Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
The level of embryonation influences detection of Ostertagia ostertagi eggs by semi-quantitative PCR
DEFF Research Database (Denmark)
Drag, Markus; Höglund, Johan; Nejsum, Peter
2016-01-01
The Internal Transcribed Spacer 2 (ITS2) is a candidate diagnostic marker of the pathogenic cattle nematode Ostertagia ostertagi. The aims of this study were: (i) to document and quantify how the development of O. ostertagi eggs affects ITS2 copies under different storage conditions, and (ii......) to suggest optimal storage conditions for faecal samples in a diagnostic pipeline that involves detection and semi-quantification by real-time semi-quantitative polymerase chain reaction (qPCR). Eggs of Ostertagia ostertagi were obtained from fresh faeces and stored at 4 °C or 25 °C under aerobic...
Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu
2016-04-01
A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi
2012-07-28
To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
International Nuclear Information System (INIS)
Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi
2013-01-01
In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Directory of Open Access Journals (Sweden)
Maria Frølund
Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn
2013-06-01
A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Directory of Open Access Journals (Sweden)
Lai-yu Kwok
Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
DEFF Research Database (Denmark)
Guil-Luna, S.; Stenvang, Jan; Brünner, Nils
2014-01-01
and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Directory of Open Access Journals (Sweden)
Maria Cesarina Abete
2013-04-01
Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Directory of Open Access Journals (Sweden)
Boissière-Michot Florence
2009-04-01
Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.
Quantitative sexing (Q-Sexing) and relative quantitative sexing (RQ ...
African Journals Online (AJOL)
samer
Key words: Polymerase chain reaction (PCR), quantitative real time polymerase chain reaction (qPCR), quantitative sexing, Siberian tiger. INTRODUCTION. Animal molecular sexing .... 43:3-12. Ellegren H (1996). First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds. Proc.
DEFF Research Database (Denmark)
Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias
2015-01-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Soupé-Gilbert, Marie-Estelle; Bierque, Emilie; Geroult, Sophie; Teurlai, Magali; Goarant, Cyrille
2017-10-01
Rodents are the main reservoir animals of leptospirosis. In this study, we characterized and quantified the urinary excretion dynamics of Leptospira by Mus musculus infected with 2 × 10 8 virulent Leptospira borgpetersenii serogroup Ballum. Each micturition was collected separately in metabolic cages, at 12 time points from 7 to 117 days post-infection (dpi). We detected Leptospira in all urine samples collected (up to 8 per time point per mouse) proving that Leptospira excretion is continuous with ca. 90% live L. borgpetersenii Ballum, revealed by viability quantitative polymerase chain reaction. Microscopic visualization by Live/Dead fluorescence confirmed this high proportion of live bacteria and demonstrated that L. borgpetersenii Ballum are excreted, at least partly, as bacterial aggregates. We observed two distinct phases in the excretion dynamics, first an increase in Leptospira concentration shed in the urine between 7 and 63 dpi followed by a plateau phase from 63 dpi onward, with up to 3 × 10 7 Leptospira per mL of urine. These two phases seem to correspond to progressive colonization of renal tubules first, then to stable cell survival and maintenance in kidneys. Therefore, chronically infected adult mice are able to contaminate the environment via urine at each micturition event throughout their lifetime. Because Leptospira excretion reached its maximum 2 months after infection, older rodents have a greater risk of contaminating their surrounding environment.
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F
2015-10-01
We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Directory of Open Access Journals (Sweden)
Eiichi Uchio
2010-11-01
Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Directory of Open Access Journals (Sweden)
Hamed Rezaeejam
2015-01-01
Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.
Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin
2015-10-01
Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.
Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M
2014-12-10
A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.
Ayatollahi, Hossein; Fani, Azar; Ghayoor Karimiani, Ehsan; Homaee, Fateme; Shajiei, Arezoo; Sheikh, Maryam; Shakeri, Sepideh; Shams, Seyyede Fatemeh
2017-01-01
The assessment of human epidermal growth factor receptor 2 (HER2) status has become of great importance in the diagnosis of breast cancer. The aim of this study was to investigate the diagnostic value of quantitative Polymerase Chain Reaction (qPCR) and Chromogenic In Situ Hybridization (CISH) to assess HER2 status of biopsy specimens. To elucidate the status of HER2 gene amplification, biopsies of breast carcinoma from 120 patients with 2+ IHC status were analyzed by qPCR and CISH. The results of the two experiments were compared, and it was depicted that the concordance rate between CISH and qPCR assays was 88.1%.The quantification of HER2 gene with CISH and qPCR showed that there was a significant correlation (p value= 0.0001 and r= 0.808). The results of this research support the idea that qPCR is a precise and reproducible technique, which can be employed as a supplementary method to evaluate HER2 status.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
First hitting probabilities for semi markov chains and estimation
DEFF Research Database (Denmark)
Georgiadis, Stylianos
2017-01-01
We first consider a stochastic system described by an absorbing semi-Markov chain with finite state space and we introduce the absorption probability to a class of recurrent states. Afterwards, we study the first hitting probability to a subset of states for an irreducible semi-Markov chain...
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A
2012-08-15
Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.
Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves
2008-05-15
Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae
2009-03-01
Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R
2013-07-10
The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process
Treff, Nathan R; Scott, Richard T
2013-03-15
Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Hofmann, Joerg; Frenzel, Katrin; Minh, Bui Q; von Haeseler, Arndt; Edelmann, Anke; Ross, Stefan R; Berg, Thomas; Krüger, Detlev H; Meisel, Helga
2010-06-01
Hepatitis D virus (HDV) infection is an important etiologic agent of fulminant hepatitis and may aggravate the clinical course of chronic hepatitis B infection resulting in cirrhosis and liver failure. This report describes the establishment of a real-time reverse transcriptase polymerase chain reaction method that allows the quantitative detection of HDV-1 and HDV-3 with a sensitivity in a linear range of 2 x 10(3) to 10(8) copies/mL. Additionally, the new assay provides the opportunity to distinguish HDV-1 from HDV-3 by a subsequent melting curve analysis, an important option because these HDV types are highly associated with severe clinical outcome. The results of the melting curve analysis of 42 HDV sequences obtained in this study and the phylogenetic analysis based on 139 full-length sequences from GenBank were consistent and showed that all sequences described here cluster within the HDV-1 clade. Therefore, this assay is useful for monitoring of antiviral treatment and molecular epidemiologic studies of HDV distribution. Copyright 2010 Elsevier Inc. All rights reserved.
Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y
2010-12-01
A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.
1993-01-01
OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R
2007-09-01
To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.
Directory of Open Access Journals (Sweden)
Jelena V Jovanovic
2011-10-01
Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Semi-quantitative evaluation of gallium-67 scintigraphy in lupus nephritis
International Nuclear Information System (INIS)
Lin Wanyu; Hsieh Jihfang; Tsai Shihchuan; Lan Joungliang; Cheng Kaiyuan; Wang Shyhjen
2000-01-01
Within nuclear medicine there is a trend towards quantitative analysis. Gallium renal scan has been reported to be useful in monitoring the disease activity of lupus nephritis. However, only visual interpretation using a four-grade scale has been performed in previous studies, and this method is not sensitive enough for follow-up. In this study, we developed a semi-quantitative method for gallium renal scintigraphy to find a potential parameter for the evaluation of lupus nephritis. Forty-eight patients with lupus nephritis underwent renal biopsy to determine World Health Organization classification, activity index (AI) and chronicity index (CI). A delayed 48-h gallium scan was also performed and interpreted by visual and semi-quantitative methods. For semi-quantitative analysis of the gallium uptake in both kidneys, regions of interest (ROIs) were drawn over both kidneys, the right forearm and the adjacent spine. The uptake ratios between these ROIs were calculated and expressed as the ''kidney/spine ratio (K/S ratio)'' or the ''kidney/arm ratio (K/A ratio)''. Spearman's rank correlation test and Mann-Whitney U test were used for statistical analysis. Our data showed a good correlation between the semi-quantitative gallium scan and the results of visual interpretation. K/S ratios showed a better correlation with AI than did K/A ratios. Furthermore, the left K/S ratio displayed a better correlation with AI than did the right K/S ratio. In contrast, CI did not correlate well with the results of semi-quantitative gallium scan. In conclusion, semi-quantitative gallium renal scan is easy to perform and shows a good correlation with the results of visual interpretation and renal biopsy. The left K/S ratio from semi-quantitative renal gallium scintigraphy displays the best correlation with AI and is a useful parameter in evaluating the disease activity in lupus nephritis. (orig.)
Semi-arid development: competitiveness factors in biodiesel productive chain
Breno Barros Telles do Carmo; Dmontier Pinheiro Aragão; Heráclito Lopes Jaguaribe Pontes; Bruno Magalhães Ribeiro; Marcos Ronaldo Albertin
2009-01-01
The new global market competitiveness considerer the competition between productive chains (PC) or supply chains, not just between enterprises. In this case, it can be observed collaboration and cooperation enterprises that dispute with others productives chain. The PC competitiveness can be impaired if is subject by inhibitors factors, that can impairer the performance. This paper analyses these competitiveness factors inhibitors in biodiesel productive chain (CPB) in semi-arid area: exporte...
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A
2015-12-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
UVB DNA dosimeters analyzed by polymerase chain reactors
International Nuclear Information System (INIS)
Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL
1997-01-01
Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
Semi-quantitative evaluation of gallium-67 scintigraphy in lupus nephritis
Energy Technology Data Exchange (ETDEWEB)
Lin Wanyu [Dept. of Nuclear Medicine, Taichung Veterans General Hospital, Taichung (Taiwan); Dept. of Radiological Technology, Chung-Tai College of Medical Technology, Taichung (Taiwan); Hsieh Jihfang [Section of Nuclear Medicine, Chi-Mei Foundation Hospital, Yunk Kang City, Tainan (Taiwan); Tsai Shihchuan [Dept. of Nuclear Medicine, Show Chwan Memorial Hospital, Changhua (Taiwan); Lan Joungliang [Dept. of Internal Medicine, Taichung Veterans General Hospital, Taichung (Taiwan); Cheng Kaiyuan [Dept. of Radiological Technology, Chung-Tai College of Medical Technology, Taichung (Taiwan); Wang Shyhjen [Dept. of Nuclear Medicine, Taichung Veterans General Hospital, Taichung (Taiwan)
2000-11-01
Within nuclear medicine there is a trend towards quantitative analysis. Gallium renal scan has been reported to be useful in monitoring the disease activity of lupus nephritis. However, only visual interpretation using a four-grade scale has been performed in previous studies, and this method is not sensitive enough for follow-up. In this study, we developed a semi-quantitative method for gallium renal scintigraphy to find a potential parameter for the evaluation of lupus nephritis. Forty-eight patients with lupus nephritis underwent renal biopsy to determine World Health Organization classification, activity index (AI) and chronicity index (CI). A delayed 48-h gallium scan was also performed and interpreted by visual and semi-quantitative methods. For semi-quantitative analysis of the gallium uptake in both kidneys, regions of interest (ROIs) were drawn over both kidneys, the right forearm and the adjacent spine. The uptake ratios between these ROIs were calculated and expressed as the ''kidney/spine ratio (K/S ratio)'' or the ''kidney/arm ratio (K/A ratio)''. Spearman's rank correlation test and Mann-Whitney U test were used for statistical analysis. Our data showed a good correlation between the semi-quantitative gallium scan and the results of visual interpretation. K/S ratios showed a better correlation with AI than did K/A ratios. Furthermore, the left K/S ratio displayed a better correlation with AI than did the right K/S ratio. In contrast, CI did not correlate well with the results of semi-quantitative gallium scan. In conclusion, semi-quantitative gallium renal scan is easy to perform and shows a good correlation with the results of visual interpretation and renal biopsy. The left K/S ratio from semi-quantitative renal gallium scintigraphy displays the best correlation with AI and is a useful parameter in evaluating the disease activity in lupus nephritis. (orig.)
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1991-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1993-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K
2014-01-01
Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk
Directory of Open Access Journals (Sweden)
V.K. Jain
2010-02-01
Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.
Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.
2011-01-01
Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.
Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F
2015-01-01
Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
On the dynamics of semi-rigid chains
International Nuclear Information System (INIS)
Rodriguez Talavera, R.; Alexander-Katz, R.
1993-01-01
The dynamics of a semi-rigid polymer chain is studied. The force structure of the chain is derived from the statistics generated through a Wiener measure whose end-to-end distance is that of a Kratky-Porod chain. Additionally, the dissipative terms in the equation of motion will contain, besides the usual Stokes' term, a non-local friction term (internal viscosity) which is quadratic in the normal mode q, in order to take into account the resistance to changes in curvature. The analytical shape of this term is the same as the one introduced by Edwards and Freed. We show that this model of stiff chain reproduces both asymptotic limits: the flexible and the rod limits for the elastic moduli. A form for the internal viscosity coefficient is deduced from a phenomenological approach, which has the right solvent viscosity dependency as obtained by MacInnes. (Author)
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Jung, Woo-Sun; Yang, Il-Hyung; Lim, Won Hee; Baek, Seung-Hak; Kim, Tae-Woo; Ahn, Sug-Joon
2015-12-01
To analyze in vivo mutans streptococci (MS) adhesion to self-ligating ceramic brackets [Clarity-SL (CSL) and Clippy-C (CC)] and the relationships between bacterial adhesion and oral hygiene indices. Four central incisor brackets from the maxilla and mandible were collected from 40 patients (20 patients per each bracket type) at debonding immediately after plaque and gingival indices were measured. Adhesions of Streptococcus mutans, S. sobrinus, and total bacteria were quantitatively determined using real-time polymerase chain reaction after genomic DNA was extracted. Factorial analysis of variance was used to analyze bacterial adhesion to the brackets with respect to the bracket type and jaw position. Correlation coefficients were calculated to determine the relationships of bacterial adhesion to oral hygiene indices. Adhesion of total bacteria and S. mutans to CSL was higher than that to CC (P brackets was higher than that to the maxillary ones (P brackets were higher than that in the mandibular ones (P brackets and jaw positions. Interestingly, no significant relationships were found between bacterial adhesions and oral hygiene indices. Complex bracket configurations may significantly influence bacterial adhesion to orthodontic brackets. Further in vivo study using bracket raw materials will help to define the relationships between bacteria adhesion and enamel demineralization. Because oral hygiene indices were not significantly correlated with adhesions of MS to self-ligating ceramic brackets, careful examinations around the brackets should be needed to prevent enamel demineralization, regardless of oral hygiene status. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H
2017-06-20
We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.
Shin, Yun-Kyung; Nam, Ki-Woong; Park, Kwan Ha; Yoon, Jong-Man; Park, Kyung-Il
2014-11-26
The kinetoplastid parasite, Azumiobodo hoyamushi, is the causative agent of soft tunic syndrome (STS) in ascidians and leads to their mass mortality in Korean waters. This study was conducted to quantify A. hoyamushi density during the development of STS in the tunics of ascidians (Halocynthia roretzi) using real-time polymerase chain reaction (qPCR). The infection intensity of A. hoyamushi, as measured by qPCR, varied depending on the part of the tunic analyzed, as well as the stage of STS development. The highest infection intensity was recorded in the tunics of the siphons. The infection intensity of A. hoyamushi in the siphons was only 2.9 cell/tunic (area, 0.25 cm(2)) or 106.0 cell/gram tunic (GT) in the early phase of STS, but this value increased dramatically to 16,066 cells/tunic (0.25 cm(2)) or 617,004 cell/GT at the time of death. The number of A. hoyamushi parasites increased gradually and their distribution spread from the siphons to the other parts of the tunics. qPCR enabled the quantitation of A. hoyamushi and the results revealed that parasite density increased as STS progressed. In addition, our results suggested that the siphons might function as the portal of entry for A. hoyamushi during infection.
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
Global scaling for semi-quantitative analysis in FP-CIT SPECT.
Kupitz, D; Apostolova, I; Lange, C; Ulrich, G; Amthauer, H; Brenner, W; Buchert, R
2014-01-01
Semi-quantitative characterization of dopamine transporter availability from single photon emission computed tomography (SPECT) with 123I-ioflupane (FP-CIT) is based on uptake ratios relative to a reference region. The aim of this study was to evaluate the whole brain as reference region for semi-quantitative analysis of FP-CIT SPECT. The rationale was that this might reduce statistical noise associated with the estimation of non-displaceable FP-CIT uptake. 150 FP-CIT SPECTs were categorized as neurodegenerative or non-neurodegenerative by an expert. Semi-quantitative analysis of specific binding ratios (SBR) was performed with a custom-made tool based on the Statistical Parametric Mapping software package using predefined regions of interest (ROIs) in the anatomical space of the Montreal Neurological Institute. The following reference regions were compared: predefined ROIs for frontal and occipital lobe and whole brain (without striata, thalamus and brainstem). Tracer uptake in the reference region was characterized by the mean, median or 75th percentile of its voxel intensities. The area (AUC) under the receiver operating characteristic curve was used as performance measure. The highest AUC of 0.973 was achieved by the SBR of the putamen with the 75th percentile in the whole brain as reference. The lowest AUC for the putamen SBR of 0.937 was obtained with the mean in the frontal lobe as reference. We recommend the 75th percentile in the whole brain as reference for semi-quantitative analysis in FP-CIT SPECT. This combination provided the best agreement of the semi-quantitative analysis with visual evaluation of the SPECT images by an expert and, therefore, is appropriate to support less experienced physicians.
Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung
2012-08-01
Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; pcritical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Nishiura, T; Abe, K
1999-01-01
The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.
Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich
2015-08-01
Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
On the Total Variation Distance of Semi-Markov Chains
DEFF Research Database (Denmark)
Bacci, Giorgio; Bacci, Giovanni; Larsen, Kim Guldstrand
2015-01-01
Semi-Markov chains (SMCs) are continuous-time probabilistic transition systems where the residence time on states is governed by generic distributions on the positive real line. This paper shows the tight relation between the total variation distance on SMCs and their model checking problem over...
van Dijk, R; van Assen, M; Vliegenthart, R; de Bock, G H; van der Harst, P; Oudkerk, M
2017-11-27
Stress cardiovascular magnetic resonance (CMR) perfusion imaging is a promising modality for the evaluation of coronary artery disease (CAD) due to high spatial resolution and absence of radiation. Semi-quantitative and quantitative analysis of CMR perfusion are based on signal-intensity curves produced during the first-pass of gadolinium contrast. Multiple semi-quantitative and quantitative parameters have been introduced. Diagnostic performance of these parameters varies extensively among studies and standardized protocols are lacking. This study aims to determine the diagnostic accuracy of semi- quantitative and quantitative CMR perfusion parameters, compared to multiple reference standards. Pubmed, WebOfScience, and Embase were systematically searched using predefined criteria (3272 articles). A check for duplicates was performed (1967 articles). Eligibility and relevance of the articles was determined by two reviewers using pre-defined criteria. The primary data extraction was performed independently by two researchers with the use of a predefined template. Differences in extracted data were resolved by discussion between the two researchers. The quality of the included studies was assessed using the 'Quality Assessment of Diagnostic Accuracy Studies Tool' (QUADAS-2). True positives, false positives, true negatives, and false negatives were subtracted/calculated from the articles. The principal summary measures used to assess diagnostic accuracy were sensitivity, specificity, andarea under the receiver operating curve (AUC). Data was pooled according to analysis territory, reference standard and perfusion parameter. Twenty-two articles were eligible based on the predefined study eligibility criteria. The pooled diagnostic accuracy for segment-, territory- and patient-based analyses showed good diagnostic performance with sensitivity of 0.88, 0.82, and 0.83, specificity of 0.72, 0.83, and 0.76 and AUC of 0.90, 0.84, and 0.87, respectively. In per territory
Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.
2012-01-01
During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
International Nuclear Information System (INIS)
Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.
1990-01-01
Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
Song, Yan; Feng, Jun; Dang, Ying; Zhao, Chao; Zheng, Jie; Ruan, Litao
2017-12-01
The aim of this study was to determine the relationship between plaque echo, thickness and neovascularization in different stenosis groups using quantitative and semi-quantitative contrast-enhanced ultrasound (CEUS) in patients with carotid atherosclerosis plaque. A total of 224 plaques were divided into mild stenosis (Quantitative and semi-quantitative methods were used to assess plaque neovascularization and determine the relationship between plaque echo, thickness and neovascularization. Correlation analysis revealed no relationship of neovascularization with plaque echo in the groups using either quantitative or semi-quantitative methods. Furthermore, there was no correlation of neovascularization with plaque thickness using the semi-quantitative method. The ratio of areas under the curve (RAUC) was negatively correlated with plaque thickness (r = -0.317, p = 0.001) in the mild stenosis group. With the quartile method, plaque thickness of the mild stenosis group was divided into four groups, with significant differences between the 1.5-2.2 mm and ≥3.5 mm groups (p = 0.002), 2.3-2.8 mm and ≥3.5 mm groups (p quantitative and quantitative CEUS methods characterizing neovascularization of plaque are equivalent with respect to assessing relationships between neovascularization, echogenicity and thickness. However, the quantitative method could fail for plaque <3.5 mm because of motion artifacts. Copyright © 2017 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Directory of Open Access Journals (Sweden)
Carlos Alberto Scrideli
2001-09-01
Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Cloning and semi-quantitative expression of endochitinase ( ech42 ...
African Journals Online (AJOL)
Cloning and semi-quantitative expression of endochitinase (ech42) gene from Trichoderma spp. Pratibha Sharma, K Saravanan, R Ramesh, P Vignesh Kumar, Dinesh Singh, Manika Sharma, Monica S. Henry, Swati Deep ...
Critical appraisal of semi-quantitative analysis of 2-deoxyglucose autoradiograms
Energy Technology Data Exchange (ETDEWEB)
Kelly, P T; McCulloch, J [Glasgow Univ. (UK)
1983-06-13
Semi-quantitative analysis (e.g. optical density ratios) of (/sup 14/C)2-deoxyglucose autoradiograms is widely used in neuroscience research. The authors demonstrate that a fixed ratio of /sup 14/C-concentrations in the CNS does not yield a constant optical density ratio but is dependent upon the exposure time in the preparation of the autoradiograms and the absolute amounts of /sup 14/C from which the concentration ratio is derived. The failure of a fixed glucose utilization ratio to result in a constant optical density ratio represents a major interpretative difficulty in investigations where only semi-quantitative analysis of (/sup 14/C)2-deoxyglucose autoradiograms is undertaken.
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Artemisia desertorum Spreng; drought tolerance; mRNA differential display; RING zinc ... Semi-quantitative reverse-transcriptase-polymerase chain reaction ... College of Life Sciences, National Key Laboratory of Protein Engineering and Plant ...
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Sun, Wenjuan; Hu, Xiaolong; Liu, Jia; Zhang, Yurong; Lu, Jianzhong; Zeng, Libo
2017-10-01
In this study, the multi-walled carbon nanotubes (MWCNTs) were applied in lateral flow strips (LFS) for semi-quantitative and quantitative assays. Firstly, the solubility of MWCNTs was improved using various surfactants to enhance their biocompatibility for practical application. The dispersed MWCNTs were conjugated with the methamphetamine (MET) antibody in a non-covalent manner and then manufactured into the LFS for the quantitative detection of MET. The MWCNTs-based lateral flow assay (MWCNTs-LFA) exhibited an excellent linear relationship between the values of test line and MET when its concentration ranges from 62.5 to 1500 ng/mL. The sensitivity of the LFS was evaluated by conjugating MWCNTs with HCG antibody and the MWCNTs conjugated method is 10 times more sensitive than the one conjugated with classical colloidal gold nanoparticles. Taken together, our data demonstrate that MWCNTs-LFA is a more sensitive and reliable assay for semi-quantitative and quantitative detection which can be used in forensic analysis.
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION
Directory of Open Access Journals (Sweden)
Honcharova S.Y.
2015-08-01
Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.
Pierik, A.; Moamfa, M; van Zelst, M.; Clout, D.; Stapert, H.; Dijksman, Johan Frederik; Broer, D.; Wimberger-Friedl, R.
2012-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that
Pierik, Anke; Boamfa, M.; Zelst, van M.; Clout, D.; Stapert, H.R.; Dijksman, J.F.; Broer, D.J.; Wimberger-Friedl, R.
2012-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) is widely used as a research and diagnostic tool. Notwithstanding its many powerful features, the method is limited in the degree of multiplexing to about 6 due to spectral overlap of the available fluorophores. A new method is presented that
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.
2002-01-01
Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Campbell, J; Lowe, J; Walz, S; Ezzell, J
1993-01-01
We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Cimino, Rubén O; Jeun, Rebecca; Juarez, Marisa; Cajal, Pamela S; Vargas, Paola; Echazú, Adriana; Bryan, Patricia E; Nasser, Julio; Krolewiecki, Alejandro; Mejia, Rojelio
2015-07-17
In resource-limited countries, stool microscopy is the diagnostic test of choice for intestinal parasites (soil-transmitted helminths and/or intestinal protozoa). However, sensitivity and specificity is low. Improved diagnosis of intestinal parasites is especially important for accurate measurements of prevalence and intensity of infections in endemic areas. The study was carried out in Orán, Argentina. A total of 99 stool samples from a local surveillance campaign were analyzed by concentration microscopy and McMaster egg counting technique compared to the analysis by multi-parallel quantitative real-time polymerase chain reaction (qPCR). This study compared the performance of qPCR assay and stool microscopy for 8 common intestinal parasites that infect humans including the helminths Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichuris trichiura, and the protozoa Giardia lamblia, Cryptosporidium parvum/hominis, and Entamoeba histolytica, and investigated the prevalence of polyparasitism in an endemic area. qPCR showed higher detection rates for all parasites as compared to stool microscopy except T. trichiura. Species-specific primers and probes were able to distinguish between A. duodenale (19.1%) and N. americanus (36.4%) infections. There were 48.6% of subjects co-infected with both hookworms, and a significant increase in hookworm DNA for A. duodenale versus N. americanus (119.6 fg/μL: 0.63 fg/μL, P parasites in an endemic area that has improved diagnostic accuracy compared to stool microscopy. This first time use of multi-parallel qPCR in Argentina has demonstrated the high prevalence of intestinal parasites in a peri-urban area. These results will contribute to more accurate epidemiological survey, refined treatment strategies on a public scale, and better health outcomes in endemic settings.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Roth, S.
2004-01-01
A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...
Ueda, Jun; Yoshimura, Hajime; Shimizu, Keiji; Hino, Megumu; Kohara, Nobuo
2017-07-01
Visual and semi-quantitative assessments of 123 I-FP-CIT single-photon emission computed tomography (SPECT) are useful for the diagnosis of dopaminergic neurodegenerative diseases (dNDD), including Parkinson's disease, dementia with Lewy bodies, progressive supranuclear palsy, multiple system atrophy, and corticobasal degeneration. However, the diagnostic value of combined visual and semi-quantitative assessment in dNDD remains unclear. Among 239 consecutive patients with a newly diagnosed possible parkinsonian syndrome who underwent 123 I-FP-CIT SPECT in our medical center, 114 patients with a disease duration less than 7 years were diagnosed as dNDD with the established criteria or as non-dNDD according to clinical judgment. We retrospectively examined their clinical characteristics and visual and semi-quantitative assessments of 123 I-FP-CIT SPECT. The striatal binding ratio (SBR) was used as a semi-quantitative measure of 123 I-FP-CIT SPECT. We calculated the sensitivity and specificity of visual assessment alone, semi-quantitative assessment alone, and combined visual and semi-quantitative assessment for the diagnosis of dNDD. SBR was correlated with visual assessment. Some dNDD patients with a normal visual assessment had an abnormal SBR, and vice versa. There was no statistically significant difference between sensitivity of the diagnosis with visual assessment alone and semi-quantitative assessment alone (91.2 vs. 86.8%, respectively, p = 0.29). Combined visual and semi-quantitative assessment demonstrated superior sensitivity (96.7%) to visual assessment (p = 0.03) or semi-quantitative assessment (p = 0.003) alone with equal specificity. Visual and semi-quantitative assessments of 123 I-FP-CIT SPECT are helpful for the diagnosis of dNDD, and combined visual and semi-quantitative assessment shows superior sensitivity with equal specificity.
Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A
2014-01-01
The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.
2007-01-01
After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and
Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.
Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay
2018-01-10
Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
PIQMIe: A web server for semi-quantitative proteomics data management and analysis
A. Kuzniar (Arnold); R. Kanaar (Roland)
2014-01-01
textabstractWe present the Proteomics Identifications and Quantitations Data Management and Integration Service or PIQMIe that aids in reliable and scalable data management, analysis and visualization of semi-quantitative mass spectrometry based proteomics experiments. PIQMIe readily integrates
A critical appraisal of semi-quantitative analysis of 2-deoxyglucose autoradiograms
International Nuclear Information System (INIS)
Kelly, P.T.; McCulloch, J.
1983-01-01
Semi-quantitative analysis (e.g. optical density ratios) of [ 14 C]2-deoxyglucose autoradiograms is widely used in neuroscience research. The authors demonstrate that a fixed ratio of 14 C-concentrations in the CNS does not yield a constant optical density ratio but is dependent upon the exposure time in the preparation of the autoradiograms and the absolute amounts of 14 C from which the concentration ratio is derived. The failure of a fixed glucose utilization ratio to result in a constant optical density ratio represents a major interpretative difficulty in investigations where only semi-quantitative analysis of [ 14 C]2-deoxyglucose autoradiograms is undertaken. (Auth.)
DREAM: a method for semi-quantitative dermal exposure assessment
Wendel de Joode, B. van; Brouwer, D.H.; Kromhout, H.; Hemmen, J.J. van
2003-01-01
This paper describes a new method (DREAM) for structured, semi-quantitative dermal exposure assessment for chemical or biological agents that can be used in occupational hygiene or epidemiology. It is anticipated that DREAM could serve as an initial assessment of dermal exposure, amongst others,
Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR)
Ruiz-Villalba, Adrián; van Pelt-Verkuil, Elizabeth; Gunst, Quinn D.; Ruijter, Jan M.; van den Hoff, Maurice J. B.
2017-01-01
Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated
Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao
2013-11-27
The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.
2008-01-01
Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to
International Nuclear Information System (INIS)
Gokahmetoglu, S.; Deniz, E.
2007-01-01
To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)
Stationary population flow of a semi-open Markov Chain. | Yakasai ...
African Journals Online (AJOL)
In this paper we study the state vector of a semi-open Markov chain of a stochastic population flow. We consider stationary inflow of new members into the system and derive the limiting value of the state vector X(n) = (X1(n),....,(Xm(n) ∈Z+ as n→ ∞ , when the system's capacity, is known. Journal of the Nigerian Association ...
le Roux, Marie Cecilia; Hoosen, Anwar Ahmed
2017-01-01
This study was done to diagnose Mycoplasma genitalium infection based on bacterial load in urine specimens from symptomatic and asymptomatic men. Urine specimens from 94 men with visible urethral discharge, 206 with burning on micturition and 75 without symptoms presenting to a family practitioner were tested for M. genitalium as well as Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis by transcription-mediated amplification assays. A quantitative polymerase chain reaction assay was used to determine the bacterial load for all specimens in which M. genitalium was the only organism detected. Among the 375 specimens collected, M. genitalium was detected in 59 (15.7%) men (both symptomatic and asymptomatic) using the transcription-mediated amplification assay, and in 45 (12.0%) of the total population, it was the only pathogen detected. One or more pathogens were detected in 129 (43%) of the symptomatic men, with N. gonorrhoeae in 50 (16.7%); C. trachomatis in 37 (12.3%) and T. vaginalis present in 24 (8.0%) patients. Among the 17 patients where mixed infections were detected, M. genitalium with N. gonorrhoeae was the most common (11/17; 64.7%). Patients with visible urethral discharge had significantly higher M. genitalium concentrations than those with burning on micturition. The median M. genitalium load in symptomatic men was significantly higher than that in asymptomatic men. This study confirms the high prevalence of M. genitalium among men with urethritis in South Africa and demonstrates that there is a strong association with M. genitalium bacterial load and clinical urethritis. As the number of organisms increased, the severity of the symptoms increased, an indication of the role that the organism plays in disease progression.
Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.
2011-01-01
Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.
Semi-quantitative SPECT for anterior dislocation of the disc in the temporo-mandibular joint
Energy Technology Data Exchange (ETDEWEB)
Oesterreich, F.U.; Jend-Rossmann, I.; Jend, H.H.; Triebel, H.J.
1987-01-01
SPECT-examination of the TMJ using 99m-Tc-MDP was performed in 43 patients with arthrographically proven anterior dislocation of the disc and in 30 normals. The results were evaluated visually and also in a semi-quantitative manner that took account of relative 99m Tc activity in the TMJ and of the age of the patient. In the presence of arthrographically proven anterior, but reversible, disc dislocation, the semi-quantitative method proved positive in 75% of cases (28 cases). In joints with fixed anterior dislocation (29 cases), bone changes were demonstrated in 26%. Visual evaluation was positive in 50% of reversible, and in 72% of non-reversible dislocations. Semi-quantitative SPECT of the TMJ is excellent for demonstrating bone reaction resulting from TMJ dysfunction and for indicating the severity of the joint abnormality.
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.
Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José
2013-01-01
Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
On the semi-classical limit of scalar products of the XXZ spin chain
Energy Technology Data Exchange (ETDEWEB)
Jiang, Yunfeng; Brunekreef, Joren [Institut für Theoretische Physik, ETH Zürich,Wolfgang Pauli Strasse 27, CH-8093 Zürich (Switzerland)
2017-03-03
We study the scalar products between Bethe states in the XXZ spin chain with anisotropy |Δ|>1 in the semi-classical limit where the length of the spin chain and the number of magnons tend to infinity with their ratio kept finite and fixed. Our method is a natural yet non-trivial generalization of similar methods developed for the XXX spin chain. The final result can be written in a compact form as a contour integral in terms of Faddeev’s quantum dilogarithm function, which in the isotropic limit reduces to the classical dilogarithm function.
On the semi-classical limit of scalar products of the XXZ spin chain
International Nuclear Information System (INIS)
Jiang, Yunfeng; Brunekreef, Joren
2017-01-01
We study the scalar products between Bethe states in the XXZ spin chain with anisotropy |Δ|>1 in the semi-classical limit where the length of the spin chain and the number of magnons tend to infinity with their ratio kept finite and fixed. Our method is a natural yet non-trivial generalization of similar methods developed for the XXX spin chain. The final result can be written in a compact form as a contour integral in terms of Faddeev’s quantum dilogarithm function, which in the isotropic limit reduces to the classical dilogarithm function.
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
Directory of Open Access Journals (Sweden)
Miriam YH Ueda
2015-06-01
Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Directory of Open Access Journals (Sweden)
Людмила Мар’янівна Іщенко
2016-11-01
Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer
Stepwise kinetic equilibrium models of quantitative polymerase chain reaction
Directory of Open Access Journals (Sweden)
Cobbs Gary
2012-08-01
Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the
Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.
Cobbs, Gary
2012-08-16
Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Fenollar, Florence; Laouira, Sonia; Lepidi, Hubert; Rolain, Jean-Marc; Raoult, Didier
2008-09-01
Whipple disease (WD) is a chronic infectious disease caused by Tropheryma whipplei. WD DNA has been found in stool and saliva specimens from patients and asymptomatic carriers. A total of 4418 samples that were sent to our center for determination of WD were tested by a T. whipplei-specific quantitative polymerase chain reaction (PCR) based on repetitive sequences. Definite WD was diagnosed in 71 patients, including 55 patients with classic WD (defined by positive results of periodic acid-Schiff staining and/or specific immunohistochemistry of small-bowel biopsy specimens) and 16 patients with localized WD (including patients with endocarditis, neurologic infection, and uveitis). Of the persons without WD, 2.3% had stool specimens positive for T. whipplei by PCR and 0.2% had saliva specimens positive for T. whipplei by PCR. Diagnosis of WD was likely in patients with positive results of both PCR of saliva specimens and PCR of stool specimens (positive predictive value, 95.2%). When the bacterial load was >10(4) colony-forming units per g of stool, the positive predictive value was 100%. A negative result of PCR of a saliva or stool specimen had a negative predictive value of 99.2% for classic WD. For localized WD, positive results of both PCR of saliva specimens and PCR of stool specimens had a sensitivity of 58% (compared with 94% for classic WD). The positive predictive value of testing of blood, cerebrospinal fluid, and urine specimens was 100% for each, and the positive predictive value for testing of duodenal biopsy specimens was 97.5%. T. whipplei-specific quantitative PCR of saliva and stool specimens should be performed as first-line noninvasive screening for WD. When the results for both types of specimens are positive, diagnosis of classic WD should be highly suspected, especially if a high bacterial load is detected. Because PCR of saliva and stool specimens lacks sensitivity for determination of localized WD, invasive samples should be tested on the
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe
2014-11-01
Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.
Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares
2012-03-23
Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic
Semi Quantitative MALDI TOF for Antimicrobial Susceptibility Testing in Staphylococcus aureus
2017-08-31
Semi- quantitative MALDI-TOF for antimicrobial susceptibility testing in Staphylococcus 1 aureus 2 3 4 Tucker Maxson,a Cheryl L. Taylor-Howell,a...Timothy D. Minoguea# 5 6 Diagnostic Systems Division, United States Army Medical Research Institute of Infectious 7 Disease, Fort Detrick, MD...USAa 8 9 Running Title: Quantitative MALDI for AST in S. aureus 10 #Address correspondence to Timothy D. Minogue, timothy.d.minogue.civ@mail.mil
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection
Directory of Open Access Journals (Sweden)
Amanda de Faveri Pitz
2013-12-01
Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Zhu, Jingqi; Xiong, Zuogang; Zhang, Jiulong; Qiu, Yuyou; Hua, Ting; Tang, Guangyu
2017-11-14
This study aims to investigate the technical feasibility of semi-quantitative and quantitative dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) in the assessment of longitudinal changes of marrow perfusion in a rat osteoporosis model, using bone mineral density (BMD) measured by micro-computed tomography (micro-CT) and histopathology as the gold standards. Fifty rats were randomly assigned to the control group (n=25) and ovariectomy (OVX) group whose bilateral ovaries were excised (n=25). Semi-quantitative and quantitative DCE-MRI, micro-CT, and histopathological examinations were performed on lumbar vertebrae at baseline and 3, 6, 9, and 12 weeks after operation. The differences between the two groups in terms of semi-quantitative DCE-MRI parameter (maximum enhancement, E max ), quantitative DCE-MRI parameters (volume transfer constant, K trans ; interstitial volume, V e ; and efflux rate constant, K ep ), micro-CT parameter (BMD), and histopathological parameter (microvessel density, MVD) were compared at each of the time points using an independent-sample t test. The differences in these parameters between baseline and other time points in each group were assessed via Bonferroni's multiple comparison test. A Pearson correlation analysis was applied to assess the relationships between DCE-MRI, micro-CT, and histopathological parameters. In the OVX group, the E max values decreased significantly compared with those of the control group at weeks 6 and 9 (p=0.003 and 0.004, respectively). The K trans values decreased significantly compared with those of the control group from week 3 (pquantitative DCE-MRI, the quantitative DCE-MRI parameter K trans is a more sensitive and accurate index for detecting early reduced perfusion in osteoporotic bone.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
Reliability of a semi-quantitative method for dermal exposure assessment (DREAM)
Wendel de Joode, B. van; Hemmen, J.J. van; Meijster, T.; Major, V.; London, L.; Kromhout, H.
2005-01-01
Valid and reliable semi-quantitative dermal exposure assessment methods for epidemiological research and for occupational hygiene practice, applicable for different chemical agents, are practically nonexistent. The aim of this study was to assess the reliability of a recently developed
The food chain transfer of radionuclides through semi-natural habitats
International Nuclear Information System (INIS)
Copplestone, David.
1996-07-01
The behaviour of 134 Cs, 137 Cs, 238 Pu, 239+240 Pu and 241 Am in food chains in three semi-natural ecosystems: a coniferous woodland, a salt marsh and a sand dune have been investigated. These sites, within the environs of the Sellafield nuclear complex in Cumbria, are subject to both anthropogenic and historic inputs of radioactivity. Inputs to these ecosystems have been assessed, as well as activity in soils, vegetation, litter, invertebrates and small mammals. (author)
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
Reference genes for reverse transcription quantitative PCR in canine brain tissue
Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C
2015-01-01
BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and
DEFF Research Database (Denmark)
Meldgaard, Michael; Morling, N
1997-01-01
Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which...... is one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals...... are analyzed. We have investigated the relative levels of formation of extra peaks in 14 STR marker systems. We found that not only the parameters of the PCR but also factors determining the stringency during the post-PCR and pre-electrophoresis handling of samples were of importance for the formation of extra...
Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E
1992-01-01
Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.
Directory of Open Access Journals (Sweden)
Jennifer A. Scoble
2013-10-01
Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.
Angusti, Tiziana; Pilati, Emanuela; Parente, Antonella; Carignola, Renato; Manfredi, Matteo; Cauda, Simona; Pizzigati, Elena; Dubreuil, Julien; Giammarile, Francesco; Podio, Valerio; Skanjeti, Andrea
2017-09-01
The aim of this study was the assessment of semi-quantified salivary gland dynamic scintigraphy (SGdS) parameters independently and in an integrated way in order to predict primary Sjögren's syndrome (pSS). Forty-six consecutive patients (41 females; age 61 ± 11 years) with sicca syndrome were studied by SGdS after injection of 200 MBq of pertechnetate. In sixteen patients, pSS was diagnosed, according to American-European Consensus Group criteria (AECGc). Semi-quantitative parameters (uptake (UP) and excretion fraction (EF)) were obtained for each gland. ROC curves were used to determine the best cut-off value. The area under the curve (AUC) was used to estimate the accuracy of each semi-quantitative analysis. To assess the correlation between scintigraphic results and disease severity, semi-quantitative parameters were plotted versus Sjögren's syndrome disease activity index (ESSDAI). A nomogram was built to perform an integrated evaluation of all the scintigraphic semi-quantitative data. Both UP and EF of salivary glands were significantly lower in pSS patients compared to those in non-pSS (p quantitative parameters and ESSDAI. The proposed nomogram accuracy was 87%. SGdS is an accurate and reproducible tool for the diagnosis of pSS. ESSDAI was not shown to be correlated with SGdS data. SGdS should be the first-line imaging technique in patients with suspected pSS.
Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung
2017-01-01
Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G
2010-09-20
Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Detection of chromosome abnormalities by quantitative fluorescent PCR in ectopic pregnancies
Goddijn, Mariette; van Stralen, Marja; Schuring-Blom, Heleen; Redeker, Bert; van Leeuwen, Liesbeth; Repping, Sjoerd; Leschot, Nico; van der Veen, Fulco
2005-01-01
Objective: To evaluate the potential value of quantitative fluorescent polymerase chain reaction (QF-PCR) in the detection of chromosome abnormalities in ectopic pregnancies. Methods: Seventy chorionic villi samples of ectopic pregnancies were studied by QF-PCR. Primers for chromosomes 16, 21, X and
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.
Nadin-Davis, Susan; Knowles, Margaret K; Burke, Teresa; Böse, Reinhard; Devenish, John
2015-07-01
A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment.
Rollín, R; Alvarez-Lafuente, R; Marco, F; Jover, J A; Hernández-García, C; Rodríguez-Navas, C; López-Durán, L; Fernández-Gutiérrez, B
2007-04-01
To investigate whether there is a possible viral transmission using mesenchymal stem cells (MSCs) in autologous or allogeneic transplantation in the context of osteoarthritis (OA) patients. The presence of parvovirus B19 (B19), varicella zoster virus (VZV), and human herpesvirus-6 (HHV-6) was studied in MSCs from bone marrow of patients with OA and healthy controls. MSCs were prepared from bone marrow aspirates obtained from 18 patients undergoing joint replacement as a result of OA and from 10 healthy controls. DNA was extracted from primary MSCs' culture established from these cells and quantitative real-time polymerase chain reaction was performed to analyse the prevalence and viral load of B19, VZV and HHV-6. The prevalence of total viral DNA among patients with OA was 16.7% (3/18), with a mean viral load of 29.7 copies/microg of DNA. One out of 18 was positive for B19 (viral load, 61.2 copies/microg of DNA), two for VZV (mean viral load, 14.4 copies/microg of DNA), and none for HHV-6. The prevalence of total viral DNA in the control group was 20% (2/10), with a mean viral load of 13.4 copies/microg of DNA. Both positive results were of B19 parvoviruses. There were no statistically significant differences among patients and controls. This first approach to the viral prevalence in MSCs of bone marrow in OA patients and healthy controls seems to show a very low risk of viral transmission or reactivation in a possible MSCs' transplantation.
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
A simple, semi-quantitative method for measuring pulsed soft x-rays
International Nuclear Information System (INIS)
Takahama, Y.; Du, J.; Yanagidaira, T.; Hirano, K.
1993-01-01
A simple semi-quantitative measurement and image processing system for pulsed soft X-rays with a time and spatial resolution is proposed. Performance of the system is examined using a cylindrical soft X-ray source generated with a plasma device. The system consists of commercial facilities which are easily obtained such as a microchannel plate-phosphor screen combination, a CCD camera, an image memory board and a personal computer. To make a quantitative measurement possible, the image processing and observation of the phosphor screen current are used in conjunction. (author)
Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases
Directory of Open Access Journals (Sweden)
Sharma J
2010-01-01
Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients
International Nuclear Information System (INIS)
Cao Hongbin; Banh, Alice; Kwok, Shirley; Shi Xiaoli; Wu, Simon; Krakow, Trevor; Khong, Brian; Bavan, Brindha; Bala, Rajeev; Pinsky, Benjamin A.; Colevas, Dimitrios; Pourmand, Nader; Koong, Albert C.; Kong, Christina S.; Le, Quynh-Thu
2012-01-01
Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed by p16 INK4a staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using 18 F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Polypeptide -acetylgalactosaminyltransferase 14 (GalNAc-T14) is a novel IGFBP-3 binding partner. In this paper, small interference RNA (siRNA) targeting GalNAc-T14 was used to examine whether GalNAc-T14 affects the apoptotic action of IGFBP-3. Using semi-quantitative reverse-transcriptase polymerase chain ...
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...
A semi-quantitative model for risk appreciation and risk weighing
DEFF Research Database (Denmark)
Bos, Peter M.J.; Boon, Polly E.; van der Voet, Hilko
2009-01-01
Risk managers need detailed information on (1) the type of effect, (2) the size (severity) of the expected effect(s) and (3) the fraction of the population at risk to decide on well-balanced risk reduction measures. A previously developed integrated probabilistic risk assessment (IPRA) model...... provides quantitative information on these three parameters. A semi-quantitative tool is presented that combines information on these parameters into easy-readable charts that will facilitate risk evaluations of exposure situations and decisions on risk reduction measures. This tool is based on a concept...... detailed information on the estimated health impact in a given exposure situation. These graphs will facilitate the discussions on appropriate risk reduction measures to be taken....
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof
2012-05-15
Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.
Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes
2017-02-07
Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.
Ugajin, Motoi; Yamaki, Kenichi; Hirasawa, Natsuko; Yagi, Takeo
2014-04-01
The semi-quantitative serum procalcitonin test (Brahms PCT-Q) is available conveniently in clinical practice. However, there are few data on the relationship between results for this semi-quantitative procalcitonin test and clinical outcomes of community-acquired pneumonia (CAP). We investigated the usefulness of this procalcitonin test for predicting the clinical outcomes of CAP in comparison with severity scoring systems and the blood urea nitrogen/serum albumin (B/A) ratio, which has been reported to be a simple but reliable prognostic indicator in our prior CAP study. This retrospective study included data from subjects who were hospitalized for CAP from August 2010 through October 2012 and who were administered the semi-quantitative serum procalcitonin test on admission. The demographic characteristics; laboratory biomarkers; microbiological test results; Pneumonia Severity Index scores; confusion, urea nitrogen, breathing frequency, blood pressure, ≥ 65 years of age (CURB-65) scale scores; and age, dehydration, respiratory failure, orientation disturbance, pressure (A-DROP) scale scores on hospital admission were retrieved from their medical charts. The outcomes were mortality within 28 days of hospital admission and the need for intensive care. Of the 213 subjects with CAP who were enrolled in the study, 20 died within 28 days of hospital admission, and 32 required intensive care. Mortality did not differ significantly among subjects with different semi-quantitative serum procalcitonin levels; however, subjects with serum procalcitonin levels ≥ 10.0 ng/mL were more likely to require intensive care than those with lower levels (P pneumonia. Using the receiver operating characteristic curves for mortality, the area under the curve was 0.86 for Pneumonia Severity Index class, 0.81 for B/A ratio, 0.81 for A-DROP, 0.80 for CURB-65, and 0.57 for semi-quantitative procalcitonin test. The semi-quantitative serum procalcitonin level on hospital admission was less
Reliability measures for indexed semi-Markov chains applied to wind energy production
International Nuclear Information System (INIS)
D'Amico, Guglielmo; Petroni, Filippo; Prattico, Flavio
2015-01-01
The computation of the dependability measures is a crucial point in many engineering problems as well as in the planning and development of a wind farm. In this paper we address the issue of energy production by wind turbines by using an indexed semi-Markov chain as a model of wind speed. We present the mathematical model, the data and technical characteristics of a commercial wind turbine (Aircon HAWT-10kW). We show how to compute some of the main dependability measures such as reliability, availability and maintainability functions. We compare the results of the model with real energy production obtained from data available in the Lastem station (Italy) and sampled every 10 min. - Highlights: • Semi-Markov models. • Time series generation of wind speed. • Computation of availability, reliability and maintainability.
Griffin, Dale W.
2011-01-01
Epifluorescent microscopy and quantitative polymerase chain reaction (qPCR) were utilized to determine the presence, concentration and identification of bacteria, and more specifically sulfate reducing bacteria (SRB) in subsamples of Chinese and North American wallboard, and wallboard-mine rock. Bacteria were visible in most subsamples, which included wallboard-lining paper from each side of the wallboard, wallboard filler, wallboard tape and fragments of mined wallboard rock via microscopy. Observed bacteria occurred as single or small clusters of cells and no mass aggregates indicating colonization were noted. Universal 16S qPCR was utilized to directly examine samples and detected bacteria at concentrations ranging from 1.4 x 103 to 6.4 x 104 genomic equivalents per mm2 of paper or per gram of wallboard filler or mined rock, in 12 of 41 subsamples. Subsamples were incubated in sulfate reducing broth for ~30 to 60 days (enrichment assay) and then analyzed by universal 16S and SRB qPCR. Enrichment universal 16S qPCR detected bacteria in 32 of 41 subsamples at concentrations ranging from 1.5 x 104 to 4.2 x 107 genomic equivalents per ml of culture broth. Evaluation of enriched subsamples by SRB qPCR demonstrated that SRB were not detectable in most of the samples and if they were detected, detection was not reproducible (an indication of low concentrations, if present). Enrichment universal 16S and SRB qPCR demonstrated that viable bacteria were present in subsamples (as expected given exposure of the samples following manufacture, transport and use) but that SRB were either not present or present at very low numbers. Further, no differences in trends were noted between the various Chinese and North American wallboard samples. In all, the microscopy and qPCR data indicated that the suspected ‘sulfur emissions’ emanating from suspect wallboard samples is not due to microbial activity.
Quantitative models for sustainable supply chain management
DEFF Research Database (Denmark)
Brandenburg, M.; Govindan, Kannan; Sarkis, J.
2014-01-01
and directions of this research area, this paper provides a content analysis of 134 carefully identified papers on quantitative, formal models that address sustainability aspects in the forward SC. It was found that a preponderance of the publications and models appeared in a limited set of six journals......Sustainability, the consideration of environmental factors and social aspects, in supply chain management (SCM) has become a highly relevant topic for researchers and practitioners. The application of operations research methods and related models, i.e. formal modeling, for closed-loop SCM...... and reverse logistics has been effectively reviewed in previously published research. This situation is in contrast to the understanding and review of mathematical models that focus on environmental or social factors in forward supply chains (SC), which has seen less investigation. To evaluate developments...
MR Imaging-based Semi-quantitative Methods for Knee Osteoarthritis
JARRAYA, Mohamed; HAYASHI, Daichi; ROEMER, Frank Wolfgang; GUERMAZI, Ali
2016-01-01
Magnetic resonance imaging (MRI)-based semi-quantitative (SQ) methods applied to knee osteoarthritis (OA) have been introduced during the last decade and have fundamentally changed our understanding of knee OA pathology since then. Several epidemiological studies and clinical trials have used MRI-based SQ methods to evaluate different outcome measures. Interest in MRI-based SQ scoring system has led to continuous update and refinement. This article reviews the different SQ approaches for MRI-based whole organ assessment of knee OA and also discuss practical aspects of whole joint assessment. PMID:26632537
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
Czech Academy of Sciences Publication Activity Database
Trachtová, S.; Španová, A.; Horák, Daniel; Kozáková, Hana; Rittich, B.
