FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

[Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

Science.gov (United States)

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2016-01-01

Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

1995-01-01

Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

International Nuclear Information System (INIS)

Kosaka, T.; Kuwabara, M.; Koide, F.

1992-01-01

Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Activity-based in vitro selection of T4 DNA ligase

International Nuclear Information System (INIS)

Takahashi, Fumio; Funabashi, Hisakage; Mie, Masayasu; Endo, Yaeta; Sawasaki, Tatsuya; Aizawa, Masuo; Kobatake, Eiry

2005-01-01

Recent in vitro methodologies for selection and directed evolution of proteins have concentrated not only on proteins with affinity such as single-chain antibody but also on enzymes. We developed a display technology for selection of T4 DNA ligase on ribosome because an in vitro selection method for DNA ligase had never been developed. The 3' end of mRNA encoding the gene of active or inactive T4 DNA ligase-spacer peptide fusion protein was hybridized to dsDNA fragments with cohesive ends, the substrate of T4 DNA ligase. After in vitro translation of the mRNA-dsDNA complex in a rabbit reticulocyte system, a mRNA-dsDNA-ribosome-ligase complex was produced. T4 DNA ligase enzyme displayed on a ribosome, through addition of a spacer peptide, is able to react with dsDNA in the complex. The complex expressing active ligase was biotinylated by ligation with another biotinylated dsDNA probe and selected with streptavidin-coated magnetic beads. We effectively selected active T4 DNA ligase from a small amount of protein. The gene of the active T4 DNA ligase was enriched 40 times from a mixture of active and inactive genes using this selection strategy. This ribosomal display strategy may have high potential to be useful for selection of other enzymes associated with DNA

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Model for how type I restriction enzymes select cleavage sites in DNA

International Nuclear Information System (INIS)

Studier, F.W.; Bandyopadhyay, P.K.

1988-01-01

Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

Science.gov (United States)

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Real-time Tracking of DNA Fragment Separation by Smartphone.

Science.gov (United States)

Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

2017-06-01

Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

Science.gov (United States)

2005-10-01

1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

Effect of superoxide dismutase supplementation on sperm DNA fragmentation

Directory of Open Access Journals (Sweden)

Luciano Negri

2017-10-01

Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

Science.gov (United States)

Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

2013-10-01

Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

International Nuclear Information System (INIS)

Jones, J.L.; Bulford, B.B.

1990-07-01

The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

Directory of Open Access Journals (Sweden)

Gosalvez Jaime

2009-04-01

Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

International Nuclear Information System (INIS)

Evenson, Donald P.; Wixon, Regina

2005-01-01

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

Science.gov (United States)

Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

2006-12-01

The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

DEFF Research Database (Denmark)

Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

2013-01-01

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

NARCIS (Netherlands)

Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

1996-01-01

We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

[Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

Science.gov (United States)

Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

2009-02-01

To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Robust Object Tracking Using Valid Fragments Selection.

Science.gov (United States)

Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor

Science.gov (United States)

Zhao, Wei; Jardine, Paul J.

2015-01-01

ABSTRACT During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. IMPORTANCE During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful

An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor.

Science.gov (United States)

Zhao, Wei; Jardine, Paul J; Grimes, Shelley

2015-12-01

During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Fragmentation and reactivity of energy-selected ferrocenium ions

International Nuclear Information System (INIS)

Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

2002-01-01

In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

Science.gov (United States)

Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

2008-01-01

Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

Directory of Open Access Journals (Sweden)

Manlio Palumbo

2008-06-01

Full Text Available Cathepsin G (CatG is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions.

The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

2015-01-01

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

Directory of Open Access Journals (Sweden)

Stephane Boyer

Full Text Available DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI is over 600 base pairs (bp, amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R. This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey DNA from 46 landsnail (predator faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1 when dealing with degraded DNA for which only small fragments can be amplified, (2 for cases where no consensus has yet been reached on the appropriate barcode gene, or (3 to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

Sliding window analyses for optimal selection of mini-barcodes, and application to 454-pyrosequencing for specimen identification from degraded DNA.

Science.gov (United States)

Boyer, Stephane; Brown, Samuel D J; Collins, Rupert A; Cruickshank, Robert H; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D

2012-01-01

DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

Science.gov (United States)

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

Science.gov (United States)

Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

2014-04-01

Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

2015-05-15

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

Science.gov (United States)

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

Science.gov (United States)

Fraser, L; Strzezek, J

2007-07-15

In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

Science.gov (United States)

Holley, W. R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

Science.gov (United States)

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

International Nuclear Information System (INIS)

Yakura, Kimitaka; Tanifuji, Shigeyuki.

1983-01-01

EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

Unsupervised binning of environmental genomic fragments based on an error robust selection of l-mers.

Science.gov (United States)

Yang, Bin; Peng, Yu; Leung, Henry Chi-Ming; Yiu, Siu-Ming; Chen, Jing-Chi; Chin, Francis Yuk-Lun

2010-04-16

With the rapid development of genome sequencing techniques, traditional research methods based on the isolation and cultivation of microorganisms are being gradually replaced by metagenomics, which is also known as environmental genomics. The first step, which is still a major bottleneck, of metagenomics is the taxonomic characterization of DNA fragments (reads) resulting from sequencing a sample of mixed species. This step is usually referred as "binning". Existing binning methods are based on supervised or semi-supervised approaches which rely heavily on reference genomes of known microorganisms and phylogenetic marker genes. Due to the limited availability of reference genomes and the bias and instability of marker genes, existing binning methods may not be applicable in many cases. In this paper, we present an unsupervised binning method based on the distribution of a carefully selected set of l-mers (substrings of length l in DNA fragments). From our experiments, we show that our method can accurately bin DNA fragments with various lengths and relative species abundance ratios without using any reference and training datasets. Another feature of our method is its error robustness. The binning accuracy decreases by less than 1% when the sequencing error rate increases from 0% to 5%. Note that the typical sequencing error rate of existing commercial sequencing platforms is less than 2%. We provide a new and effective tool to solve the metagenome binning problem without using any reference datasets or markers information of any known reference genomes (species). The source code of our software tool, the reference genomes of the species for generating the test datasets and the corresponding test datasets are available at http://i.cs.hku.hk/~alse/MetaCluster/.

