcripts is specifically impaired. Thus, we show for the first time that a 5'-3' increase of a protein complex is essential for correct expression of the genome. In summary, we provide insight into how the phospho-code of the CTD directs mRNP formation and export through TREX recruitment.

Transcription-induced DNA supercoiling: New roles of intranucleosomal DNA loops in DNA repair and transcription.

Science.gov (United States)

Gerasimova, N S; Pestov, N A; Kulaeva, O I; Clark, D J; Studitsky, V M

2016-05-26

RNA polymerase II (Pol II) transcription through chromatin is accompanied by formation of small intranucleosomal DNA loops. Pol II captured within a small loop drives accumulation of DNA supercoiling, facilitating further transcription. DNA breaks relieve supercoiling and induce Pol II arrest, allowing detection of DNA damage hidden in chromatin structure.

Journal of Biosciences | Indian Academy of Sciences

Indian Academy of Sciences (India)

Polypeptide -acetylgalactosaminyltransferase 14 (GalNAc-T14) is a novel IGFBP-3 binding partner. In this paper, small interference RNA (siRNA) targeting GalNAc-T14 was used to examine whether GalNAc-T14 affects the apoptotic action of IGFBP-3. Using semi-quantitative reverse-transcriptase polymerase chain ...

Characterization of human mesothelin transcripts in ovarian and pancreatic cancer

International Nuclear Information System (INIS)

Muminova, Zhanat E; Strong, Theresa V; Shaw, Denise R

2004-01-01

Mesothelin is an attractive target for cancer immunotherapy due to its restricted expression in normal tissues and high level expression in several tumor types including ovarian and pancreatic adenocarcinomas. Three mesothelin transcript variants have been reported, but their relative expression in normal tissues and tumors has been poorly characterized. The goal of the present study was to clarify which mesothelin transcript variants are commonly expressed in human tumors. Human genomic and EST nucleotide sequences in the public databases were used to evaluate sequences reported for the three mesothelin transcript variants in silico. Subsequently, RNA samples from normal ovary, ovarian and pancreatic carcinoma cell lines, and primary ovarian tumors were analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and nucleotide sequencing to directly identify expressed transcripts. In silico comparisons of genomic DNA sequences with available EST sequences supported expression of mesothelin transcript variants 1 and 3, but there were no sequence matches for transcript variant 2. Newly-derived nucleotide sequences of RT-PCR products from tissues and cell lines corresponded to mesothelin transcript variant 1. Mesothelin transcript variant 2 was not detected. Transcript variant 3 was observed as a small percentage of total mesothelin amplification products from all studied cell lines and tissues. Fractionation of nuclear and cytoplasmic RNA indicated that variant 3 was present primarily in the nuclear fraction. Thus, mesothelin transcript variant 3 may represent incompletely processed hnRNA. Mesothelin transcript variant 1 represents the predominant mature mRNA species expressed by both normal and tumor cells. This conclusion should be important for future development of cancer immunotherapies, diagnostic tests, and gene microarray studies targeting mesothelin

Transcription regulation by the Mediator complex.

Science.gov (United States)

Soutourina, Julie

2018-04-01

Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

RNA binding and replication by the poliovirus RNA polymerase

International Nuclear Information System (INIS)

Oberste, M.S.

1988-01-01

RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

Directory of Open Access Journals (Sweden)

Matthew S Lalonde

2011-05-01

Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

Interplay between DNA supercoiling and transcription elongation.

Science.gov (United States)

Ma, Jie; Wang, Michelle

2014-01-01

Transcription-coupled DNA supercoiling has been shown to be an important regulator of transcription that is broadly present in the cell. Here we review experimental work which shows that RNA polymerase is a powerful torsional motor that can alter DNA topology and structure, and DNA supercoiling in turn directly affects transcription elongation.

DNA intercalator stimulates influenza transcription and virus replication

Directory of Open Access Journals (Sweden)

Poon Leo LM

2011-03-01

Full Text Available Abstract Influenza A virus uses its host transcription machinery to facilitate viral RNA synthesis, an event that is associated with cellular RNA polymerase II (RNAPII. In this study, various RNAPII transcription inhibitors were used to investigate the effect of RNAPII phosphorylation status on viral RNA transcription. A low concentration of DNA intercalators, such as actinomycin D (ActD, was found to stimulate viral polymerase activity and virus replication. This effect was not observed in cells treated with RNAPII kinase inhibitors. In addition, the loss of RNAPIIa in infected cells was due to the shift of nonphosphorylated RNAPII (RNAPIIa to hyperphosphorylated RNAPII (RNAPIIo.

Interplay Among Constitutes of Ebola Virus: Nucleoprotein, Polymerase L, Viral Proteins

Science.gov (United States)

Zhang, Minchuan; He, Peiming; Su, Jing; Singh, Dadabhai T.; Su, Hailei; Su, Haibin

Ebola virus is a highly lethal filovirus, claimed thousands of people in its recent outbreak. Seven viral proteins constitute ebola viral structure, and four of them (nucleoprotein (NP), polymerase L, VP35 and VP30) participate majorly in viral replication and transcription. We have elucidated a conformation change of NP cleft by VP35 NP-binding protein domains through superimposing two experimental NP structure images and discussed the function of this conformation change in the replication and transcription with polymerase complex (L, VP35 and VP30). The important roles of VP30 in viral RNA synthesis have also been discussed. A “tapping” model has been proposed in this paper for a better understanding of the interplay among the four viral proteins (NP, polymerase L, VP35 and VP30). Moreover, we have pinpointed some key residue changes on NP (both NP N- and C-terminal) and L between Reston and Zaire by computational studies. Together, this paper provides a description of interactions among ebola viral proteins (NP, L, VP35, VP30 and VP40) in viral replication and transcription, and sheds light on the complex system of viral reproduction.

Structural Basis of Mitochondrial Transcription Initiation.

Science.gov (United States)

Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick

2017-11-16

Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

DNA damage mediated transcription arrest: Step back to go forward.

Science.gov (United States)

Mullenders, Leon

2015-12-01

The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

OpenAIRE

Qureshi, S A; Bell, S D; Jackson, S P

1997-01-01

Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is h...

Repression of RNA polymerase by the archaeo-viral regulator ORF145/RIP

DEFF Research Database (Denmark)

Sheppard, Carol; Blombach, Fabian; Belsom, Adam

2016-01-01

Little is known about how archaeal viruses perturb the transcription machinery of their hosts. Here we provide the first example of an archaeo-viral transcription factor that directly targets the host RNA polymerase (RNAP) and efficiently represses its activity. ORF145 from the temperate Acidianus...

Detection of Enterovirus 71 gene from clinical specimens by reverse-transcription loop-mediated isothermal amplification

OpenAIRE

D Wang; X Wang; Y Geng; C An

2014-01-01

Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conven...

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

Science.gov (United States)

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

RNA polymerase of the killer virus of yeast

International Nuclear Information System (INIS)

Georgopoulos, D.E.; Leibowitz, M.J.

1984-01-01

The L/sub A/ and M double-stranded (ds) RNA segments of the cytoplasmically inherited killer virus of Saccharomyces cerevisiae are encapsidated in virions that contain a DNA-independent transcriptase activity. This enzyme catalyzes the synthesis of full-length (+) stranded copies of the genomic dsRNA segments, denoted l/sub A/ and m. The L/sub A/ dsRNA segment appears to encode the major capsid protein in which both dsRNA molecules are encapsidated, while M dsRNA encodes products responsible for the two killer phenotypes of toxin production and resistance to toxin. Proteins extracted from transcriptionally active virions fail to cross-react with antibody to yeast DNA-dependent RNA polymerases, suggesting that none of the subunits of the host cell polymerases are active in viral transcription. Sequence analysis of the in vitro transcripts reveals neither to be 3'-terminally polyadenylated, although m contains an apparent internal polyA-like tract. In the presence of any three ribonucleoside triphosphates (0.5 mM), the fourth ribonucleoside triphosphate shows an optimal rate of incorporation into transcript at a concentration of 20 μM. However, in a 3-hour reaction, the yield of a product RNA increases with the concentration of the limiting ribonucleotide up to 0.5 mM. Gel electrophoresis of the reaction products reveals that increasing the substrate concentration accelerates the appearance of radioactivity in full-length l/sub A/ and m transcripts

Battles and hijacks: Noncoding transcription in plants

KAUST Repository

Ariel, Federico

2015-06-01

Noncoding RNAs have emerged as major components of the eukaryotic transcriptome. Genome-wide analyses revealed the existence of thousands of long noncoding RNAs (lncRNAs) in several plant species. Plant lncRNAs are transcribed by the plant-specific RNA polymerases Pol IV and Pol V, leading to transcriptional gene silencing, as well as by Pol II. They are involved in a wide range of regulatory mechanisms impacting on gene expression, including chromatin remodeling, modulation of alternative splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates the current knowledge on the regulatory mechanisms acting through plant noncoding transcription. © 2015 Elsevier Ltd.

Semi-quantitative evaluation of gallium-67 scintigraphy in lupus nephritis

International Nuclear Information System (INIS)

Lin Wanyu; Hsieh Jihfang; Tsai Shihchuan; Lan Joungliang; Cheng Kaiyuan; Wang Shyhjen

2000-01-01

Within nuclear medicine there is a trend towards quantitative analysis. Gallium renal scan has been reported to be useful in monitoring the disease activity of lupus nephritis. However, only visual interpretation using a four-grade scale has been performed in previous studies, and this method is not sensitive enough for follow-up. In this study, we developed a semi-quantitative method for gallium renal scintigraphy to find a potential parameter for the evaluation of lupus nephritis. Forty-eight patients with lupus nephritis underwent renal biopsy to determine World Health Organization classification, activity index (AI) and chronicity index (CI). A delayed 48-h gallium scan was also performed and interpreted by visual and semi-quantitative methods. For semi-quantitative analysis of the gallium uptake in both kidneys, regions of interest (ROIs) were drawn over both kidneys, the right forearm and the adjacent spine. The uptake ratios between these ROIs were calculated and expressed as the ''kidney/spine ratio (K/S ratio)'' or the ''kidney/arm ratio (K/A ratio)''. Spearman's rank correlation test and Mann-Whitney U test were used for statistical analysis. Our data showed a good correlation between the semi-quantitative gallium scan and the results of visual interpretation. K/S ratios showed a better correlation with AI than did K/A ratios. Furthermore, the left K/S ratio displayed a better correlation with AI than did the right K/S ratio. In contrast, CI did not correlate well with the results of semi-quantitative gallium scan. In conclusion, semi-quantitative gallium renal scan is easy to perform and shows a good correlation with the results of visual interpretation and renal biopsy. The left K/S ratio from semi-quantitative renal gallium scintigraphy displays the best correlation with AI and is a useful parameter in evaluating the disease activity in lupus nephritis. (orig.)

Non-canonical transcription initiation: the expanding universe of transcription initiating substrates

Czech Academy of Sciences Publication Activity Database

Barvík, I.; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor

2017-01-01

Roč. 41, č. 2 (2017), s. 131-138 ISSN 0168-6445 R&D Projects: GA ČR GA15-05228S; GA ČR GA15-11711S Institutional support: RVO:61388963 ; RVO:61388971 Keywords : RNA polymerase * non-canonical transcription initiation * transcription initiating substrate * nicotinamide adenine dinucleotide (NAD(+)) * coenzymes * RNA stability Subject RIV: EB - Genetics ; Molecular Biology; EE - Microbiology, Virology (MBU-M) OBOR OECD: Biochemistry and molecular biology; Microbiology (MBU-M) Impact factor: 12.198, year: 2016

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

Science.gov (United States)

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Model of transcriptional activation by MarA in Escherichia coli.

Science.gov (United States)

Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

2009-12-01

The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Model of transcriptional activation by MarA in Escherichia coli.

Directory of Open Access Journals (Sweden)

Michael E Wall

2009-12-01

Full Text Available The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

Novel functions of prototype foamy virus Gag glycine- arginine-rich boxes in reverse transcription and particle morphogenesis.

Science.gov (United States)

Müllers, Erik; Uhlig, Tobias; Stirnnagel, Kristin; Fiebig, Uwe; Zentgraf, Hanswalter; Lindemann, Dirk

2011-02-01

Prototype foamy virus (PFV) Gag lacks the characteristic orthoretroviral Cys-His motifs that are essential for various steps of the orthoretroviral replication cycle, such as RNA packaging, reverse transcription, infectivity, integration, and viral assembly. Instead, it contains three glycine-arginine-rich boxes (GR boxes) in its C terminus that putatively represent a functional equivalent. We used a four-plasmid replication-deficient PFV vector system, with uncoupled RNA genome packaging and structural protein translation, to analyze the effects of deletion and various substitution mutations within each GR box on particle release, particle-associated protein composition, RNA packaging, DNA content, infectivity, particle morphology, and intracellular localization. The degree of viral particle release by all mutants was similar to that of the wild type. Only minimal effects on Pol encapsidation, exogenous reverse transcriptase (RT) activity, and genomic viral RNA packaging were observed. In contrast, particle-associated DNA content and infectivity were drastically reduced for all deletion mutants and were undetectable for all alanine substitution mutants. Furthermore, GR box I mutants had significant changes in particle morphology, and GR box II mutants lacked the typical nuclear localization pattern of PFV Gag. Finally, it could be shown that GR boxes I and III, but not GR box II, can functionally complement each other. It therefore appears that, similar to the orthoretroviral Cys-His motifs, the PFV Gag GR boxes are important for RNA encapsidation, genome reverse transcription, and virion infectivity as well as for particle morphogenesis.

Human RNA polymerase II associated factor 1 complex promotes tumorigenesis by activating c-MYC transcription in non-small cell lung cancer

International Nuclear Information System (INIS)

Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei

2015-01-01

Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. - Highlights: • hPAF1C expression is a prognostic biomarker for early stage non-small cell lung cancer. • The expression of hPAF1C was positively correlated with c-MYC in tumor samples of patients and in several NSCLC cell lines. • hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription.

Microphthalmia-associated transcription factor (MITF – from Waardenburg syndrome genetics to melanoma therapy

Directory of Open Access Journals (Sweden)

Ivan Šamija

2010-11-01

Full Text Available Microphthalmia-associated transcription factor (MITF was first discovered as protein coded by gene whose mutations are associated with Waardenburg syndrome. Later, MITF was shown to be key transcription factor regulating melanogenesis. Further studies have shown that in addition to regulating melanogenesis MITF also plays central role in regulation of melanocyte development and survival. MITF gene is amplified in a proportion of melanomas and ectopic MITF expression can transform melanocytes so MITF can function as melanoma “lineage survival” oncogene. Different studies have further revealed MITF’s important but complex role in tumorigenesis and progression of melanoma. As expected from its important role in melanocytes and melanoma MITF is intricately regulated on all the levels from transcription to post-translational modifications. Although complex mechanisms of MITF functioning are still being revealed, MITF already has a valuable role in managing melanoma patients. Immunohistochemical analysis of MITF has shown both diagnostic and prognostic value in patients with melanoma. MITF is also a valuable specific marker for detection of circulating melanoma cells by reverse-transcription – polymerase chain reaction. MITF has recently been investigated as a potential target for melanoma therapy.

Semiquantitative Culture Analysis during Therapy for Mycobacterium avium Complex Lung Disease.

Science.gov (United States)

Griffith, David E; Adjemian, Jennifer; Brown-Elliott, Barbara A; Philley, Julie V; Prevots, D Rebecca; Gaston, Christopher; Olivier, Kenneth N; Wallace, Richard J

2015-09-15

Microbiologically based criteria such as sputum culture conversion to negative have traditionally been used to define treatment success for mycobacterial diseases. There are, however, limited data regarding whether nontuberculous mycobacterial sputum culture conversion or semiquantitative culture analysis correlates with subjective or nonmicrobiologic objective indices of treatment response. To determine whether a semiquantitative mycobacterial culture scale correlated with clinical disease status and was predictive of long-term sputum mycobacterial culture conversion to negative in a cohort of patients with nodular/bronchiectatic Mycobacterium avium complex lung disease undergoing therapy. One hundred and eighty patients undergoing standard macrolide-based therapy for M. avium complex lung disease were monitored at standard frequent intervals with symptomatic, radiographic, and microbiologic data collected, including semiquantitative mycobacterial culture analysis. Analyses were used to evaluate clinical and microbiologic predictors of long-term sputum conversion to culture negative. After 12 months of therapy, 148 (82%) patients had sputum conversion to culture negative. Baseline semiquantitative sputum culture scores did not differ between patients with sputum conversion and those without. The change in sputum culture semiquantitative score from baseline to Month 3 was highly predictive of subsequent sputum long-term conversion status indicative of treatment success, as was improvement in cough, and especially early radiographic improvement. Early semiquantitative sputum agar plate culture results can be used to predict symptomatic and radiographic improvement as well as long-term sputum culture conversion to negative in this population. We suggest that semiquantitative sputum culture scores can be a useful tool for evaluating new nontuberculous mycobacterial lung disease therapies.

Separation of replication and transcription domains in nucleoli.

Science.gov (United States)

Smirnov, E; Borkovec, J; Kováčik, L; Svidenská, S; Schröfel, A; Skalníková, M; Švindrych, Z; Křížek, P; Ovesný, M; Hagen, G M; Juda, P; Michalová, K; Cardoso, M C; Cmarko, D; Raška, I

2014-12-01

In mammalian cells, active ribosomal genes produce the 18S, 5.8S and 28S RNAs of ribosomal particles. Transcription levels of these genes are very high throughout interphase, and the cell needs a special strategy to avoid collision of the DNA polymerase and RNA polymerase machineries. To investigate this problem, we measured the correlation of various replication and transcription signals in the nucleoli of HeLa, HT-1080 and NIH 3T3 cells using a specially devised software for analysis of confocal images. Additionally, to follow the relationship between nucleolar replication and transcription in living cells, we produced a stable cell line expressing GFP-RPA43 (subunit of RNA polymerase I, pol I) and RFP-PCNA (the sliding clamp protein) based on human fibrosarcoma HT-1080 cells. We found that replication and transcription signals are more efficiently separated in nucleoli than in the nucleoplasm. In the course of S phase, separation of PCNA and pol I signals gradually increased. During the same period, separation of pol I and incorporated Cy5-dUTP signals decreased. Analysis of single molecule localization microscopy (SMLM) images indicated that transcriptionally active FC/DFC units (i.e. fibrillar centers with adjacent dense fibrillar components) did not incorporate DNA nucleotides. Taken together, our data show that replication of the ribosomal genes is spatially separated from their transcription, and FC/DFC units may provide a structural basis for that separation. Copyright © 2014 Elsevier Inc. All rights reserved.

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

DEFF Research Database (Denmark)

Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias

2015-01-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...

Leptin upregulates telomerase activity and transcription of human telomerase reverse transcriptase in MCF-7 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ren, He, E-mail: herenrh@yahoo.com.cn [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Zhao, Tiansuo; Wang, Xiuchao; Gao, Chuntao; Wang, Jian; Yu, Ming [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China); Hao, Jihui, E-mail: jihuihao@yahoo.com [Key Laboratory of Breast Cancer Prevention and Therapy, Tianjin Medical University, Ministry of Education, Tianjin Medical University Cancer Hospital, Tianjin (China)

2010-03-26

The aim was to analyze the mechanism of leptin-induced activity of telomerase in MCF-7 breast cancer cells. We found that leptin activated telomerase in a dose-dependent manner; leptin upregulated the expression of Human Telomerase Reverse Transcriptase (hTERT) at mRNA and protein levels; blockade of signal transducer and activator of transcription 3 (STAT3) phosphorylation significantly counteracted leptin-induced hTERT transcription and protein expression; chromatin immunoprecipitation analysis showed that leptin enhanced the binding of STAT3 to the hTERT promoter. This study uncovers a new mechanism of the proliferative effect of leptin on breast cancer cells and provides a new explanation of obesity-related breast cancer.

Quantitative transcriptional profiling of ATDC5 mouse progenitor cells during chondrogenesis

DEFF Research Database (Denmark)

Chen, Li; Fink, Trine; Zhang, Xiao-Yan

2005-01-01

During the differentiation of a mouse chondroprogenitor cell line, ATDC5, an analysis of the transcription cartilage-related genes was carried out using real-time RT-PCR in a semiquantitative fashion. A total number of 104 genes both previously linked to chondrogenesis and hitherto not associated...

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Two proteins with reverse transcriptase activities associated with hepatitis B virus-like particles

International Nuclear Information System (INIS)

Bavand, M.R.; Laub, O.