2016-01-01
Roč. 22, č. 5 (2016), s. 639-646 ISSN 1381-6128 R&D Projects: GA ČR GA15-07268S Institutional support: RVO:61389013 ; RVO:61388971 Keywords : magnetic microspheres * inhibitory effect * real-time polymerase chain Subject RIV: CD - Macromolecular Chemistry; CD - Macromolecular Chemistry (MBU-M) Impact factor: 2.611, year: 2016
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
Riboli, Danilo Flávio Moraes; Lyra, João César; Silva, Eliane Pessoa; Valadão, Luisa Leite; Bentlin, Maria Regina; Corrente, José Eduardo; Rugolo, Ligia Maria Suppo de Souza; da Cunha, Maria de Lourdes Ribeiro de Souza
2014-05-22
Catheter-related bloodstream infections (CR-BSIs) have become the most common cause of healthcare-associated bloodstream infections in neonatal intensive care units (ICUs). Microbiological evidence implicating catheters as the source of bloodstream infection is necessary to establish the diagnosis of CR-BSIs. Semi-quantitative culture is used to determine the presence of microorganisms on the external catheter surface, whereas quantitative culture also isolates microorganisms present inside the catheter. The main objective of this study was to determine the sensitivity and specificity of these two techniques for the diagnosis of CR-BSIs in newborns from a neonatal ICU. In addition, PFGE was used for similarity analysis of the microorganisms isolated from catheters and blood cultures. Semi-quantitative and quantitative methods were used for the culture of catheter tips obtained from newborns. Strains isolated from catheter tips and blood cultures which exhibited the same antimicrobial susceptibility profile were included in the study as positive cases of CR-BSI. PFGE of the microorganisms isolated from catheters and blood cultures was performed for similarity analysis and detection of clones in the ICU. A total of 584 catheter tips from 399 patients seen between November 2005 and June 2012 were analyzed. Twenty-nine cases of CR-BSI were confirmed. Coagulase-negative staphylococci (CoNS) were the most frequently isolated microorganisms, including S. epidermidis as the most prevalent species (65.5%), followed by S. haemolyticus (10.3%), yeasts (10.3%), K. pneumoniae (6.9%), S. aureus (3.4%), and E. coli (3.4%). The sensitivity of the semi-quantitative and quantitative techniques was 72.7% and 59.3%, respectively, and specificity was 95.7% and 94.4%. The diagnosis of CR-BSIs based on PFGE analysis of similarity between strains isolated from catheter tips and blood cultures showed 82.6% sensitivity and 100% specificity. The semi-quantitative culture method showed higher
A chemical profiling strategy for semi-quantitative analysis of flavonoids in Ginkgo extracts.
Yang, Jing; Wang, An-Qi; Li, Xue-Jing; Fan, Xue; Yin, Shan-Shan; Lan, Ke
2016-05-10
Flavonoids analysis in herbal products is challenged by their vast chemical diversity. This work aimed to develop a chemical profiling strategy for the semi-quantification of flavonoids using extracts of Ginkgo biloba L. (EGB) as an example. The strategy was based on the principle that flavonoids in EGB have an almost equivalent molecular absorption coefficient at a fixed wavelength. As a result, the molecular-contents of flavonoids were able to be semi-quantitatively determined by the molecular-concentration calibration curves of common standards and recalculated as the mass-contents with the characterized molecular weight (MW). Twenty batches of EGB were subjected to HPLC-UV/DAD/MS fingerprinting analysis to test the feasibility and reliability of this strategy. The flavonoid peaks were distinguished from the other peaks with principle component analysis and Pearson correlation analysis of the normalized UV spectrometric dataset. Each flavonoid peak was subsequently tentatively identified by the MS data to ascertain their MW. It was highlighted that the flavonoids absorption at Band-II (240-280 nm) was more suitable for the semi-quantification purpose because of the less variation compared to that at Band-I (300-380 nm). The semi-quantification was therefore conducted at 254 nm. Beyond the qualitative comparison results acquired by common chemical profiling techniques, the semi-quantitative approach presented the detailed compositional information of flavonoids in EGB and demonstrated how the adulteration of one batch was achieved. The developed strategy was believed to be useful for the advanced analysis of herbal extracts with a high flavonoid content without laborious identification and isolation of individual components. Copyright © 2016 Elsevier B.V. All rights reserved.
Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A
2010-10-01
The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
International Nuclear Information System (INIS)
Takatsuji, Yoshiyuki; Wakabayashi, Ryo; Sakakura, Tatsuya; Haruyama, Tetsuya
2015-01-01
The molecular affinities of biomolecules have found applications in the areas of clinical diagnostics, drug discovery, as well as allied fields of study. An affinity sensor is a unique in situ assay tool, which is valuable and convenient in practical situations. In this study, we designed a photo-excitable molecular interface with an affinity domain and fabricated with a “swingable” straight-chain affinity molecule immobilized on a semi-conductor electrode (SCE). The straight-chain affinity molecule possessed a photo-excitable dye at one end and was bound to the SCE surface at the other by the EC tag method, which was developed previously. A straight-chain molecule is too long to transfer electrons from the photo-excited dye to the conduction band of the SCE. However, the straight-chain molecule was designed with a “swing” structure, which made the transfer of electrons possible. The central region of the chain molecule has an affinity to the activated estrogen receptor (ER). When the activated ER bound to the affinity region, the molecular lost its swingable function, the electron transfer from the photo-excited dye to the SCE was consequently suppressed. Based on the unique swingable molecular interface, the affinity sensor can be used to determine the in situ concentration of endocrine disrupter ESTROGEN (17β-estradiol) at concentrations ranging from 2 to 10 nM with very good reproducibility. The superior assay reproducibility is responsible for the success of the EC tag method, which is a quantitative method for immobilizing molecules on SCE.
DEFF Research Database (Denmark)
Qayyum, Abbas Ali; Kühl, Jørgen Tobias; Kjaer, Andreas
2017-01-01
INTRODUCTION: Computed tomography (CT) is a novel method for assessment of myocardial perfusion and has not yet been compared to rubidium-82 positron emission tomography (PET). We aimed to compare CT measured semi-quantitative myocardial perfusion with absolute quantified myocardial perfusion usi...
Quantitative Model for Supply Chain Visibility: Process Capability Perspective
Directory of Open Access Journals (Sweden)
Youngsu Lee
2016-01-01
Full Text Available Currently, the intensity of enterprise competition has increased as a result of a greater diversity of customer needs as well as the persistence of a long-term recession. The results of competition are becoming severe enough to determine the survival of company. To survive global competition, each firm must focus on achieving innovation excellence and operational excellence as core competency for sustainable competitive advantage. Supply chain management is now regarded as one of the most effective innovation initiatives to achieve operational excellence, and its importance has become ever more apparent. However, few companies effectively manage their supply chains, and the greatest difficulty is in achieving supply chain visibility. Many companies still suffer from a lack of visibility, and in spite of extensive research and the availability of modern technologies, the concepts and quantification methods to increase supply chain visibility are still ambiguous. Based on the extant researches in supply chain visibility, this study proposes an extended visibility concept focusing on a process capability perspective and suggests a more quantitative model using Z score in Six Sigma methodology to evaluate and improve the level of supply chain visibility.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
Directory of Open Access Journals (Sweden)
Xu Q
2015-06-01
Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect
Directory of Open Access Journals (Sweden)
Camila Appolinário
2015-09-01
Full Text Available Rabies virus (RABV isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2, Desmodus rotundus (variant 3, crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to clinical evolution from five RABV variants. The presence of the RABV was investigated in brain samples by fluorescent antibody test (FAT and real time polymerase chain reaction (qRT-PCR for quantification of rabies virus nucleoprotein gene (N gene. Virus replication is not correlated with clinical signs and evolution. The pattern of FAT is associated with RABV replication levels. Virus isolates from crab eating fox and marmoset had a longer evolution period and higher survival rate suggesting that the evolution period may contribute to the outcome. RABV virus variants had independent characteristics that determine the clinical evolution and survival of the infected mice.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
International Nuclear Information System (INIS)
Bleeker, Leslie; Berg, Rene van den; Majoie, Charles B.; Marquering, Henk A.; Nederkoorn, Paul J.
2012-01-01
Intracranial carotid artery atherosclerotic disease is an independent predictor for recurrent stroke. However, its quantitative assessment is not routinely performed in clinical practice. In this diagnostic study, we present and evaluate a novel semi-automatic application to quantitatively measure intracranial internal carotid artery (ICA) degree of stenosis and calcium volume in CT angiography (CTA) images. In this retrospective study involving CTA images of 88 consecutive patients, intracranial ICA stenosis was quantitatively measured by two independent observers. Stenoses were categorized with cutoff values of 30% and 50%. The calcification in the intracranial ICA was qualitatively categorized as absent, mild, moderate, or severe and quantitatively measured using the semi-automatic application. Linear weighted kappa values were calculated to assess the interobserver agreement of the stenosis and calcium categorization. The average and the standard deviation of the quantitative calcium volume were calculated for the calcium categories. For the stenosis measurements, the CTA images of 162 arteries yielded an interobserver correlation of 0.78 (P < 0.001). Kappa values of the categorized stenosis measurements were moderate: 0.45 and 0.58 for cutoff values of 30% and 50%, respectively. The kappa value for the calcium categorization was 0.62, with a good agreement between the qualitative and quantitative calcium assessment. Quantitative degree of stenosis measurement of the intracranial ICA on CTA is feasible with a good interobserver agreement ICA. Qualitative calcium categorization agrees well with quantitative measurements. (orig.)
Directory of Open Access Journals (Sweden)
Claudia Huber
Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
He, Rong-Quan; Lan, Ai-Hua; Zhong, Jin-Cai; Chen, Gang; Feng, Zhen-Bo; Wei, Kang-Lai
2018-01-01
MicroRNAs (miRNAs or miRs) are highly conserved small noncoding RNA molecules involved in gene regulation. An increasing number of studies have demonstrated that miRNAs act as oncogenes or antioncogenes in various types of cancer, including breast cancer (BC). However, the exact role of miR-671-3p in BC has not yet been reported. In the present study, in vitro experiments were implemented to explore the effects of miR-671-3p on the proliferation and apoptosis of BC cells, and reverse transcription-quantitative polymerase chain reaction was conducted using in-house clinical BC samples to address the expression level and clinical value of miR-671-3p in BC. Simultaneously, miR-671-3p target genes were collected, and subsequent bioinformatics analyses were executed to probe the potential signaling pathway through which miR-671-3p influenced the occurrence and progression of BC. According to the results, the expression level of miR-671-3p was lower in BC tissues compared with that in adjacent non-tumorous tissues (P=0.048), and the area under the curve was 0.697 (95% confidence interval=0.538-0.856), with a sensitivity and specificity of 0.818 and 0.579, respectively. Forced miR-671-3p expression in the BC cell line MDA-MB-231 evidently arrested cell proliferation and induced cell apoptosis. Furthermore, in silico enrichment analyses suggested that miR-671-3p may be involved in the initiation and progression of BC through the targeting of genes associated with the Wnt signaling pathway. In conclusion, the present study findings suggested that miR-671-3p may function as a tumor suppressor in BC by influencing the Wnt signaling cascade, which provides a prospective molecular target for the therapy of BC. PMID:29620195
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Semi-crystalline photovoltaic polymers with siloxane-terminated hybrid side-chains
Institute of Scientific and Technical Information of China (English)
Yuxiang Li; Seyeong Song; Song Yi Park; Jin Young Kim; Han Young Woo
2017-01-01
Three types of semi-cry stalline photovoltaic polymers were synthesized by incorporating a siloxane-terminated organic/inorganic hybrid side-chain and changing the number of fluorine substituents.A branch point away from a polymer main backbone in the siloxane-containing side-chains and the intra-and/or interchain noncovalent coulombic interactions enhance a chain planarity and facile interchain organization.The resulting polymers formed strongly agglomerated films with high roughness,suggesting strong intermolecular interactions.The optical band gap of ca.1.7 eV was measured for all polymers with a pronounced shoulder peak due to tight π-π stacking.With increasing the fluorine substituents,the frontier energy levels decreased and preferential face-on orientation was observed.The siloxane-terminated side-chains and fluorine substitution promoted the intermolecular packing,showing well resolved lamellar scatterings up to(300) for this series of polymers in the grazing incidence wide angle X-ray scattering measurements.The PPsiDTBT,PPsiDTFBT and PPsiDT2 FBT devices showed a power conversion efficiency of 3.16%,4.40%and 5.65%,respectively,by blending with PC71BM.Langevin-type bimolecular charge recombination was similar for three polymeric solar cells.The main loss in the photocurrent generation for PPsiDTBT:PC71BM was interpreted to originate from the trap assisted charge recombination by measuring light-intensity dependent short-circuit current density(JSC) and open-circuit voltage(VOc).Our results provide a new insight into the rational selection of solubilizing substituents for optimizing crystalline interchain packing with appropriate miscibility with PC71 BM for further optimizing polymer solar cells.
Semi-crystalline photovoltaic polymers with siloxane-terminated hybrid side-chains
Institute of Scientific and Technical Information of China (English)
Yuxiang Li; Seyeong Song; Song Yi Park; Jin Young Kim; Han Young Woo
2017-01-01
Three types of semi-crystalline photovoltaic polymers were synthesized by incorporating a siloxane-terminated organic/inorganic hybrid side-chain and changing the number of fluorine substituents.A branch point away from a polymer main backbone in the siloxane-containing side-chains and the intra-and/or interchain noncovalent coulombic interactions enhance a chain planarity and facile interchain organization.The resulting polymers formed strongly agglomerated films with high roughness,suggesting strong intermolecular interactions.The optical band gap of ca.1.7 eV was measured for all polymers with a pronounced shoulder peak due to tight π-π stacking.With increasing the fluorine substituents,the frontier energy levels decreased and preferential face-on orientation was observed.The siloxane-terminated side-chains and fluorine substitution promoted the intermolecular packing,showing well resolved lamellar scatterings up to (300) for this series of polymers in the grazing incidence wide angle X-ray scattering measurements.The PPsiDTBT,PPsiDTFBT and PPsiDT2FBT devices showed a power conversion efficiency of 3.16%,4.40% and 5.65%,respectively,by blending with PC71BM.Langevin-type bimolecular charge recombination was similar for three polymeric solar cells.The main loss in the photocurrent generation for PPsiDTBT:PC71BM was interpreted to originate from the trap assisted charge recombination by measuring light-intensity dependent short-circuit current density (Jsc) and open-circuit voltage (Voc).Our results provide a new insight into the rational selection of solubilizing substituents for optimizing crystalline interchain packing with appropriate miscibility with PC71BM for further optimizing polymer solar cells.
Quantitation of the mRNA expression of the epidermal growth factor system
DEFF Research Database (Denmark)
Sørensen, B S; Tørring, N; Bor, M V
2000-01-01
) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...
Foley, Joseph W; Sidow, Arend
2013-01-01
BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF's direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF's motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.
Foley, Joseph W
2013-10-20
BACKGROUND: High-occupancy target (HOT) regions are compact genome loci occupied by many different transcription factors (TFs). HOT regions were initially defined in invertebrate model organisms, and we here show that they are a ubiquitous feature of the human gene-regulation landscape. RESULTS: We identified HOT regions by a comprehensive analysis of ChIP-seq data from 96 DNA-associated proteins in 5 human cell lines. Most HOT regions co-localize with RNA polymerase II binding sites, but many are not near the promoters of annotated genes. At HOT promoters, TF occupancy is strongly predictive of transcription preinitiation complex recruitment and moderately predictive of initiating Pol II recruitment, but only weakly predictive of elongating Pol II and RNA transcript abundance. TF occupancy varies quantitatively within human HOT regions; we used this variation to discover novel associations between TFs. The sequence motif associated with any given TF\\'s direct DNA binding is somewhat predictive of its empirical occupancy, but a great deal of occupancy occurs at sites without the TF\\'s motif, implying indirect recruitment by another TF whose motif is present. CONCLUSIONS: Mammalian HOT regions are regulatory hubs that integrate the signals from diverse regulatory pathways to quantitatively tune the promoter for RNA polymerase II recruitment.
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
Chen, Qianqian; Xie, Qian; Zhao, Min; Chen, Bin; Gao, Shi; Zhang, Haishan; Xing, Hua; Ma, Qingjie
2015-01-01
To compare the diagnostic value of visual and semi-quantitative analysis of technetium-99m-poly-ethylene glycol, 4-arginine-glycine-aspartic acid ((99m)Tc-3PRGD2) scintimammography (SMG) for better differentiation of benign from malignant breast masses, and also investigate the incremental role of semi-quantitative index of SMG. A total of 72 patients with breast lesions were included in the study. Technetium-99m-3PRGD2 SMG was performed with single photon emission computed tomography (SPET) at 60 min after intravenous injection of 749 ± 86MBq of the radiotracer. Images were evaluated by visual interpretation and semi-quantitative indices of tumor to non-tumor (T/N) ratios, which were compared with pathology results. Receiver operating characteristics (ROC) curve analyses were performed to determine the optimal visual grade, to calculate cut-off values of semi-quantitative indices, and to compare visual and semi-quantitative diagnostic values. Among the 72 patients, 89 lesions were confirmed by histopathology after fine needle aspiration biopsy or surgery, 48 malignant and 41 benign lesions. The mean T/N ratio of (99m)Tc-3PRGD2 SMG in malignant lesions was significantly higher than that in benign lesions (Pvalue for the detection of primary breast cancer, the sensitivity, specificity and accuracy were 81.3%, 70.7%, and 76.4%, respectively. When a T/N ratio of 2.01 was used as cut-off value, the sensitivity, specificity and accuracy were 79.2%, 75.6%, and 77.5%, respectively. According to ROC analysis, the area under the curve for semi-quantitative analysis was higher than that for visual analysis, but the statistical difference was not significant (P=0.372). Compared with visual analysis or semi-quantitative analysis alone, the sensitivity, specificity and accuracy of visual analysis combined with semi-quantitative analysis in diagnosing primary breast cancer were higher, being: 87.5%, 82.9%, and 85.4%, respectively. The area under the curve was 0.891. Results of
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Validation of a Semi-Quantitative Food Frequency Questionnaire for Argentinean Adults
Dehghan, Mahshid; del Cerro, Silvia; Zhang, Xiaohe; Cuneo, Jose Maini; Linetzky, Bruno; Diaz, Rafael; Merchant, Anwar T.
2012-01-01
BACKGROUND: The Food Frequency Questionnaire (FFQ) is the most commonly used method for ranking individuals based on long term food intake in large epidemiological studies. The validation of an FFQ for specific populations is essential as food consumption is culture dependent. The aim of this study was to develop a Semi-quantitative Food Frequency Questionnaire (SFFQ) and evaluate its validity and reproducibility in estimating nutrient intake in urban and rural areas of Argentina. METHODS/PRI...