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Laser-assisted shape selective fragmentation of nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Kazakevich, P.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Simakin, A.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Shafeev, G.A. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation)]. E-mail: shafeev@kapella.gpi.ru; Viau, G. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Soumare, Y. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Bozon-Verduraz, F. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France)

2007-07-31

Experimental results are presented on laser-assisted fragmentation of gold-containing nanoparticles suspended in liquids (either ethanol or water). Two kinds of nanoparticles are considered: (i) elongated Au nanorods synthesized by laser ablation of a gold target immersed in liquid phase; (ii) gold-covered NiCo nanorods with high aspect ratio ({theta} {approx} 10) synthesized by wet chemistry processes. The shape selectivity induced by laser fragmentation of these nanorods is gained via tuning the wavelength of laser radiation into different parts of the spectrum of their plasmon resonance corresponding to different aspect ratios {theta}. Fragmentation is performed using three laser wavelengths, involving a Cu vapour laser (510 and 578 nm) and a Nd:YAG (1064 nm). Nanoparticles are characterized by UV-vis spectrometry, Transmission Electron Microscopy (TEM). The effect of laser pulse duration (nanosecond against picosecond range) is also studied in the case of fragmentation with an IR laser radiation.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments.

Science.gov (United States)

Kirley, Terence L; Greis, Kenneth D; Norman, Andrew B

2016-11-25

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab') 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab') 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. Copyright © 2016 Elsevier Inc. All rights reserved.

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

Directory of Open Access Journals (Sweden)

Beiyu Liu

2009-09-01

Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

Directory of Open Access Journals (Sweden)

Agustín García-Peiró

2014-01-01

Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

Selective disulfide reduction for labeling and enhancement of Fab antibody fragments

International Nuclear Information System (INIS)

Kirley, Terence L.; Greis, Kenneth D.; Norman, Andrew B.

2016-01-01

Many methods have been developed for chemical labeling and enhancement of the properties of antibodies and their common fragments, including the Fab and F(ab’) 2 fragments. Somewhat selective reduction of some antibody disulfide bonds has been previously achieved, yielding antibodies and antibody fragments that can be labeled at defined sites, enhancing their utility and properties. Selective reduction of the two hinge disulfide bonds present in F(ab’) 2 fragments using mild reduction has been useful. However, such reduction is often not quantitative and results in the reduction of multiple disulfide bonds, and therefore subsequent multiple labeling or conjugation sites are neither homogenous nor stoichiometric. Here, a simple and efficient selective reduction of the single disulfide bond linking the partial heavy chain and the intact light chain which compose the Fab fragment is accomplished utilizing tris(2-carboxyethyl)phosphine (TCEP) immobilized on agarose beads. The resultant reduced cysteine residues were labeled with several cysteine-selective fluorescent reagents, as well as by cysteine-directed PEGylation. These two cysteine residues can also be re-ligated by means of a bifunctional cysteine cross-linking agent, dibromobimane, thereby both restoring a covalent linkage between the heavy and light chains at this site, far removed from the antigen binding site, and also introducing a fluorescent probe. There are many other research and clinical uses for these selectively partially reduced Fab fragments, including biotinylation, toxin and drug conjugation, and incorporation of radioisotopes, and this technique enables simple generation of very useful Fab fragment derivatives with many potential applications. - Highlights: • TCEP agarose is effective for selective reduction of a single Fab disulfide bond. • This disulfide is solvent accessible and distant from the antigen binding site. • A variety of buffers of varying pHs can be used, simplifying

Fragmentation of chromatin with 125I radioactive disintegrations

International Nuclear Information System (INIS)

Turner, G.N.; Nobis, P.; Dewey, W.C.

1976-01-01

The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

Science.gov (United States)

Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

2011-01-01

The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

International Nuclear Information System (INIS)

Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

2012-01-01

Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

Energy Technology Data Exchange (ETDEWEB)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

International Nuclear Information System (INIS)

Wei Kang; Liu Xueying; Zhu Xuefen

1984-01-01

The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

Modelling the negative effects of landscape fragmentation on habitat selection

NARCIS (Netherlands)

Langevelde, van F.

2015-01-01

Landscape fragmentation constrains movement of animals between habitat patches. Fragmentation may, therefore, limit the possibilities to explore and select the best habitat patches, and some animals may have to cope with low-quality patches due to these movement constraints. If so, these individuals

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

Science.gov (United States)

Treulen, F; Uribe, P; Boguen, R; Villegas, J V

2016-02-01

Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Attosecond-recollision-controlled selective fragmentation of polyatomic molecules.

Science.gov (United States)

Xie, Xinhua; Doblhoff-Dier, Katharina; Roither, Stefan; Schöffler, Markus S; Kartashov, Daniil; Xu, Huailiang; Rathje, Tim; Paulus, Gerhard G; Baltuška, Andrius; Gräfe, Stefanie; Kitzler, Markus

2012-12-14

Control over various fragmentation reactions of a series of polyatomic molecules (acetylene, ethylene, 1,3-butadiene) by the optical waveform of intense few-cycle laser pulses is demonstrated experimentally. We show both experimentally and theoretically that the responsible mechanism is inelastic ionization from inner-valence molecular orbitals by recolliding electron wave packets, whose recollision energy in few-cycle ionizing laser pulses strongly depends on the optical waveform. Our work demonstrates an efficient and selective way of predetermining fragmentation and isomerization reactions in polyatomic molecules on subfemtosecond time scales.

EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

Directory of Open Access Journals (Sweden)

S. Yu. Borovets

2017-01-01

Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Directory of Open Access Journals (Sweden)

Jorge A. Bertolotto

2016-06-01

Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Science.gov (United States)

Bertolotto, Jorge A.; Umazano, Juan P.

2016-06-01

In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

Science.gov (United States)

Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

2016-06-20

Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

Directory of Open Access Journals (Sweden)

George Anifandis

2018-05-01

Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

International Nuclear Information System (INIS)

Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

1998-01-01

This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

International Nuclear Information System (INIS)

Al-Gubory, Kais H.

2005-01-01

The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

Directory of Open Access Journals (Sweden)

Leclerc Xavier

2009-04-01

Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

International Nuclear Information System (INIS)

Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

1987-01-01

The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

Molecular markers. Amplified fragment length polymorphism

Directory of Open Access Journals (Sweden)

Pržulj Novo

2005-01-01

Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

Selection of cDNAs differential fragments related to water stress in Ullucus tuberosus Loz. (Bassellaceae) «olluco»

OpenAIRE

Romero-Carpio, Mariela; Estrada-Jiménez, Rolando

2013-01-01

A partir de la expresión diferencial de ARNm de plántulas in vitro de dos accesiones de Ullucus tuberosus Loz. «olluco» altamente tolerantes a estrés osmótico, fueron seleccionados 31 fragmentos diferenciales de ADNc relacionados con tolerancia a sequía. Thirty-one differential fragments of cDNA related to drought tolerance have been selected from the mRNA differential expression of in vitro plantelets belonging to two accessions of Ullucus tuberosus Loz. «olluco» highly tolerant to osmoti...

Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

International Nuclear Information System (INIS)

Holley, W.R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

[Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

Science.gov (United States)

Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

2016-09-01

Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

Science.gov (United States)

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

[Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

Science.gov (United States)

Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

2015-08-01

In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

Directory of Open Access Journals (Sweden)

Cheuk-Chun Szeto

Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

Science.gov (United States)

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-01-01

Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

Science.gov (United States)

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-06-16

As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

Directory of Open Access Journals (Sweden)

Schnabel Robert D

2009-06-01

Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

Cationization increases brain distribution of an amyloid-beta protofibril selective F(ab')2 fragment

OpenAIRE

Syvänen, Stina; Edén, Desireé; Sehlin, Dag

2017-01-01

Antibodies and fragments thereof are, because of high selectivity for their targets, considered as potential therapeutics and biomarkers for several neurological disorders. However, due to their large molecular size, antibodies/fragments do not easily penetrate into the brain. The aim of the present study was to improve the brain distribution via adsorptive-mediated transcytosis of an amyloid-beta (A beta) protofibril selective F(ab')2 fragment (F(ab')2-h158). F(ab')2-h158 was cationized to d...

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

International Nuclear Information System (INIS)

Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

2010-01-01

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

Energy Technology Data Exchange (ETDEWEB)

Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

2010-01-05

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

International Nuclear Information System (INIS)

Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

1998-01-01

The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

Science.gov (United States)

Bille, Todd W; Cromartie, Carter; Farr, Matthew

2009-09-01

This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

Geotechnology and landscape ecology applied to the selection of potential forest fragments for seed harvesting.

Science.gov (United States)

Santos, Alexandre Rosa Dos; Antonio Alvares Soares Ribeiro, Carlos; de Oliveira Peluzio, Telma Machado; Esteves Peluzio, João Batista; de Queiroz, Vagner Tebaldi; Figueira Branco, Elvis Ricardo; Lorenzon, Alexandre Simões; Domingues, Getulio Fonseca; Marcatti, Gustavo Eduardo; de Castro, Nero Lemos Martins; Teixeira, Thaisa Ribeiro; Dos Santos, Gleissy Mary Amaral Dino Alves; Santos Mota, Pedro Henrique; Ferreira da Silva, Samuel; Vargas, Rozimelia; de Carvalho, José Romário; Macedo, Leandro Levate; da Silva Araújo, Cintia; de Almeida, Samira Luns Hatum

2016-12-01

The Atlantic Forest biome is recognized for its biodiversity and is one of the most threatened biomes on the planet, with forest fragmentation increasing due to uncontrolled land use, land occupation, and population growth. The most serious aspect of the forest fragmentation process is the edge effect and the loss of biodiversity. In this context, the aim of this study was to evaluate the dynamics of forest fragmentation and select potential forest fragments with a higher degree of conservation for seed harvesting in the Itapemirim river basin, Espírito Santo State, Brazil. Image classification techniques, forest landscape ecology, and multi-criteria analysis were used to evaluate the evolution of forest fragmentation to develop the landscape metric indexes, and to select potential forest fragments for seed harvesting for the years 1985 and 2013. According to the results, there was a reduction of 2.55% of the occupancy of the fragments in the basin between the years 1985 and 2013. For the years 1985 and 2013, forest fragment units 2 and 3 were spatialized with a high potential for seed harvesting, representing 6.99% and 16.01% of the total fragments, respectively. The methodology used in this study has the potential to be used to support decisions for the selection of potential fragments for seed harvesting because selecting fragments in different environments by their spatial attributes provides a greater degree of conservation, contributing to the protection and conscious management of the forests. The proposed methodology can be adapted to other areas and different biomes of the world. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction

International Nuclear Information System (INIS)

Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang

2002-01-01

The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor

Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction

Science.gov (United States)

Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang

2002-12-01

The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

2012-07-29

Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

Directory of Open Access Journals (Sweden)

Olga Makarova

Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

Science.gov (United States)

Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

2001-01-01

Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter

Directory of Open Access Journals (Sweden)

Makoto Komiyama

2013-02-01

Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.

Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

Science.gov (United States)

Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

2018-02-01

Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

Science.gov (United States)

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-05-11

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

Technique for Increasing the Selectivity of the Method of Laser Fragmentation/Laser-Induced Fluorescence

Science.gov (United States)

Bobrovnikov, S. M.; Gorlov, E. V.; Zharkov, V. I.

2018-05-01

A technique for increasing the selectivity of the method of detecting high-energy materials (HEMs) based on laser fragmentation of HEM molecules with subsequent laser excitation of fluorescence of the characteristic NO fragments from the first vibrational level of the ground state is suggested.

Probe Selection for DNA Microarrays using OligoWiz

DEFF Research Database (Denmark)

Wernersson, Rasmus; Juncker, Agnieszka; Nielsen, Henrik Bjørn

2007-01-01

Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client-server appl......Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client......-server application that offers a detailed graphical interface and real-time user interaction on the client side, and massive computer power and a large collection of species databases (400, summer 2007) on the server side. Probes are selected according to five weighted scores: cross-hybridization, deltaT(m), folding...... computer skills and can be executed from any Internet-connected computer. The probe selection procedure for a standard microarray design targeting all yeast transcripts can be completed in 1 h....

Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

Directory of Open Access Journals (Sweden)

Leterrier Christine

2010-07-01

Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

Selection and characterization of DNA aptamers

NARCIS (Netherlands)

Ruigrok, V.J.B.

2013-01-01

This thesis focusses on the selection and characterisation of DNA aptamers and the various aspects related to their selection from large pools of randomized oligonucleotides. Aptamers are affinity tools that can specifically recognize and bind predefined target molecules; this ability, however,

Crystal structure of an Okazaki fragment at 2-A resolution

Science.gov (United States)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

Science.gov (United States)

Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

2016-01-01

DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

Directory of Open Access Journals (Sweden)

Sara Sadeghi

2016-01-01

Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

Isolation and characterization of microsatellite DNA loci from Sillago ...

Indian Academy of Sciences (India)

A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...