1988-01-01

Recent studies suggest that hepatitis B virus (HBV), despite being a DNA virus, replicates via an RNA intermediate. The HBV life cycle is therefore a permuted version of the RNA retroviral life cycle. Sequence homology between retroviral reverse transcriptase and the putative HBV polymerase gene product suggests the presence of an HBV reverse transcriptase. As yet, there has been no direct evidence that reverse transcriptase activity is present in the viral particle. The authors used activity gel analysis to detect the in situ catalytic activities of DNA polymerases after sodium dodecyl sulfate-polyacrylamide gel electrophorsis. These studies demonstrated that HBV-like particles secreted by a differentiated human hepatoma cell line tranfected with genomic HBV DNA contain two major polymerase activities which migrate as ∼90- and ∼70-kilodalton (kDa) proteins. This demonstrated, for the first time, that HBV-like particles contain a novel DNA polymerase-reverse transcriptase activity. Furthermore, they propose that the 70-kDa reverse transcriptase may be produced by proteolytic self-cleavage of the 90-kDa precursor protein

Semi-quantitative evaluation of gallium-67 scintigraphy in lupus nephritis

Energy Technology Data Exchange (ETDEWEB)

Lin Wanyu [Dept. of Nuclear Medicine, Taichung Veterans General Hospital, Taichung (Taiwan); Dept. of Radiological Technology, Chung-Tai College of Medical Technology, Taichung (Taiwan); Hsieh Jihfang [Section of Nuclear Medicine, Chi-Mei Foundation Hospital, Yunk Kang City, Tainan (Taiwan); Tsai Shihchuan [Dept. of Nuclear Medicine, Show Chwan Memorial Hospital, Changhua (Taiwan); Lan Joungliang [Dept. of Internal Medicine, Taichung Veterans General Hospital, Taichung (Taiwan); Cheng Kaiyuan [Dept. of Radiological Technology, Chung-Tai College of Medical Technology, Taichung (Taiwan); Wang Shyhjen [Dept. of Nuclear Medicine, Taichung Veterans General Hospital, Taichung (Taiwan)

2000-11-01

Within nuclear medicine there is a trend towards quantitative analysis. Gallium renal scan has been reported to be useful in monitoring the disease activity of lupus nephritis. However, only visual interpretation using a four-grade scale has been performed in previous studies, and this method is not sensitive enough for follow-up. In this study, we developed a semi-quantitative method for gallium renal scintigraphy to find a potential parameter for the evaluation of lupus nephritis. Forty-eight patients with lupus nephritis underwent renal biopsy to determine World Health Organization classification, activity index (AI) and chronicity index (CI). A delayed 48-h gallium scan was also performed and interpreted by visual and semi-quantitative methods. For semi-quantitative analysis of the gallium uptake in both kidneys, regions of interest (ROIs) were drawn over both kidneys, the right forearm and the adjacent spine. The uptake ratios between these ROIs were calculated and expressed as the ''kidney/spine ratio (K/S ratio)'' or the ''kidney/arm ratio (K/A ratio)''. Spearman's rank correlation test and Mann-Whitney U test were used for statistical analysis. Our data showed a good correlation between the semi-quantitative gallium scan and the results of visual interpretation. K/S ratios showed a better correlation with AI than did K/A ratios. Furthermore, the left K/S ratio displayed a better correlation with AI than did the right K/S ratio. In contrast, CI did not correlate well with the results of semi-quantitative gallium scan. In conclusion, semi-quantitative gallium renal scan is easy to perform and shows a good correlation with the results of visual interpretation and renal biopsy. The left K/S ratio from semi-quantitative renal gallium scintigraphy displays the best correlation with AI and is a useful parameter in evaluating the disease activity in lupus nephritis. (orig.)

The transcript release factor PTRF augments ribosomal gene transcription by facilitating reinitiation of RNA polymerase I

Czech Academy of Sciences Publication Activity Database

Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.

2001-01-01

Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001

Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

International Nuclear Information System (INIS)

Pavelic, J.

1996-07-01

Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

Visual Detection of Potato leafroll virus by One-step Reverse Transcription Loop-Mediated Isothermal Amplification of DNA with Hydroxynaphthol Blue Dye

NARCIS (Netherlands)

Ahmadi, S.; Almasi, A.M.; Fatehi, F.; Struik, P.C.; Moradi, A.

2013-01-01

Loop-mediated isothermal amplification (LAMP) assay is a novel technique for amplifying DNA under constant temperature, with high specificity, sensitivity, rapidity and efficiency. We applied reverse transcription loop-mediated isothermal amplification (RT-LAMP) to visually detect Potato leafroll

A comparative study of microbial diversity and community structure in marine sediments using poly(A tailing and reverse transcription PCR

Directory of Open Access Journals (Sweden)

Tatsuhiko eHoshino

2013-06-01

Full Text Available To obtain a better understanding of metabolically active microbial communities, we tested a molecular ecological approach using poly(A tailing of environmental 16S rRNA, followed by full-length complementary DNA (cDNA synthesis and sequencing to eliminate potential biases caused by mismatching of PCR primer sequences. The RNA pool tested was extracted from marine sediments of the Yonaguni Knoll IV hydrothermal field in the southern Okinawa Trough. The sequences obtained using the ploy(A tailing method were compared statistically and phylogenetically with those obtained using conventional reverse transcription-polymerase chain reaction (RT-PCR with published domain-specific primers. Both methods indicated that Deltaproteobacteria are predominant in sediment (>85% of the total sequence read. The poly(A tailing method indicated that Desulfobacterales were the predominant deltaproteobacteria, while most of the sequences in libraries constructed using RT-PCR were derived from Desulfuromonadales. This discrepancy may have been due to low coverage of Desulfobacterales by the primers used. A comparison of library diversity indices indicated that the poly(A tailing method retrieves more phylogenetically diverse sequences from the environment. The four archaeal 16S rRNA sequences that were obtained using the poly(A tailing method formed deeply branching lineages that were related to Candidatus Parvarchaeum and the Ancient Archaeal Group. These results clearly demonstrate that poly(A tailing followed by cDNA sequencing is a powerful and less biased molecular ecological approach for the study of metabolically active microbial communities.

Basal transcription machinery

Indian Academy of Sciences (India)

2007-03-29

Mar 29, 2007 ... The holoenzyme of prokaryotic RNA polymerase consists of the core enzyme, made of two , , ' and subunits, which lacks promoter selectivity and a sigma () subunit which enables the core enzyme to initiate transcription in a promoter dependent fashion. A stress sigma factor s, in prokaryotes ...

RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

International Nuclear Information System (INIS)

Gilmour, D.S.; Lis, J.T.

1986-01-01

By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

Effect of uv irradiation on lambda DNA transcription

Energy Technology Data Exchange (ETDEWEB)

Ranade, S S [Cancer Research Inst., Bombay (India)

1977-05-01

The effect of uv irradiation of template DNA has been studied in vitro in the E.coli RNA polymerase system with native and uv treated lambda DNA. Lambda DNA was more susceptible to uv than was calf-thymus DNA, yet a residual activity was observed at a uv dose of 0.5 x 10/sup 4/ erg/mm/sup 2/. From the kinetic analysis of the reaction and the incorporation of lambda /sup 32/P-labelled nucleoside triphosphates, it seems reasonable to conclude that uv irradiation probably did not affect the DNA initiation sites, recognizable by RNA polymerase. The transcription products made with uv irradiated lambda DNA were asymmetrical, and hybridized to the right half (R) and the left half (L) of lambda DNA with the ratio of R/L=4/1, and they showed a lower hybridizability than the transcripts with native lambda DNA. The initiation sites recognizable by RNA polymerase seemed to be the same on both native and uv irradiated lambda DNA, though the transcription of uv treated lambda DNA appeared to terminate with rather short RNA chains.

Quantitation of apolipoprotein epsilon gene expression by competitive polymerase chain reaction in a patient with familial apolipoprotein E deficiency.

Science.gov (United States)

Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G

1998-06-22

A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.

In depth analysis of the Sox4 gene locus that consists of sense and natural antisense transcripts

Science.gov (United States)

Ling, King-Hwa; Brautigan, Peter J.; Moore, Sarah; Fraser, Rachel; Leong, Melody Pui-Yee; Leong, Jia-Wen; Zainal Abidin, Shahidee; Lee, Han-Chung; Cheah, Pike-See; Raison, Joy M.; Babic, Milena; Lee, Young Kyung; Daish, Tasman; Mattiske, Deidre M.; Mann, Jeffrey R.; Adelson, David L.; Thomas, Paul Q.; Hahn, Christopher N.; Scott, Hamish S.

2016-01-01

SRY (Sex Determining Region Y)-Box 4 or Sox4 is an important regulator of the pan-neuronal gene expression during post-mitotic cell differentiation within the mammalian brain. Sox4 gene locus has been previously characterized with multiple sense and overlapping natural antisense transcripts [1], [2]. Here we provide accompanying data on various analyses performed and described in Ling et al. [2]. The data include a detail description of various features found at Sox4 gene locus, additional experimental data derived from RNA-Fluorescence in situ Hybridization (RNA-FISH), Western blotting, strand-specific reverse-transcription quantitative polymerase chain reaction (RT-qPCR), gain-of-function and in situ hybridization (ISH) experiments. All the additional data provided here support the existence of an endogenous small interfering- or PIWI interacting-like small RNA known as Sox4_sir3, which origin was found within the overlapping region consisting of a sense and a natural antisense transcript known as Sox4ot1. PMID:26958646

In depth analysis of the Sox4 gene locus that consists of sense and natural antisense transcripts

Directory of Open Access Journals (Sweden)

King-Hwa Ling

2016-06-01

Full Text Available SRY (Sex Determining Region Y-Box 4 or Sox4 is an important regulator of the pan-neuronal gene expression during post-mitotic cell differentiation within the mammalian brain. Sox4 gene locus has been previously characterized with multiple sense and overlapping natural antisense transcripts [1,2]. Here we provide accompanying data on various analyses performed and described in Ling et al. [2]. The data include a detail description of various features found at Sox4 gene locus, additional experimental data derived from RNA-Fluorescence in situ Hybridization (RNA-FISH, Western blotting, strand-specific reverse-transcription quantitative polymerase chain reaction (RT-qPCR, gain-of-function and in situ hybridization (ISH experiments. All the additional data provided here support the existence of an endogenous small interfering- or PIWI interacting-like small RNA known as Sox4_sir3, which origin was found within the overlapping region consisting of a sense and a natural antisense transcript known as Sox4ot1.

Uncovering layers of human RNA polymerase II transcription

DEFF Research Database (Denmark)

Jensen, Torben Heick

In recent years DNA microarray and high-throughput sequencing technologies have challenged the “gene-centric” view that pre-mRNA is the only RNA species transcribed off protein-coding genes. Instead unorthodox transcription from within genic- and intergenic regions has been demonstrated to occur...

Transcription of potato spindle tuber viroid by RNA polymerase II starts in the left terminal loop

International Nuclear Information System (INIS)

Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja; Hu, Kang-Hong; Moors, Michaela; Schmitz, Michael; Steger, Gerhard; Riesner, Detlev

2006-01-01

Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified by affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta

Uncovering growth-suppressive MicroRNAs in lung cancer

DEFF Research Database (Denmark)

Liu, Xi; Sempere, Lorenzo F; Galimberti, Fabrizio

2009-01-01

PURPOSE: MicroRNA (miRNA) expression profiles improve classification, diagnosis, and prognostic information of malignancies, including lung cancer. This study uncovered unique growth-suppressive miRNAs in lung cancer. EXPERIMENTAL DESIGN: miRNA arrays were done on normal lung tissues...... and adenocarcinomas from wild-type and proteasome degradation-resistant cyclin E transgenic mice to reveal repressed miRNAs in lung cancer. Real-time and semiquantitative reverse transcription-PCR as well as in situ hybridization assays validated these findings. Lung cancer cell lines were derived from each......-malignant human lung tissue bank. RESULTS: miR-34c, miR-145, and miR-142-5p were repressed in transgenic lung cancers. Findings were confirmed by real-time and semiquantitative reverse transcription-PCR as well as in situ hybridization assays. Similar miRNA profiles occurred in human normal versus malignant lung...

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Trans-activation of the 5' to 3' viral DNA strand transfer by nucleocapsid protein during reverse transcription of HIV1 RNA.

Science.gov (United States)

Darlix, J L; Vincent, A; Gabus, C; de Rocquigny, H; Roques, B

1993-08-01

Two DNA strand transfer reactions take place during reverse transcription of the retroviral genome. The first transfer, that of the minus-strand strong stop DNA from the 5' end of the viral RNA to the 3' end, has been studied in vitro with two RNAs mimicking the 5' and 3' regions of the HIV1 genome and with nucleocapsid protein, NCp7, and reverse transcriptase. The results show that NCp7 strongly activates the 5' to 3' DNA strand transfer during reverse transcription while a basic peptide resembling NCp7 is inactive. Activation of the first transfer by several NCp7 derived peptides and the influence of the terminal redundancies (R) present at the 5' and 3' ends of HIV1 RNA were also examined. The first transfer is optimal in the presence of intact NCp7 and necessitates R on both the 5' and 3' RNAs. Sequencing of full length viral DNA products reveals approximately 40% misincorporations at the first nucleotide beyond the transfer point. If such base misincorporations occur during proviral DNA synthesis with possible homologous recombinations it may well contribute to the high level of genetic variability of HIV.

Mutual interdependence of splicing and transcription elongation.

Science.gov (United States)

Brzyżek, Grzegorz; Świeżewski, Szymon

2015-01-01

Transcription and splicing are intrinsically linked, as splicing needs a pre-mRNA substrate to commence. The more nuanced view is that the rate of transcription contributes to splicing regulation. On the other hand there is accumulating evidence that splicing has an active role in controlling transcription elongation by DNA-dependent RNA polymerase II (RNAP II). We briefly review those mechanisms and propose a unifying model where splicing controls transcription elongation to provide an optimal timing for successive rounds of splicing.

In vitro fluorescence studies of transcription factor IIB-DNA interaction.

Science.gov (United States)

Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

2015-01-01

General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

Real-time dynamics of RNA Polymerase II clustering in live human cells

Science.gov (United States)

Cisse, Ibrahim

2014-03-01

Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.

Distinct Mechanism Evolved for Mycobacterial RNA Polymerase and Topoisomerase I Protein-Protein Interaction.

Science.gov (United States)

Banda, Srikanth; Cao, Nan; Tse-Dinh, Yuk-Ching

2017-09-15

We report here a distinct mechanism of interaction between topoisomerase I and RNA polymerase in Mycobacterium tuberculosis and Mycobacterium smegmatis that has evolved independently from the previously characterized interaction between bacterial topoisomerase I and RNA polymerase. Bacterial DNA topoisomerase I is responsible for preventing the hyper-negative supercoiling of genomic DNA. The association of topoisomerase I with RNA polymerase during transcription elongation could efficiently relieve transcription-driven negative supercoiling. Our results demonstrate a direct physical interaction between the C-terminal domains of topoisomerase I (TopoI-CTDs) and the β' subunit of RNA polymerase of M. smegmatis in the absence of DNA. The TopoI-CTDs in mycobacteria are evolutionarily unrelated in amino acid sequence and three-dimensional structure to the TopoI-CTD found in the majority of bacterial species outside Actinobacteria, including Escherichia coli. The functional interaction between topoisomerase I and RNA polymerase has evolved independently in mycobacteria and E. coli, with distinctively different structural elements of TopoI-CTD utilized for this protein-protein interaction. Zinc ribbon motifs in E. coli TopoI-CTD are involved in the interaction with RNA polymerase. For M. smegmatis TopoI-CTD, a 27-amino-acid tail that is rich in basic residues at the C-terminal end is responsible for the interaction with RNA polymerase. Overexpression of recombinant TopoI-CTD in M. smegmatis competed with the endogenous topoisomerase I for protein-protein interactions with RNA polymerase. The TopoI-CTD overexpression resulted in decreased survival following treatment with antibiotics and hydrogen peroxide, supporting the importance of the protein-protein interaction between topoisomerase I and RNA polymerase during stress response of mycobacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.

Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

NARCIS (Netherlands)

Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

2004-01-01

Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

Design and optimization of reverse-transcription quantitative PCR experiments.

Science.gov (United States)

Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

2009-10-01

Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

From reverse transcription to human brain tumors

Directory of Open Access Journals (Sweden)

Dmitrenko V. V.

2013-05-01

Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics.

Science.gov (United States)

Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

2017-05-01

Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics

Directory of Open Access Journals (Sweden)

Miriam Ribas Zambenedetti

Full Text Available BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV, hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+ plasmid, generating pET47b(+-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

Wound induced tanscriptional regulation of benzylisoquinoline pathway and characterization of wound inducible PsWRKY transcription factor from Papaver somniferum.

Directory of Open Access Journals (Sweden)

Sonal Mishra

Full Text Available Wounding is required to be made in the walls of the green seed pod of Opium poppy prior exudation of latex. To withstand this kind of trauma plants regulate expression of some metabolites through an induced transcript level. 167 unique wound-inducible ESTs were identified by a repetitive round of cDNA subtraction after 5 hours of wounding in Papaver somniferum seedlings. Further repetitive reverse northern analysis of these ESTs revealed 80 transcripts showing more than two fold induction, validated through semi-quantitative RT-PCR & real time expression analysis. One of the major classified categories among identified ESTs belonged to benzylisoquinoline transcripts. Tissue specific metabolite analysis of benzylisoquinoline alkaloids (BIAs in response to wounding revealed increased accumulation of narcotine and papaverine. Promoter analysis of seven transcripts of BIAs pathway showed the presence of W-box cis-element with the consensus sequence of TGAC, which is the proposed binding site for WRKY type transcription factors. One of the Wound inducible 'WRKY' EST isolated from our subtracted library was made full-length and named as 'PsWRKY'. Bacterially expressed PsWRKY interacted with the W-box element having consensus sequence TTGACT/C present in the promoter region of BIAs biosynthetic pathway genes. PsWRKY further activated the TYDC promoter in yeast and transiently in tobacco BY2 cells. Preferential expression of PsWRKY in straw and capsule and its interaction with consensus W-box element present in BIAs pathway gene transcripts suggest its possible involvement in the wound induced regulation of BIAs pathway.

The reverse transcription inhibitor abacavir shows anticancer activity in prostate cancer cell lines.

Directory of Open Access Journals (Sweden)

Francesca Carlini

Full Text Available BACKGROUND: Transposable Elements (TEs comprise nearly 45% of the entire genome and are part of sophisticated regulatory network systems that control developmental processes in normal and pathological conditions. The retroviral/retrotransposon gene machinery consists mainly of Long Interspersed Nuclear Elements (LINEs-1 and Human Endogenous Retroviruses (HERVs that code for their own endogenous reverse transcriptase (RT. Interestingly, RT is typically expressed at high levels in cancer cells. Recent studies report that RT inhibition by non-nucleoside reverse transcriptase inhibitors (NNRTIs induces growth arrest and cell differentiation in vitro and antagonizes growth of human tumors in animal model. In the present study we analyze the anticancer activity of Abacavir (ABC, a nucleoside reverse transcription inhibitor (NRTI, on PC3 and LNCaP prostate cancer cell lines. PRINCIPAL FINDINGS: ABC significantly reduces cell growth, migration and invasion processes, considerably slows S phase progression, induces senescence and cell death in prostate cancer cells. Consistent with these observations, microarray analysis on PC3 cells shows that ABC induces specific and dose-dependent changes in gene expression, involving multiple cellular pathways. Notably, by quantitative Real-Time PCR we found that LINE-1 ORF1 and ORF2 mRNA levels were significantly up-regulated by ABC treatment. CONCLUSIONS: Our results demonstrate the potential of ABC as anticancer agent able to induce antiproliferative activity and trigger senescence in prostate cancer cells. Noteworthy, we show that ABC elicits up-regulation of LINE-1 expression, suggesting the involvement of these elements in the observed cellular modifications.

Sequence-specific inhibition of duck hepatitis B virus reverse transcription by peptide nucleic acids (PNA)

DEFF Research Database (Denmark)

Robaczewska, Magdalena; Narayan, Ramamurthy; Seigneres, Beatrice

2005-01-01

BACKGROUND/AIMS: Peptide nucleic acids (PNAs) appear as promising new antisense agents, that have not yet been examined as hepatitis B virus (HBV) inhibitors. Our aim was to study the ability of PNAs targeting the duck HBV (DHBV) encapsidation signal epsilon to inhibit reverse transcription (RT...... in primary duck hepatocytes (PDH). RESULTS: Both PNAs reproducibly inhibited DHBV RT in a dose-dependent manner with IC(50) of 10nM, whereas up to 600-fold higher concentration of S-ODNs was required for similar inhibition. The PNA targeting the bulge and upper stem of epsilon appeared as more efficient RT...

Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

Science.gov (United States)

Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

2015-11-05

Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

A semiquantitative PCR assay for assessing Perkinsus marinus infections in the eastern oyster, Crassostrea virginica.