International Nuclear Information System (INIS)
Huang Jingxiong; He Xiaojiang; Yu Hao; Wu Hua; Chen Guibing
2009-01-01
Objective: Labial gland biopsy is one of major diagnostic methods for Sjogren's syndrome (SS). Meanwhile, 99 Tc m O 4 - parotid scintigraphy has been proven useful for the clinical evaluation of SS. This study was performed to investigate the correlation between the two examinations and evaluate the semi-quantitative parotid scintigraphy in the early diagnosis and staging for SS patients.Methods: There were 135 SS patients and 30 normal subjects as control group in this study. They all underwent 99 Tc m O 4 - parotid scintigraphy. Semi-quantitative analyses of parotid scintigraphy were conducted with parameters including maximum accumulation ratio (MAR), maximum secretion ratio (MSR), time interval from stimulation to minimum count (t parotid ), prestimulatory oral activity index (PRI) and poststimulatory oral activity index (POI). For comparison, the biopsy of labial gland was performed in each patient and the pathological se-verity was classified into grade 0, 1, 2, 3, 4 (also defined as subgroups). One-way ANOVA and q-teat were applied for the correlation analyses between the two examinations. Results: There was significant difference between pathological subgroup 3 or subgroup 4 and the control in all the semi-quantitative parameters (q=6.79-38.64, P parotid (r=0.364, P 99 Tc m aO 4 - parotid scintigraphy may be well correlated with the pathological severity of labial gland biopsy in SS patients. Further, the semi-quantitative indices especially PRI and POI may be helpful for the early diagnosis and staging of SS patients. (authors)
Directory of Open Access Journals (Sweden)
Olivier Martínez
Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.
Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals
Directory of Open Access Journals (Sweden)
Mayara C. Lombardi
2014-12-01
Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D
2016-12-01
Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.
van Zadelhoff, Claudia; Ehrle, Anna; Merle, Roswitha; Jahn, Werner; Lischer, Christoph
2018-05-09
Scintigraphy is a standard diagnostic method for evaluating horses with back pain due to suspected thoracic processus spinosus pathology. Lesion detection is based on subjective or semi-quantitative assessments of increased uptake. This retrospective, analytical study is aimed to compare semi-quantitative and subjective methods in the evaluation of scintigraphic images of the processi spinosi in the equine thoracic spine. Scintigraphic images of 20 Warmblood horses, presented for assessment of orthopedic conditions between 2014 and 2016, were included in the study. Randomized, blinded image evaluation was performed by 11 veterinarians using subjective and semi-quantitative methods. Subjective grading was performed for the analysis of red-green-blue and grayscale scintigraphic images, which were presented in full-size or as masked images. For the semi-quantitative assessment, observers placed regions of interest over each processus spinosus. The uptake ratio of each processus spinosus in comparison to a reference region of interest was determined. Subsequently, a modified semi-quantitative calculation was developed whereby only the highest counts-per-pixel for a specified number of pixels was processed. Inter- and intraobserver agreement was calculated using intraclass correlation coefficients. Inter- and intraobserver intraclass correlation coefficients were 41.65% and 71.39%, respectively, for the subjective image assessment. Additionally, a correlation between intraobserver agreement, experience, and grayscale images was identified. The inter- and intraobserver agreement was significantly increased when using semi-quantitative analysis (97.35% and 98.36%, respectively) or the modified semi-quantitative calculation (98.61% and 98.82%, respectively). The proposed modified semi-quantitative technique showed a higher inter- and intraobserver agreement when compared to other methods, which makes it a useful tool for the analysis of scintigraphic images. The
Primitive chain network simulations of probe rheology.
Masubuchi, Yuichi; Amamoto, Yoshifumi; Pandey, Ankita; Liu, Cheng-Yang
2017-09-27
Probe rheology experiments, in which the dynamics of a small amount of probe chains dissolved in immobile matrix chains is discussed, have been performed for the development of molecular theories for entangled polymer dynamics. Although probe chain dynamics in probe rheology is considered hypothetically as single chain dynamics in fixed tube-shaped confinement, it has not been fully elucidated. For instance, the end-to-end relaxation of probe chains is slower than that for monodisperse melts, unlike the conventional molecular theories. In this study, the viscoelastic and dielectric relaxations of probe chains were calculated by primitive chain network simulations. The simulations semi-quantitatively reproduced the dielectric relaxation, which reflects the effect of constraint release on the end-to-end relaxation. Fair agreement was also obtained for the viscoelastic relaxation time. However, the viscoelastic relaxation intensity was underestimated, possibly due to some flaws in the model for the inter-chain cross-correlations between probe and matrix chains.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Directory of Open Access Journals (Sweden)
Chieh-Hsien Lai
2017-07-01
Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.
Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A
2008-05-20
Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
A novel semi-quantitative method for measuring tissue bleeding.
Vukcevic, G; Volarevic, V; Raicevic, S; Tanaskovic, I; Milicic, B; Vulovic, T; Arsenijevic, S
2014-03-01
In this study, we describe a new semi-quantitative method for measuring the extent of bleeding in pathohistological tissue samples. To test our novel method, we recruited 120 female patients in their first trimester of pregnancy and divided them into three groups of 40. Group I was the control group, in which no dilation was applied. Group II was an experimental group, in which dilation was performed using classical mechanical dilators. Group III was also an experimental group, in which dilation was performed using a hydraulic dilator. Tissue samples were taken from the patients' cervical canals using a Novak's probe via energetic single-step curettage prior to any dilation in Group I and after dilation in Groups II and III. After the tissue samples were prepared, light microscopy was used to obtain microphotographs at 100x magnification. The surfaces affected by bleeding were measured in the microphotographs using the Autodesk AutoCAD 2009 program and its "polylines" function. The lines were used to mark the area around the entire sample (marked A) and to create "polyline" areas around each bleeding area on the sample (marked B). The percentage of the total area affected by bleeding was calculated using the formula: N = Bt x 100 / At where N is the percentage (%) of the tissue sample surface affected by bleeding, At (A total) is the sum of the surfaces of all of the tissue samples and Bt (B total) is the sum of all the surfaces affected by bleeding in all of the tissue samples. This novel semi-quantitative method utilizes the Autodesk AutoCAD 2009 program, which is simple to use and widely available, thereby offering a new, objective and precise approach to estimate the extent of bleeding in tissue samples.
Araújo, G W; Beyer, C; Arnold, S
2008-07-01
The regulation of mitochondrial energy metabolism plays an essential role in the central nervous system (CNS). Abnormalities of the mitochondrial respiratory chain often accompany neurodegenerative diseases. This makes mitochondria a perfect target for strategies of cellular protection against toxic compounds and pathological conditions. Steroid hormones, such as oestrogen, are well-known to fulfil a protective role in the brain during ischaemic and degenerative processes. Because astrocytes function as the major energy supplier in the CNS, we have analysed oestrogen effects on the mitochondrial respiratory chain of this cell type. In our studies, we applied semi- and quantitative polymerase chain reaction analysis of gene expression and polarographic measurements of the respiratory chain activity of mitochondria. We observed that structural and functional properties were regulated dependent on the oestrogen exposure time and the brain region, but independent of the nuclear oestrogen receptors. We could demonstrate that long-term oestrogen exposure increases the subunit gene expression of respiratory chain complexes and the mitochondrial DNA content, thereby indicating an up-regulation of the amount of mitochondria per cell together with an increase of mitochondrial energy production. This could represent an important indirect mechanism by which long-term oestrogen exposure protects neurones from cell death under neurotoxic conditions. On the other hand, we observed short-term effects of oestrogen on the activity of mitochondrial, proton-pumping respiratory chain complexes. In astrocytes from the cortex, respiratory chain activity was decreased, whereas it was increased in astrocytes from the mesencephalon. An increased production of reactive oxygen species would be the consequence of an increased respiratory chain activity in mesencephalic astrocytes. This could explain the different efficiencies of oestrogen-mediated short-term protection in distinct brain
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer
DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
International Nuclear Information System (INIS)
Gerdes, Kirk; Carter, Kimberly E.
2011-01-01
A process is described by which an ICP-MS equipped with an Octopole Reaction System (ORS) is calibrated using liquid phase standards to facilitate direct analysis of gas phase samples. The instrument response to liquid phase standards is analyzed to produce empirical factors relating ion generation and transmission efficiencies to standard operating parameters. Empirical factors generated for liquid phase samples are then used to produce semi-quantitative analysis of both mixed liquid/gas samples and pure gas samples. The method developed is similar to the semi-quantitative analysis algorithms in the commercial software, which have here been expanded to include gas phase elements such as Xe and Kr. Equations for prediction of relative ionization efficiencies and isotopic transmission are developed for several combinations of plasma operating conditions, which allows adjustment of limited parameters between liquid and gas injection modes. In particular, the plasma temperature and electron density are calculated from comparison of experimental results to the predictions of the Saha equation. Comparisons between operating configurations are made to determine the robustness of the analysis to plasma conditions and instrument operating parameters. Using the methods described in this research, the elemental concentrations in a liquid standard containing 45 analytes and treated as an unknown sample were quantified accurately to ± 50% for most elements using 133 Cs as a single internal reference. The method is used to predict liquid phase mercury within 12% of the actual concentration and gas phase mercury within 28% of the actual concentration. The results verify that the calibration method facilitates accurate semi-quantitative, gas phase analysis of metal species with sufficient sensitivity to quantify metal concentrations lower than 1 ppb for many metallic analytes.
Emission control strategies for short-chain chloroparaffins in two semi-hypothetical case cities
DEFF Research Database (Denmark)
Eriksson, Eva; Revitt, M.; Lützhøft, Hans-Christian Holten
2012-01-01
The short-chain chloroparaffins (SCCP), (C10-13 chloroalkanes) are identified in the European Water Framework Directive, as priority hazardous substances. Within the ScorePP project, the aim is to develop emission control strategies that can be employed to reduce emissions from urban areas...... into receiving waters. Six different scenarios for mitigating SCCP emissions in two different semi-hypothetical case cities representing eastern inland and northern coastal conditions have been evaluated. The analysis, associated with scenario uncertainty, indicates that the EU legislation, Best Available...
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang
2017-07-01
The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Bafadhel M
2015-06-01
Full Text Available Mona Bafadhel,1 Koirobi Haldar,2 Bethan Barker,2,3 Hemu Patel,4 Vijay Mistry,2,3 Michael R Barer,2–4 Ian D Pavord,1 Christopher E Brightling2,3 1Respiratory Medicine Unit, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, UK; 2Department of Infection, Immunity and Inflammation, University of Leicester, 3Institute for Lung Health, National Institute for Health Research Respiratory Biomedical Research Unit, Glenfield Hospital, University of Leicester, 4Department of Clinical Microbiology, University Hospitals of Leicester NHS Trust, Leicester, UK Background: Potentially pathogenic microorganisms can be detected by quantitative real-time polymerase chain reaction (qPCR in sputum from patients with COPD, although how this technique relates to culture and clinical measures of disease is unclear. We used cross-sectional and longitudinal data to test the hypotheses that qPCR is a more sensitive measure of bacterial presence and is associated with neutrophilic airway inflammation and adverse clinical outcomes.Methods: Sputum was collected from 174 stable COPD subjects longitudinally over 12 months. Microbial sampling using culture and qPCR was performed. Spirometry and sputum measures of airway inflammation were assessed.Findings: Sputum was qPCR-positive (>106 copies/mL in 77/152 samples (Haemophilus influenzae [n=52], Moraxella catarrhalis [n=24], Streptococcus pneumoniae [n=19], and Staphylococcus aureus [n=7]. Sputum was culture-positive in 50/174 samples, with 49 out of 50 culture-positive samples having pathogen-specific qPCR bacterial loads >106 copies/mL. Samples that had qPCR copy numbers >106/mL, whether culture-positive or not, had increased sputum neutrophil counts. H. influenzae qPCR copy numbers correlated with sputum neutrophil counts (r=0.37, P<0.001, were repeatable within subjects, and were >106/mL three or more times in 19 patients, eight of whom were repeatedly sputum culture-positive. Persistence, whether
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
Ostovaneh, Mohammad R; Vavere, Andrea L; Mehra, Vishal C; Kofoed, Klaus F; Matheson, Matthew B; Arbab-Zadeh, Armin; Fujisawa, Yasuko; Schuijf, Joanne D; Rochitte, Carlos E; Scholte, Arthur J; Kitagawa, Kakuya; Dewey, Marc; Cox, Christopher; DiCarli, Marcelo F; George, Richard T; Lima, Joao A C
2018-04-03
To determine the diagnostic accuracy of semi-automatic quantitative metrics compared to expert reading for interpretation of computed tomography perfusion (CTP) imaging. The CORE320 multicenter diagnostic accuracy clinical study enrolled patients between 45 and 85 years of age who were clinically referred for invasive coronary angiography (ICA). Computed tomography angiography (CTA), CTP, single photon emission computed tomography (SPECT), and ICA images were interpreted manually in blinded core laboratories by two experienced readers. Additionally, eight quantitative CTP metrics as continuous values were computed semi-automatically from myocardial and blood attenuation and were combined using logistic regression to derive a final quantitative CTP metric score. For the reference standard, hemodynamically significant coronary artery disease (CAD) was defined as a quantitative ICA stenosis of 50% or greater and a corresponding perfusion defect by SPECT. Diagnostic accuracy was determined by area under the receiver operating characteristic curve (AUC). Of the total 377 included patients, 66% were male, median age was 62 (IQR: 56, 68) years, and 27% had prior myocardial infarction. In patient based analysis, the AUC (95% CI) for combined CTA-CTP expert reading and combined CTA-CTP semi-automatic quantitative metrics was 0.87(0.84-0.91) and 0.86 (0.83-0.9), respectively. In vessel based analyses the AUC's were 0.85 (0.82-0.88) and 0.84 (0.81-0.87), respectively. No significant difference in AUC was found between combined CTA-CTP expert reading and CTA-CTP semi-automatic quantitative metrics in patient based or vessel based analyses(p > 0.05 for all). Combined CTA-CTP semi-automatic quantitative metrics is as accurate as CTA-CTP expert reading to detect hemodynamically significant CAD. Copyright © 2018 Society of Cardiovascular Computed Tomography. Published by Elsevier Inc. All rights reserved.
Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR
Directory of Open Access Journals (Sweden)
Adrián Ruiz-Villalba
2017-12-01
Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template âplasmid DNA- and non-template âmouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Monte Carlo simulations towards semi-quantitative prompt gamma activation imaging
International Nuclear Information System (INIS)
Kis, Zoltan; Belgya, Tamas; Szentmiklosi, Laszlo
2011-01-01
Numerous non-destructive techniques utilize neutron attenuation, scattering or capture to gain morphological, structural or elemental information about the material under study. However, few attempts have been made so far to use neutron-induced gamma radiation for 3D element mapping. The first ever facility using direct scanning for element imaging was set up at the Budapest Research Reactor. It was shown that the position-sensitive prompt-gamma detection (PGAI) enables us to determine the spatial distribution of major elements. Iterative Monte Carlo simulation technique has also been developed to provide not only qualitative but also semi-quantitative element distribution of a simple object.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
International Nuclear Information System (INIS)
Petkovska, Iva; Shah, Sumit K.; McNitt-Gray, Michael F.; Goldin, Jonathan G.; Brown, Matthew S.; Kim, Hyun J.; Brown, Kathleen; Aberle, Denise R.
2006-01-01
Purpose: To determine whether conventional nodule densitometry or analysis based on contrast enhancement maps of indeterminate lung nodules imaged with contrast-enhanced CT can distinguish benign from malignant lung nodules. Materials and method: Thin section, contrast-enhanced CT (baseline, and post-contrast series acquired at 45, 90,180, and 360 s) was performed on 29 patients with indeterminate lung nodules (14 benign, 15 malignant). A thoracic radiologist identified the boundary of each nodule using semi-automated contouring to form a 3D region-of-interest (ROI) on each image series. The post-contrast series having the maximum mean enhancement was then volumetrically registered to the baseline series. The two series were subtracted volumetrically and the subtracted voxels were quantized into seven color-coded bins, forming a contrast enhancement map (CEM). Conventional nodule densitometry was performed to obtain the maximum difference in mean enhancement values for each nodule from a circular ROI. Three thoracic radiologists performed visual semi-quantitative analysis of each nodule, scoring each map for: (a) magnitude and (b) heterogeneity of enhancement throughout the entire volume of the nodule on a five-point scale. Receiver operator characteristic (ROC) analysis was conducted on these features to evaluate their diagnostic efficacy. Finally, 14 quantitative texture features were calculated for each map. A statistical analysis was performed to combine the 14 texture features to a single factor. ROC analysis of the derived aggregate factor was done as an indicator of malignancy. All features were analyzed for differences between benign and malignant nodules. Results: Using 15 HU as a threshold, 93% (14/15) of malignant and 79% (11/14) of benign nodules demonstrated enhancement. The ROC curve when higher values of enhancement indicate malignancy was generated and area under the curve (AUC) was 0.76. The visually scored magnitude of enhancement was found to be
Mehdi, Muhammad Zain; Nagi, Abdul Hanan; Naseem, Nadia
2016-01-01
Fuhrman nuclear grade is the most important histological parameter to predict prognosis in a patient of renal cell carcinoma (RCC). However, it suffers from inter-observer and intra-observer variation giving rise to need of a parameter that not only correlates with nuclear grade but is also objective and reproducible. Proliferation is the measure of aggressiveness of a tumour and it is strongly correlated with Fuhrman nuclear grade, clinical survival and recurrence in RCC. Ki-67 is conventionally used to assess proliferation. Mini-chromosome maintenance 2 (MCM-2) is a lesser known marker of proliferation and identifies a greater proliferation faction. This study was designed to assess the prognostic significance of MCM-2 by comparing it with Fuhrman nuclear grade and Ki-67. n=50 cases of various ages, stages, histological subtypes and grades of RCC were selected for this study. Immunohistochemical staining using Ki-67(MIB-1, Mouse monoclonal antibody, Dako) and MCM-2 (Mouse monoclonal antibody, Thermo) was performed on the paraffin embedded blocks in the department of Morbid anatomy and Histopathology, University of Health Sciences, Lahore. Labeling indices (LI) were determined by two pathologists independently using quantitative and semi-quantitative analysis. Statistical analysis was carried out using SPSS 20.0. Kruskall-Wallis test was used to determine a correlation of proliferation markers with grade, and Pearson's correlate was used to determine correlation between the two proliferation markers. Labeling index of MCM-2 (median=24.29%) was found to be much higher than Ki-67(median=13.05%). Both markers were significantly related with grade (p=0.00; Kruskall-Wallis test). LI of MCM-2 was found to correlate significantly with LI of Ki-67(r=0.0934;p=0.01 with Pearson's correlate). Results of semi-quantitative analysis correlated well with quantitative analysis. Both Ki-67 and MCM-2 are markers of proliferation which are closely linked to grade. Therefore, they
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
Identification of four squid species by quantitative real-time polymerase chain reaction.
Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan
2016-02-01
Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.
Quantitative risk stratification in Markov chains with limiting conditional distributions.
Chan, David C; Pollett, Philip K; Weinstein, Milton C
2009-01-01
Many clinical decisions require patient risk stratification. The authors introduce the concept of limiting conditional distributions, which describe the equilibrium proportion of surviving patients occupying each disease state in a Markov chain with death. Such distributions can quantitatively describe risk stratification. The authors first establish conditions for the existence of a positive limiting conditional distribution in a general Markov chain and describe a framework for risk stratification using the limiting conditional distribution. They then apply their framework to a clinical example of a treatment indicated for high-risk patients, first to infer the risk of patients selected for treatment in clinical trials and then to predict the outcomes of expanding treatment to other populations of risk. For the general chain, a positive limiting conditional distribution exists only if patients in the earliest state have the lowest combined risk of progression or death. The authors show that in their general framework, outcomes and population risk are interchangeable. For the clinical example, they estimate that previous clinical trials have selected the upper quintile of patient risk for this treatment, but they also show that expanded treatment would weakly dominate this degree of targeted treatment, and universal treatment may be cost-effective. Limiting conditional distributions exist in most Markov models of progressive diseases and are well suited to represent risk stratification quantitatively. This framework can characterize patient risk in clinical trials and predict outcomes for other populations of risk.
Directory of Open Access Journals (Sweden)
Qinghua Qiu
2018-04-01
Full Text Available Background Freemartinism generally occurs in female offspring of dizygotic twins in a mixed-sex pregnancy. Most bovine heterosexual twin females are freemartins. However, about 10% of bovine heterosexual twin females are fertile. Farmers mostly cull bovine fertile heterosexual twin females due to the lack of a practical diagnostic approach. Culling of such animals results in economic and genetic-material losses both for dairy and beef industry. Methods In this study, a comparative test, including qualitative detection of SRY gene by polymerase chain reaction (PCR, quantitative detection of relative content of SRY by real-time quantitative polymerase chain reaction (qPCR, and quantitative detection of H-Y antigen, was performed to establish the most accurate diagnosis for freemartin. Twelve Holstein heterosexual twin females were used in this study, while three normal Holstein bulls and three normal Holstein cows were used as a positive and negative control, respectively. Results Polymerase chain reaction results revealed that SRY gene were absent in three heterosexual twin females and only two of them were verified as fertile in later age. The qPCR results showed that relative content of SRY was more than 14.2% in freemartins and below 0.41% in fertile heterosexual twin females. The H-Y antigen test showed no significant numerical difference between freemartin and fertile heterosexual twin female. Discussion Our results show that relative content of SRY quantified by qPCR is a better detection method for diagnosis of freemartin in Holstein cattle as compare to qualitative detection of SRY gene by PCR or quantitative detection of H-Y antigen. To the authors’ knowledge, this is the first time we applied qPCR to diagnosing freemartin by quantifying SRY gene and got relative SRY content of each freemartin and fertile heterosexual twin female. We concluded that low-level of SRY would not influence fertility of bovine heterosexual twin female.
Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Quantitative Methods in Supply Chain Management Models and Algorithms
Christou, Ioannis T
2012-01-01
Quantitative Methods in Supply Chain Management presents some of the most important methods and tools available for modeling and solving problems arising in the context of supply chain management. In the context of this book, “solving problems” usually means designing efficient algorithms for obtaining high-quality solutions. The first chapter is an extensive optimization review covering continuous unconstrained and constrained linear and nonlinear optimization algorithms, as well as dynamic programming and discrete optimization exact methods and heuristics. The second chapter presents time-series forecasting methods together with prediction market techniques for demand forecasting of new products and services. The third chapter details models and algorithms for planning and scheduling with an emphasis on production planning and personnel scheduling. The fourth chapter presents deterministic and stochastic models for inventory control with a detailed analysis on periodic review systems and algorithmic dev...
Directory of Open Access Journals (Sweden)
Dikky Indrawan
2018-05-01
Full Text Available Despite extensive efforts to control the highly pathogenic avian influenza (HPAI, it remains endemic in Western Java, Indonesia. To understand the limited effectiveness of HPAI control measures, it is important to map the complex structure of the poultry sector. The governance of the poultry value chain in particular, could play a pivotal role, yet there is limited information on the different chain governance structures and their impacts on HPAI control. This article uses value chain analysis (VCA, focusing on an in-depth assessment of governance structures as well as transaction cost economics and quantitative estimates of the market power of different chain actors, to establish a theoretical framework to examine biosecurity and HPAI control in the Western Java poultry chain. During the research, semi-structured interviews were conducted with key value-chain stakeholders, and the economic performance of identified actors was estimated. Results indicated the co-existence of four different poultry value chains in West Java: the integrator chain, the semi-automated slaughterhouse chain, the controlled slaughter-point chain, and the private slaughter-point chain. The integrator chain was characterized by the highest levels of coordination and a tight, hierarchical governance. In contrast, the other three types of value chains were less coordinated. The market power of the different actors within the four value chains also differed. In more integrated chains, slaughterhouses held considerable market power, while in more informal value chains, market power was in the hands of traders. The economic effects of HPAI and biosecurity measures also varied for the identified actors in the different value chains. Implementation of biosecurity and HPAI control measures was strongly related to the governance structure of the chain, with interactions between different chains and governance structures accentuating the risk of HPAI. Our findings highlight that a
Indrawan, Dikky; Rich, Karl M.; van Horne, Peter; Daryanto, Arief; Hogeveen, Henk
2018-01-01
Despite extensive efforts to control the highly pathogenic avian influenza (HPAI), it remains endemic in Western Java, Indonesia. To understand the limited effectiveness of HPAI control measures, it is important to map the complex structure of the poultry sector. The governance of the poultry value chain in particular, could play a pivotal role, yet there is limited information on the different chain governance structures and their impacts on HPAI control. This article uses value chain analysis (VCA), focusing on an in-depth assessment of governance structures as well as transaction cost economics and quantitative estimates of the market power of different chain actors, to establish a theoretical framework to examine biosecurity and HPAI control in the Western Java poultry chain. During the research, semi-structured interviews were conducted with key value-chain stakeholders, and the economic performance of identified actors was estimated. Results indicated the co-existence of four different poultry value chains in West Java: the integrator chain, the semi-automated slaughterhouse chain, the controlled slaughter-point chain, and the private slaughter-point chain. The integrator chain was characterized by the highest levels of coordination and a tight, hierarchical governance. In contrast, the other three types of value chains were less coordinated. The market power of the different actors within the four value chains also differed. In more integrated chains, slaughterhouses held considerable market power, while in more informal value chains, market power was in the hands of traders. The economic effects of HPAI and biosecurity measures also varied for the identified actors in the different value chains. Implementation of biosecurity and HPAI control measures was strongly related to the governance structure of the chain, with interactions between different chains and governance structures accentuating the risk of HPAI. Our findings highlight that a proper
Indrawan, Dikky; Rich, Karl M; van Horne, Peter; Daryanto, Arief; Hogeveen, Henk
2018-01-01
Despite extensive efforts to control the highly pathogenic avian influenza (HPAI), it remains endemic in Western Java, Indonesia. To understand the limited effectiveness of HPAI control measures, it is important to map the complex structure of the poultry sector. The governance of the poultry value chain in particular, could play a pivotal role, yet there is limited information on the different chain governance structures and their impacts on HPAI control. This article uses value chain analysis (VCA), focusing on an in-depth assessment of governance structures as well as transaction cost economics and quantitative estimates of the market power of different chain actors, to establish a theoretical framework to examine biosecurity and HPAI control in the Western Java poultry chain. During the research, semi-structured interviews were conducted with key value-chain stakeholders, and the economic performance of identified actors was estimated. Results indicated the co-existence of four different poultry value chains in West Java: the integrator chain, the semi-automated slaughterhouse chain, the controlled slaughter-point chain, and the private slaughter-point chain. The integrator chain was characterized by the highest levels of coordination and a tight, hierarchical governance. In contrast, the other three types of value chains were less coordinated. The market power of the different actors within the four value chains also differed. In more integrated chains, slaughterhouses held considerable market power, while in more informal value chains, market power was in the hands of traders. The economic effects of HPAI and biosecurity measures also varied for the identified actors in the different value chains. Implementation of biosecurity and HPAI control measures was strongly related to the governance structure of the chain, with interactions between different chains and governance structures accentuating the risk of HPAI. Our findings highlight that a proper
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Directory of Open Access Journals (Sweden)
Edina Rodrigues Pires
1997-01-01
Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive
Directory of Open Access Journals (Sweden)
Jolita Bekhof
2014-12-01
Conclusion: The reliability of the semi-quantitative measurement of glucosuria in newborn infants using reagent strips is good, even under the conditions of a NICU. Changes in the rating of reagent strips of more than one category are most likely to be beyond measurement error.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Directory of Open Access Journals (Sweden)
Partha Sarathi Mandal
2017-03-01
Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
He, Rong-Quan; Yang, Xia; Liang, Liang; Chen, Gang; Ma, Jie
2018-04-01
The present study aimed to explore the potential clinical significance of microRNA (miR)-124-3p expression in the hepatocarcinogenesis and development of hepatocellular carcinoma (HCC), as well as the potential target genes of functional HCC pathways. Reverse transcription-quantitative polymerase chain reaction was performed to evaluate the expression of miR-124-3p in 101 HCC and adjacent non-cancerous tissue samples. Additionally, the association between miR-124-3p expression and clinical parameters was also analyzed. Differentially expressed genes identified following miR-124-3p transfection, the prospective target genes predicted in silico and the key genes of HCC obtained from Natural Language Processing (NLP) were integrated to obtain potential target genes of miR-124-3p in HCC. Relevant signaling pathways were assessed with protein-protein interaction (PPI) networks, Gene Ontology (GO) enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Protein Annotation Through Evolutionary Relationships (PANTHER) pathway enrichment analysis. miR-124-3p expression was significantly reduced in HCC tissues compared with expression in adjacent non-cancerous liver tissues. In HCC, miR-124-3p was demonstrated to be associated with clinical stage. The mean survival time of the low miR-124-3p expression group was reduced compared with that of the high expression group. A total of 132 genes overlapped from differentially expressed genes, miR-124-3p predicted target genes and NLP identified genes. PPI network construction revealed a total of 109 nodes and 386 edges, and 20 key genes were identified. The major enriched terms of three GO categories included regulation of cell proliferation, positive regulation of cellular biosynthetic processes, cell leading edge, cytosol and cell projection, protein kinase activity, transcription activator activity and enzyme binding. KEGG analysis revealed pancreatic cancer, prostate cancer and non-small cell lung cancer as the
Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František
2017-05-01
The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
A Complete Quantitative Deduction System for the Bisimilarity Distance on Markov Chains
DEFF Research Database (Denmark)
Bacci, Giovanni; Bacci, Giorgio; Larsen, Kim Guldstrand
2017-01-01
In this paper we propose a complete axiomatization of the bisimilarity distance of Desharnais et al. for the class of finite labelled Markov chains. Our axiomatization is given in the style of a quantitative extension of equational logic recently proposed by Mardare, Panangaden, and Plotkin (LICS...... an axiom for dealing with the Kantorovich distance between probability distributions. The axiomatization is then used to propose a metric extension of a Kleene's style representation theorem for finite labelled Markov chains, that was proposed (in a more general coalgebraic fashion) by Silva et al. (Inf...
Directory of Open Access Journals (Sweden)
Woźniakowski Grzegorz
2012-03-01
Full Text Available Abstract Background Waterfowl parvoviruses cause serious loss in geese and ducks production. Goose parvovirus (GPV is infectious for geese and ducks while Muscovy duck parvovirus (MDPV infects Muscovy ducks only. So far, for these viruses' sensitive detection polymerase chain reaction (PCR and loop-mediated isothermal amplification (LAMP were applied. However, there was no molecular biology method for both waterfowl parvoviruses detection and quantification which could unify the laboratory procedures. The level of GPV and MDPV replication and distribution plays a significant role in the parvoviral infection progress and is strictly correlated to clinical symptoms. Meanwhile, experiments conducted previously on GPV distribution in geese, performed as animal trial, did not involve epidemiological data from the disease field cases. The study on the correlation between age, clinical symptoms and viral DNA copy number may be benefitable in understanding the GPV and MDPV infection. Such data may also aid in determination of the stage and severity of the infection with parvoviruses. Therefore the aim of this study was to develop quantitative real-time PCR for parallel detection of GPV and MDPV in geese and Muscovy ducks and to determine the correlation between the age of the infected birds, clinical symptoms and DNA copy number for the estimation of the disease stage or severity. Results In order to develop quantitative real-time PCR the viral material was collected from 13 farms of geese and 3 farms of Muscovy ducks. The designed primers and Taqman probe for real-time PCR were complementary to GPV and MDPV inverted terminal repeats region. The pITR plasmid was constructed, purified and used to prepare dilutions for standard curve preparation and DNA quantification. The applied method detected both GPV and MDPV in all the examined samples extracted from the heart and liver of the infected birds. The conducted correlation tests have shown relationship
Semi-quantitative Data on Ethanol Consumption in 354 ET Cases and 370 Controls
Louis, Elan D.; Michalec, Monika
2014-01-01
The notion that there is an association between essential tremor (ET) and higher ethanol consumption has crept into the literature; however, the data are limited and conflicted. 354 ET cases and 370 matched controls were enrolled in a clinical-epidemiological study. Average current daily ethanol consumption was estimated using the Willett Semi-quantitative Food Frequency Questionnaire. The proportion of cases and controls who drank any ethanol was similar: 66.7% vs. 64.1%, p = 0.46, as was th...
Directory of Open Access Journals (Sweden)
Shyamala G
2008-01-01
Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.
Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír
2016-01-01
We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.
Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K
2016-10-15
The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV). The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus. The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%. The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Abud, J E; Luque, E H; Ramos, J G; Rodriguez, H A
2017-07-01
GST-tagged proteins are important tools for the production of recombinant proteins. Removal of GST tag from its fusion protein, frequently by harsh chemical treatments or proteolytic methods, is often required. Thus, the monitoring of the proteins in tag-free form requires a significant effort to determine the remnants of GST during purification process. In the present study, we developed both a conventional enzyme-linked immunosorbent assay (ELISA) and an immuno-polymerase chain reaction (IPCR) assay, both specific for detection of recombinant GST (rGST). rGST was expressed in Escherichia coli JM109, using a pGEX4T-3 vector, and several anti-rGST monoclonal antibodies were generated using hybridoma technology. Two of these were rationally selected as capture and detection antibodies, allowing the development of a sandwich ELISA with a limit of detection (LOD) of 0.01 μg/ml. To develop the rGST-IPCR assay, we selected "Universal-IPCR" format, comprising the biotin-avidin binding as the coupling system. In addition, the rGST-IPCR was developed in standard PCR tubes, and the surface adsorption of antibodies on PCR tubes, the optimal neutravidin concentrations, the generation of a reporter DNA and the concentration effect were studied and determined. Under optimized assay conditions, the rGST-IPCR assay provided a 100-fold increase in the LOD as well as an expanded working range, in comparison with rGST-ELISA. The proposed method exhibited great potentiality for application in several fields in which measurement of very low levels of GST is necessary, and might provide a model for other IPCR assays. Copyright © 2017 Elsevier Inc. All rights reserved.
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
Energy Technology Data Exchange (ETDEWEB)
Alizai, Hamza; Nardo, Lorenzo; Karampinos, Dimitrios C.; Joseph, Gabby B.; Yap, Samuel P.; Baum, Thomas; Krug, Roland; Majumdar, Sharmila; Link, Thomas M. [University of California, San Francisco, Musculoskeletal and Quantitative Imaging Research Group, Department of Radiology and Biomedical Imaging, San Francisco, CA (United States)
2012-07-15
The goal of this study was to compare the semi-quantitative Goutallier classification for fat infiltration with quantitative fat-fraction derived from a magnetic resonance imaging (MRI) chemical shift-based water/fat separation technique. Sixty-two women (age 61 {+-} 6 years), 27 of whom had diabetes, underwent MRI of the calf using a T1-weighted fast spin-echo sequence and a six-echo spoiled gradient-echo sequence at 3 T. Water/fat images and fat fraction maps were reconstructed using the IDEAL algorithm with T2* correction and a multi-peak model for the fat spectrum. Two radiologists scored fat infiltration on the T1-weighted images using the Goutallier classification in six muscle compartments. Spearman correlations between the Goutallier grades and the fat fraction were calculated; in addition, intra-observer and inter-observer agreement were calculated. A significant correlation between the clinical grading and the fat fraction values was found for all muscle compartments (P < 0.0001, R values ranging from 0.79 to 0.88). Goutallier grades 0-4 had a fat fraction ranging from 3.5 to 19%. Intra-observer and inter-observer agreement values of 0.83 and 0.81 were calculated for the semi-quantitative grading. Semi-quantitative grading of intramuscular fat and quantitative fat fraction were significantly correlated and both techniques had excellent reproducibility. However, the clinical grading was found to overestimate muscle fat. (orig.)