Forest Fragmentation and Selective Logging Have Inconsistent Effects on Multiple Animal-Mediated Ecosystem Processes in a Tropical Forest

Science.gov (United States)

Schleuning, Matthias; Farwig, Nina; Peters, Marcell K.; Bergsdorf, Thomas; Bleher, Bärbel; Brandl, Roland; Dalitz, Helmut; Fischer, Georg; Freund, Wolfram; Gikungu, Mary W.; Hagen, Melanie; Garcia, Francisco Hita; Kagezi, Godfrey H.; Kaib, Manfred; Kraemer, Manfred; Lung, Tobias; Schaab, Gertrud; Templin, Mathias; Uster, Dana; Wägele, J. Wolfgang; Böhning-Gaese, Katrin

2011-01-01

Forest fragmentation and selective logging are two main drivers of global environmental change and modify biodiversity and environmental conditions in many tropical forests. The consequences of these changes for the functioning of tropical forest ecosystems have rarely been explored in a comprehensive approach. In a Kenyan rainforest, we studied six animal-mediated ecosystem processes and recorded species richness and community composition of all animal taxa involved in these processes. We used linear models and a formal meta-analysis to test whether forest fragmentation and selective logging affected ecosystem processes and biodiversity and used structural equation models to disentangle direct from biodiversity-related indirect effects of human disturbance on multiple ecosystem processes. Fragmentation increased decomposition and reduced antbird predation, while selective logging consistently increased pollination, seed dispersal and army-ant raiding. Fragmentation modified species richness or community composition of five taxa, whereas selective logging did not affect any component of biodiversity. Changes in the abundance of functionally important species were related to lower predation by antbirds and higher decomposition rates in small forest fragments. The positive effects of selective logging on bee pollination, bird seed dispersal and army-ant raiding were direct, i.e. not related to changes in biodiversity, and were probably due to behavioural changes of these highly mobile animal taxa. We conclude that animal-mediated ecosystem processes respond in distinct ways to different types of human disturbance in Kakamega Forest. Our findings suggest that forest fragmentation affects ecosystem processes indirectly by changes in biodiversity, whereas selective logging influences processes directly by modifying local environmental conditions and resource distributions. The positive to neutral effects of selective logging on ecosystem processes show that the

Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

Science.gov (United States)

Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

2017-01-01

Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

International Nuclear Information System (INIS)

Vejko, N.N.; Spitkovskij, D.M.

2000-01-01

The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

Science.gov (United States)

Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

2000-01-01

DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Selection of monoclonal anti-CEA antibody fragments for tumor detection by immunoscintigraphy

International Nuclear Information System (INIS)

Mach, J.P.; Buchegger, F.

1986-01-01

It is described how individual MAb directed against carcinoembryotic antigen (CEA) is selected which does not crossreact with granulocytes and gives the best tumor localization in the model of nude mice grafted with human colon carcinoma. Using this model, the superiority of F(ab')/sub 2/ and particularly Fab fragments from high affinity MAb for the localization of relatively small tumor nodules is demonstrated. These MAb fragments are also successfully used in an ongoing clinical trial for the detection of primary and metastatic colorectal carcinomas

Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

Science.gov (United States)

Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

2017-09-01

In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

Scar-less multi-part DNA assembly design automation

Science.gov (United States)

Hillson, Nathan J.

2016-06-07

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

Site-specific fragmentation of polystyrene molecule using size-selected Ar gas cluster ion beam

International Nuclear Information System (INIS)

Moritani, Kousuke; Mukai, Gen; Hashinokuchi, Michihiro; Mochiji, Kozo

2009-01-01

The secondary ion mass spectrum (SIMS) of a polystyrene thin film was investigated using a size-selected Ar gas cluster ion beam (GCIB). The fragmentation in the SIM spectrum varied by kinetic energy per atom (E atom ); the E atom dependence of the secondary ion intensity of the fragment species of polystyrene can be essentially classified into three types based on the relationship between E atom and the dissociation energy of a specific bonding site in the molecule. These results indicate that adjusting E atom of size-selected GCIB may realize site-specific bond breaking within a molecule. (author)

A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

Science.gov (United States)

Santangelo, G M; Tornow, J

1997-12-01

As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

Science.gov (United States)

Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

2018-01-01

Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

Science.gov (United States)

Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

1994-11-01

Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

Fertilization capacity with rainbow trout DNA-damaged sperm and embryo developmental success.

Science.gov (United States)

Pérez-Cerezales, S; Martínez-Páramo, S; Beirão, J; Herráez, M P

2010-06-01

Mammalian spermatozoa undergo a strong selection process along the female tract to guarantee fertilization by good quality cells, but risks of fertilization with DNA-damaged spermatozoa have been reported. In contrast, most external fertilizers such as fish seem to have weaker selection procedures. This fact, together with their high prolificacy and external embryo development, indicates that fish could be useful for the study of the effects of sperm DNA damage on embryo development. We cryopreserved sperm from rainbow trout using egg yolk and low-density lipoprotein as additives to promote different rates of DNA damage. DNA fragmentation and oxidization were analyzed using comet assay with and without digestion with restriction enzymes, and fertilization trials were performed. Some embryo batches were treated with 3-aminobenzamide (3AB) to inhibit DNA repair by the poly (ADP-ribose) polymerase, which is an enzyme of the base excision repair pathway. Results showed that all the spermatozoa cryopreserved with egg yolk carried more than 10% fragmented DNA, maintaining fertilization rates of 61.1+/-2.3 but a high rate of abortions, especially during gastrulation, and only 14.5+/-4.4 hatching success. Furthermore, after 3AB treatment, hatching dropped to 3.2+/-2.2, showing that at least 10% DNA fragmentation was repaired. We conclude that trout sperm maintains its ability to fertilize in spite of having DNA damage, but that embryo survival is affected. Damage is partially repaired by the oocyte during the first cleavage. Important advantages of using rainbow trout for the study of processes related to DNA damage and repair during development have been reported.

Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

International Nuclear Information System (INIS)

Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

2006-01-01

Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

OpenAIRE

Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

2015-01-01

We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

Selective sweeps of mitochondrial DNA can drive the evolution of uniparental inheritance.

Science.gov (United States)

Christie, Joshua R; Beekman, Madeleine

2017-08-01

Although the uniparental (or maternal) inheritance of mitochondrial DNA (mtDNA) is widespread, the reasons for its evolution remain unclear. Two main hypotheses have been proposed: selection against individuals containing different mtDNAs (heteroplasmy) and selection against "selfish" mtDNA mutations. Recently, uniparental inheritance was shown to promote adaptive evolution in mtDNA, potentially providing a third hypothesis for its evolution. Here, we explore this hypothesis theoretically and ask if the accumulation of beneficial mutations provides a sufficient fitness advantage for uniparental inheritance to invade a population in which mtDNA is inherited biparentally. In a deterministic model, uniparental inheritance increases in frequency but cannot replace biparental inheritance if only a single beneficial mtDNA mutation sweeps through the population. When we allow successive selective sweeps of mtDNA, however, uniparental inheritance can replace biparental inheritance. Using a stochastic model, we show that a combination of selection and drift facilitates the fixation of uniparental inheritance (compared to a neutral trait) when there is only a single selective mtDNA sweep. When we consider multiple mtDNA sweeps in a stochastic model, uniparental inheritance becomes even more likely to replace biparental inheritance. Our findings thus suggest that selective sweeps of beneficial mtDNA haplotypes can drive the evolution of uniparental inheritance. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

Science.gov (United States)

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

2012-01-01

Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

International Nuclear Information System (INIS)

Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

1986-01-01

A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

Science.gov (United States)

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

Science.gov (United States)

Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

2015-08-18

The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

Application of DNA fingerprints for cell-line individualization.