Science.gov (United States)

Marsh, A G; Gauthier, J D; Vasta, G R

1995-08-01

A 3.2-kb fragment of Perkinsus marinus DNA was cloned and sequenced. A noncoding domain was identified and targeted for the development of a semiquantitative polymerase chain reaction (PCR) assay for the presence of P. marinus in eastern oyster tissues. The assay involves extracting total DNA from oyster hemolymph and using 1 microgram of that DNA as template in a stringent PCR amplification with oligonucleotide primers that are specific for the P. marinus 3.2-kb fragment. With this assay, we can detect 10 pg of total P. marinus DNA per 1 microgram of oyster hemocyte DNA with ethidium bromide (EtBr) staining of agarose gels, 100 fg total P. marinus DNA with Southern blot autoradiography, and 10 fg of total P. marinus DNA with dot-blot hybridizations. We have used the sensitivity of the PCR assay to develop a method for estimating the level of P. marinus DNA in oyster hemolymph and have successfully applied this technique to gill tissues. Our semiquantitative assay uses a dilution series to essentially titrate the point at which a P. marinus DNA target is no longer amplified in a sample. We refer to this technique as "dilution endpoint" PCR. Using hemocytes obtained by withdrawing a 1-ml sample of hemolymph, this assay provides a nondestructive methodology for rapidly screening large numbers of adult oysters for the presence and quantification of P. marinus infection levels. This technique is applicable to other tissues (gills) and could potentially be applied to DNA extracts of whole larvae or spat.

RNA Pol II promotes transcription of centromeric satellite DNA in beetles.

Directory of Open Access Journals (Sweden)

Zeljka Pezer

Full Text Available Transcripts of centromeric satellite DNAs are known to play a role in heterochromatin formation as well as in establishment of the kinetochore. However, little is known about basic mechanisms of satellite DNA expression within constitutive heterochromatin and its regulation. Here we present comprehensive analysis of transcription of abundant centromeric satellite DNA, PRAT from beetle Palorus ratzeburgii (Coleoptera. This satellite is characterized by preservation and extreme sequence conservation among evolutionarily distant insect species. PRAT is expressed in all three developmental stages: larvae, pupae and adults at similar level. Transcripts are abundant comprising 0.033% of total RNA and are heterogeneous in size ranging from 0.5 kb up to more than 5 kb. Transcription proceeds from both strands but with 10 fold different expression intensity and transcripts are not processed into siRNAs. Most of the transcripts (80% are not polyadenylated and remain in the nucleus while a small portion is exported to the cytoplasm. Multiple, irregularly distributed transcription initiation sites as well as termination sites have been mapped within the PRAT sequence using primer extension and RLM-RACE. The presence of cap structure as well as poly(A tails in a portion of the transcripts indicate RNA polymerase II-dependent transcription and a putative polymerase II promoter site overlaps the most conserved part of the PRAT sequence. The treatment of larvae with alpha-amanitin decreases the level of PRAT transcripts at concentrations that selectively inhibit pol II activity. In conclusion, stable, RNA polymerase II dependant transcripts of abundant centromeric satellite DNA, not regulated by RNAi, have been identified and characterized. This study offers a basic understanding of expression of highly abundant heterochromatic DNA which in beetle species constitutes up to 50% of the genome.

New discoveries linking transcription to DNA repair and damage tolerance pathways.

Science.gov (United States)

Cohen, Susan E; Walker, Graham C

2011-01-01

In Escherichia coli, the transcription elongation factor NusA is associated with all elongating RNA polymerases where it functions in transcription termination and antitermination. Here, we review our recent results implicating NusA in the recruitment of DNA repair and damage tolerance mechanisms to sites of stalled transcription complexes.

Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

DEFF Research Database (Denmark)

Helbo, Alexandra Søgaard; Lay, Fides D; Jones, Peter A

2017-01-01

Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high...

Studies on Transcriptional Incorporation of 5'-N-Triphosphates of 5'-Amino-5'-Deoxyribonucleosides.

Directory of Open Access Journals (Sweden)

Weronika Kotkowiak

Full Text Available In this study, several RNA polymerases were used for the first time to examine the possibility of transcriptional incorporation of 5'-N-triphosphates of 5'-amino-5'-deoxyribonucleosides (5'NH NTPs. The T3, T7, Sp6 and T7 Y639F RNA polymerases were employed to show that the full-length transcript cannot be synthesized. The results suggest that the application of 5'NH NTPs could decrease transcription reaction rates. What is more, the modification of transcription conditions had no influence on the rate of 5'NH NTPs incorporation. Based on experimental data it is postulated that 5'NH NTPs can be used as potential transcription inhibitors. Our findings expand the knowledge on suitable uses of the 5'-N-triphosphates of 5'-amino-5'-deoxyribonucleoside and the exact mechanism of transcriptional inhibition.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Design and optimization of a novel reverse transcription linear-after-the-exponential PCR for the detection of foot-and-mouth disease virus.

Science.gov (United States)

Pierce, K E; Mistry, R; Reid, S M; Bharya, S; Dukes, J P; Hartshorn, C; King, D P; Wangh, L J

2010-07-01

A novel molecular assay for the detection of foot-and-mouth disease virus (FMDV) was developed using linear-after-the-exponential polymerase chain reaction (LATE-PCR). Pilot experiments using synthetic DNA targets demonstrated the ability of LATE-PCR to quantify initial target concentration through endpoint detection. A two-step protocol involving reverse transcription (RT) followed by LATE-PCR was then used to confirm the ability of the assay to detect FMDV RNA. Finally, RT and LATE-PCR were combined in a one-step duplex assay for co-amplification of an FMDV RNA segment and an internal control comprised of an Armored RNA. In that form, each of the excess primers in the reaction mixture hybridize to their respective RNA targets during a short pre-incubation, then generate cDNA strands during a 3-min RT step at 60°C, and the resulting cDNA is amplified by LATE-PCR without intervening sample processing. The RT-LATE-PCR assay generates fluorescent signals at endpoint that are proportional to the starting number of RNA targets and can detect a range of sequence variants using a single mismatch-tolerant probe. In addition to offering improvements over current laboratory-based molecular diagnostic assays for FMDV, this new assay is compatible with a novel portable ('point-of-care') device, the BioSeeq II, designed for the rapid diagnosis of FMD in the field. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

Global scaling for semi-quantitative analysis in FP-CIT SPECT.

Science.gov (United States)

Kupitz, D; Apostolova, I; Lange, C; Ulrich, G; Amthauer, H; Brenner, W; Buchert, R

2014-01-01

Semi-quantitative characterization of dopamine transporter availability from single photon emission computed tomography (SPECT) with 123I-ioflupane (FP-CIT) is based on uptake ratios relative to a reference region. The aim of this study was to evaluate the whole brain as reference region for semi-quantitative analysis of FP-CIT SPECT. The rationale was that this might reduce statistical noise associated with the estimation of non-displaceable FP-CIT uptake. 150 FP-CIT SPECTs were categorized as neurodegenerative or non-neurodegenerative by an expert. Semi-quantitative analysis of specific binding ratios (SBR) was performed with a custom-made tool based on the Statistical Parametric Mapping software package using predefined regions of interest (ROIs) in the anatomical space of the Montreal Neurological Institute. The following reference regions were compared: predefined ROIs for frontal and occipital lobe and whole brain (without striata, thalamus and brainstem). Tracer uptake in the reference region was characterized by the mean, median or 75th percentile of its voxel intensities. The area (AUC) under the receiver operating characteristic curve was used as performance measure. The highest AUC of 0.973 was achieved by the SBR of the putamen with the 75th percentile in the whole brain as reference. The lowest AUC for the putamen SBR of 0.937 was obtained with the mean in the frontal lobe as reference. We recommend the 75th percentile in the whole brain as reference for semi-quantitative analysis in FP-CIT SPECT. This combination provided the best agreement of the semi-quantitative analysis with visual evaluation of the SPECT images by an expert and, therefore, is appropriate to support less experienced physicians.

Inhibition of post-transcriptional RNA processing by CDK inhibitors and its implication in anti-viral therapy.

Directory of Open Access Journals (Sweden)

Jitka Holcakova

Full Text Available Cyclin-dependent kinases (CDKs are key regulators of the cell cycle and RNA polymerase II mediated transcription. Several pharmacological CDK inhibitors are currently in clinical trials as potential cancer therapeutics and some of them also exhibit antiviral effects. Olomoucine II and roscovitine, purine-based inhibitors of CDKs, were described as effective antiviral agents that inhibit replication of a broad range of wild type human viruses. Olomoucine II and roscovitine show high selectivity for CDK7 and CDK9, with important functions in the regulation of RNA polymerase II transcription. RNA polymerase II is necessary for viral transcription and following replication in cells. We analyzed the effect of inhibition of CDKs by olomoucine II on gene expression from viral promoters and compared its effect to widely-used roscovitine. We found that both roscovitine and olomoucine II blocked the phosphorylation of RNA polymerase II C-terminal domain. However the repression of genes regulated by viral promoters was strongly dependent on gene localization. Both roscovitine and olomoucine II inhibited expression only when the viral promoter was not integrated into chromosomal DNA. In contrast, treatment of cells with genome-integrated viral promoters increased their expression even though there was decreased phosphorylation of the C-terminal domain of RNA polymerase II. To define the mechanism responsible for decreased gene expression after pharmacological CDK inhibitor treatment, the level of mRNA transcription from extrachromosomal DNA was determined. Interestingly, our results showed that inhibition of RNA polymerase II C-terminal domain phosphorylation increased the number of transcribed mRNAs. However, some of these mRNAs were truncated and lacked polyadenylation, which resulted in decreased translation. These results suggest that phosphorylation of RNA polymerase II C-terminal domain is critical for linking transcription and posttrancriptional

Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU

Science.gov (United States)

Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi

2010-01-01

The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798

Transcriptional mutagenesis: causes and involvement in tumor development

Science.gov (United States)

Brégeon, Damien; Doetsch, Paul W.

2013-01-01

The majority of normal cells in a human do not multiply continuously but are quiescent and devote most of their energy to gene transcription. When DNA damages in the transcribed strand of an active gene are bypassed by an RNA polymerase, they can miscode at the damaged site and produce mutant transcripts. This process known as transcriptional mutagenesis can lead to the production of mutant proteins that could be important in tumor development. PMID:21346784

New insights into transcription fidelity: thermal stability of non-canonical structures in template DNA regulates transcriptional arrest, pause, and slippage.

Science.gov (United States)

Tateishi-Karimata, Hisae; Isono, Noburu; Sugimoto, Naoki

2014-01-01

The thermal stability and topology of non-canonical structures of G-quadruplexes and hairpins in template DNA were investigated, and the effect of non-canonical structures on transcription fidelity was evaluated quantitatively. We designed ten template DNAs: A linear sequence that does not have significant higher-order structure, three sequences that form hairpin structures, and six sequences that form G-quadruplex structures with different stabilities. Templates with non-canonical structures induced the production of an arrested, a slipped, and a full-length transcript, whereas the linear sequence produced only a full-length transcript. The efficiency of production for run-off transcripts (full-length and slipped transcripts) from templates that formed the non-canonical structures was lower than that from the linear. G-quadruplex structures were more effective inhibitors of full-length product formation than were hairpin structure even when the stability of the G-quadruplex in an aqueous solution was the same as that of the hairpin. We considered that intra-polymerase conditions may differentially affect the stability of non-canonical structures. The values of transcription efficiencies of run-off or arrest transcripts were correlated with stabilities of non-canonical structures in the intra-polymerase condition mimicked by 20 wt% polyethylene glycol (PEG). Transcriptional arrest was induced when the stability of the G-quadruplex structure (-ΔG°37) in the presence of 20 wt% PEG was more than 8.2 kcal mol(-1). Thus, values of stability in the presence of 20 wt% PEG are an important indicator of transcription perturbation. Our results further our understanding of the impact of template structure on the transcription process and may guide logical design of transcription-regulating drugs.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry Transcrição reversa e reação em cadeia da polimerase: princípios e aplicações em odontologia

Directory of Open Access Journals (Sweden)

Carlos Ferreira dos Santos

2004-03-01

Full Text Available Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR, which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT reaction in order to produce cDNA from RNA (RT-PCR. RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer. Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.Várias técnicas de biologia molecular têm sido disponibilizadas nos últimos anos. Uma que revolucionou a análise de ácidos nucléicos foi a reação em cadeia da polimerase (PCR, descrita pela primeira vez em 1985. Esta técnica baseia-se na possibilidade de amplificação exponencial de fragmentos específicos de DNA, com a criação de milhões de cópias que servirão como matéria-prima para diferentes tipos de análises. A PCR pode ser precedida por uma reação de transcrição reversa (RT para a obtenção de cDNA a partir de RNA (RT-PCR, representando, por exemplo, uma possibilidade de análise de expressão gênica em células ou tecidos. As técnicas de PCR e RT-PCR têm sido utilizadas em pesquisas odontológicas como

Affinity isolation and I-DIRT mass spectrometric analysis of the Escherichia coli O157:H7 Sakai RNA polymerase complex.

Science.gov (United States)

Lee, David J; Busby, Stephen J W; Westblade, Lars F; Chait, Brian T

2008-02-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the "core" E. coli genome.

Architecture of the RNA polymerase II-Mediator core initiation complex.

Science.gov (United States)

Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P

2015-02-19

The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.

Hepatocellular hypoxia-induced vascular endothelial growth factor expression and angiogenesis in experimental biliary cirrhosis.

Science.gov (United States)

Rosmorduc, O; Wendum, D; Corpechot, C; Galy, B; Sebbagh, N; Raleigh, J; Housset, C; Poupon, R

1999-10-01

We tested the potential role of vascular endothelial growth factor (VEGF) and of fibroblast growth factor-2 (FGF-2) in the angiogenesis associated with experimental liver fibrogenesis induced by common bile duct ligation in Sprague-Dawley rats. In normal rats, VEGF and FGF-2 immunoreactivities were restricted to less than 3% of hepatocytes. One week after bile duct ligation, hypoxia was demonstrated by the immunodetection of pimonidazole adducts unevenly distributed throughout the lobule. After 2 weeks, hypoxia and VEGF expression were detected in >95% of hepatocytes and coexisted with an increase in periportal vascular endothelial cell proliferation, as ascertained by Ki67 immunolabeling. Subsequently, at 3 weeks the density of von Willebrand-labeled vascular section in fibrotic areas significantly increased. Semiquantitative reverse transcription polymerase chain reaction showed that VEGF(120) and VEGF(164) transcripts, that correspond to secreted isoforms, increased within 2 weeks, while VEGF(188) transcripts remained unchanged. FGF-2 mainly consisting of a 22-kd isoform, according to Western blot, was identified by immunohistochemistry in 49% and 100% of hepatocytes at 3 and 7 weeks, respectively. Our data provide evidence that in biliary-type liver fibrogenesis, angiogenesis is stimulated primarily by VEGF in response to hepatocellular hypoxia while FGF-2 likely contributes to the maintenance of angiogenesis at later stages.

Non-canonical transcription initiation: the expanding universe of transcription initiating substrates.

Science.gov (United States)

Barvík, Ivan; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor

2017-03-01

RNA polymerase (RNAP) is the central enzyme of transcription of the genetic information from DNA into RNA. RNAP recognizes four main substrates: ATP, CTP, GTP and UTP. Experimental evidence from the past several years suggests that, besides these four NTPs, other molecules can be used to initiate transcription: (i) ribooligonucleotides (nanoRNAs) and (ii) coenzymes such as NAD+, NADH, dephospho-CoA and FAD. The presence of these molecules at the 5΄ ends of RNAs affects the properties of the RNA. Here, we discuss the expanding portfolio of molecules that can initiate transcription, their mechanism of incorporation, effects on RNA and cellular processes, and we present an outlook toward other possible initiation substrates. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Improved Detection of Lassa Virus by Reverse Transcription-PCR Targeting the 5′ Region of S RNA▿

OpenAIRE

Ölschläger, Stephan; Lelke, Michaela; Emmerich, Petra; Panning, Marcus; Drosten, Christian; Hass, Meike; Asogun, Danny; Ehichioya, Deborah; Omilabu, Sunday; Günther, Stephan

2010-01-01

The method of choice for the detection of Lassa virus is reverse transcription (RT)-PCR. However, the high degree of genetic variability of the virus poses a problem with the design of RT-PCR assays that will reliably detect all strains. Recently, we encountered difficulties in detecting some strains from Liberia and Nigeria in a commonly used glycoprotein precursor (GPC) gene-specific RT-PCR assay (A. H. Demby, J. Chamberlain, D. W. Brown, and C. S. Clegg, J. Clin. Microbiol. 32:2898-2903, 1...

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

Science.gov (United States)

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

In situ hybridization detection methods for HPV16 E6/E7 mRNA in identifying transcriptionally active HPV infection of oropharyngeal carcinoma: an updating.

Science.gov (United States)

Volpi, Chiara C; Ciniselli, Chiara M; Gualeni, Ambra V; Plebani, Maddalena; Alfieri, Salvatore; Verderio, Paolo; Locati, Laura; Perrone, Federica; Quattrone, Pasquale; Carbone, Antonino; Pilotti, Silvana; Gloghini, Annunziata

2018-04-01

The aim of this study is to compare 2 in situ hybridization (ISH) detection methods for human papilloma virus (HPV) 16 E6/E7 mRNA, that is, the RNAscope 2.0 High Definition (HD) and the upgraded RNAscope 2.5 HD version. The RNAscope 2.5 HD has recently replaced the RNAscope 2.0 HD detection kit. Therefore, this investigation starts from the need to analytically validate the new mRNA ISH assay and, possibly, to refine the current algorithm for HPV detection in oropharyngeal squamous cell carcinoma with the final goal of applying it to daily laboratory practice. The study was based on HPV status and on generated data, interpreted by a scoring algorithm. The results highlighted that the compared RNAscope HPV tests had a good level of interchangeability and enabled to identify oropharyngeal squamous cell carcinoma that are truly driven by high-risk HPV infection. This was also supported by the comparison of the RNAscope HPV test with HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction in a fraction of cases where material for HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction was available. Furthermore, the algorithm that associates p16 immunohistochemistry with the identification of HPV mRNA by RNAscope was more effective than the one that associated p16 immunohistochemistry with the identification of HPV DNA by ISH. Copyright © 2017 Elsevier Inc. All rights reserved.

Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

Science.gov (United States)

Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

2009-06-01

Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

Genome-wide analysis of KAP1, the 7SK snRNP complex, and RNA polymerase II

Directory of Open Access Journals (Sweden)

Ryan P. McNamara

2016-03-01

Full Text Available The transition of RNA polymerase II (Pol II from transcription initiation into productive elongation in eukaryotic cells is regulated by the P-TEFb kinase, which phosphorylates the C-terminal domain of paused Pol II at promoter-proximal regions. Our recent study found that P-TEFb (in an inhibited state bound to the 7SK snRNP complex interacts with the KAP1/TRIM28 transcriptional regulator, and that KAP1 and the 7SK snRNP co-occupy most gene promoters containing paused Pol II. Here we provide a detailed experimental description and analysis of the ChIP-seq datasets that have been deposited into Gene Expression Omnibus (GEO: GS72622, so that independent groups can replicate and expand upon these findings. We propose these datasets would provide valuable information for researchers studying mechanisms of transcriptional regulation including Pol II pausing and pause release. Keywords: P-TEFb/7SK snRNP, KAP1, RNA polymerase II, ChIP-seq, Transcription elongation

The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

NARCIS (Netherlands)

van den Berg, A.A.

2017-01-01

During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells

Energy Technology Data Exchange (ETDEWEB)

Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H

1988-10-25

DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.

Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.

Science.gov (United States)

Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D

2016-09-08

A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

Role of the polymerase 3 in mutagenesis in the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Zaborowska, D.; Baranowska, H.; Zuk, J.

1994-01-01

UV induction of cdc + revertants in thermosensitive cdc2 mutants (polymerase III) in the restrictive conditions (37 C) and after preincubation 4 h in permissive condition (23 C) has showed, that preincubation in permissive temperature, when polymerase III (CDC2 gene) is active, the frequency and mutation yield is lower. In HB75 (cdc2-1/cdc2-1) strain at the restrictive conditions the increase in the frequency of reversion in the meth his and trp mutants was observed after UV treatment. These data suggest, that cdc2 mutants lacked proofreading 3'-5' exonuclease activity besides the polymerase activity. (author). 11 refs, 3 tabs

Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

International Nuclear Information System (INIS)

Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

2010-01-01

Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

Battles and hijacks: Noncoding transcription in plants

KAUST Repository

Ariel, Federico; Romero-Barrios, Natali; Jé gu, Teddy; Benhamed, Moussa; Crespi, Martin

2015-01-01

splicing, fine-tuning of miRNA activity, and the control of mRNA translation or accumulation. Recently, dual noncoding transcription by alternative RNA polymerases was implicated in epigenetic and chromatin conformation dynamics. This review integrates

Affinity Isolation and I-DIRT Mass Spectrometric Analysis of the Escherichia coli O157:H7 Sakai RNA Polymerase Complex▿

Science.gov (United States)

Lee, David J.; Busby, Stephen J. W.; Westblade, Lars F.; Chait, Brian T.