Walker, Martin; Basáñez, María-Gloria; Ouédraogo, André Lin; Hermsen, Cornelus; Bousema, Teun; Churcher, Thomas S
2015-01-16
Quantitative molecular methods (QMMs) such as quantitative real-time polymerase chain reaction (q-PCR), reverse-transcriptase PCR (qRT-PCR) and quantitative nucleic acid sequence-based amplification (QT-NASBA) are increasingly used to estimate pathogen density in a variety of clinical and epidemiological contexts. These methods are often classified as semi-quantitative, yet estimates of reliability or sensitivity are seldom reported. Here, a statistical framework is developed for assessing the reliability (uncertainty) of pathogen densities estimated using QMMs and the associated diagnostic sensitivity. The method is illustrated with quantification of Plasmodium falciparum gametocytaemia by QT-NASBA. The reliability of pathogen (e.g. gametocyte) densities, and the accompanying diagnostic sensitivity, estimated by two contrasting statistical calibration techniques, are compared; a traditional method and a mixed model Bayesian approach. The latter accounts for statistical dependence of QMM assays run under identical laboratory protocols and permits structural modelling of experimental measurements, allowing precision to vary with pathogen density. Traditional calibration cannot account for inter-assay variability arising from imperfect QMMs and generates estimates of pathogen density that have poor reliability, are variable among assays and inaccurately reflect diagnostic sensitivity. The Bayesian mixed model approach assimilates information from replica QMM assays, improving reliability and inter-assay homogeneity, providing an accurate appraisal of quantitative and diagnostic performance. Bayesian mixed model statistical calibration supersedes traditional techniques in the context of QMM-derived estimates of pathogen density, offering the potential to improve substantially the depth and quality of clinical and epidemiological inference for a wide variety of pathogens.
Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette
2017-09-27
Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
Critical analysis: use of polymerase chain reaction to diagnose leprosy
Directory of Open Access Journals (Sweden)
Flaviane Granero Maltempe
Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna
2016-05-01
Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol
Directory of Open Access Journals (Sweden)
Elisabetta Di Giannatale
2010-03-01
Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.
International Nuclear Information System (INIS)
Fazeli, M.; Firoozi, F.
2002-01-01
It well established that myocardial perfusion SPECT with 201 T L or 99 mTc-se sta mi bi play an important role diagnosis and risk assessment in patients with known or suspected coronary artery disease. Both quantitative and qualitative methods are available for interpretation of images. The use of a semi quantitative scoring system in which each of 20 segments is scored according to a five-point scheme provides an approach to interpretation that is more systematic and reproducible than simple qualitative evaluation. Only a limited number of studies have dealt with the interpretive observer reproducibility of 99 mTc-steamboat's myocardial perfusion imaging. The aim of this study was to assess the intra-and inter observer variability of semi quantitative SPECT performed with this technique. Among 789 patients that underwent myocardial perfusion SPECT during last year 80 patients finally need to coronary angiography as gold standard. In this group of patients a semi quantitative visual interpretation was carried out using short axis and vertical long-axis myocardial tomograms and a 20-segments model. These segments we reassigned on six evenly spaced regions in the apical, mid-ventricular, and basal short-axis view and two apical segments on the mid-ventricular long-axis slice. Uptake in each segment was graded on a 5-point scale (0=normal, 1=equivocal, 2=moderate, 3=severe, 4=absence of uptake). The steamboat's images was interpreted separately w ice by two observers without knowledge of each other's findings or results of angiography. A SPECT study was judged abnormal if there were two or more segments with a stress score equal or more than 2. We con eluded that semi-quantitative visual analysis is a simple and reproducible method of interpretation
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Embryonation of Ostertagia ostertagi eggs affects the outcome of real-time quantitative PCR
DEFF Research Database (Denmark)
Drag, Markus; Höglund, Johan; Nejsum, Peter
prior to detection and quantification by real-time quantitative polymerase chain reaction (qPCR). Fresh O. ostertagi eggs were isolated from cattle faeces and stored at 4°C or 25°C under aerobic or anaerobic conditions. Embryonation was monitored by microscopy and the ITS2 copies were determined by q...... the outcome of qPCR analysis for the quantitative determination of O. ostertagi eggs in cattle faeces. Cold storage at 4°C for up to 3 days or anaerobicvacuum packing at 25°C for up to 336 h will entail no undesirable effects on ITS2 copies....
Embryonation of Ostertagia ostertagi eggs affects the outcome of real-time quantitative PCR
DEFF Research Database (Denmark)
Drag, Markus; Höglund, Johan; Nejsum, Peter
prior to detection and quantification by real-time quantitative polymerase chain reaction (qPCR) . Fresh O. ostertagi eggs were isolated from cattle faeces and stored at 4°C or 25°C under aerobic or anaerobic conditions. Embryonation was monitored by microscopy and the ITS2 copies were determined by q...... the outcome of qPCR analysis for the quantitative determination of O. ostertagi eggs in cattle faeces. Cold storage at 4°C for up to 3 days or anaerobic vacuum packing at 25°C for up to 336 h will entail no undesirable effects on ITS2 copies....
Directory of Open Access Journals (Sweden)
Carlo Mengoli
2009-06-01
Full Text Available Background Trichomonas vaginalis is the most common nonviral sexually trasmitted diseases (STDs agent. For females, the diagnostic gold standard is the culture of vaginal swab, which is labour-exacting.The direct microscopic examination of vaginal secretions is the most used approach, but its sensitivity depends on the skill of the observer. Objectives We evaluated an original real-time TaqMan-based Polymerase Chain Reaction (PCR technique.The scope of the study was to confirm the effectiveness of the molecular approach in a clinical context and to explore its relevance to an epidemiological investigation. Study Design a ß-tubulin gene was chosen as target sequence.The assay was designed to exploit the quantitative potential of the TaqMan procedure.The population sample was 583 adult females presenting at the Service from January 2005 to December 2005.Three vaginal swabs were collected from each patient, one for wet mount microscopy, one for broth culture, and one for the molecular assay. Results The prevalence was 3.3% (culture, 3.1% (microscopy, 3.8% (PCR.An excess risk was detected in the immigrant population (risk ratio by PCR = 28. Conclusions The molecular approach was the most accurate way to detect the protozoon.The real-time PCR is convenient in a busy laboratory, provided the necessary equipment is available, and it is suitable for epidemiological investigation.
Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M
2011-07-01
Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.
Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha
2017-09-19
The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Silvar, C; Díaz, J; Merino, F
2005-12-01
ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Aide, Nicolas; Louis, Marie-Hélène; Dutoit, Soizic; Labiche, Alexandre; Lemoisson, Edwige; Briand, Mélanie; Nataf, Valérie; Poulain, Laurent; Gauduchon, Pascal; Talbot, Jean-Noël; Montravers, Françoise
2007-10-01
To evaluate the accuracy of semi-quantitative small-animal PET data, uncorrected for attenuation, and then of the same semi-quantitative data corrected by means of recovery coefficients (RCs) based on phantom studies. A phantom containing six fillable spheres (diameter range: 4.4-14 mm) was filled with an 18F-FDG solution (spheres/background activity=10.1, 5.1 and 2.5). RCs, defined as measured activity/expected activity, were calculated. Nude rats harbouring tumours (n=50) were imaged after injection of 18F-FDG and sacrificed. The standardized uptake value (SUV) in tumours was determined with small-animal PET and compared to ex-vivo counting (ex-vivo SUV). Small-animal PET SUVs were corrected with RCs based on the greatest tumour diameter. Tumour proliferation was assessed with cyclin A immunostaining and correlated to the SUV. RCs ranged from 0.33 for the smallest sphere to 0.72 for the largest. A sigmoidal correlation was found between RCs and sphere diameters (r(2)=0.99). Small-animal PET SUVs were well correlated with ex-vivo SUVs (y=0.48x-0.2; r(2)=0.71) and the use of RCs based on the greatest tumour diameter significantly improved regression (y=0.84x-0.81; r(2)=0.77), except for tumours with important necrosis. Similar results were obtained without sacrificing animals, by using PET images to estimate tumour dimensions. RC-based corrections improved correlation between small-animal PET SUVs and tumour proliferation (uncorrected data: Rho=0.79; corrected data: Rho=0.83). Recovery correction significantly improves both accuracy of small-animal PET semi-quantitative data in rat studies and their correlation with tumour proliferation, except for largely necrotic tumours.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Zheng, Wenjun; Wang, Qingsong; Bi, Qun
2016-04-01
Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Nikhil Moorchung
2011-01-01
Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza
2016-01-01
This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Templar, Alexander; Woodhouse, Stefan; Keshavarz-Moore, Eli; Nesbeth, Darren N
2016-08-01
Advances in synthetic genomics are now well underway in yeasts due to the low cost of synthetic DNA. These new capabilities also bring greater need for quantitating the presence, loss and rearrangement of loci within synthetic yeast genomes. Methods for achieving this will ideally; i) be robust to industrial settings, ii) adhere to a global standard and iii) be sufficiently rapid to enable at-line monitoring during cell growth. The methylotrophic yeast Pichia pastoris (P. pastoris) is increasingly used for industrial production of biotherapeutic proteins so we sought to answer the following questions for this particular yeast species. Is time-consuming DNA purification necessary to obtain accurate end-point polymerase chain reaction (e-pPCR) and quantitative PCR (qPCR) data? Can the novel linear regression of efficiency qPCR method (LRE qPCR), which has properties desirable in a synthetic biology standard, match the accuracy of conventional qPCR? Does cell cultivation scale influence PCR performance? To answer these questions we performed e-pPCR and qPCR in the presence and absence of cellular material disrupted by a mild 30s sonication procedure. The e-pPCR limit of detection (LOD) for a genomic target locus was 50pg (4.91×10(3) copies) of purified genomic DNA (gDNA) but the presence of cellular material reduced this sensitivity sixfold to 300pg gDNA (2.95×10(4) copies). LRE qPCR matched the accuracy of a conventional standard curve qPCR method. The presence of material from bioreactor cultivation of up to OD600=80 did not significantly compromise the accuracy of LRE qPCR. We conclude that a simple and rapid cell disruption step is sufficient to render P. pastoris samples of up to OD600=80 amenable to analysis using LRE qPCR which we propose as a synthetic biology standard. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
A. van der Zee (Anneke); L.D. Roorda (Lieuwe); G. Bosman (Gerda); J.M. Ossewaarde (Jacobus)
2016-01-01
textabstractBackground The objective of our study was the development of a semi-quantitative real-time PCR to detect uropathogens. Two multiplex PCR reactions were designed to detect Escherichia coli, Klebsiella spp., Enterobacter spp., Citrobacter spp., Proteus mirabilis, Enterococcus faecalis, and
Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian
2016-01-01
Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
PIQMIe: a web server for semi-quantitative proteomics data management and analysis.
Kuzniar, Arnold; Kanaar, Roland
2014-07-01
We present the Proteomics Identifications and Quantitations Data Management and Integration Service or PIQMIe that aids in reliable and scalable data management, analysis and visualization of semi-quantitative mass spectrometry based proteomics experiments. PIQMIe readily integrates peptide and (non-redundant) protein identifications and quantitations from multiple experiments with additional biological information on the protein entries, and makes the linked data available in the form of a light-weight relational database, which enables dedicated data analyses (e.g. in R) and user-driven queries. Using the web interface, users are presented with a concise summary of their proteomics experiments in numerical and graphical forms, as well as with a searchable protein grid and interactive visualization tools to aid in the rapid assessment of the experiments and in the identification of proteins of interest. The web server not only provides data access through a web interface but also supports programmatic access through RESTful web service. The web server is available at http://piqmie.semiqprot-emc.cloudlet.sara.nl or http://www.bioinformatics.nl/piqmie. This website is free and open to all users and there is no login requirement. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...
Quantitative phylogenetic assessment of microbial communities indiverse environments
Energy Technology Data Exchange (ETDEWEB)
von Mering, C.; Hugenholtz, P.; Raes, J.; Tringe, S.G.; Doerks,T.; Jensen, L.J.; Ward, N.; Bork, P.
2007-01-01
The taxonomic composition of environmental communities is an important indicator of their ecology and function. Here, we use a set of protein-coding marker genes, extracted from large-scale environmental shotgun sequencing data, to provide a more direct, quantitative and accurate picture of community composition than traditional rRNA-based approaches using polymerase chain reaction (PCR). By mapping marker genes from four diverse environmental data sets onto a reference species phylogeny, we show that certain communities evolve faster than others, determine preferred habitats for entire microbial clades, and provide evidence that such habitat preferences are often remarkably stable over time.
DEFF Research Database (Denmark)
Ammitzbøll-Danielsen, Mads; Østergaard, Mikkel; Naredo, Esperanza
2016-01-01
OBJECTIVES: The aim was to evaluate the metric properties of the semi-quantitative OMERACT US scoring system vs a novel quantitative US scoring system for tenosynovitis, by testing its intra- and inter-reader reliability, sensitivity to change and comparison with clinical tenosynovitis scoring...... in a 6-month follow-up study. METHODS: US and clinical assessments of the tendon sheaths of the clinically most affected hand and foot were performed at baseline, 3 and 6 months in 51 patients with RA. Tenosynovitis was assessed using the semi-quantitative scoring system (0-3) proposed by the OMERACT US...... tenosynovitis score was performed, calculating a sum score per patient. RESULTS: The intra- and inter-observer agreements for US tenosynovitis assessments were very good at baseline and for change for GS and CD, but less good for PI. The smallest detectable change was 0.97 for GS, 0.93 for CD and 30.1 for PI...
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum
Directory of Open Access Journals (Sweden)
Ching Giap Tan
2014-09-01
Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
Brucella contamination in raw milk by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2016-10-01
Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of
A semi-quantitative reasoning methodology for filtering and ranking HAZOP results in HAZOPExpert
International Nuclear Information System (INIS)
Vaidhyanathan, Ramesh; Venkatasubramanian, Venkat
1996-01-01
Hazard and Operability (HAZOP) analysis is the most widely used and recognized as the preferred Process Hazards Analysis (PHA) approach in the chemical process industry. Recently, a diagraph-model based framework and an expert system called HAZOPExpert was developed for automating this analysis. Upon testing the performance of the system on various industrial case studies. HAZOPExpert was found to successfully mimic the human expert's reasoning and identify the hazards. But, with the increasing complexity of the processes, the HAZOPExpert system generated a large number of consequences compared to those identified by a team of experts. This is mainly due to the strict qualitative reasoning approach implemented in the HAZOPExpert system. In order to filter and rank the consequences generated by the HAZOPExpert system, a semi-quantitative reasoning methodology is proposed using additional quantitative knowledge in the form of design and operating specifications of the process units, and process material property values. This filtering approach combines the qualitative digraph-based HAZOP models and the quantitative knowledge to eliminate the unrealizable consequences. Significant reduction in the number of consequences was obtained using this approach on an ethylene process plant HAZOP case study
Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş
2018-03-15
To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (pClostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Directory of Open Access Journals (Sweden)
Gerich M. S.
2012-12-01
Full Text Available Let ${xi(t, x(t}$ be a homogeneous semi-continuous lattice Poisson process on the Markov chain.The jumps of one sign are geometrically distributed, and jumps of the opposite sign are arbitrary latticed distribution. For a suchprocesses the relations for the components of two-sided matrix factorization are established.This relations define the moment genereting functions for extremumf of the process and their complements.
A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.
Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco
2018-01-01
control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Directory of Open Access Journals (Sweden)
Abazar Pournajaf
Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Directory of Open Access Journals (Sweden)
Mini P Singh
2017-01-01
Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.
Faron, Gilles; Vancutsem, Ellen; Naessens, Anne; Buyl, Ronald; Gucciardo, Leonardo; Foulon, Walter
2017-01-01
Objective. This study aimed to compare the qualitative and quantitative reproducibility of quantitative PCR (qPCR) for Ureaplasma species (Ureaplasma spp.) throughout pregnancy and according to the genital sampling site. Study Design. Between 5 and 14 weeks of gestation (T1), vaginal, fornix, and two cervical samples were taken. Sampling was repeated during the 2nd (T2) and 3rd (T3) trimester in randomly selected T1 positive and negative women. Qualitative and quantitative reproducibility wer...
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
International Nuclear Information System (INIS)
Hu, Hao; Xu, Xiao-Quan; Liu, Hu; Hong, Xun-Ning; Shi, Hai-Bin; Wu, Fei-Yun
2017-01-01
Objectives: To assess the value of dynamic contrast-enhanced MR imaging (DCE-MRI) in differentiating benign from malignant orbital lymphoproliferative disorders (OLPDs). Methods: Thirty-nine patients with orbital lymphoproliferative disorders (21 malignant and 18 benign) underwent DCE-MRI scan for pre-treatment evaluation from March 2013 to December 2015. Both semi-quantitative (TTP, AUC, Slope max ) and quantitative (K trans , k ep , v e ) parameters were calculated, and compared between two groups. Receiver operating characteristic (ROC) curve analyses were used to determine the diagnostic value of each significant parameter. Results: Malignant OLPDs showed significantly higher k ep , lower v e , and lower AUC than benign OLPDs, while no significant differences were found on K trans , TTP and Slope max . ROC analyses indicated that v e exhibited the best diagnostic performance in predicting malignant OLPDs (cutoff value, 0.211; area under the curve, 0.896; sensitivity, 76.2%; specificity, 94.9%), followed by k ep (cutoff value, 0.853; area under the curve, 0.839; sensitivity, 85.7%; specificity, 89.9%). Conclusion: DCE-MRI and specially its derived quantitative parameters of k ep and v e are promising metrics for differentiating malignant from benign OLPDs.
Alizai, Hamza; Nardo, Lorenzo; Karampinos, Dimitrios C; Joseph, Gabby B; Yap, Samuel P; Baum, Thomas; Krug, Roland; Majumdar, Sharmila; Link, Thomas M
2012-07-01
The goal of this study was to compare the semi-quantitative Goutallier classification for fat infiltration with quantitative fat-fraction derived from a magnetic resonance imaging (MRI) chemical shift-based water/fat separation technique. Sixty-two women (age 61 ± 6 years), 27 of whom had diabetes, underwent MRI of the calf using a T1-weighted fast spin-echo sequence and a six-echo spoiled gradient-echo sequence at 3 T. Water/fat images and fat fraction maps were reconstructed using the IDEAL algorithm with T2* correction and a multi-peak model for the fat spectrum. Two radiologists scored fat infiltration on the T1-weighted images using the Goutallier classification in six muscle compartments. Spearman correlations between the Goutallier grades and the fat fraction were calculated; in addition, intra-observer and inter-observer agreement were calculated. A significant correlation between the clinical grading and the fat fraction values was found for all muscle compartments (P infiltration of muscle commonly occurs in many metabolic and neuromuscular diseases. • Image-based semi-quantitative classifications for assessing fat infiltration are not well validated. • Quantitative MRI techniques provide an accurate assessment of muscle fat.