Science.gov (United States)

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-09-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

Selective Covalent Conjugation of Phosphorothioate DNA Oligonucleotides with Streptavidin

Directory of Open Access Journals (Sweden)

Christof M. Niemeyer

2011-08-01

Full Text Available Protein-DNA conjugates have found numerous applications in the field of diagnostics and nanobiotechnology, however, their intrinsic susceptibility to DNA degradation by nucleases represents a major obstacle for many applications. We here report the selective covalent conjugation of the protein streptavidin (STV with phosphorothioate oligonucleotides (psDNA containing a terminal alkylthiolgroup as the chemically addressable linking unit, using a heterobifunctional NHS-/maleimide crosslinker. The psDNA-STV conjugates were synthesized in about 10% isolated yields. We demonstrate that the terminal alkylthiol group selectively reacts with the maleimide while the backbone sulfur atoms are not engaged in chemical conjugation. The novel psDNA-STV conjugates retain their binding capabilities for both biotinylated macromolecules and the complementary nucleic acid. Moreover, the psDNA-STV conjugate retained its binding capacity for complementary oligomers even after a nuclease digestion step, which effectively degrades deoxyribonucleotide oligomers and thus the binding capability of regular DNA-STV conjugates. The psDNA-STV therefore hold particular promise for applications e.g. in proteome research and novel biosensing devices, where interfering endogenous nucleic acids need to be removed from analytes by nuclease digestion.

Cell lethality after selective irradiation of the DNA replication fork

International Nuclear Information System (INIS)

Hofer, K.G.; Warters, R.L.

1985-01-01

It has been suggested that nascent DNA located at the DNA replication fork may exhibit enhanced sensitivity to radiation damage. To evaluate this hypothesis, Chinese hamster ovary cells (CHO) were labeled with 125 I-iododeoxyuridine ( 125 IUdR) either in the presence or absence of aphidicolin. Aphidicolin (5 μg/ml) reduced cellular 125 IUdR incorporation to 3-5% of the control value. The residual 125 I incorporation appeared to be restricted to low molecular weight (sub-replicon sized) fragments of DNA which were more sensitive to micrococcal nuclease attack and less sensitive to high salt DNase I digestion than randomly labeled DNA. These findings suggest that DNA replicated in the presence of aphidicolin remains localized at the replication fork adjacent to the nuclear matrix. Based on these observations an attempt was made to compare the lethal consequences of 125 I decays at the replication fork to that of 125 I decays randomly distributed over the entire genome. Regardless of the distribution of decay events, all treatment groups exhibited identical dose-response curves (D 0 : 101 125 I decays/cell). Since differential irradiation of the replication complex did not result in enhanced cell lethality, it can be concluded that neither the nascent DNA nor the protein components (replicative enzymes, nuclear protein matrix) associated with the DNA replication site constitute key radiosensitive targets within the cellular genome. (orig.)

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Sequence-selective topoisomerase II inhibition by anthracycline derivatives in SV40 DNA: Relationship with DNA binding affinity and cytotoxicity

International Nuclear Information System (INIS)

Capranico, G.; Kohn, K.W.; Pommier, Y.; Zunino, F.

1990-01-01

Topoisomerase II mediated double-strand breaks produced by anthracycline analogues were studied in SV40 DNA. The compounds included doxorubicin, daunorubicin, two doxorubicin stereoisomers (4'-epimer and β-anomer), and five chromophore-modified derivatives, with a wide range of cytotoxic activity and DNA binding affinity. Cleavage of 32 P-end-labeled DNA fragments was visualized by autoradiography of agarose and polyacrylamide gels. Structure-activity relationships indicated that alterations in the chromophore structure greatly affected drug action on topoisomerase II. In particular, removal of substituents on position 4 of the D ring resulted in more active inducers of cleavage with lower DNA binding affinity. The stereochemistry between the sugar and the chromophore was also essential for activity. All the active anthracyclines induced a single region of prominent cleavage in the entire SV40 DNA, which resulted from a cluster of sites between nucleotides 4237 and 4294. DNA cleavage intensity patterns exhibited differences among analogues and were also dependent upon drug concentration. Intensity at a given site dependent on both stimulatory and suppressive effects depending upon drug concentration and DNA sequence. A good correlation was found between cytotoxicity and intensity of topoisomerase II mediated DNA breakage

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

Science.gov (United States)

Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

2015-09-01

To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

Science.gov (United States)

Takahashi, S; Maecker, H T; Levy, R

1989-10-01

An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates

Science.gov (United States)

2008-06-01

might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed

HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

OpenAIRE

C. Selva Kumar

2011-01-01

Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol＋1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

Science.gov (United States)

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

1999-01-01

Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

[Reconstruction of long polynucleotide sequences from fragments using the Iskra-226 personal computer

Science.gov (United States)

Kostetskiĭ, P V; Dobrova, I E

1988-04-01

An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

2016-09-02

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

International Nuclear Information System (INIS)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

2016-01-01

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Selecting a Conservation Surrogate Species for Small Fragmented Habitats Using Ecological Niche Modelling

Directory of Open Access Journals (Sweden)

K. Anne-Isola Nekaris

2015-01-01

Full Text Available Flagship species are traditionally large, charismatic animals used to rally conservation efforts. Accepted flagship definitions suggest they need only fulfil a strategic role, unlike umbrella species that are used to shelter cohabitant taxa. The criteria used to select both flagship and umbrella species may not stand up in the face of dramatic forest loss, where remaining fragments may only contain species that do not suit either set of criteria. The Cinderella species concept covers aesthetically pleasing and overlooked species that fulfil the criteria of flagships or umbrellas. Such species are also more likely to occur in fragmented habitats. We tested Cinderella criteria on mammals in the fragmented forests of the Sri Lankan Wet Zone. We selected taxa that fulfilled both strategic and ecological roles. We created a shortlist of ten species, and from a survey of local perceptions highlighted two finalists. We tested these for umbrella characteristics against the original shortlist, utilizing Maximum Entropy (MaxEnt modelling, and analysed distribution overlap using ArcGIS. The criteria highlighted Loris tardigradus tardigradus and Prionailurus viverrinus as finalists, with the former having highest flagship potential. We suggest Cinderella species can be effective conservation surrogates especially in habitats where traditional flagship species have been extirpated.