2008-01-01

Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the “core” E. coli genome. PMID:18083804

The Mediator complex: a master coordinator of transcription and cell lineage development.

Science.gov (United States)

Yin, Jing-wen; Wang, Gang

2014-03-01

Mediator is a multiprotein complex that is required for gene transcription by RNA polymerase II. Multiple subunits of the complex show specificity in relaying information from signals and transcription factors to the RNA polymerase II machinery, thus enabling control of the expression of specific genes. Recent studies have also provided novel mechanistic insights into the roles of Mediator in epigenetic regulation, transcriptional elongation, termination, mRNA processing, noncoding RNA activation and super enhancer formation. Based on these specific roles in gene regulation, Mediator has emerged as a master coordinator of development and cell lineage determination. Here, we describe the most recent advances in understanding the mechanisms of Mediator function, with an emphasis on its role during development and disease.

The effect of Saccharomyces boulardii on human colon cells and inflammation in rats with trinitrobenzene sulfonic acid-induced colitis.

Science.gov (United States)

Lee, Sang Kil; Kim, Youn Wha; Chi, Sung-Gil; Joo, Yeong-Shil; Kim, Hyo Jong

2009-02-01

Saccharomyces boulardii (S. boulardii) has beneficial effects in the treatment of intestinal inflammation; however, little is known about the mechanisms by which these effects occur. We investigated the effects of S. boulardii on the expression of peroxisome proliferator-activated receptor-gamma (PPAR-gamma) and interleukin-8 (IL-8), using human HT-29 colonocytes and a rat model of trinitrobenzene sulfonic acid (TNBS)-induced colitis. The effect of S. boulardii on gene expression was assessed by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), and Northern blot and Western blot assays. Pharmacological inhibitors for various signaling pathways were used to determine the signaling pathways implicated in the S. boulardii regulation of PPAR-gamma and IL-8. We found that S. boulardii up-regulated and down-regulated PPAR-gamma and IL-8 expression at the transcription level, both in vitro and in vivo (P Saccharomyces boulardii blocked tumor necrosis factor-alpha (TNF-alpha) regulation of PPAR-gamma and IL-8 through disruption of TNF-alpha-mediated nuclear factor kappa B (NF-kappaB) activation. Furthermore, S. boulardii suppressed colitis and expression of pro-inflammatory cytokine genes in vivo (P boulardii reduces colonic inflammation and regulates inflammatory gene expression.

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene.

Science.gov (United States)

Park, Jeong-Woong; Song, Ki-Duk; Kim, Nam Young; Choi, Jae-Young; Hong, Seul A; Oh, Jin Hyeog; Kim, Si Won; Lee, Jeong Hyo; Park, Tae Sub; Kim, Jin-Kyoo; Kim, Jong Geun; Cho, Byung-Wook

2017-10-01

Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase ( AXL ) gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form) in equine skeletal muscle to gain insight(s) into the role of each alternative transcript during exercise. We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR), and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR). Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D) prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3) and immunoglobin (Ig) domain was different between two alternative isoforms. It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s) and significance of the alternative splicing isoforms in race horse skeletal muscle.

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene

Directory of Open Access Journals (Sweden)

Jeong-Woong Park

2017-10-01

Full Text Available Objective Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase (AXL gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form in equine skeletal muscle to gain insight(s into the role of each alternative transcript during exercise. Methods We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR, and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR. Results Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3 and immunoglobin (Ig domain was different between two alternative isoforms. Conclusion It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s and significance of the alternative splicing isoforms in race horse skeletal muscle.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

International Nuclear Information System (INIS)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

1990-01-01

We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

Energy Technology Data Exchange (ETDEWEB)

Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.

Science.gov (United States)

Zhang, Jinwei; Landick, Robert

2016-04-01

The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

The replisome uses mRNA as a primer after colliding with RNA polymerase.

Science.gov (United States)

Pomerantz, Richard T; O'Donnell, Mike

2008-12-11

Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

Mammalian RNA polymerase II core promoters: insights from genome-wide studies

DEFF Research Database (Denmark)

Sandelin, Albin; Carninci, Piero; Lenhard, Boris

2007-01-01

The identification and characterization of mammalian core promoters and transcription start sites is a prerequisite to understanding how RNA polymerase II transcription is controlled. New experimental technologies have enabled genome-wide discovery and characterization of core promoters, revealing...... in the mammalian transcriptome and proteome. Promoters can be described by their start site usage distribution, which is coupled to the occurrence of cis-regulatory elements, gene function and evolutionary constraints. A comprehensive survey of mammalian promoters is a major step towards describing...

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

Science.gov (United States)

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

The effect of U.V.-irradiation on lambda DNA transcription

International Nuclear Information System (INIS)

Ranade, S.S.

1977-01-01

The effect of U.V.-irradiation of template DNA has been studied in vitro in the E.coli RNA polymerase system with native and U.V.-treated lambda DNA. Lambda DNA was more susceptible to U.V. than was calf-thymus DNA, yet a residual activity was observed at a U.V. dose of 0.5 x 10 4 erg/mm 2 . From the kinetic analysis of the reaction and the incorporation of lambda 32 P-labelled nucleoside triphosphates, it seems reasonable to conclude that U.V.-irradiation probably did not affect the DNA initiation sites, recognizable by RNA polymerase. The transcription products made with U.V.-irradiated lambda DNA were asymmetrical, and hybridized to the right half (R) and the left half (L) of lambda DNA with the ratio of R/L=4/1, and they showed a lower hybridizability than the transcripts with native lambda DNA. The initiation sites recognizable by RNA polymerase seemed to be the same on both native and U.V.-irradiated lambda DNA, though the transcription of U.V.-treated lambda DNA appeared to terminate with rather short RNA chains. (author)

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

Science.gov (United States)

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

A new semiquantitative method for evaluation of metastasis progression.

Science.gov (United States)

Volarevic, A; Ljujic, B; Volarevic, V; Milovanovic, M; Kanjevac, T; Lukic, A; Arsenijevic, N

2012-01-01

Although recent technical advancements are directed toward developing novel assays and methods for detection of micro and macro metastasis, there are still no reports of reliable, simple to use imaging software that could be used for the detection and quantification of metastasis in tissue sections. We herein report a new semiquantitative method for evaluation of metastasis progression in a well established 4T1 orthotopic mouse model of breast cancer metastasis. The new semiquantitative method presented here was implemented by using the Autodesk AutoCAD 2012 program, a computer-aided design program used primarily for preparing technical drawings in 2 dimensions. By using the Autodesk AutoCAD 2012 software- aided graphical evaluation we managed to detect each metastatic lesion and we precisely calculated the average percentage of lung and liver tissue parenchyma with metastasis in 4T1 tumor-bearing mice. The data were highly specific and relevant to descriptive histological analysis, confirming reliability and accuracy of the AutoCAD 2012 software as new method for quantification of metastatic lesions. The new semiquantitative method using AutoCAD 2012 software provides a novel approach for the estimation of metastatic progression in histological tissue sections.

High-Resolution Phenotypic Landscape of the RNA Polymerase II Trigger Loop.

Directory of Open Access Journals (Sweden)

Chenxi Qiu

2016-11-01

Full Text Available The active sites of multisubunit RNA polymerases have a "trigger loop" (TL that multitasks in substrate selection, catalysis, and translocation. To dissect the Saccharomyces cerevisiae RNA polymerase II TL at individual-residue resolution, we quantitatively phenotyped nearly all TL single variants en masse. Three mutant classes, revealed by phenotypes linked to transcription defects or various stresses, have distinct distributions among TL residues. We find that mutations disrupting an intra-TL hydrophobic pocket, proposed to provide a mechanism for substrate-triggered TL folding through destabilization of a catalytically inactive TL state, confer phenotypes consistent with pocket disruption and increased catalysis. Furthermore, allele-specific genetic interactions among TL and TL-proximal domain residues support the contribution of the funnel and bridge helices (BH to TL dynamics. Our structural genetics approach incorporates structural and phenotypic data for high-resolution dissection of transcription mechanisms and their evolution, and is readily applicable to other essential yeast proteins.

Laboratory evaluation of a quantitative real-time reverse transcription PCR assay for the detection and identification of the four subgroups of avian metapneumovirus.

Science.gov (United States)

Guionie, O; Toquin, D; Sellal, E; Bouley, S; Zwingelstein, F; Allée, C; Bougeard, S; Lemière, S; Eterradossi, N

2007-02-01

Avian metapneumovirus (AMPV) is an important pathogen causing respiratory diseases and egg drops in several avian species. Four AMPV subgroups have been identified. The laboratory diagnosis of AMPV infections relies on serological methods, on labour-intensive virus isolation procedures, and on recently developed subgroup specific reverse transcription PCR (RT-PCR) protocols. In the present study, both the specificity and sensitivity of a commercial real-time reverse transcription PCR (RRT-PCR) for the detection and identification of the four AMPV subgroups were evaluated. Fifteen non-AMPV avian viruses belonging to 7 genera and 32 AMPV belonging to the 4 subgroups were tested. No non-AMPV virus was detected, whereas all AMPV viruses were identified in agreement with their previous molecular and antigenic subgroup assignment. The sensitivity and quantitating ability of the RRT-PCR assay were determined using serial dilutions of RNA derived either from AMPV virus stocks or from runoff transcripts. In all cases, linear dose/responses were observed. The detection limits of the different subgroups ranged from 500 to 5000 RNA copies and from 0.03 to 3.16TCID50/ml. The results were reproducible under laboratory conditions, thus showing that quantitative RRT-PCR is a new and powerful tool for the rapid and sensitive detection, identification and quantitation of AMPVs.

Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

Science.gov (United States)

Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

2008-05-20

Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

Directory of Open Access Journals (Sweden)

Ahmed Abd El Wahed

Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.

Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

Energy Technology Data Exchange (ETDEWEB)

Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

2006-01-01

The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

Versatility of cooperative transcriptional activation: a thermodynamical modeling analysis for greater-than-additive and less-than-additive effects.

Directory of Open Access Journals (Sweden)

Till D Frank

Full Text Available We derive a statistical model of transcriptional activation using equilibrium thermodynamics of chemical reactions. We examine to what extent this statistical model predicts synergy effects of cooperative activation of gene expression. We determine parameter domains in which greater-than-additive and less-than-additive effects are predicted for cooperative regulation by two activators. We show that the statistical approach can be used to identify different causes of synergistic greater-than-additive effects: nonlinearities of the thermostatistical transcriptional machinery and three-body interactions between RNA polymerase and two activators. In particular, our model-based analysis suggests that at low transcription factor concentrations cooperative activation cannot yield synergistic greater-than-additive effects, i.e., DNA transcription can only exhibit less-than-additive effects. Accordingly, transcriptional activity turns from synergistic greater-than-additive responses at relatively high transcription factor concentrations into less-than-additive responses at relatively low concentrations. In addition, two types of re-entrant phenomena are predicted. First, our analysis predicts that under particular circumstances transcriptional activity will feature a sequence of less-than-additive, greater-than-additive, and eventually less-than-additive effects when for fixed activator concentrations the regulatory impact of activators on the binding of RNA polymerase to the promoter increases from weak, to moderate, to strong. Second, for appropriate promoter conditions when activator concentrations are increased then the aforementioned re-entrant sequence of less-than-additive, greater-than-additive, and less-than-additive effects is predicted as well. Finally, our model-based analysis suggests that even for weak activators that individually induce only negligible increases in promoter activity, promoter activity can exhibit greater

Diagnostic efficacy of molecular assays for the viral haemorrhagic septicaemia virus isolates from the Czech Republic

Directory of Open Access Journals (Sweden)

Ľubomír Pojezdal

2017-01-01

Full Text Available The diagnostic properties of the one-step real-time reverse-transcription polymerase chain reaction assay for viral haemorrhagic septicaemia virus detection were compared to methods currently in use in the Czech Republic, namely, virus isolation using the cell culture and conventional reverse-transcription polymerase chain reaction followed by the nested polymerase chain reaction. The assays were tested on a panel of 25 archived viral haemorrhagic septicaemia isolates and 8 archived infectious haematopoietic necrosis isolates obtained from monitoring and/or outbreaks of the diseases among farmed salmonids in the Czech Republic. The ability to detect the presence of the virus in the tissues of fish was tested on additional 32 field samples collected from the rainbow trout (Oncorhynchus mykiss, brown trout (Salmo trutta and brook trout (Salvelinus fontinalis. The real-time assay showed the highest analytic sensitivity by detecting the presence of viral nucleic acid in samples with 10-7 dilution, whereas the sensitivity of the conventional polymerase chain reaction peaked at 10-5. Diagnostic specificity of both molecular assays was confirmed by absence of cross-reactivity with the infectious haematopoietic necrosis virus isolates. This, along with consistent results in the detection of the virus in the fish tissues, confirms that the one-step real-time reverse-transcription polymerase chain reaction is currently an optimal stand-alone diagnostic method for the detection of the viral haemorrhagic septicaemia virus.

Poly(adenosine 5'-diphosphate) ribose polymerase activation as a cause of metabolic dysfunction in critical illness.

Science.gov (United States)

Liaudet, Lucas

2002-03-01

Poly(adenosine 5'-diphosphate) ribose polymerase is a nuclear enzyme activated in response to genotoxic stress induced by a variety of DNA damaging agents. Several oxygen and nitrogen-centered free radicals, notably peroxynitrite, are strong inducers of DNA damage and poly(adenosine 5'-diphosphate) ribose polymerase activation in vitro and in vivo. Activation of this nuclear enzyme depletes the intracellular stores of its substrate nicotinamide adenine dinucleotide, slowing the rate of glycolysis, mitochondrial electron transport and adenosine triphosphate formation. This process triggers a severe energetic crisis within the cell, leading to acute cell dysfunction and cell necrosis. Poly(adenosine 5'-diphosphate) ribose polymerase also plays an important role in the regulation of inflammatory cascades, through a functional association with various transcription factors and transcription co-activators. Recent works identified this enzyme as a critical mediator of cellular metabolic dysfunction, inflammatory injury, and organ damage in conditions associated with overwhelming oxidative stress, including systemic inflammation, circulatory shock, and ischemia-reperfusion. Accordingly, pharmacological inhibitors of poly(adenosine 5'-diphosphate) ribose polymerase protect against cell death and tissue injury in such conditions, and may therefore represent novel therapeutic tools to limit multiple organ damage and dysfunction in critically ill patients.

Rapid detection of genetically diverse tomato black ring virus isolates using reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Hasiów-Jaroszewska, Beata; Budzyńska, Daria; Borodynko, Natasza; Pospieszny, Henryk

2015-12-01

A reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) has been developed for detection of tomato black ring virus (TBRV) isolates collected from different hosts. One-step RT-LAMP was performed with a set of four primers, the design of which was based on the coat protein gene. Results of RT-LAMP were visualized by direct staining of products with fluorescent dyes, agarose gel electrophoresis, and analysis of amplification curves. The sensitivity of RT-LAMP was 100-fold greater than that of RT-PCR. The RT-LAMP assay developed here is a useful and practical method for diagnosis of TBRV.

Karakteristik Reverse Transcriptase Gen Polymerase Virus Hepatitis B Pada Penderita Hepatitis B Kronis Asimptomatik Pra-Pengobatan

Directory of Open Access Journals (Sweden)

Turyadi Turyadi

2018-01-01

Full Text Available Abstrak Antiviral nucleos(tide analogue (NUCs merupakan pengobatan utama pada hepatitis B kronis (HBK. Pemberian jangka panjang dinilai cukup efektif menekan progresivitas penyakit, namun dapat menimbulkan mutasi resisten. Studi ini melihat karakteristik gen polimerase yang berkaitan dengan resistensi NUCs pada penderita HBK asimptomatik pra-pengobatan. Penelitian dilakukan di Laboratorium Hepatitis, Lembaga Biologi Molekuler Eijkman, Jakarta. Sebanyak 38 sampel individu dengan hepatitis B surface antigen (HBsAg positif dikarakterisasi dengan PCR-sekuensing. Genotipe dan subtipe ditentukan berdasarkan sekuens HBsAg. Sebanyak 37 (97,4% sampel menunjukkan mutasi rtQ238H/N dan satu sampel wildtype. Sebanyak 23 (62,2% memiliki mutasi rtQ238H, 10 (27,0% rtQ238N, dan empat (10,8% dengan mutasi ganda rtA194T dan rtQ238H. Genotipe B ditemukan pada 26 (68,4% sampel, genotipe C pada 11 (28,9%, dan genotipe D pada satu (2,6% sampel. Secara statistik, mutasi rtQ238H berasosiasi dengan genotipe B (p<0,001 dan mutasi rtQ238N dengan genotipe C (p<0,001. Subtipe ayw ditemukan pada 25 (65,8% sampel, adr pada 11 (28,9%, dan adw pada dua (5,3% sampel. Sebagian besar sampel tidak menunjukkan mutasi yang berkaitan dengan resistensi NUCs, sehingga pemberian NUCs masih. Mutasi rtQ238H merupakan varian yang berkaitan dengan genotipe B dan rtQ238N dengan genotipe C. Kata kunci: virus hepatitis B; mutasi; pengobatan; polymerase.   Reverse-Transcriptase Characteristics of Hepatitis B Virus Polymerase Gene in Treatment-Naïve Asymptomatic Chronic Hepatitis B Individuals Abstract Nucleos(tide analogues (NUCs remain the main treatment for chronic hepatitis B (CHB. Long-term use of NUCs significantly reduces disease progression; however, it might lead to resistance-associated mutations. We studied characteristics of polymerase gene related to NUCs resistance in naïve hepatitis B surface antigen (HBsAg-positive individuals. The research was done at Laboratory of Hepatitis

[Participation of the piRNA pathway in recruiting a component of RNA polymerase I transcription initiation complex to germline cell nucleoli].

Science.gov (United States)

Fefelova, E A; Stolyarenko, A D; Yakushev, E Y; Gvozdev, V A; Klenov, M S

2017-01-01

Proteins of the Piwi family and short Piwi-interacting RNAs (piRNAs) ensure the protection of the genome from transposable elements. We have previously shown that nuclear Piwi protein tends to concentrate in the nucleoli of the cells of Drosophila melanogaster ovaries. It could be hypothesized that the function of Piwi in the nucleolus is associated with the repression of R1 and R2 retrotransposons inserted into the rDNA cluster. Here, we show that Piwi participates in recruiting Udd protein to nucleoli. Udd is a component of the conserved Selectivity Factor I-like (SL1-like) complex, which is required for transcription initiation by RNA polymerase I. We found that Udd localization depends on Piwi in germline cells, but not in somatic cells of the ovaries. In contrast, knockdowns of the SL1-like components (Udd or TAF1b) do not disrupt Piwi localization. We also observed that the absence of Udd or TAF1b in germline cells, as well as the impairment of Piwi nuclear localization lead to the accumulation of late stage egg chambers in the ovaries, which could be explained by reduced rRNA transcription. These results allow us to propose for the first time a role for Piwi in the nucleolus that is not directly associated with transposable element repression.

CHD chromatin remodelers and the transcription cycle

Science.gov (United States)

Murawska, Magdalena

2011-01-01

It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by “opening” or “closing” chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but also are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts. PMID:22223048

X-ray Crystal Structures Elucidate the Nucleotidyl Transfer Reaction of Transcript Initiation Using Two Nucleotides

Energy Technology Data Exchange (ETDEWEB)

M Gleghorn; E Davydova; R Basu; L Rothman-Denes; K Murakami

2011-12-31

We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groups of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.

Detection of foot-and-mouth disease virus rna by reverse transcription loop-mediated isothermal amplification

Directory of Open Access Journals (Sweden)

Chen Hao-tai

2011-11-01

Full Text Available Abstract A reverse transcription loop-mediated isothermal amplification (RT-LAMP assay was developed for foot-and-mouth disease virus (FMDV RNA. The amplification was able to finish in 45 min under isothermal condition at 64°C by employing a set of four primers targeting FMDV 2B. The assay showed higher sensitivity than RT-PCR. No cross reactivity was observed from other RNA viruses including classical swine fever virus, swine vesicular disease, porcine reproductive and respiratory syndrome virus, Japanese encephalitis virus. Furthermore, the assay correctly detected 84 FMDV positive samples but not 65 FMDV negative specimens. The result indicated the potential usefulness of the technique as a simple and rapid procedure for the detection of FMDV infection.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

Directory of Open Access Journals (Sweden)

Matsutani Sachiko

2004-08-01

Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

Science.gov (United States)

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

Science.gov (United States)

Williams, D Ross; Chanos, Panagiotis

2012-12-01

Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali

2015-11-27

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

KAUST Repository

Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Ludicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki

2015-01-01

Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

Recovery of infectious type Asia1 foot-and-mouth disease virus from suckling mice directly inoculated with an RNA polymerase I/II-driven unidirectional transcription plasmid.