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
International Nuclear Information System (INIS)
Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng
2007-01-01
Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Vautrin, Sonia; Zhang, David
2007-01-01
A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.
Komninaka, Veroniki; Kolomodi, Dionysia; Christoulas, Dimitrios; Marinakis, Theodoros; Papatheodorou, Athanasios; Repa, Konstantina; Voskaridou, Ersi; Revenas, Konstantinos; Terpos, Evangelos
2015-10-01
The aim of this study was to evaluate bone involvement in patients with Gaucher disease (GD) and to propose a novel semi-quantitative magnetic resonance imaging (MRI) staging. MRI of the lumbar spine, femur, and tibia was performed in 24 patients with GD and 24 healthy controls. We also measured circulating levels of C-C motif ligand-3 (CCL-3) chemokine, C-telopeptide of collagen type-1 (CTX), and tartrate-resistant acid phosphatase isoform type-b (TRACP-5b). We used the following staging based on MRI data: stage I: region of interest (ROI) 1/2 of normal values and bone infiltration up to 30%; stage II: ROI 1/3 of normal values and bone infiltration from 30 to 60%; stage III: ROI 1/4 of normal values and bone infiltration from 60% to 80%; and stage IV: detection of epiphyseal infiltration, osteonecrosis and deformity regardless of the ROI's values. All but two patients had abnormal MRI findings: 9 (37.5%), 6 (25%), 3 (12.5%), and 4 (16.7%) had stages I-IV, respectively. Patients with GD had elevated chitotriosidase, serum TRACP-5b, and CCL-3 levels (P < 0.001). We propose an easily reproducible semi-quantitative scoring system and confirm that patients with GD have abnormal MRI bone findings and enhanced osteoclast activity possibly due to elevated CCL-3. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Identification of duck plague virus by polymerase chain reaction
Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto
International Nuclear Information System (INIS)
Patriarca, Riccardo; Di Gravio, Giulio; Costantino, Francesco; Tronci, Massimo
2017-01-01
Environmental auditing is a main issue for any production plant and assessing environmental performance is crucial to identify risks factors. The complexity of current plants arises from interactions among technological, human and organizational system components, which are often transient and not easily detectable. The auditing thus requires a systemic perspective, rather than focusing on individual behaviors, as emerged in recent research in the safety domain for socio-technical systems. We explore the significance of modeling the interactions of system components in everyday work, by the application of a recent systemic method, i.e. the Functional Resonance Analysis Method (FRAM), in order to define dynamically the system structure. We present also an innovative evolution of traditional FRAM following a semi-quantitative approach based on Monte Carlo simulation. This paper represents the first contribution related to the application of FRAM in the environmental context, moreover considering a consistent evolution based on Monte Carlo simulation. The case study of an environmental risk auditing in a sinter plant validates the research, showing the benefits in terms of identifying potential critical activities, related mitigating actions and comprehensive environmental monitoring indicators. - Highlights: • We discuss the relevance of a systemic risk based environmental audit. • We present FRAM to represent functional interactions of the system. • We develop a semi-quantitative FRAM framework to assess environmental risks. • We apply the semi-quantitative FRAM framework to build a model for a sinter plant.
Energy Technology Data Exchange (ETDEWEB)
Patriarca, Riccardo, E-mail: riccardo.patriarca@uniroma1.it; Di Gravio, Giulio; Costantino, Francesco; Tronci, Massimo
2017-03-15
Environmental auditing is a main issue for any production plant and assessing environmental performance is crucial to identify risks factors. The complexity of current plants arises from interactions among technological, human and organizational system components, which are often transient and not easily detectable. The auditing thus requires a systemic perspective, rather than focusing on individual behaviors, as emerged in recent research in the safety domain for socio-technical systems. We explore the significance of modeling the interactions of system components in everyday work, by the application of a recent systemic method, i.e. the Functional Resonance Analysis Method (FRAM), in order to define dynamically the system structure. We present also an innovative evolution of traditional FRAM following a semi-quantitative approach based on Monte Carlo simulation. This paper represents the first contribution related to the application of FRAM in the environmental context, moreover considering a consistent evolution based on Monte Carlo simulation. The case study of an environmental risk auditing in a sinter plant validates the research, showing the benefits in terms of identifying potential critical activities, related mitigating actions and comprehensive environmental monitoring indicators. - Highlights: • We discuss the relevance of a systemic risk based environmental audit. • We present FRAM to represent functional interactions of the system. • We develop a semi-quantitative FRAM framework to assess environmental risks. • We apply the semi-quantitative FRAM framework to build a model for a sinter plant.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-12-01
Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.
Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia
International Nuclear Information System (INIS)
Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.
2014-01-01
Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Directory of Open Access Journals (Sweden)
Gabriel Adrian Popescu
2018-03-01
Full Text Available Aims: To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. Methods: A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. Results: The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years; 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%. Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL, and the majority were polymerase chain reaction ribotype 027 (p<0.0001. Conclusion: The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Factors influencing extent of traceability along organic fresh produce value chains
DEFF Research Database (Denmark)
Gichure, Josphat Njenga; Wahome, Raphael Githaiga; Njage, Patrick M.Kamau
2017-01-01
Information asymmetry is often a characteristic present in food value chains. However, high information asymmetry reduces trust and may compromise food safety and quality. Traceability enhances information sharing and disclosure thereby reducing the imperfection. Qualitative and quantitative data...... was collected from Kenyan certified farmers and organic outlets to generate empirical information on the extent and factors that contribute to traceability along organic kale value chains. Interviews were conducted using a semi-structured questionnaire. Data was analysed using descriptive statistics and factor.......754), certification by other quality management standards (0.711), training on food safety and traceability management (0.444) and system monitoring (0.770). Such knowledge can be used by players along the value chain to reduce information asymmetry. The results suggest need for awareness creation among stakeholders...
Wen, Dong-Yue; Lin, Peng; Pang, Yu-Yan; Chen, Gang; He, Yun; Dang, Yi-Wu; Yang, Hong
2018-05-05
BACKGROUND Long non-coding RNAs (lncRNAs) have a role in physiological and pathological processes, including cancer. The aim of this study was to investigate the expression of the long intergenic non-protein coding RNA 665 (LINC00665) gene and the cell cycle in hepatocellular carcinoma (HCC) using database analysis including The Cancer Genome Atlas (TCGA), the Gene Expression Omnibus (GEO), and quantitative real-time polymerase chain reaction (qPCR). MATERIAL AND METHODS Expression levels of LINC00665 were compared between human tissue samples of HCC and adjacent normal liver, clinicopathological correlations were made using TCGA and the GEO, and qPCR was performed to validate the findings. Other public databases were searched for other genes associated with LINC00665 expression, including The Atlas of Noncoding RNAs in Cancer (TANRIC), the Multi Experiment Matrix (MEM), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction (PPI) networks. RESULTS Overexpression of LINC00665 in patients with HCC was significantly associated with gender, tumor grade, stage, and tumor cell type. Overexpression of LINC00665 in patients with HCC was significantly associated with overall survival (OS) (HR=1.47795%; CI: 1.046-2.086). Bioinformatics analysis identified 469 related genes and further analysis supported a hypothesis that LINC00665 regulates pathways in the cell cycle to facilitate the development and progression of HCC through ten identified core genes: CDK1, BUB1B, BUB1, PLK1, CCNB2, CCNB1, CDC20, ESPL1, MAD2L1, and CCNA2. CONCLUSIONS Overexpression of the lncRNA, LINC00665 may be involved in the regulation of cell cycle pathways in HCC through ten identified hub genes.
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.
1998-01-01
A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed
Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.
2004-01-01
We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Supply chain risk management of newspaper industry: A quantitative study
Sartika, Viny; Hisjam, Muh.; Sutopo, Wahyudi
2018-02-01
The newspaper industry has several distinctive features that make it stands out from other industries. The strict delivery deadline and zero inventory led to a very short time frame for production and distribution. On the other hand, there is pressure from the newsroom to encourage the start of production as slowly as possible in order to enter the news, while there is pressure from production and distribution to start production as early as possible. Supply chain risk management is needed in determining the best strategy for dealing with possible risks in the newspaper industry. In a case study of a newspaper in Surakarta, quantitative approaches are made to the newspaper supply chain risk management by calculating the expected cost of risk based on the magnitude of the impact and the probability of a risk event. From the calculation results obtained that the five risks with the highest value are newspaper delays to the end customer, broken plate, miss print, down machine, and delayed delivery of newspaper content. Then analyzed appropriate mitigation strategies to cope with such risk events.
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao; Xu, Xiao-Quan [Department of Radiology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Liu, Hu [Department of Ophthalmology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Hong, Xun-Ning; Shi, Hai-Bin [Department of Radiology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Wu, Fei-Yun, E-mail: wfydd_njmu@163.com [Department of Radiology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China)
2017-03-15
Objectives: To assess the value of dynamic contrast-enhanced MR imaging (DCE-MRI) in differentiating benign from malignant orbital lymphoproliferative disorders (OLPDs). Methods: Thirty-nine patients with orbital lymphoproliferative disorders (21 malignant and 18 benign) underwent DCE-MRI scan for pre-treatment evaluation from March 2013 to December 2015. Both semi-quantitative (TTP, AUC, Slope{sub max}) and quantitative (K{sup trans}, k{sub ep}, v{sub e}) parameters were calculated, and compared between two groups. Receiver operating characteristic (ROC) curve analyses were used to determine the diagnostic value of each significant parameter. Results: Malignant OLPDs showed significantly higher k{sub ep}, lower v{sub e}, and lower AUC than benign OLPDs, while no significant differences were found on K{sup trans}, TTP and Slope{sub max}. ROC analyses indicated that v{sub e} exhibited the best diagnostic performance in predicting malignant OLPDs (cutoff value, 0.211; area under the curve, 0.896; sensitivity, 76.2%; specificity, 94.9%), followed by k{sub ep} (cutoff value, 0.853; area under the curve, 0.839; sensitivity, 85.7%; specificity, 89.9%). Conclusion: DCE-MRI and specially its derived quantitative parameters of k{sub ep} and v{sub e} are promising metrics for differentiating malignant from benign OLPDs.
DEFF Research Database (Denmark)
Horn, P; Schouenborg, P Øland; Brandslund, I
2007-01-01
OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... epidermidis. Reference intervals (CI) and biological variation were evaluated using index of individuality (II) and critical difference (CD). RESULTS: 45% of the participants were positive for S. aureus on all 10 days. Intra-individual biological variation (CVI) was 129% for S. aureus and 62% for S...
Barbu, Vlad
2008-01-01
Semi-Markov processes are much more general and better adapted to applications than the Markov ones because sojourn times in any state can be arbitrarily distributed, as opposed to the geometrically distributed sojourn time in the Markov case. This book concerns with the estimation of discrete-time semi-Markov and hidden semi-Markov processes
Directory of Open Access Journals (Sweden)
Natália Malaguti
2015-01-01
Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
DEFF Research Database (Denmark)
Neergaard, Jesper; Schieber, Jay D.
1999-01-01
A self-consistent reptation model that includes chain stretching, chain-length fluctuations, segment connectivity and constraint release is used to predict transient and steady flows. Quantitative comparisons are made with entangledsolution data. The model is able to capture quantitatively all...
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
Directory of Open Access Journals (Sweden)
Shyamal G
2005-01-01
Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Directory of Open Access Journals (Sweden)
Stewart Don
2008-05-01
Full Text Available Abstract Background Based upon defining a common reference point, current real-time quantitative PCR technologies compare relative differences in amplification profile position. As such, absolute quantification requires construction of target-specific standard curves that are highly resource intensive and prone to introducing quantitative errors. Sigmoidal modeling using nonlinear regression has previously demonstrated that absolute quantification can be accomplished without standard curves; however, quantitative errors caused by distortions within the plateau phase have impeded effective implementation of this alternative approach. Results Recognition that amplification rate is linearly correlated to amplicon quantity led to the derivation of two sigmoid functions that allow target quantification via linear regression analysis. In addition to circumventing quantitative errors produced by plateau distortions, this approach allows the amplification efficiency within individual amplification reactions to be determined. Absolute quantification is accomplished by first converting individual fluorescence readings into target quantity expressed in fluorescence units, followed by conversion into the number of target molecules via optical calibration. Founded upon expressing reaction fluorescence in relation to amplicon DNA mass, a seminal element of this study was to implement optical calibration using lambda gDNA as a universal quantitative standard. Not only does this eliminate the need to prepare target-specific quantitative standards, it relegates establishment of quantitative scale to a single, highly defined entity. The quantitative competency of this approach was assessed by exploiting "limiting dilution assay" for absolute quantification, which provided an independent gold standard from which to verify quantitative accuracy. This yielded substantive corroborating evidence that absolute accuracies of ± 25% can be routinely achieved. Comparison
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-11-27
Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Directory of Open Access Journals (Sweden)
K. Rathore
2018-04-01
Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.
On Darboux-integrable semi-discrete chains
International Nuclear Information System (INIS)
Habibullin, Ismagil; Sakieva, Alfia; Zheltukhina, Natalya
2010-01-01
A differential-difference equation d/dx t (n+1,x) = f(x,t(n,x),t(n+1,x),d/dx t (n,x)) with unknown t(n, x) depending on the continuous and discrete variables x and n is studied. We call an equation of such kind Darboux integrable if there exist two functions (called integrals) F and I of a finite number of dynamical variables such that D x F = 0 and DI = I, where D x is the operator of total differentiation with respect to x and D is the shift operator: Dp(n) = p(n + 1). It is proved that the integrals can be brought to some canonical form. A method of construction of an explicit formula for a general solution to Darboux-integrable chains is discussed and such solutions are found for a class of chains.
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.
1989-01-01
Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions
Espinoza-León, Fabiola; Arocha, Francisco; Hassanhi, Manzur; Arévalo, Julio
2010-09-01
Borrelia burgdorferi is the causative agent of Lyme Borreliosis, an infectious multisystemic disease transmitted to humans by the Ixodes ticks bite. A possible association of Borrelia burgdorferi with localized scleroderma has been postulated. However, published data do not provide unequivocal results. Previous serologic analysis of patients with localized scleroderma in South American countries (including Venezuela), have been reported as yielding some reactivity. The present study looked for evidence of Borrelia burgdorferi infection in venezuelan patients with localized scleroderma, using the polymerase chain reaction to analyze 21 skin samples of patients with this skin condition. The results were negative in all the samples studied. Our data do not support an association of Borrelia burgdorferi infection and the sclerotic lesions of localized scleroderma; but do not rule out the possibility of a relationship between localized scleroderma and an unknown geno-specie of Borrelia burgdorferi sensu lato complex, a different Borrelia specie or a different spirochetal organism, as the etiological agents of the skin lesions in this area.
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-09-01
Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms
Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M
2003-08-01
Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all
Speicher, David J; Johnson, Newell W
2012-09-11
Human herpesvirus 8 (HHV-8), the aetiological agent of Kaposi's sarcoma (KS), multicentric Castleman's disease (MCD), and primary effusion lymphoma (PEL) is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer) with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively.The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract): When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells). These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well-suited for quantitative detection in whole blood. They are now
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Directory of Open Access Journals (Sweden)
Amanda Mahoney
2012-01-01
Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.
Xia, Minghui; Qi, Qingguo
2013-01-01
We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.
Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David
2007-11-01
To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.
Qin, Xiao-ying; Li, Guo-xuan; Qin, Ya-zhen; Wang, Yu; Wang, Feng-rong; Liu, Dai-hong; Xu, Lan-ping; Chen, Huan; Han, Wei; Wang, Jing-zhi; Zhang, Xiao-hui; Li, Jin-lan; Li, Ling-di; Liu, Kai-yan; Huang, Xiao-jun
2011-08-01
Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7) informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative assessment of mixed chimerism that can be useful in predicting graft rejection and early relapse.
Majidiani, Hamidreza; Nabavi, Reza; Ganjali, Maryam; Saadati, Dariush
2015-01-01
Theileria annulata is common in tropical and subtropical regions especially in Iran and causes great economic losses in cattle industry. In Iran the epidemiological aspects of bovine theileriosis in different breeds of cattle is poorly understood. The aim of present study is comparison of the number of T. annulata carriers in the two major cattle breeds (Holstein–Friesian and Sistani) in Sistan of Iran by giemsa and polymerase chain reaction (PCR) methods. During winter 2013, 160 native cattl...
Directory of Open Access Journals (Sweden)
CUNHA Regina Ayr Florio da
1998-01-01
Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.
Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum
2014-08-01
A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kiarash Ghazvini
2012-01-01
Full Text Available Planning for appropriate preventive measures against Chlamydia trachomatis, a common cause of sexually transmitted disease, requires knowledge of prevalence of infection so that interventions can be targeted in a cost-effective manner. This study was performed on 178 male patients presenting with urethritis in the Mashhad province to determine the prevalence of chlamydial infection in Northeast Iran. A cotton swab and first voided urine specimen were collected according to standard procedures. Polymerase chain reaction (PCR tests were used for the detection of C. trachomatis in the specimens collected and the results were analyzed using SPSS program. Results showed that 10.6% of male patients in this group were infected with C. trachomatis. This study provides strong evidence that prevalence of Chlamydia in the Northeast Iran is high and suggests that Chlamydia screening as a routine part of STD investigations is highly necessary in this area.
Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M
2015-03-01
This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Speicher David J
2012-09-01
Full Text Available Abstract Background Human herpesvirus 8 (HHV-8, the aetiological agent of Kaposi’s sarcoma (KS, multicentric Castleman’s disease (MCD, and primary effusion lymphoma (PEL is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. Methods A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. Results The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively. The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract: When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells. Conclusions These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well