Tagging genes for drought resistance by DNA markers in wheat (abstract)

International Nuclear Information System (INIS)

Malik, T.A.; Rahman, S.; Zafar, Y.

2005-01-01

Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

Flexible metabolic pathway construction using modular and divisible selection gene regulators

DEFF Research Database (Denmark)

Rugbjerg, Peter; Myling-Petersen, Nils; Sommer, Morten Otto Alexander

2015-01-01

Genetic selections are important to biological engineering. Although selectable traits are limited,currently each trait only permits simultaneous introduction of a single DNA fragment. Complex pathwayand strain construction however depends on rapid, combinatorial introduction of many genes thaten...

Polymer fragmentation in extensional flow

Energy Technology Data Exchange (ETDEWEB)

Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

2001-06-01

In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

Site-Selective Conjugation of Native Proteins with DNA

DEFF Research Database (Denmark)

Trads, Julie Brender; Tørring, Thomas; Gothelf, Kurt Vesterager

2017-01-01

Conjugation of DNA to proteins is increasingly used in academia and industry to provide proteins with tags for identification or handles for hybridization to other DNA strands. Assay technologies such as immuno-PCR and proximity ligation and the imaging technology DNA-PAINT require DNA-protein....... The introduction of a bioorthogonal handle at a specific position of a protein by recombinant techniques provides an excellent approach to site-specific conjugation, but for many laboratories and for applications where several proteins are to be labeled, the expression of recombinant proteins may be cumbersome...... conjugates. In DNA nanotechnology, the DNA handle is exploited to precisely position proteins by self-assembly. For these applications, site-selective conjugation is almost always desired because fully functional proteins are required to maintain the specificity of antibodies and the activity of enzymes...

Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

Directory of Open Access Journals (Sweden)

Yuqian Luo

2016-11-01

Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Energy distribution in selected fragment vibrations in dissociation processes in polyatomic molecules

International Nuclear Information System (INIS)

Band, Y.B.; Freed, K.F.

1977-01-01

The full quantum theory of dissociation processes in polyatomic molecules is converted to a form enabling the isolation of a selected fragment vibration. This form enables the easy evaluation of the probability distribution for energy partitioning between this vibration and all other degrees of freedom that results from the sudden Franck--Condon rearrangement process. The resultant Franck--Condon factors involve the square of the one-dimensional overlap integral between effective oscillator wavefunctions and the wavefunctions for the selected fragment vibration, a form that resembles the simple golden rule model for polyatomic dissociation and reaction processes. The full quantum theory can, therefore, be viewed as providing both a rigorous justification for certain generic aspects of the simple golden rule model as well as providing a number of important generalizations thereof. Some of these involve dealing with initial bound state vibrational excitation, explicit molecule, fragment and energy dependence of the effective oscillator, and the incorporation of all isotopic dependence. In certain limiting situations the full quantum theory yields simple, readily usable analytic expressions for the frequency and equilibrium position of the effective oscillator. Specific applications are presented for the direct photodissociation of HCN, DCN, and CO 2 where comparisons between the full theory and the simple golden rule are presented. We also discuss the generalizations of the previous theory to enable the incorporation of effects of distortion in the normal modes as a function of the reaction coordinate on the repulsive potential energy surface

A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

Energy Technology Data Exchange (ETDEWEB)

Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

1994-09-15

In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

International Nuclear Information System (INIS)

Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

2011-01-01

Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

Energy Technology Data Exchange (ETDEWEB)

Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

2012-06-01

Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Signatures of DNA target selectivity by ETS transcription factors.

Science.gov (United States)

Poon, Gregory M K; Kim, Hye Mi

2017-05-27

The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.

Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

Directory of Open Access Journals (Sweden)

D. Vaamonde

2014-12-01

Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

2002-01-01

, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

Polarization Selectivity of Artificial Anisotropic Structures Based on DNA-Like Helices

International Nuclear Information System (INIS)

Semchenko, I. V.; Khakhomov, S. A.; Balmakov, A. P.

2010-01-01

Currently, 2D and 3D structures of different symmetries can be formed from DNA molecules. The electromagnetic properties of this new natural chiral material can be changed by metalizing DNA. Spatial structures of this type can be used in nanotechnology to prepare metamaterials for the far-UV region. It is shown by the example of an octahedron and a cube composed of DNA-like helices that these structures may exhibit polarization selectivity to electromagnetic radiation. In addition, it is suggested that the effect of the polarization selectivity of DNA-like artificial structures may also occur in the soft X-ray region for all living organisms in nature due to the universal DNA form.

Synchronization of DNA array replication kinetics

Science.gov (United States)

Manturov, Alexey O.; Grigoryev, Anton V.

2016-04-01

In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

A new location to split Cre recombinase for protein fragment complementation.

Science.gov (United States)

Rajaee, Maryam; Ow, David W

2017-11-01

We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

Science.gov (United States)

Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

2017-04-15

Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

OpenAIRE

Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

2014-01-01

Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

[cDNA library construction from panicle meristem of finger millet].

Science.gov (United States)

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

4β-Hydroxywithanolide E selectively induces oxidative DNA damage for selective killing of oral cancer cells.

Science.gov (United States)

Tang, Jen-Yang; Huang, Hurng-Wern; Wang, Hui-Ru; Chan, Ya-Ching; Haung, Jo-Wen; Shu, Chih-Wen; Wu, Yang-Chang; Chang, Hsueh-Wei

2018-03-01

Reactive oxygen species (ROS) induction had been previously reported in 4β-hydroxywithanolide (4βHWE)-induced selective killing of oral cancer cells, but the mechanism involving ROS and the DNA damage effect remain unclear. This study explores the role of ROS and oxidative DNA damage of 4βHWE in the selective killing of oral cancer cells. Changes in cell viability, morphology, ROS, DNA double strand break (DSB) signaling (γH2AX foci in immunofluorescence and DSB signaling in western blotting), and oxidative DNA damage (8-oxo-2'deoxyguanosine [8-oxodG]) were detected in 4βHWE-treated oral cancer (Ca9-22) and/or normal (HGF-1) cells. 4βHWE decreased cell viability, changed cell morphology and induced ROS generation in oral cancer cells rather than oral normal cells, which were recovered by a free radical scavenger N-acetylcysteine (NAC). For immunofluorescence, 4βHWE also accumulated more of the DSB marker, γH2AX foci, in oral cancer cells than in oral normal cells. For western blotting, DSB signaling proteins such as γH2AX and MRN complex (MRE11, RAD50, and NBS1) were overexpressed in 4βHWE-treated oral cancer cells in different concentrations and treatment time. In the formamidopyrimidine-DNA glycolyase (Fpg)-based comet assay and 8-oxodG-based flow cytometry, the 8-oxodG expressions were higher in 4βHWE-treated oral cancer cells than in oral normal cells. All the 4βHWE-induced DSB and oxidative DNA damage to oral cancer cells were recovered by NAC pretreatment. Taken together, the 4βHWE selectively induced DSB and oxidative DNA damage for the ROS-mediated selective killing of oral cancer cells. © 2017 Wiley Periodicals, Inc.

Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

International Nuclear Information System (INIS)

Fritz, E.

1994-06-01

In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

Science.gov (United States)

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-07-15

presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

AQUATIC PLANT SPECIATION AFFECTED BY DIVERSIFYING SELECTION OF ORGANELLE DNA REGIONS(1).

Science.gov (United States)

Kato, Syou; Misawa, Kazuharu; Takahashi, Fumio; Sakayama, Hidetoshi; Sano, Satomi; Kosuge, Keiko; Kasai, Fumie; Watanabe, Makoto M; Tanaka, Jiro; Nozaki, Hisayoshi

2011-10-01

Many of the genes that control photosynthesis are carried in the chloroplast. These genes differ among species. However, evidence has yet to be reported revealing the involvement of organelle genes in the initial stages of plant speciation. To elucidate the molecular basis of aquatic plant speciation, we focused on the unique plant species Chara braunii C. C. Gmel. that inhabits both shallow and deep freshwater habitats and exhibits habitat-based dimorphism of chloroplast DNA (cpDNA). Here, we examined the "shallow" and "deep" subpopulations of C. braunii using two nuclear DNA (nDNA) markers and cpDNA. Genetic differentiation between the two subpopulations was measured in both nDNA and cpDNA regions, although phylogenetic analyses suggested nuclear gene flow between subpopulations. Neutrality tests based on Tajima's D demonstrated diversifying selection acting on organelle DNA regions. Furthermore, both "shallow" and "deep" haplotypes of cpDNA detected in cultures originating from bottom soils of three deep environments suggested that migration of oospores (dormant zygotes) between the two habitats occurs irrespective of the complete habitat-based dimorphism of cpDNA from field-collected vegetative thalli. Therefore, the two subpopulations are highly selected by their different aquatic habitats and show prezygotic isolation, which represents an initial process of speciation affected by ecologically based divergent selection of organelle genes. © 2011 Phycological Society of America.

Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

DEFF Research Database (Denmark)

Stronati, A; Manicardi, G C; Cecati, M

2006-01-01

Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

Science.gov (United States)

Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

2008-04-01

The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

NARCIS (Netherlands)

Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

1998-01-01

Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

Hybrid male sterility is caused by mitochondrial DNA deletion.

Science.gov (United States)

Hayashida, Kenji; Kohno, Shigeru

2009-07-01

Although it is known that the hybrid male mouse is sterile just like any other animal's heterogametic sex, the reason why only the male germ cells are impaired has yet to be discovered. TdT-mediated dUTP nick end labeling assay using a confocal fluorescence microscope and DNA fragmentation assay of hybrid testis indicated destruction of the mitochondrial DNA (mtDNA) rather than the nuclear DNA. Previously we reported that maternal mtDNA inheritance is through selective sperm mtDNA elimination based on the sperm factor and two egg factors, and expression of these three factors was recognized in the hybrid testis. It was thereby assumed that mtDNA destruction caused by the expression of maternal mtDNA inheritance system in male germ cells is implicated in the hybrid male sterility of mice.

How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

Science.gov (United States)

Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

2014-01-01

The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

Science.gov (United States)

Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

2018-05-14

Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

Science.gov (United States)

Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

2017-06-19

Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

Science.gov (United States)

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

Electronic transport in methylated fragments of DNA

Energy Technology Data Exchange (ETDEWEB)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Electronic transport in methylated fragments of DNA

International Nuclear Information System (INIS)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

2015-01-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

Directory of Open Access Journals (Sweden)

Claudia Huber

Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

International Nuclear Information System (INIS)

Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

2011-01-01

Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

Selective detection and quantification of modified DNA with solid-state nanopores.

Science.gov (United States)

Carlsen, Autumn T; Zahid, Osama K; Ruzicka, Jan A; Taylor, Ethan W; Hall, Adam R

2014-10-08

We demonstrate a solid-state nanopore assay for the unambiguous discrimination and quantification of modified DNA. Individual streptavidin proteins are employed as high-affinity tags for DNA containing a single biotin moiety. We establish that the rate of translocation events corresponds directly to relative concentration of protein-DNA complexes and use the selectivity of our approach to quantify modified oligonucleotides from among a background of unmodified DNA in solution.

RAPD analysis of alfalfa DNA mutation via N+ implantation

International Nuclear Information System (INIS)

Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

2003-01-01

Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

Science.gov (United States)

Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

2007-05-02

An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

Science.gov (United States)

Arora, Shagun; Tandon, Simran

2015-01-01

In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...

African Journals Online (AJOL)

Purpose: To explore the use of restriction inhibition assay (RIA) to study the binding specificity of some anticancer drugs. Methods: A 448 bp DNA fragment derived from pBCKS+ plasmid (harboring the polylinker region with multiple restriction endonuclease sites) was used as a template for sequence selective inhibition of ...

Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

Directory of Open Access Journals (Sweden)

A. Yu. Popova

2015-01-01

Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

Quality of human spermatozoa: relationship between high-magnification sperm morphology and DNA integrity.

Science.gov (United States)

Maettner, R; Sterzik, K; Isachenko, V; Strehler, E; Rahimi, G; Alabart, J L; Sánchez, R; Mallmann, P; Isachenko, E

2014-06-01

The aim of this work is to establish the relationship between the morphology of Intracytoplasmic Morphologically Selected Sperm Injection (IMSI)-selected spermatozoa and their DNA integrity. The 45 ejaculates were randomly distributed into three treatment groups: normozoospermic, oligoasthenozoospermic and oligoasthenotheratozoospermic samples. The evaluation of DNA integrity was performed using the sperm chromatin dispersion test. It was established that DNA integrity of spermatozoa is strongly dependent on ejaculate quality (P count of spermatozoa with nonfragmented DNA in normozoospermic samples was high and independent from IMSI-morphological classes (Class 1 versus Class 3, respectively) (P > 0.1). With decreased ejaculate quality, the percentage of spermatozoa with nonfragmented DNA decreased significantly (P < 0.05) independent from morphological class. Nevertheless, the rate of IMSI-selected spermatozoa with fragmented DNA within of Class 1 in normozoospermic (Group 1), in oligoasthenozoospermic (Group 2) and in oligoasthenotheratozoospermic (Group 3) samples was 21.1%, 31.8% and 54.1%, respectively. In conclusion, there is a direct relationship between morphological parameters of spermatozoa and their DNA integrity. However, the IMSI technique alone is not enough for the selection of spermatozoa with intact nuclei. © 2013 Blackwell Verlag GmbH.