Science.gov (United States)

Lian, Kaiqi; Yang, Fan; Zhu, Zixiang; Cao, Weijun; Jin, Ye; Li, Dan; Zhang, Keshan; Guo, Jianhong; Zheng, Haixue; Liu, Xiangtao

2015-10-02

We developed an RNA polymerase (pol) I- and II-driven plasmid-based reverse genetics system to rescue infectious foot-and-mouth disease virus (FMDV) from cloned cDNA. In this plasmid-based transfection, the full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta ribozyme (HdvRz) sequences, which were arranged downstream of the two promoters (cytomegalovirus (CMV) and pol I promoter) and upstream of the terminators and polyadenylation signal, respectively. The utility of this method was demonstrated by the recovery of FMDV Asia1 HN/CHA/06 in BHK-21 cells transfected with cDNA plasmids. Furthermore, infectious FMDV Asia1 HN/CHA/06 could be rescued from suckling mice directly inoculated with cDNA plasmids. Thus, this reverse genetics system can be applied to fundamental research and vaccine studies, most notably to rescue those viruses for which there is currently an absence of a suitable cell culture system. Copyright © 2015 Elsevier B.V. All rights reserved.

Interference of transcription across H-NS binding sites and repression by H-NS.

Science.gov (United States)

Rangarajan, Aathmaja Anandhi; Schnetz, Karin

2018-05-01

Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

Distinct transcriptional networks in quiescent myoblasts: a role for Wnt signaling in reversible vs. irreversible arrest.

Directory of Open Access Journals (Sweden)

Sindhu Subramaniam

Full Text Available Most cells in adult mammals are non-dividing: differentiated cells exit the cell cycle permanently, but stem cells exist in a state of reversible arrest called quiescence. In damaged skeletal muscle, quiescent satellite stem cells re-enter the cell cycle, proliferate and subsequently execute divergent programs to regenerate both post-mitotic myofibers and quiescent stem cells. The molecular basis for these alternative programs of arrest is poorly understood. In this study, we used an established myogenic culture model (C2C12 myoblasts to generate cells in alternative states of arrest and investigate their global transcriptional profiles. Using cDNA microarrays, we compared G0 myoblasts with post-mitotic myotubes. Our findings define the transcriptional program of quiescent myoblasts in culture and establish that distinct gene expression profiles, especially of tumour suppressor genes and inhibitors of differentiation characterize reversible arrest, distinguishing this state from irreversibly arrested myotubes. We also reveal the existence of a tissue-specific quiescence program by comparing G0 C2C12 myoblasts to isogenic G0 fibroblasts (10T1/2. Intriguingly, in myoblasts but not fibroblasts, quiescence is associated with a signature of Wnt pathway genes. We provide evidence that different levels of signaling via the canonical Wnt pathway characterize distinct cellular states (proliferation vs. quiescence vs. differentiation. Moderate induction of Wnt signaling in quiescence is associated with critical properties such as clonogenic self-renewal. Exogenous Wnt treatment subverts the quiescence program and negatively affects clonogenicity. Finally, we identify two new quiescence-induced regulators of canonical Wnt signaling, Rgs2 and Dkk3, whose induction in G0 is required for clonogenic self-renewal. These results support the concept that active signal-mediated regulation of quiescence contributes to stem cell properties, and have implications for

Distinct transcriptional networks in quiescent myoblasts: a role for Wnt signaling in reversible vs. irreversible arrest.

Science.gov (United States)

Subramaniam, Sindhu; Sreenivas, Prethish; Cheedipudi, Sirisha; Reddy, Vatrapu Rami; Shashidhara, Lingadahalli Subrahmanya; Chilukoti, Ravi Kumar; Mylavarapu, Madhavi; Dhawan, Jyotsna

2014-01-01

Most cells in adult mammals are non-dividing: differentiated cells exit the cell cycle permanently, but stem cells exist in a state of reversible arrest called quiescence. In damaged skeletal muscle, quiescent satellite stem cells re-enter the cell cycle, proliferate and subsequently execute divergent programs to regenerate both post-mitotic myofibers and quiescent stem cells. The molecular basis for these alternative programs of arrest is poorly understood. In this study, we used an established myogenic culture model (C2C12 myoblasts) to generate cells in alternative states of arrest and investigate their global transcriptional profiles. Using cDNA microarrays, we compared G0 myoblasts with post-mitotic myotubes. Our findings define the transcriptional program of quiescent myoblasts in culture and establish that distinct gene expression profiles, especially of tumour suppressor genes and inhibitors of differentiation characterize reversible arrest, distinguishing this state from irreversibly arrested myotubes. We also reveal the existence of a tissue-specific quiescence program by comparing G0 C2C12 myoblasts to isogenic G0 fibroblasts (10T1/2). Intriguingly, in myoblasts but not fibroblasts, quiescence is associated with a signature of Wnt pathway genes. We provide evidence that different levels of signaling via the canonical Wnt pathway characterize distinct cellular states (proliferation vs. quiescence vs. differentiation). Moderate induction of Wnt signaling in quiescence is associated with critical properties such as clonogenic self-renewal. Exogenous Wnt treatment subverts the quiescence program and negatively affects clonogenicity. Finally, we identify two new quiescence-induced regulators of canonical Wnt signaling, Rgs2 and Dkk3, whose induction in G0 is required for clonogenic self-renewal. These results support the concept that active signal-mediated regulation of quiescence contributes to stem cell properties, and have implications for pathological

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704

Directory of Open Access Journals (Sweden)

Trina Ekawati Tallei

2015-10-01

Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.

Microprocessor Recruitment to Elongating RNA Polymerase II Is Required for Differential Expression of MicroRNAs

Directory of Open Access Journals (Sweden)

Victoria A. Church

2017-09-01

Full Text Available The cellular abundance of mature microRNAs (miRNAs is dictated by the efficiency of nuclear processing of primary miRNA transcripts (pri-miRNAs into pre-miRNA intermediates. The Microprocessor complex of Drosha and DGCR8 carries this out, but it has been unclear what controls Microprocessor’s differential processing of various pri-miRNAs. Here, we show that Drosophila DGCR8 (Pasha directly associates with the C-terminal domain of the RNA polymerase II elongation complex when it is phosphorylated by the Cdk9 kinase (pTEFb. When association is blocked by loss of Cdk9 activity, a global change in pri-miRNA processing is detected. Processing of pri-miRNAs with a UGU sequence motif in their apical junction domain increases, while processing of pri-miRNAs lacking this motif decreases. Therefore, phosphorylation of RNA polymerase II recruits Microprocessor for co-transcriptional processing of non-UGU pri-miRNAs that would otherwise be poorly processed. In contrast, UGU-positive pri-miRNAs are robustly processed by Microprocessor independent of RNA polymerase association.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Transcription arrest caused by long nascent RNA chains

DEFF Research Database (Denmark)

Bentin, Thomas; Cherny, Dmitry; Larsen, H Jakob

2004-01-01

on transcription. Using phage T3 RNA polymerase (T3 RNAP) and covalently closed circular (cccDNA) DNA templates that did not contain any strong termination signal, transcription was severely inhibited after a short period of time. Less than approximately 10% residual transcriptional activity remained after 10 min......The transcription process is highly processive. However, specific sequence elements encoded in the nascent RNA may signal transcription pausing and/or termination. We find that under certain conditions nascent RNA chains can have a strong and apparently sequence-independent inhibitory effect...... of incubation. The addition of RNase A almost fully restored transcription in a dose dependent manner. Throughout RNase A rescue, an elongation rate of approximately 170 nt/s was maintained and this velocity was independent of RNA transcript length, at least up to 6 kb. Instead, RNase A rescue increased...

Identification of a methylated oligoribonucleotide as a potent inhibitor of HIV-1 reverse transcription complex.

Science.gov (United States)

Grigorov, Boyan; Bocquin, Anne; Gabus, Caroline; Avilov, Sergey; Mély, Yves; Agopian, Audrey; Divita, Gilles; Gottikh, Marina; Witvrouw, Myriam; Darlix, Jean-Luc

2011-07-01

Upon HIV-1 infection of a target cell, the viral reverse transcriptase (RT) copies the genomic RNA to synthesize the viral DNA. The genomic RNA is within the incoming HIV-1 core where it is coated by molecules of nucleocapsid (NC) protein that chaperones the reverse transcription process. Indeed, the RT chaperoning properties of NC extend from the initiation of cDNA synthesis to completion of the viral DNA. New and effective drugs against HIV-1 continue to be required, which prompted us to search for compounds aimed at inhibiting NC protein. Here, we report that the NC chaperoning activity is extensively inhibited in vitro by small methylated oligoribonucleotides (mODN). These mODNs were delivered intracellularly using a cell-penetrating-peptide and found to impede HIV-1 replication in primary human cells at nanomolar concentrations. Extensive analysis showed that viral cDNA synthesis was severely impaired by mODNs. Partially resistant viruses with mutations in NC and RT emerged after months of passaging in cell culture. A HIV-1 molecular clone (NL4.3) bearing these mutations was found to replicate at high concentrations of mODN, albeit with a reduced fitness. Small, methylated ODNs such as mODN-11 appear to be a new type of highly potent inhibitor of HIV-1.

Curaxin CBL0100 Blocks HIV-1 Replication and Reactivation through Inhibition of Viral Transcriptional Elongation

Directory of Open Access Journals (Sweden)

Maxime J. Jean

2017-10-01

Full Text Available Despite combination antiretroviral therapy (cART, acquired immunodeficiency syndrome (AIDS, predominantly caused by the human immunodeficiency virus type 1 (HIV-1, remains incurable. The barrier to a cure lies in the virus' ability to establish a latent infection in HIV/AIDS patients. Unsurprisingly, efforts for a sterilizing cure have focused on the “shock and kill” strategy using latency-reversing agents (LRAs to complement cART in order to eliminate these latent reservoirs. However, this method faces numerous challenges. Recently, the “block and lock” strategy has been proposed. It aims to reinforce a deep state of latency and prevent sporadic reactivation (“blip” of HIV-1 using latency-promoting agents (LPAs for a functional cure. Our studies of curaxin 100 (CBL0100, a small-molecule targeting the facilitates chromatin transcription (FACT complex, show that it blocks both HIV-1 replication and reactivation in in vitro and ex vivo models of HIV-1. Mechanistic investigation elucidated that CBL0100 preferentially targets HIV-1 transcriptional elongation and decreases the occupancy of RNA Polymerase II (Pol II and FACT at the HIV-1 promoter region. In conclusion, CBL0100 is a newly identified inhibitor of HIV-1 transcription that can be used as an LPA in the “block and lock” cure strategy.

Reg IV is a direct target of intestinal transcriptional factor CDX2 in gastric cancer.

Directory of Open Access Journals (Sweden)

Yutaka Naito

Full Text Available REG4, which encodes Reg IV protein, is a member of the calcium-dependent lectin superfamily and potent activator of the epidermal growth factor receptor/Akt/activator protein-1 signaling pathway. Several human cancers overexpress Reg IV, and Reg IV expression is associated with intestinal phenotype differentiation. However, regulation of REG4 transcription remains unclear. In the present study, we investigated whether CDX2 regulates Reg IV expression in gastric cancer (GC cells. Expression of Reg IV and CDX2 was analyzed by Western blot and quantitative reverse transcription-polymerase chain reaction in 9 GC cell lines and 2 colon cancer cell lines. The function of the 5'-flanking region of the REG4 gene was characterized by luciferase assay. In 9 GC cell lines, endogenous Reg IV and CDX2 expression were well correlated. Using an estrogen receptor-regulated form of CDX2, rapid induction of Reg IV expression was observed in HT-29 cells. Reporter gene assays revealed an important role in transcription for consensus CDX2 DNA binding elements in the 5'-flanking region of the REG4 gene. Chromatin immunoprecipitation assays showed that CDX2 binds directly to the 5'-flanking region of REG4. These results indicate that CDX2 protein directly regulates Reg IV expression.

Cloning and semi-quantitative expression of endochitinase ( ech42 ...

African Journals Online (AJOL)

Cloning and semi-quantitative expression of endochitinase (ech42) gene from Trichoderma spp. Pratibha Sharma, K Saravanan, R Ramesh, P Vignesh Kumar, Dinesh Singh, Manika Sharma, Monica S. Henry, Swati Deep ...

Critical appraisal of semi-quantitative analysis of 2-deoxyglucose autoradiograms

Energy Technology Data Exchange (ETDEWEB)

Kelly, P T; McCulloch, J [Glasgow Univ. (UK)

1983-06-13

Semi-quantitative analysis (e.g. optical density ratios) of (/sup 14/C)2-deoxyglucose autoradiograms is widely used in neuroscience research. The authors demonstrate that a fixed ratio of /sup 14/C-concentrations in the CNS does not yield a constant optical density ratio but is dependent upon the exposure time in the preparation of the autoradiograms and the absolute amounts of /sup 14/C from which the concentration ratio is derived. The failure of a fixed glucose utilization ratio to result in a constant optical density ratio represents a major interpretative difficulty in investigations where only semi-quantitative analysis of (/sup 14/C)2-deoxyglucose autoradiograms is undertaken.

Differential gene expression in the murine gastric fundus lacking interstitial cells of Cajal

Directory of Open Access Journals (Sweden)

Ward Sean M

2003-06-01

Full Text Available Abstract Background The muscle layers of murine gastric fundus have no interstitial cells of Cajal at the level of the myenteric plexus and only possess intramuscular interstitial cells and this tissue does not generate electric slow waves. The absence of intramuscular interstitial cells in W/WV mutants provides a unique opportunity to study the molecular changes that are associated with the loss of these intercalating cells. Method The gene expression profile of the gastric fundus of wild type and W/WV mice was assayed by murine microarray analysis displaying a total of 8734 elements. Queried genes from the microarray analysis were confirmed by semi-quantitative reverse transcription-polymerase chain reaction. Results Twenty-one genes were differentially expressed in wild type and W/WV mice. Eleven transcripts had 2.0–2.5 fold higher mRNA expression in W/WV gastric fundus when compared to wild type tissues. Ten transcripts had 2.1–3.9 fold lower expression in W/WV mutants in comparison with wild type animals. None of these genes have ever been implicated in any bowel motility function. Conclusions These data provides evidence that several important genes have significantly changed in the murine fundus of W/WV mutants that lack intramuscular interstitial cells of Cajal and have reduced enteric motor neurotransmission.

Role of the σ⁵⁴ Activator Interacting Domain in Bacterial Transcription Initiation

Energy Technology Data Exchange (ETDEWEB)

Siegel, Alexander R. [Univ. of California, Berkeley, CA (United States); Wemmer, David E. [Univ. of California, Berkeley, CA (United States)

2016-10-11

Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ⁵⁴ family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ⁵⁴ are primarily made through an N-terminal σ⁵⁴ activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ⁵⁴ AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ⁵⁴ alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ⁵⁴ AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ⁵⁴ AID complex using NMR spectroscopy. We show that the σ⁵⁴ AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ⁵⁴ bacterial transcription initiation.

Pan-Cancer Mutational and Transcriptional Analysis of the Integrator Complex

Directory of Open Access Journals (Sweden)

Antonio Federico

2017-04-01

Full Text Available The integrator complex has been recently identified as a key regulator of RNA Polymerase II-mediated transcription, with many functions including the processing of small nuclear RNAs, the pause-release and elongation of polymerase during the transcription of protein coding genes, and the biogenesis of enhancer derived transcripts. Moreover, some of its components also play a role in genome maintenance. Thus, it is reasonable to hypothesize that their functional impairment or altered expression can contribute to malignancies. Indeed, several studies have described the mutations or transcriptional alteration of some Integrator genes in different cancers. Here, to draw a comprehensive pan-cancer picture of the genomic and transcriptomic alterations for the members of the complex, we reanalyzed public data from The Cancer Genome Atlas. Somatic mutations affecting Integrator subunit genes and their transcriptional profiles have been investigated in about 11,000 patients and 31 tumor types. A general heterogeneity in the mutation frequencies was observed, mostly depending on tumor type. Despite the fact that we could not establish them as cancer drivers, INTS7 and INTS8 genes were highly mutated in specific cancers. A transcriptome analysis of paired (normal and tumor samples revealed that the transcription of INTS7, INTS8, and INTS13 is significantly altered in several cancers. Experimental validation performed on primary tumors confirmed these findings.

Step out of the groove : epigenetic gene control systems and engineered transcription factors

NARCIS (Netherlands)

Verschure, P.J.; Visser, A.E.; Rots, M.G.

2006-01-01

At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not

Mutations in the catalytic core or the C-terminus of murine leukemia virus (MLV) integrase disrupt virion infectivity and exert diverse effects on reverse transcription

International Nuclear Information System (INIS)

Steinrigl, Adolf; Nosek, Dagmara; Ertl, Reinhard; Guenzburg, Walter H.; Salmons, Brian; Klein, Dieter

2007-01-01

Understanding of the structures and functions of the retroviral integrase (IN), a key enzyme in the viral replication cycle, is essential for developing antiretroviral treatments and facilitating the development of safer gene therapy vehicles. Thus, four MLV IN-mutants were constructed in the context of a retroviral vector system, harbouring either a substitution in the catalytic centre, deletions in the C-terminus, or combinations of both modifications. IN-mutants were tested for their performance in different stages of the viral replication cycle: RNA-packaging; RT-activity; transient and stable infection efficiency; dynamics of reverse transcription and nuclear entry. All mutant vectors packaged viral RNA with wild-type efficiencies and displayed only slight reductions in RT-activity. Deletion of either the IN C-terminus alone, or in addition to part of the catalytic domain exerted contrasting effects on intracellular viral DNA levels, implying that IN influences reverse transcription in more than one direction

Validated reverse transcription droplet digital PCR serves as a higher order method for absolute quantification of Potato virus Y strains.

Science.gov (United States)

Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša

2018-05-03

RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.

Interferon antagonist NSs of La Crosse virus triggers a DNA damage response-like degradation of transcribing RNA polymerase II.

Science.gov (United States)

Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann

2011-02-04

La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.

Combined visual and semi-quantitative assessment of 123I-FP-CIT SPECT for the diagnosis of dopaminergic neurodegenerative diseases.

Science.gov (United States)

Ueda, Jun; Yoshimura, Hajime; Shimizu, Keiji; Hino, Megumu; Kohara, Nobuo

2017-07-01

Visual and semi-quantitative assessments of 123 I-FP-CIT single-photon emission computed tomography (SPECT) are useful for the diagnosis of dopaminergic neurodegenerative diseases (dNDD), including Parkinson's disease, dementia with Lewy bodies, progressive supranuclear palsy, multiple system atrophy, and corticobasal degeneration. However, the diagnostic value of combined visual and semi-quantitative assessment in dNDD remains unclear. Among 239 consecutive patients with a newly diagnosed possible parkinsonian syndrome who underwent 123 I-FP-CIT SPECT in our medical center, 114 patients with a disease duration less than 7 years were diagnosed as dNDD with the established criteria or as non-dNDD according to clinical judgment. We retrospectively examined their clinical characteristics and visual and semi-quantitative assessments of 123 I-FP-CIT SPECT. The striatal binding ratio (SBR) was used as a semi-quantitative measure of 123 I-FP-CIT SPECT. We calculated the sensitivity and specificity of visual assessment alone, semi-quantitative assessment alone, and combined visual and semi-quantitative assessment for the diagnosis of dNDD. SBR was correlated with visual assessment. Some dNDD patients with a normal visual assessment had an abnormal SBR, and vice versa. There was no statistically significant difference between sensitivity of the diagnosis with visual assessment alone and semi-quantitative assessment alone (91.2 vs. 86.8%, respectively, p = 0.29). Combined visual and semi-quantitative assessment demonstrated superior sensitivity (96.7%) to visual assessment (p = 0.03) or semi-quantitative assessment (p = 0.003) alone with equal specificity. Visual and semi-quantitative assessments of 123 I-FP-CIT SPECT are helpful for the diagnosis of dNDD, and combined visual and semi-quantitative assessment shows superior sensitivity with equal specificity.

Transcription blockage by stable H-DNA analogs in vitro.

Science.gov (United States)

Pandey, Shristi; Ogloblina, Anna M; Belotserkovskii, Boris P; Dolinnaya, Nina G; Yakubovskaya, Marianna G; Mirkin, Sergei M; Hanawalt, Philip C

2015-08-18

DNA sequences that can form unusual secondary structures are implicated in regulating gene expression and causing genomic instability. H-palindromes are an important class of such DNA sequences that can form an intramolecular triplex structure, H-DNA. Within an H-palindrome, the H-DNA and canonical B-DNA are in a dynamic equilibrium that shifts toward H-DNA with increased negative supercoiling. The interplay between H- and B-DNA and the fact that the process of transcription affects supercoiling makes it difficult to elucidate the effects of H-DNA upon transcription. We constructed a stable structural analog of H-DNA that cannot flip into B-DNA, and studied the effects of this structure on transcription by T7 RNA polymerase in vitro. We found multiple transcription blockage sites adjacent to and within sequences engaged in this triplex structure. Triplex-mediated transcription blockage varied significantly with changes in ambient conditions: it was exacerbated in the presence of Mn(2+) or by increased concentrations of K(+) and Li(+). Analysis of the detailed pattern of the blockage suggests that RNA polymerase is sterically hindered by H-DNA and has difficulties in unwinding triplex DNA. The implications of these findings for the biological roles of triple-stranded DNA structures are discussed. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Peroxisome proliferator-activated receptor gamma recruits the positive transcription elongation factor b complex to activate transcription and promote adipogenesis

DEFF Research Database (Denmark)

Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien

2006-01-01

Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....

Detection of Tumor Cell-Specific mRNA in the Peripheral Blood of Patients with Breast Cancer — Evaluation of Several Markers with Real-Time Reverse Transcription-PCR

Directory of Open Access Journals (Sweden)

Ulrich Andergassen

2013-01-01

Full Text Available It is widely known that cells from epithelial tumors, e.g., breast cancer, detach from their primary tissue and enter blood circulation. We show that the presence of circulating tumor cells (CTCs in samples of patients with primary and metastatic breast cancer can be detected with an array of selected tumor-marker-genes by reverse transcription real-time PCR. The focus of the presented work is on detecting differences in gene expression between healthy individuals and adjuvant and metastatic breast cancer patients, not an accurate quantification of these differences. Therefore, total RNA was isolated from blood samples of healthy donors and patients with primary or metastatic breast cancer after enrichment of mononuclear cells by density gradient centrifugation. After reverse transcription real-time PCR was carried out with a set of marker genes (BCSP, CK8, Her2, MGL, CK18, CK19. B2M and GAPDH were used as reference genes. Blood samples from patients with metastatic disease revealed increased cytokine gene levels in comparison to normal blood samples. Detection of a single gene was not sufficient to detect CTCs by reverse transcription real-time PCR. Markers used here were selected based on a recent study detecting cancer cells on different protein levels. The combination of such a marker array leads to higher and more specific discovery rates, predominantly in metastatic patients. Identification of CTCs by PCR methods may lead to better diagnosis and prognosis and could help to choose an adequate therapy.

Semiquantitative bacterial observations with group B streptococcal vulvovaginitis.

Science.gov (United States)

Monif, G R

1999-01-01

OBJECTIVE: Group B streptococcal (GBS) vulvovaginitis is a poorly-delineated clinical entity. The purpose of this study is to report semiquantitative data from four cases of GBS vulvovaginitis and to comment on their significance in terms of the in vitro inhibitory capabilities of GBS. METHODOLOGY: Four patients whose clinical presentations were consistent with GBS vulvovaginitis, from whom GBS was isolated and for whom semi-quantitative as well as qualitative microbiologic data existed, were identified. RESULTS: To produce vulvovaginitis, GBS must be at a high multiplicity (10(8) CFU/g of vaginal fluid). Single coisolates were identified in three of the four cases (two cases of Escherichia coli and one case of Staphylococcus aureus). Group B streptococcus does not inhibit either of these bacteria in vitro. CONCLUSION: When the growth requirements for the demonstration of in vitro inhibition for GBS or lack thereof are met in vivo, the in vivo observations are consistent with those projected from the in vitro data. PMID:10524667

Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

DEFF Research Database (Denmark)

1998-01-01

RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...... to the action of a DNA dependant RNA polymerase in the presence of nucleoside triphosphates. Equal length transcripts may be obtained by placing a block to transcription downstream from the initiation site or by cutting the template at such a selected location. The initiation site is formed by displacement...... of one strand of the DNA locally by the PNA hybridization....

Transcription of human 7S K DNA in vitro and in vivo is exclusively controlled by an upstream promoter

Energy Technology Data Exchange (ETDEWEB)

Kleinert, H.; Benecke, B.J.

1988-02-25

The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.

Coordinating repair of oxidative DNA damage with transcription and replication

International Nuclear Information System (INIS)

Cooper, P.K.

2003-01-01

Transcription-coupled repair (TCR) preferentially removes DNA lesions from template strands of active genes. Defects in TCR, which acts both on lesions removed by nucleotide excision repair (NER) and on oxidative lesions removed by base excision repair (BER), underlie the fatal developmental disorder Cockayne syndrome. Although its detailed mechanism remains unknown, TCR involves recognition of a stalled RNA polymerase (RNAP), removal or remodeling of RNAP to allow access to the lesion, and recruitment of repair enzymes. At a minimum, these early steps require a non-enzymatic function of the multifunctional repair protein XPG, the CSB protein with ATP-dependent chromatin remodeling activity, and the TFIIH complex (including the XPB and XPD helicases) that is also required for basal transcription initiation and NER. XPG exists in the cell in a complex with TFIIH, and in vitro evidence has suggested that it interacts with CSB. To address the mechanism of TCR, we are characterizing protein-DNA and protein-protein interactions of XPG. We show that XPG preferentially binds to double-stranded DNA containing bubbles resembling in size the unpaired regions associated with transcription. Two distinct domains of XPG are required for the observed strong binding specificity and stability. XPG both interacts directly with CSB and synergistically binds with it to bubble DNA, and it strongly stimulates the bubble DNA-dependent ATPase activity of CSB. Significantly for TCR, XPG also interacts directly with RNAP II, binds both the protein and nucleic acid components (the R-loop) of a stalled RNA polymerase, and forms a ternary complex with CSB and the stalled RNAP. These results are consistent with the model that XPG and CSB jointly interact with the DNA/chromatin structure in the vicinity of the stalled transcriptional apparatus and with the transcriptional machinery itself to remodel the chromatin and either move or remodel the blocked RNA polymerase to expose the lesion

Detection of live Salmonella enterica in fresh-cut vegetables by a TaqMan-based one-step reverse transcription real-time PCR.

Science.gov (United States)

Miao, Y J; Xiong, G T; Bai, M Y; Ge, Y; Wu, Z F

2018-05-01

Fresh-cut produce is at greater risk of Salmonella contamination. Detection and early warning systems play an important role in reducing the dissemination of contaminated products. One-step Reverse Transcription Polymerase Chain Reaction (RT-qPCR) targeting Salmonella tmRNA with or without a 6-h enrichment was evaluated for the detection of Salmonella in fresh-cut vegetables after 6-h storage. LOD of one-step RT-qPCR was 1·0 CFU per ml (about 100 copies tmRNA per ml) by assessed 10-fold serially diluted RNA from 10 6 CFU per ml bacteria culture. Then, one-step RT-qPCR assay was applied to detect viable Salmonella cells in 14 fresh-cut vegetables after 6-h storage. Without enrichment, this assay could detect 10 CFU per g for fresh-cut lettuce, cilantro, spinach, cabbage, Chinese cabbage and bell pepper, and 10 2 CFU per g for other vegetables. With a 6-h enrichment, this assay could detect 10 CFU per g for all fresh-cut vegetables used in this study. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. Significance and Impact of the Study: Fresh-cut produce is at greater risk of Salmonella contamination. Rapid detection methods play an important role in reducing the dissemination of contaminated products. One-step RT-qPCR assay used in this study could detect 10 CFU per g Salmonella for 14 fresh-cut vegetables with a 6-h short enrichment. Moreover, this assay was able to discriminate viable cells from dead cells. This rapid detection assay may provide potential processing control and early warning method in fresh-cut vegetable processing to strengthen food safety assurance. © 2018 The Society for Applied Microbiology.

Evaluation of Reference Genes for Reverse Transcription Quantitative PCR Studies of Physiological Responses in the Ghost Moth, Thitarodes armoricanus (Lepidoptera, Hepialidae.

Directory of Open Access Journals (Sweden)

Guiqing Liu

Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is the sensitive method to quantify the expression levels of target genes on the basis of endogenous control. An appropriate reference gene set for normalization is essential for reliable results. The ghost moth, Thitarodes armoricanus, a host species of a medicinal fungus, Ophiocordyceps sinensis, is an economically important member of the Lepidoptera. Recent studies have focused on the mechanism of adaptation of this species to its high-altitude environment and host immune response to O. sinensis infection and RT-qPCR is commonly used in these studies to decipher the genetic basis of physiological functions. However, a thorough assessment of candidate reference genes in the genus Thitarodes is lacking. Here, the expression levels of eight candidate reference genes (ACT, EF, EIF4A, GAPDH, G6PDH, RPL13A, TUB and 18S in T. armoricanus at different developmental stages and in different body parts of the seventh instar larvae were analyzed, along with larvae kept under low temperatures, larvae exposed to two fungal infections and larvae fed different diets. Three established software programs-Bestkeeper, geNorm and NormFinder-were employed to calculate variation among the treatments. The results revealed that the best-suited reference genes differed across the treatments, with EF, EIF4A and GAPDH found to be the best suited for the different developmental stages and larvae body parts; EF, EIF4A and RPL13A found to be the best suited for low-temperature challenge; and EF, EIF4A and TUB found to be the best suited for the fungal infections and dietary treatments. This study thus further contributes to the establishment of an accurate method for normalizing RT-qPCR results for T. armoricanus and serves as a reference for gene expression studies of related insect species.

Asymmetric Modification of Hepatitis B Virus (HBV) Genomes by an Endogenous Cytidine Deaminase inside HBV Cores Informs a Model of Reverse Transcription.

Science.gov (United States)

Nair, Smita; Zlotnick, Adam

2018-05-15

Cytidine deaminases inhibit replication of a broad range of DNA viruses by deaminating cytidines on single-stranded DNA (ssDNA) to generate uracil. While several lines of evidence have revealed hepatitis B virus (HBV) genome editing by deamination, it is still unclear which nucleic acid intermediate of HBV is modified. Hepatitis B virus has a relaxed circular double-stranded DNA (rcDNA) genome that is reverse transcribed within virus cores from a RNA template. The HBV genome also persists as covalently closed circular DNA (cccDNA) in the nucleus of an infected cell. In the present study, we found that in HBV-producing HepAD38 and HepG2.2.15 cell lines, endogenous cytidine deaminases edited 10 to 25% of HBV rcDNA genomes, asymmetrically with almost all mutations on the 5' half of the minus strand. This region corresponds to the last half of the minus strand to be protected by plus-strand synthesis. Within this half of the genome, the number of mutations peaks in the middle. Overexpressed APOBEC3A and APOBEC3G could be packaged in HBV capsids but did not change the amount or distribution of mutations. We found no deamination on pregenomic RNA (pgRNA), indicating that an intact genome is encapsidated and deaminated during or after reverse transcription. The deamination pattern suggests a model of rcDNA synthesis in which pgRNA and then newly synthesized minus-sense single-stranded DNA are protected from deaminase by interaction with the virus capsid; during plus-strand synthesis, when enough dsDNA has been synthesized to displace the remaining minus strand from the capsid surface, the single-stranded DNA becomes deaminase sensitive. IMPORTANCE Host-induced mutation of the HBV genome by APOBEC proteins may be a path to clearing the virus. We examined cytidine-to-thymidine mutations in the genomes of HBV particles grown in the presence or absence of overexpressed APOBEC proteins. We found that genomes were subjected to deamination activity during reverse transcription

Influenza Polymerase Can Adopt an Alternative Configuration Involving a Radical Repacking of PB2 Domains.

Science.gov (United States)

Thierry, Eric; Guilligay, Delphine; Kosinski, Jan; Bock, Thomas; Gaudon, Stephanie; Round, Adam; Pflug, Alexander; Hengrung, Narin; El Omari, Kamel; Baudin, Florence; Hart, Darren J; Beck, Martin; Cusack, Stephen

2016-01-07

Influenza virus polymerase transcribes or replicates the segmented RNA genome (vRNA) into respectively viral mRNA or full-length copies and initiates RNA synthesis by binding the conserved 3' and 5' vRNA ends (the promoter). In recent structures of promoter-bound polymerase, the cap-binding and endonuclease domains are configured for cap snatching, which generates capped transcription primers. Here, we present a FluB polymerase structure with a bound complementary cRNA 5' end that exhibits a major rearrangement of the subdomains within the C-terminal two-thirds of PB2 (PB2-C). Notably, the PB2 nuclear localization signal (NLS)-containing domain translocates ∼90 Å to bind to the endonuclease domain. FluA PB2-C alone and RNA-free FluC polymerase are similarly arranged. Biophysical and cap-dependent endonuclease assays show that in solution the polymerase explores different conformational distributions depending on which RNA is bound. The inherent flexibility of the polymerase allows it to adopt alternative conformations that are likely important during polymerase maturation into active progeny RNPs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

A Function for the hnRNP A1/A2 Proteins in Transcription Elongation.

Science.gov (United States)

Lemieux, Bruno; Blanchette, Marco; Monette, Anne; Mouland, Andrew J; Wellinger, Raymund J; Chabot, Benoit

2015-01-01

The hnRNP A1 and A2 proteins regulate processes such as alternative pre-mRNA splicing and mRNA stability. Here, we report that a reduction in the levels of hnRNP A1 and A2 by RNA interference or their cytoplasmic retention by osmotic stress drastically increases the transcription of a reporter gene. Based on previous work, we propose that this effect may be linked to a decrease in the activity of the transcription elongation factor P-TEFb. Consistent with this hypothesis, the transcription of the reporter gene was stimulated when the catalytic component of P-TEFb, CDK9, was inhibited with DRB. While low levels of A1/A2 stimulated the association of RNA polymerase II with the reporter gene, they also increased the association of CDK9 with the repressor 7SK RNA, and compromised the recovery of promoter-distal transcription on the Kitlg gene after the release of pausing. Transcriptome analysis revealed that more than 50% of the genes whose expression was affected by the siRNA-mediated depletion of A1/A2 were also affected by DRB. RNA polymerase II-chromatin immunoprecipitation assays on DRB-treated and A1/A2-depleted cells identified a common set of repressed genes displaying increased occupancy of polymerases at promoter-proximal locations, consistent with pausing. Overall, our results suggest that lowering the levels of hnRNP A1/A2 elicits defective transcription elongation on a fraction of P-TEFb-dependent genes, hence favoring the transcription of P-TEFb-independent genes.

A Function for the hnRNP A1/A2 Proteins in Transcription Elongation.

Directory of Open Access Journals (Sweden)

Bruno Lemieux

Full Text Available The hnRNP A1 and A2 proteins regulate processes such as alternative pre-mRNA splicing and mRNA stability. Here, we report that a reduction in the levels of hnRNP A1 and A2 by RNA interference or their cytoplasmic retention by osmotic stress drastically increases the transcription of a reporter gene. Based on previous work, we propose that this effect may be linked to a decrease in the activity of the transcription elongation factor P-TEFb. Consistent with this hypothesis, the transcription of the reporter gene was stimulated when the catalytic component of P-TEFb, CDK9, was inhibited with DRB. While low levels of A1/A2 stimulated the association of RNA polymerase II with the reporter gene, they also increased the association of CDK9 with the repressor 7SK RNA, and compromised the recovery of promoter-distal transcription on the Kitlg gene after the release of pausing. Transcriptome analysis revealed that more than 50% of the genes whose expression was affected by the siRNA-mediated depletion of A1/A2 were also affected by DRB. RNA polymerase II-chromatin immunoprecipitation assays on DRB-treated and A1/A2-depleted cells identified a common set of repressed genes displaying increased occupancy of polymerases at promoter-proximal locations, consistent with pausing. Overall, our results suggest that lowering the levels of hnRNP A1/A2 elicits defective transcription elongation on a fraction of P-TEFb-dependent genes, hence favoring the transcription of P-TEFb-independent genes.

Tumoral Environment Triggers Transcript Anomalies in Established Tumors: Induction of Altered Gene Expression and of Aberrant, Truncated and B2 Repeat-Containing Gene Transcripts

Directory of Open Access Journals (Sweden)

Pieter Rottiers

1999-12-01

Full Text Available In addition to eugenetic changes, cancerous cells exhibit extensive modifications in the expression levels of a variety of genes. The phenotypic switch observed after inoculation of T lymphoma cells into syngenic mice illustrates the active participation of tumoral environment in the induction of an aberrant gene expression pattern. To further substantiate this contribution, we performed polymerase chain reaction (PCR-based subtraction suppression hybridization (SSH to identify genes that are differentially expressed in tumor-derived EL4/13.3 cells compared to the same cells isolated from cultures. Besides a number of unknown genes, the subtracted library contained several known genes that have been reported to be expressed at increased levels in tumors and/or to contribute to carcinogenesis. Apart from clones representing translated transcripts, the subtracted library also contained a high number of clones representing B2 repeat elements, viz. short interspersed repetitive elements that are transcribed by RNA polymerase III. Northern blotting confirmed the induction of B2 transcripts in tumor tissue and also revealed induction of chimeric, B2 repeat-containing mRNA. The appearance of chimeric transcripts was accompanied by aberrant, shorter-than-full-length transcripts, specifically from upregulated genes. Accordingly, in addition to altered gene expression, tumoral environmental triggers constitute a potent mechanism to create an epigenetic diversity in cancers by inducing extensive transcript anomalies.

Subunit architecture and functional modular rearrangements of the transcriptional mediator complex.

Science.gov (United States)

Tsai, Kuang-Lei; Tomomori-Sato, Chieri; Sato, Shigeo; Conaway, Ronald C; Conaway, Joan W; Asturias, Francisco J

2014-06-05

The multisubunit Mediator, comprising ∼30 distinct proteins, plays an essential role in gene expression regulation by acting as a bridge between DNA-binding transcription factors and the RNA polymerase II (RNAPII) transcription machinery. Efforts to uncover the Mediator mechanism have been hindered by a poor understanding of its structure, subunit organization, and conformational rearrangements. By overcoming biochemical and image analysis hurdles, we obtained accurate EM structures of yeast and human Mediators. Subunit localization experiments, docking of partial X-ray structures, and biochemical analyses resulted in comprehensive mapping of yeast Mediator subunits and a complete reinterpretation of our previous Mediator organization model. Large-scale Mediator rearrangements depend on changes at the interfaces between previously described Mediator modules, which appear to be facilitated by factors conducive to transcription initiation. Conservation across eukaryotes of Mediator structure, subunit organization, and RNA polymerase II interaction suggest conservation of fundamental aspects of the Mediator mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

International Nuclear Information System (INIS)

Plotch, S.J.; Palant, O.; Gluzman, Y.

1989-01-01

A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer, RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, [α- 32 P]UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

Science.gov (United States)

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Leptin potentiates Prevotella intermedia lipopolysaccharide-induced production of TNF-alpha in monocyte-derived macrophages.

Science.gov (United States)

Kim, Sung-Jo

2010-06-01

In addition to regulating body weight, leptin is also recognized for its role in the regulation of immune function and inflammation. The purpose of this study was to investigate the effect of leptin on Prevotella (P.) intermedia lipopolysaccharide (LPS)-induced tumor necrosis factor (TNF)-alpha production in differentiated THP-1 cells, a human monocytic cell line. LPS from P. intermedia ATCC 25611 was prepared by the standard hot phenol-water method. THP-1 cells were incubated in the medium supplemented with phorbol myristate acetate to induce differentiation into macrophage-like cells. The amount of TNF-alpha and interleukin-8 secreted into the culture medium was determined by enzyme-linked immunosorbent assay (ELISA). TNF-alpha and Ob-R mRNA expression levels were determined by semi-quantitative reverse transcription-polymerase chain reaction analysis. Leptin enhanced P. intermedia LPS-induced TNF-alpha production in a dose-dependent manner. Leptin modulated P. intermedia LPS-induced TNF-alpha expression predominantly at the transcriptional level. Effect of leptin on P. intermedia LPS-induced TNF-alpha production was not mediated by the leptin receptor. The ability of leptin to enhance P. intermedia LPS-induced TNF-alpha production may be important in the establishment of chronic lesion accompanied by osseous tissue destruction observed in inflammatory periodontal disease.

Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications.

Directory of Open Access Journals (Sweden)

Rodrigo Jácome

Full Text Available The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, "fingertips" that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection.

Catalytic properties of RNA polymerases IV and V: accuracy, nucleotide incorporation and rNTP/dNTP discrimination.

Science.gov (United States)

Marasco, Michelle; Li, Weiyi; Lynch, Michael; Pikaard, Craig S

2017-11-02

All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA-Argonaute silencing complexes are recruited. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70

Directory of Open Access Journals (Sweden)

Noireaux Vincent

2010-06-01

Full Text Available Abstract Background Escherichia coli cell-free expression systems use bacteriophage RNA polymerases, such as T7, to synthesize large amounts of recombinant proteins. These systems are used for many applications in biotechnology, such as proteomics. Recently, informational processes have been reconstituted in vitro with cell-free systems. These synthetic approaches, however, have been seriously limited by a lack of transcription modularity. The current available cell-free systems have been optimized to work with bacteriophage RNA polymerases, which put significant restrictions to engineer processes related to biological information. The development of efficient cell-free systems with broader transcription capabilities is required to study complex informational processes in vitro. Results In this work, an efficient cell-free expression system that uses the endogenous E. coli RNA polymerase only and sigma factor 70 for transcription was prepared. Approximately 0.75 mg/ml of Firefly luciferase and enhanced green fluorescent protein were produced in batch mode. A plasmid was optimized with different regulatory parts to increase the expression. In addition, a new eGFP was engineered that is more translatable in cell-free systems than the original eGFP. The protein production was characterized with three different adenosine triphosphate (ATP regeneration systems: creatine phosphate (CP, phosphoenolpyruvate (PEP, and 3-phosphoglyceric acid (3-PGA. The maximum protein production was obtained with 3-PGA. Preparation of the crude extract was streamlined to a simple routine procedure that takes 12 hours including cell culture. Conclusions Although it uses the endogenous E. coli transcription machinery, this cell-free system can produce active proteins in quantities comparable to bacteriophage systems. The E. coli transcription provides much more possibilities to engineer informational processes in vitro. Many E. coli promoters/operators specific to sigma

A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

Directory of Open Access Journals (Sweden)

Redman Julia C

2008-07-01

Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

Reptin is required for the transcription of telomerase reverse transcriptase and over-expressed in gastric cancer

Directory of Open Access Journals (Sweden)

Liu Tiantian

2010-05-01

Full Text Available Abstract Background Telomerase is activated in oncogenesis, which confers an immortal phenotype to cancer cells. The AAA + ATPase Reptin is required for telomerase biogenesis by maintaining telomerase RNA (hTER stability and is aberrantly expressed in certain cancers. Given its role in chromatin remodeling and transcription regulation, we determined the effect of Reptin on the transcription of the telomerase reverse transcriptase (hTERT gene, a key component of the telomerase complex and its expression in gastric cancer. Results Knocking down Reptin or its partner Pontin using small interfering RNA in gastric and cervical cancer cells led to significant decreases in hTERT mRNA, but hTERT promoter activity was inhibited in only Reptin-depleted cells. Reptin interacted with the c-MYC oncoprotein and its stimulatory effect on the hTERTpromoter was significantly dependent on functional E-boxes in the promoter. Moreover, Reptin bound to the hTERT proximal promoter and the loss of the Reptin occupancy led to dissociation of c-MYC from the hTERT promoter in Reptin-depleted cells. Reptin inhibition dramatically impaired clonogenic potential of gastric cancer cells by inducing cell growtharrest and over-expression of Reptin was observed in primary gastric cancer specimens. Conclusions The hTERT gene is a direct target of Reptin, and hTERT transcription requires constitutive expression of Reptin and its cooperation with c-MYC. Thus, Reptin regulates telomerase at two different levels. This finding, together with the requirementof Reptin for the clonogenic potential of cancer cells and its over-expression in gastriccancer and other solid tumors, suggests that Reptin may be a putative therapeutic target.

Human extrahepatic portal vein obstruction correlates with decreased factor VII and protein C transcription but increased hepatocyte proliferation.

Science.gov (United States)

Chiu, Bill; Melin-Aldana, Hector; Superina, Riccardo A

2007-10-01

A 3-year-old girl developed extrahepatic portal vein obstruction (EHPVO) after a liver transplant. She had sequelae of portal hypertension that required another transplantation. The circumstances allowed for comparison of liver-dependent coagulation factor production between the second donor liver and the explanted liver with EHPVO. Liver samples from the explanted first graft and the second transplant were obtained. Fresh tissue was used to perform reverse transcription-polymerase chain reaction with primers against factors V, VII, as well as VIII, protein C, and paraffin-embedded sections for hepatocyte proliferation using Ki-67 antibody as well as for apoptosis using TUNEL assay. The transcription of factor VII and that of protein C were decreased in the explant as compared with the newly transplanted liver (factor VII, 77% of the donor; protein C, 88% of the donor). The transcription of factor V and that of factor VIII were unchanged. The explant had a greater percentage of proliferating hepatocytes than the new organ (0.85% +/- 0.75% vs 0.11% +/- 0.21%). The percentage of apoptotic cells was similar between the 2 livers (0.09% +/- 0.13% vs 0.09% +/- 0.13%). Idiopathic EHPVO is associated with a reduction in liver-dependent coagulation factor transcription and an increase in hepatocyte proliferation. Portal blood flow deprivation alters hepatic homeostasis and initiates mechanisms that attempt to restore liver-dependent coagulation factors.

Increased transcript level of poly(ADP-ribose) polymerase (PARP-1) in human tricuspid compared with bicuspid aortic valves correlates with the stenosis severity

International Nuclear Information System (INIS)

Nagy, Edit; Caidahl, Kenneth; Franco-Cereceda, Anders; Bäck, Magnus

2012-01-01

Highlights: ► Oxidative stress has been implicated in the pathomechanism of calcific aortic valve stenosis. ► We assessed the transcript levels for PARP-1 (poly(ADP-ribose) polymerase), acts as a DNA damage nick sensor in stenotic valves. ► Early stage of diseased tricuspid valves exhibited higher mRNA levels for PARP-1 compared to bicuspid valves. ► The mRNA levels for PARP-1 inversely correlated with the clinical stenosis severity in tricuspid valves. ► Our data demonstrated that DNA damage pathways might be associated with stenosis severity only in tricuspid valves. -- Abstract: Oxidative stress may contribute to the hemodynamic progression of aortic valve stenosis, and is associated with activation of the nuclear enzyme poly(ADP-ribose) polymerase (PARP) 1. The aim of the present study was to assess the transcriptional profile and the topological distribution of PARP-1 in human aortic valves, and its relation to the stenosis severity. Human stenotic aortic valves were obtained from 46 patients undergoing aortic valve replacement surgery and used for mRNA extraction followed by quantitative real-time PCR to correlate the PARP-1 expression levels with the non invasive hemodynamic parameters quantifying the stenosis severity. Primary isolated valvular interstitial cells (VICs) were used to explore the effects of cytokines and leukotriene C 4 (LTC 4 ) on valvular PARP-1 expression. The thickened areas of stenotic valves with tricuspid morphology expressed significantly higher levels of PARP-1 mRNA compared with the corresponding part of bicuspid valves (0.501 vs 0.243, P = 0.01). Furthermore, the quantitative gene expression levels of PARP-1 were inversely correlated with the aortic valve area (AVA) (r = −0.46, P = 0.0469) and AVA indexed for body surface area (BSA) (r = −0.498; P = 0.0298) only in tricuspid aortic valves. LTC 4 (1 nM) significantly elevated the mRNA levels of PARP-1 by 2.38-fold in VICs. Taken together, these data suggest that

In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants

Directory of Open Access Journals (Sweden)

Mokhtar Nosrati

2017-08-01

Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.

Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

Science.gov (United States)

Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

2011-01-01

HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA

DEFF Research Database (Denmark)

Scheibye-Knudsen, Morten; Tseng, Anne; Jensen, Martin Borch

2016-01-01

of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number...... to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans. In conclusion, this work...

A critical appraisal of semi-quantitative analysis of 2-deoxyglucose autoradiograms

International Nuclear Information System (INIS)

Kelly, P.T.; McCulloch, J.

1983-01-01

Semi-quantitative analysis (e.g. optical density ratios) of [ 14 C]2-deoxyglucose autoradiograms is widely used in neuroscience research. The authors demonstrate that a fixed ratio of 14 C-concentrations in the CNS does not yield a constant optical density ratio but is dependent upon the exposure time in the preparation of the autoradiograms and the absolute amounts of 14 C from which the concentration ratio is derived. The failure of a fixed glucose utilization ratio to result in a constant optical density ratio represents a major interpretative difficulty in investigations where only semi-quantitative analysis of [ 14 C]2-deoxyglucose autoradiograms is undertaken. (Auth.)

Transcript and protein expression profile of PF11_0394, a Plasmodium falciparum protein expressed in salivary gland sporozoites

Directory of Open Access Journals (Sweden)

Schlarman Maggie S

2012-03-01

Full Text Available Abstract Background Plasmodium falciparum malaria is a significant problem around the world today, thus there is still a need for new control methods to be developed. Because the sporozoite displays dual infectivity for both the mosquito salivary glands and vertebrate host tissue, it is a good target for vaccine development. Methods The P. falciparum gene, PF11_0394, was chosen as a candidate for study due to its potential role in the invasion of host tissues. This gene, which was selected using a data mining approach from PlasmoDB, is expressed both at the transcriptional and protein levels in sporozoites and likely encodes a putative surface protein. Using reverse transcription-polymerase chain reaction (RT-PCR and green fluorescent protein (GFP-trafficking studies, a transcript and protein expression profile of PF11_0394 was determined. Results The PF11_0394 protein has orthologs in other Plasmodium species and Apicomplexans, but none outside of the group Apicomplexa. PF11_0394 transcript was found to be present during both the sporozoite and erythrocytic stages of the parasite life cycle, but no transcript was detected during axenic exoerythrocytic stages. Despite the presence of transcript throughout several life cycle stages, the PF11_0394 protein was only detected in salivary gland sporozoites. Conclusions PF11_0394 appears to be a protein uniquely detected in salivary gland sporozoites. Even though a specific function of PF11_0394 has not been determined in P. falciparum biology, it could be another candidate for a new vaccine.

[Characterization and transcriptional analysis of a new CC chemokine associated with innate imimune response in cobia (Rachycentron canadum)].

Science.gov (United States)

Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J

2013-01-01

Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.

Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

OpenAIRE

Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

1990-01-01

During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...

DREAM: a method for semi-quantitative dermal exposure assessment

NARCIS (Netherlands)

Wendel de Joode, B. van; Brouwer, D.H.; Kromhout, H.; Hemmen, J.J. van

2003-01-01

This paper describes a new method (DREAM) for structured, semi-quantitative dermal exposure assessment for chemical or biological agents that can be used in occupational hygiene or epidemiology. It is anticipated that DREAM could serve as an initial assessment of dermal exposure, amongst others,

Quantitative versus semiquantitative MR imaging of cartilage in blood-induced arthritic ankles: preliminary findings

International Nuclear Information System (INIS)

Doria, Andrea S.; Zhang, Ningning; Lundin, Bjorn; Hilliard, Pamela; Man, Carina; Weiss, Ruth; Detzler, Garry; Blanchette, Victor; Moineddin, Rahim; Eckstein, Felix; Sussman, Marshall S.

2014-01-01

Recent advances in hemophilia prophylaxis have raised the need for accurate noninvasive methods for assessment of early cartilage damage in maturing joints to guide initiation of prophylaxis. Such methods can either be semiquantitative or quantitative. Whereas semiquantitative scores are less time-consuming to be performed than quantitative methods, they are prone to subjective interpretation. To test the feasibility of a manual segmentation and a quantitative methodology for cross-sectional evaluation of articular cartilage status in growing ankles of children with blood-induced arthritis, as compared with a semiquantitative scoring system and clinical-radiographic constructs. Twelve boys, 11 with hemophilia (A, n = 9; B, n = 2) and 1 with von Willebrand disease (median age: 13; range: 6-17), underwent physical examination and MRI at 1.5 T. Two radiologists semiquantitatively scored the MRIs for cartilage pathology (surface erosions, cartilage loss) with blinding to clinical information. An experienced operator applied a validated quantitative 3-D MRI method to determine the percentage area of denuded bone (dAB) and the cartilage thickness (ThCtAB) in the joints' MRIs. Quantitative and semiquantitative MRI methods and clinical-radiographic constructs (Hemophilia Joint Health Score [HJHS], Pettersson radiograph scores) were compared. Moderate correlations were noted between erosions and dAB (r = 0.62, P = 0.03) in the talus but not in the distal tibia (P > 0.05). Whereas substantial to high correlations (r range: 0.70-0.94, P < 0.05) were observed between erosions, cartilage loss, HJHS and Pettersson scores both at the distal tibia and talus levels, moderate/borderline substantial (r range: 0.55-0.61, P < 0.05) correlations were noted between dAB/ThCtAB and clinical-radiographic constructs. Whereas the semiquantitative method of assessing cartilage status is closely associated with clinical-radiographic scores in cross-sectional studies of blood-induced arthropathy

Quantitative versus semiquantitative MR imaging of cartilage in blood-induced arthritic ankles: preliminary findings

Energy Technology Data Exchange (ETDEWEB)

Doria, Andrea S. [The Hospital for Sick Children, Department of Diagnostic Imaging, Toronto, ON (Canada); University of Toronto, Department of Medical Imaging, Toronto, ON (Canada); Zhang, Ningning [Children' s Hospital, Department of Radiology, Beijing (China); Lundin, Bjorn [Skaane University Hospital and Lund University, University Hospital of Lund, Center for Medical Imaging and Physiology, Lund (Sweden); Hilliard, Pamela [The Hospital for Sick Children, Department of Rehabilitation Services, Toronto, ON (Canada); Man, Carina; Weiss, Ruth; Detzler, Garry [The Hospital for Sick Children, Department of Diagnostic Imaging, Toronto, ON (Canada); Blanchette, Victor [The Hospital for Sick Children, Department of Hematology, Toronto, ON (Canada); Moineddin, Rahim [Family and Community Medicine, Department of Public Health, Toronto, ON (Canada); Eckstein, Felix [Paracelsus Medical University, Institute of Anatomy and Musculoskeletal Research, Salzburg (Austria); Chondrometrics GmbH, Ainring (Germany); Sussman, Marshall S. [University of Toronto, Department of Medical Imaging, Toronto, ON (Canada); University Health Network, Department of Medical Imaging, Toronto, ON (Canada)

2014-05-15

Recent advances in hemophilia prophylaxis have raised the need for accurate noninvasive methods for assessment of early cartilage damage in maturing joints to guide initiation of prophylaxis. Such methods can either be semiquantitative or quantitative. Whereas semiquantitative scores are less time-consuming to be performed than quantitative methods, they are prone to subjective interpretation. To test the feasibility of a manual segmentation and a quantitative methodology for cross-sectional evaluation of articular cartilage status in growing ankles of children with blood-induced arthritis, as compared with a semiquantitative scoring system and clinical-radiographic constructs. Twelve boys, 11 with hemophilia (A, n = 9; B, n = 2) and 1 with von Willebrand disease (median age: 13; range: 6-17), underwent physical examination and MRI at 1.5 T. Two radiologists semiquantitatively scored the MRIs for cartilage pathology (surface erosions, cartilage loss) with blinding to clinical information. An experienced operator applied a validated quantitative 3-D MRI method to determine the percentage area of denuded bone (dAB) and the cartilage thickness (ThCtAB) in the joints' MRIs. Quantitative and semiquantitative MRI methods and clinical-radiographic constructs (Hemophilia Joint Health Score [HJHS], Pettersson radiograph scores) were compared. Moderate correlations were noted between erosions and dAB (r = 0.62, P = 0.03) in the talus but not in the distal tibia (P > 0.05). Whereas substantial to high correlations (r range: 0.70-0.94, P < 0.05) were observed between erosions, cartilage loss, HJHS and Pettersson scores both at the distal tibia and talus levels, moderate/borderline substantial (r range: 0.55-0.61, P < 0.05) correlations were noted between dAB/ThCtAB and clinical-radiographic constructs. Whereas the semiquantitative method of assessing cartilage status is closely associated with clinical-radiographic scores in cross-sectional studies of blood

Analysis of transcriptional isoforms of collagen types IX, II, and I in the developing avian cornea by competitive polymerase chain reaction.

Science.gov (United States)

Fitch, J M; Gordon, M K; Gibney, E P; Linsenmayer, T F

1995-01-01

The genes for the alpha 1(IX), alpha 1(II), and alpha 2(I) collagen chains can give rise to different isoforms of mRNA, generated by alternative promotor usage [for alpha 1(IX) and alpha 2(I)] or alternative splicing [for alpha 1(II)]. In this study, we employed competitive reverse transcriptase PCR to quantitate the amounts of transcriptional isoforms for these genes in the embryonic avian cornea from its inception (about 3 1/2 days of development) to 11 days. In order to compare values at different time points, the results were normalized to those obtained for the "housekeeping" enzyme, glycerol-3-phosphate dehydrogenase (G3PDH). These values were compared to those obtained from other tissues (anterior optic cup and cartilage) that synthesize different combinations of the collagen isoforms. We found that, in the cornea, transcripts from the upstream promotor of alpha 1(IX) collagen (termed "long IX") were predominant at stage 18-20 (about 3 1/2 days), but then fell rapidly, and remained at a low level. By 5 days (just before stromal swelling) the major mRNA isoform of alpha 1(IX) was from the downstream promoter (termed "short IX"). The relative amount of transcript for the short form of type IX collagen rose to a peak at about 6 days of development, and then declined. Throughout this period, the predominant transcriptional isoform of the collagen type II gene was IIA (i.e., containing the alternatively spliced exon 2). This indicates that the molecules of type II collagen that are assembled into heterotypic fibrils with type I collagen possess, at least transiently, an amino-terminal globular domain similar to that found in collagen types I, III, and V. For type I, the "bone/tendon" mRNA isoform of the alpha 2(I) collagen gene was predominant; transcripts from the downstream promotor were at basal levels. In other tissues expressing collagen types IX and II, long IX was expressed predominantly with the IIA form in the anterior optic cup at stage 22/23; in 14 1

RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.

Directory of Open Access Journals (Sweden)

Aneeshkumar G Arimbasseri

2015-12-01

Full Text Available Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m(22G26 modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m(22G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m(22G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m(22G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m(22G26 modification and that this response is conserved among highly divergent yeasts and human cells.

Application of semiquantitative parameters of bone scintigraphy in diabetic patients

International Nuclear Information System (INIS)

Bokhchelyan, Kh.; Klisarova, A.; Koeva, L.; Pranchev, L.; Tranulov, G.

1997-01-01

The aim of the study is to introduce semiquantitative indicators, contributing to early detection and dynamic measurement of the degree of bone metabolism in the foot of diabetic patients. Ten diabetics (3 women and 7 men) and 20 controls (10 women and 10 men) are included in the study. All patients are subjected to bone scintigraphy, clinical and biochemical investigation. Data are obtained pointing to enhanced and disproportional fixation of the radionuclide in symmetrical zones of the foot. The results are interpreted with a special reference to the extent of metabolic control and complications of the diabetic condition. Enhanced bone metabolism in the foot of the diabetic patients examined was established. Semiquantitative parameters enabling early detection and dynamic measurement of bone metabolism in the diabetic foot are practically implemented

In vitro transcription of a torsionally constrained template

DEFF Research Database (Denmark)

Bentin, Thomas; Nielsen, Peter E

2002-01-01

RNA polymerase (RNAP) and the DNA template must rotate relative to each other during transcription elongation. In the cell, however, the components of the transcription apparatus may be subject to rotary constraints. For instance, the DNA is divided into topological domains that are delineated...... of torsionally constrained DNA by free RNAP. We asked whether or not a newly synthesized RNA chain would limit transcription elongation. For this purpose we developed a method to immobilize covalently closed circular DNA to streptavidin-coated beads via a peptide nucleic acid (PNA)-biotin conjugate in principle...... constrained. We conclude that transcription of a natural bacterial gene may proceed with high efficiency despite the fact that newly synthesized RNA is entangled around the template in the narrow confines of torsionally constrained supercoiled DNA....

Linking Core Promoter Classes to Circadian Transcription.

Directory of Open Access Journals (Sweden)

Pål O Westermark

2016-08-01

Full Text Available Circadian rhythms in transcription are generated by rhythmic abundances and DNA binding activities of transcription factors. Propagation of rhythms to transcriptional initiation involves the core promoter, its chromatin state, and the basal transcription machinery. Here, I characterize core promoters and chromatin states of genes transcribed in a circadian manner in mouse liver and in Drosophila. It is shown that the core promoter is a critical determinant of circadian mRNA expression in both species. A distinct core promoter class, strong circadian promoters (SCPs, is identified in mouse liver but not Drosophila. SCPs are defined by specific core promoter features, and are shown to drive circadian transcriptional activities with both high averages and high amplitudes. Data analysis and mathematical modeling further provided evidence for rhythmic regulation of both polymerase II recruitment and pause release at SCPs. The analysis provides a comprehensive and systematic view of core promoters and their link to circadian mRNA expression in mouse and Drosophila, and thus reveals a crucial role for the core promoter in regulated, dynamic transcription.

African Journal of Biotechnology Vol

African Journals Online (AJOL)

DR TONUKARI NYEROVWO

2011-01-10

Jan 10, 2011 ... reverse-transcription polymerase chain reaction; CTAB, cetyl trimethyl ammonium .... Shanghai Sangon Biological Engineering Technology & Services. Co., Ltd. ..... tolerance in harvested banana fruit. Postharvest Biol.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

Science.gov (United States)

Calderwood, Stuart K

2016-05-26

Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

DEFF Research Database (Denmark)

Chen, Yun; Pai, Athma A; Herudek, Jan

2016-01-01

Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...

Modelling the CDK-dependent transcription cycle in fission yeast.

Science.gov (United States)

Sansó, Miriam; Fisher, Robert P

2013-12-01

CDKs (cyclin-dependent kinases) ensure directionality and fidelity of the eukaryotic cell division cycle. In a similar fashion, the transcription cycle is governed by a conserved subfamily of CDKs that phosphorylate Pol II (RNA polymerase II) and other substrates. A genetic model organism, the fission yeast Schizosaccharomyces pombe, has yielded robust models of cell-cycle control, applicable to higher eukaryotes. From a similar approach combining classical and chemical genetics, fundamental principles of transcriptional regulation by CDKs are now emerging. In the present paper, we review the current knowledge of each transcriptional CDK with respect to its substrate specificity, function in transcription and effects on chromatin modifications, highlighting the important roles of CDKs in ensuring quantity and quality control over gene expression in eukaryotes.

Correlation between quantitative and semiquantitative parameters in DCE-MRI with a blood pool agent in rectal cancer: can semiquantitative parameters be used as a surrogate for quantitative parameters?

Science.gov (United States)

Dijkhoff, Rebecca A P; Maas, Monique; Martens, Milou H; Papanikolaou, Nikolaos; Lambregts, Doenja M J; Beets, Geerard L; Beets-Tan, Regina G H

2017-05-01

The aim of this study was to assess correlation between quantitative and semiquantitative parameters in dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) in rectal cancer patients, both in a primary staging and restaging setting. Nineteen patients were included with DCE-MRI before and/or after neoadjuvant therapy. DCE-MRI was performed with gadofosveset trisodium (Ablavar ® , Lantheus Medical Imaging, North Billerica, Massachusetts, USA). Regions of interest were placed in the tumor and quantitative parameters were extracted with Olea Sphere 2.2 software permeability module using the extended Tofts model. Semiquantitative parameters were calculated on a pixel-by-pixel basis. Spearman rank correlation tests were used for assessment of correlation between parameters. A p value ≤0.05 was considered statistically significant. Strong positive correlations were found between mean peak enhancement and mean K trans : 0.79 (all patients, prectal cancer. Peak enhancement correlates strongly with K trans and wash-in showed strong correlation with V p and K ep . These parameters have been reported to predict tumor aggressiveness and response in rectal cancer. Therefore, semiquantitative analyses might be a surrogate for quantitative analyses.

Identification of Suitable Reference Genes for Investigating Gene Expression in Anterior Cruciate Ligament Injury by Using Reverse Transcription-Quantitative PCR.

Directory of Open Access Journals (Sweden)

Mariana Ferreira Leal

Full Text Available The anterior cruciate ligament (ACL is one of the most frequently injured structures during high-impact sporting activities. Gene expression analysis may be a useful tool for understanding ACL tears and healing failure. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR has emerged as an effective method for such studies. However, this technique requires the use of suitable reference genes for data normalization. Here, we evaluated the suitability of six reference genes (18S, ACTB, B2M, GAPDH, HPRT1, and TBP by using ACL samples of 39 individuals with ACL tears (20 with isolated ACL tears and 19 with ACL tear and combined meniscal injury and of 13 controls. The stability of the candidate reference genes was determined by using the NormFinder, geNorm, BestKeeper DataAssist, and RefFinder software packages and the comparative ΔCt method. ACTB was the best single reference gene and ACTB+TBP was the best gene pair. The GenEx software showed that the accumulated standard deviation is reduced when a larger number of reference genes is used for gene expression normalization. However, the use of a single reference gene may not be suitable. To identify the optimal combination of reference genes, we evaluated the expression of FN1 and PLOD1. We observed that at least 3 reference genes should be used. ACTB+HPRT1+18S is the best trio for the analyses involving isolated ACL tears and controls. Conversely, ACTB+TBP+18S is the best trio for the analyses involving (1 injured ACL tears and controls, and (2 ACL tears of patients with meniscal tears and controls. Therefore, if the gene expression study aims to compare non-injured ACL, isolated ACL tears and ACL tears from patients with meniscal tear as three independent groups ACTB+TBP+18S+HPRT1 should be used. In conclusion, 3 or more genes should be used as reference genes for analysis of ACL samples of individuals with and without ACL tears.

Aromatase inhibitor treatment limits progression of peritoneal endometriosis in baboons.

Science.gov (United States)

Langoi, David; Pavone, Mary Ellen; Gurates, Bilgin; Chai, Daniel; Fazleabas, Asgerally; Bulun, Serdar E

2013-03-01

To determine the effect of inhibiting aromatase activity on endometrial lesion growth and aromatase expression in a baboon model of induced endometriosis. Prospective study. Primate research institute. Sixteen olive baboons. Sixteen olive baboons with induced endometriosis were examined with laparoscopy 10 months after disease inoculation. Animals in group 1 (n = 10) were treated with 1.25 mg/d of the aromatase inhibitor (AI) letrozole, and animals in group 2 (n = 6) were given a placebo for a total of 6 months. Total number of endometriotic lesions, morphology, and volume of lesions, as well as semiquantitative reverse transcription-polymerase chain reaction and quantitative polymerase chain reaction for levels of aromatase cytochrome messenger RNA were measured. Ovarian volumes were evaluated before treatment initiation and every 2 months during the study. Treatment of group 1 animals with an AI significantly decreased lesion volume from baseline measurements, whereas the placebo-treated animals showed an increase in lesion volume. Aromatase messenger RNA levels in lesions in the AI-treated animals were significantly lower compared with the placebo-treated animals. Ovarian volumes were significantly increased at 6 months of AI treatment compared with pretreatment volumes. These findings suggest that suppression of aromatase cytochrome P450 may inhibit the in vivo growth of endometriotic lesions in baboons. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Architecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and mass spectrometry

DEFF Research Database (Denmark)

Chen, Zhuo Angel; Jawhari, Anass; Fischer, Lutz

2010-01-01

Higher-order multi-protein complexes such as RNA polymerase II (Pol II) complexes with transcription initiation factors are often not amenable to X-ray structure determination. Here, we show that protein cross-linking coupled to mass spectrometry (MS) has now sufficiently advanced as a tool to ex...

How to switch the motor on: RNA polymerase initiation steps at the single-molecule level

NARCIS (Netherlands)

Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.

RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes

Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

Science.gov (United States)

Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

2010-10-01

The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

Nature of the Nucleosomal Barrier to RNA Polymerase II | Center for Cancer Research

Science.gov (United States)

In the cell, RNA polymerase II (pol II) efficiently transcribes DNA packaged into nucleosomes, but in vitro encounters with the nucleosomes induce catalytic inactivation (arrest) of the pol II core enzyme. To determine potential mechanisms making nucleosomes transparent to transcription in vivo, we analyzed the nature of the nucleosome-induced arrest. We found that the arrests

Quantification of organellar DNA and RNA using real-time PCR.

Science.gov (United States)

Weihe, Andreas

2014-01-01

Quantitative (real-time) polymerase chain reaction (PCR) allows the measurement of relative organellar gene copy numbers as well as transcript abundance of individual mitochondrial or plastidial genes. Requiring only minute amounts of total DNA or RNA, the described method can replace traditional analyses like Southern or Northern hybridization which require large amounts of organellar nucleic acids and usually provide only semiquantitative data. Here we describe prerequisites, reaction conditions, and data analysis principles, which should be applicable for a wide range of plant species and experimental situations where comparative and precise determination of gene copy numbers or transcript abundance is requested. Sequences of amplification primers for qPCR of organellar genes from Arabidopsis are provided.

Plant Mediator complex and its critical functions in transcription regulation.

Science.gov (United States)

Yang, Yan; Li, Ling; Qu, Li-Jia

2016-02-01

The Mediator complex is an important component of the eukaryotic transcriptional machinery. As an essential link between transcription factors and RNA polymerase II, the Mediator complex transduces diverse signals to genes involved in different pathways. The plant Mediator complex was recently purified and comprises conserved and specific subunits. It functions in concert with transcription factors to modulate various responses. In this review, we summarize the recent advances in understanding the plant Mediator complex and its diverse roles in plant growth, development, defense, non-coding RNA production, response to abiotic stresses, flowering, genomic stability and metabolic homeostasis. In addition, the transcription factors interacting with the Mediator complex are also highlighted. © 2015 Institute of Botany, Chinese Academy of Sciences.

Inhibition of transcription of abscisic acid in relation to the binding with DNA

International Nuclear Information System (INIS)

Basak, Sukla; Basu, P.S.; Biswas, B.B.

1976-01-01

Abscisic acid (ABA), a plant substance inhibits RNA synthesis in vivo and vitro. In vitro inhibition by ABA has been demonstrated in isolated RNA polymerase system from coconut endosperm chromatin. This inhibition can be partly reversible with indole acetic acid-receptor protein complex if added in the system. To find the mechanism of inhibition of transcription by ABA, it has been found that ABA (10 -4 -10 -5 M) can bind with DNA and can prevent strand separation. This binding increases the Tm value. ABA binds with DNA but not with RNA. Moreover, ABA can equally bind and prevent denaturation of calfthymus DNA and E. coli DNA. pH optimum for this binding is 8.0. The bound complex is resistant to alkali and alcohol but susceptible to acid below pH 5.0. It has further been demonstrated that free aBA at this pH is changed to another component which has tentatively been identified as lactone form of ABA. (author)

Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

Science.gov (United States)

Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

2017-11-01

Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

An inquiry into the semiquantitative parameters of striatal dopamine receptor imaging

International Nuclear Information System (INIS)

Cao Guoxiang; Tan Tianzhi; Kuang Anren; Liang Zhenglu

1998-01-01

Purpose: To inquire into the optimal striatal reference region for nonspecific IBZM uptake in brain dopamine receptor imaging. Methods: Using in vivo data from rats, the authors compared the results of 125 I-iodobenzamide ( 125 I-IBZM) striatal specific binding that were respectively obtained taking cerebellum and frontal cortex as striatal reference region of nonspecific uptake of ligand. Results: Radioiodination labelled IBZM bound stereoselectively and reversibly to striatal D2 receptors. Frontal cortex and cerebellum showed rapid uptake and rapid washout of ligand. When cerebellar uptake was used as a reference of nonspecific uptake in striatum, IBZM saturation could not be demonstrated. But when the frontal cortex was used as reference region, saturation could be demonstrated with B max = 44 pmol/g striatum tissue. The percentage of haloperidol replacement and the percentage of uptake difference between striatum and other brain regions which were derived from competitive inhibition experiments with a large does of spiperone or haloperidol, suggested that the cerebellar uptake underestimated nonspecific uptake in the striatum while frontal cortex was an appropriate reference region for nonspecific uptake of ligand in striatum. Conclusions: For the calculation of specific IBZM binding and other semiquantitative parameters of striatal dopamine D2 receptor imaging, frontal cortex would be the nonspecific reference region of choice

Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

Energy Technology Data Exchange (ETDEWEB)

Tucker, James D., E-mail: jtucker@biology.biosci.wayne.edu [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Joiner, Michael C. [Department of Radiation Oncology, Wayne State University, Detroit, Michigan (United States); Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V. [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Chinkhota, Chantelle N.; Smolinski, Joseph M. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States); Divine, George W. [Department of Public Health Sciences, Henry Ford Hospital, Detroit, Michigan (United States); Auner, Gregory W. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States)

2014-03-15

Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

Vitamin K2 downregulates the expression of fibroblast growth factor receptor 3 in human hepatocellular carcinoma cells.

Science.gov (United States)

Cao, Ke; Liu, Weidong; Nakamura, Hideji; Enomoto, Hirayuki; Yamamoto, Teruhisa; Saito, Masaki; Imanishi, Hiroyasu; Shimomura, Soji; Cao, Peiguo; Nishiguchi, Shuhei

2009-11-01

Vitamin K2 exerts an antitumor activity on human hepatocellular carcinoma (HCC), however, its inhibitory mechanism has not yet been clarified. This study was designed to identify the attractive target molecule of vitamin K2 and shed some light on its effects on fibroblast growth factor receptor (FGFR)3 in HCC cells. The changes in the gene expression of HuH-7 after vitamin K2 treatment were evaluated by a DNA chip analysis. The mRNA and protein levels of FGFR were evaluated by semiquantitative reverse transcription polymerase chain reaction (RT-PCR), real-time PCR and western blot analysis. The promoter activity of the FGFR3 gene was measured by a dual-luciferase assay. The DNA chip analysis revealed different inhibitory rates of gene expression of FGFR3 (60.6%) and FGFR1 (19.4%) after vitamin K2 treatment. Vitamin K2 suppresses the proliferation of HuH-7 in a dose-dependent manner and its inhibitory rate reached approximately 61.8% at the dose of 30 microM. FGFR3 mRNA was significantly reduced based on semiquantitative RT-PCR and decreased 61.5% by a real-time PCR method after vitamin K2 treatment, but FGFR1 mRNA was not. The level of FGFR3 protein was also reduced by vitamin K2 treatment. The luciferase assay demonstrated that vitamin K2 significantly suppressed the promoter activity of FGFR3. Furthermore, the FGFR3-ERK1/2 signaling pathway was suppressed by vitamin K2 treatment. These findings suggest that vitamin K2 may suppress the proliferation of HCC cells through the downregulation of the FGFR3 expression. The transcriptional suppression of FGFR3 may be a novel mechanism of the vitamin K2 action for HCC cells.

Interaction of sigma 70 with Escherichia coli RNA polymerase core enzyme studied by surface plasmon resonance.

Science.gov (United States)

Ferguson, A L; Hughes, A D; Tufail, U; Baumann, C G; Scott, D J; Hoggett, J G

2000-09-22

The interaction between the core form of bacterial RNA polymerases and sigma factors is essential for specific promoter recognition, and for coordinating the expression of different sets of genes in response to varying cellular needs. The interaction between Escherichia coli core RNA polymerase and sigma 70 has been investigated by surface plasmon resonance. The His-tagged form of sigma 70 factor was immobilised on a Ni2+-NTA chip for monitoring its interaction with core polymerase. The binding constant for the interaction was found to be 1.9x10(-7) M, and the dissociation rate constant for release of sigma from core, in the absence of DNA or transcription, was 4x10(-3) s(-1), corresponding to a half-life of about 200 s.

Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

Science.gov (United States)

Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

2018-01-11

The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Isolation of differentially expressed sex genes in garden asparagus using suppression subtractive hybridization.

Science.gov (United States)

Deng, Chuan-liang; Wang, Ning-na; Li, Shu-fen; Dong, Tian-yu; Zhao, Xin-peng; Wang, Shao-jing; Gao, Wu-jun; Lu, Long-dou

2015-09-01

Garden asparagus (Asparagus officinalis L.) is a dioecious species whose male and female flowers are found in separate unisexual individuals. A region called the M-locus, located on a pair of homomorphic sex chromosomes, controls sexual dimorphism in asparagus. To date, no sex determining gene has been isolated from asparagus. To identify more genes involved in flower development in asparagus, subtractive hybridization library of male flowers in asparagus was constructed by suppression subtraction hybridization. A total of 107 expressed sequence tags (ESTs) were identified. BLASTX analysis showed that the library contained several genes that could be related to flower development. The expression patterns of seven selected genes believed to be involved in the development of asparagus male flower were further analyzed by semi-quantitative or real-time reverse-transcription polymerase chain reaction (RT-PCR). Results showed that AOEST4-5, AOEST12-40, and AOEST13-38 were strongly expressed in the male flower stage, whereas no transcript level of AOEST13-38 was detected in the female flower stage. The expression levels of AOEST13-87, AOEST13-92, AOEST13-40, and AOEST18-87 in the male flower stage were also higher than those in the female flower stage, although these transcripts were also expressed in other tissues. The identified genes can provide a strong starting point for further studies on the underlying molecular differences between the male and female flowers of asparagus.

Transcription of minute virus of mice, an autonomous parvovirus, may be regulated by attenuation

International Nuclear Information System (INIS)

Ben-Asher, E.; Aloni, Y.

1984-01-01

To characterize the transcriptional organization and regulation of minute virus of mice, an autonomous parvovirus, viral transcriptional complexes were isolated and cleaved with restriction enzymes. The in vivo preinitiated nascent RNA was elongated in vitro in the presence of [alpha- 32 P]UTP to generate runoff transcripts. The lengths of the runoff transcripts were analyzed by gel electrophoresis under denaturing conditions. On the basis of the map locations of the restriction sites and the lengths of the runoff transcripts, the in vivo initiation sites were determined. Two major initiation sites having similar activities were thus identified at residues 201 +/- 5 and 2005 +/- 5; both of them were preceded by a TATAA sequence. When uncleaved viral transcriptional complexes or isolated nuclei were incubated in vitro in the presence of [alpha- 32 P]UTP or [alpha- 32 P]CTP, they synthesized labeled RNA that, as determined by polyacrylamide gel electrophoresis, contained a major band of 142 nucleotides. The RNA of the major band was mapped between the initiation site at residue 201 +/- 5 and residue 342. We noticed the potential of forming two mutually exclusive stem-and-loop structures in the 142-nucleotide RNA; one of them is followed by a string of uridylic acid residues typical of a procaryotic transcription termination signal. We propose that, as in the transcription of simian virus 40, RNA transcription in minute virus of mice may be regulated by attenuation and may involve eucaryotic polymerase B, which can respond to a transcription termination signal similar to that of the procaryotic polymerase

Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NFκB binding sites

Energy Technology Data Exchange (ETDEWEB)

Bonin, Camila P., E-mail: mila_bonin@yahoo.com.br [Department of Immunology, Institute of Biomedical Sciences, University of São Paulo, São Paulo 05508-900 (Brazil); Baccarin, Raquel Y.A., E-mail: baccarin@usp.br [Department of Clinics, School of Veterinary Medicine, University of São Paulo, São Paulo 05508-900 (Brazil); Nostell, Katarina, E-mail: katarina.nostell@slu.se [Department of Clinical Sciences, Swedish University of Agricultural Sciences, Box 7054, 750 07 Uppsala (Sweden); Nahum, Laila A., E-mail: laila@nahum.com.br [Centro de Pesquisas René Rachou, Fundação Oswaldo Cruz, Belo Horizonte 30190-002 (Brazil); Faculdade Infórium de Tecnologia, Belo Horizonte 30130-180 (Brazil); Fossum, Caroline, E-mail: caroline.fossum@bvf.slu.se [Department of Biomedicine and Veterinary Public Health, Section for Immunology, Swedish University of Agricultural Sciences, BMC, Box 588, SE 751 23 Uppsala (Sweden); Camargo, Maristela M. de, E-mail: mmcamar@usp.br [Department of Immunology, Institute of Biomedical Sciences, University of São Paulo, São Paulo 05508-900 (Brazil)

2013-03-08

Highlights: ► Chimpanzees, horses and humans have regions of similarity on TLR4 and MD2 promoters. ► Rodents have few regions of similarity on TLR4 promoter when compared to primates. ► Conserved NFkB binding sites were found in the promoters of TLR4 and MD2. ► LPS-induced inhibition of TLR4 transcription is reversed by dexamethasone. ► LPS-induced transcription of MD2 is inhibited by dexamethasone. -- Abstract: Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explaining these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NFκB) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2.

Isolation and characterization of StERF transcription factor genes from potato (Solanum tuberosum L.).

Science.gov (United States)

Wang, Zemin; Zhang, Ning; Zhou, Xiangyan; Fan, Qiang; Si, Huaijun; Wang, Di

2015-04-01

Ethylene response factor (ERF) is a major subfamily of the AP2/ERF family and plays significant roles in the regulation of abiotic- and biotic-stress responses. ERF proteins can interact with the GCC-box cis-element and then initiate a transcriptional cascade activating downstream ethylene response and enhancing plant stress tolerance. In this research, we cloned five StERF genes from potato (Solanum tuberosum L.). The expressional analysis of StERF genes revealed that they showed tissue- or organ-specific expression patterns and the expression levels in leaf, stem, root, flower, and tuber were different. The assays of quantitative real-time polymerase chain reaction (qRT-PCR) and the reverse transcription-PCR (RT-PCR) showed that the expression of five StERF genes was regulated by ethephon, methyl jasmonate (MeJA), salt and drought stress. The result from the yeast one-hybrid experiment showed that five StERFs had trans-activation activity and could specifically bind to the GCC-box cis-elements. The StERFs responded to abiotic factors and hormones suggested that they possibly had diverse roles in stress and hormone regulation of potato. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

International Nuclear Information System (INIS)

Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

1990-01-01

Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

Directory of Open Access Journals (Sweden)

Haifeng eChen

2015-11-01

Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

International Nuclear Information System (INIS)

Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

2017-01-01

Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)

Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

Directory of Open Access Journals (Sweden)

Prasenjit Saha

Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

Science.gov (United States)

Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

2014-07-15

In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

Directory of Open Access Journals (Sweden)

Shyamala G

2008-01-01

Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography.

Science.gov (United States)

Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

2016-08-22

Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same 'double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs.

Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

Science.gov (United States)

Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

2011-05-17

Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.