Application of DNA fingerprints for cell-line individualization.

OpenAIRE

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-01-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

Energy Technology Data Exchange (ETDEWEB)

Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

2014-10-31

Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

International Nuclear Information System (INIS)

Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

2014-01-01

Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

Development of swine-specific DNA markers for biosensor-based halal authentication.

Science.gov (United States)

Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

2012-06-29

The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

Science.gov (United States)

Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

1998-10-01

The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

Science.gov (United States)

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki

Directory of Open Access Journals (Sweden)

Silvia W. Lestari

2015-12-01

Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD   Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on

Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

International Nuclear Information System (INIS)

Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

1982-01-01

The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

Fragment-Linking Approach Using (19)F NMR Spectroscopy To Obtain Highly Potent and Selective Inhibitors of β-Secretase.

Science.gov (United States)

Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted

2016-04-28

Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.

Extraction of ultrashort DNA molecules from herbarium specimens.

Science.gov (United States)

Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

2017-02-01

DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

Energy Technology Data Exchange (ETDEWEB)

Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

2016-10-15

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

International Nuclear Information System (INIS)

Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

2016-01-01

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

Evaluation of selectivity in homologous multimodal chromatographic systems using in silico designed antibody fragment libraries.

Science.gov (United States)

Karkov, Hanne Sophie; Woo, James; Krogh, Berit Olsen; Ahmadian, Haleh; Cramer, Steven M

2015-12-24

This study describes the in silico design, surface property analyses, production and chromatographic evaluations of a diverse set of antibody Fab fragment variants. Based on previous findings, we hypothesized that the complementarity-determining regions (CDRs) constitute important binding sites for multimodal chromatographic ligands. Given that antibodies are highly diversified molecules and in particular the CDRs, we set out to examine the generality of this result. For this purpose, four different Fab fragments with different CDRs and/or framework regions of the variable domains were identified and related variants were designed in silico. The four Fab variant libraries were subsequently generated by site-directed mutagenesis and produced by recombinant expression and affinity purification to enable examination of their chromatographic retention behavior. The effects of geometric re-arrangement of the functional moieties on the multimodal resin ligands were also investigated with respect to Fab variant retention profiles by comparing two commercially available multimodal cation-exchange ligands, Capto MMC and Nuvia cPrime, and two novel multimodal ligand prototypes. Interestingly, the chromatographic data demonstrated distinct selectivity trends between the four Fab variant libraries. For three of the Fab libraries, the CDR regions appeared as major binding sites for all multimodal ligands. In contrast, the fourth Fab library displayed a distinctly different chromatographic behavior, where Nuvia cPrime and related multimodal ligand prototypes provided markedly improved selectivity over Capto MMC. Clearly, the results illustrate that the discriminating power of multimodal ligands differs between different Fab fragments. The results are promising indications that multimodal chromatography using the appropriate multimodal ligands can be employed in downstream bioprocessing for challenging selective separation of product related variants. Copyright © 2015 Elsevier B

DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

Directory of Open Access Journals (Sweden)

José Gregorio Martínez

Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

Science.gov (United States)

Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

2007-08-01

The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

Characterization of selection effects on broiler lines using DNA fingerprinting

Directory of Open Access Journals (Sweden)

GS Schmidt

2003-05-01

Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

Science.gov (United States)

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Visualization of DNA in highly processed botanical materials.

Science.gov (United States)

Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

2018-04-15

DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

Science.gov (United States)

Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

2016-12-01

The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

Engineering DNA Backbone Interactions Results in TALE Scaffolds with Enhanced 5-Methylcytosine Selectivity.

Science.gov (United States)

Rathi, Preeti; Witte, Anna; Summerer, Daniel

2017-11-08

Transcription activator-like effectors (TALEs) are DNA major-groove binding proteins widely used for genome targeting. TALEs contain an N-terminal region (NTR) and a central repeat domain (CRD). Repeats of the CRD selectively recognize each one DNA nucleobase, offering programmability. Moreover, repeats with selectivity for 5-methylcytosine (5mC) and its oxidized derivatives can be designed for analytical applications. However, both TALE domains also nonspecifically interact with DNA phosphates via basic amino acids. To enhance the 5mC selectivity of TALEs, we aimed to decrease the nonselective binding energy of TALEs. We substituted basic amino acids with alanine in the NTR and identified TALE mutants with increased selectivity. We then analysed conserved, DNA phosphate-binding KQ diresidues in CRD repeats and identified further improved mutants. Combination of mutations in the NTR and CRD was highly synergetic and resulted in TALE scaffolds with up to 4.3-fold increased selectivity in genomic 5mC analysis via affinity enrichment. Moreover, transcriptional activation in HEK293T cells by a TALE-VP64 construct based on this scaffold design exhibited a 3.5-fold increased 5mC selectivity. This provides perspectives for improved 5mC analysis and for the 5mC-conditional control of TALE-based editing constructs in vivo.

Bone fragments a body can make

Energy Technology Data Exchange (ETDEWEB)

Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

1991-05-01

Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

Selective detection of labeled DNA using an air-clad photonic crystal fiber

DEFF Research Database (Denmark)

Jensen, Jesper Bo Damm; Hoiby, P.E.; Pedersen, L.H.

2004-01-01

Demonstration of selective detection of fluorophore labeled DNA by hybridization inside the air holes of a photonic crystal fiber A laser exposes the fiber from the side and the emitted fluorescence tunnels into the core.......Demonstration of selective detection of fluorophore labeled DNA by hybridization inside the air holes of a photonic crystal fiber A laser exposes the fiber from the side and the emitted fluorescence tunnels into the core....

Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

International Nuclear Information System (INIS)

Hentosh, P.; Henner, W.D.; Reynolds, R.J.

1985-01-01

DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

Immunochemical approach to the study of DNA damage and repair. Technical progress report

International Nuclear Information System (INIS)

1986-01-01

We are studying damages that have been shown to be stable radiolysis products found in x-irradiation DNA and thus products that have potential biological consequences. Four thymine ring saturation or fragmentation products were chosen as models for pyrimidine radiolysis products. The first product we synthesized and to which antibodies were elicited was thymine glycol. Thymine glycols are the major stable radiolysis products produced in DNA x-radiation in vitro. Although they retain base pairing characteristics, the stacking properties of thymine glycols are altered due to the saturation of the 5.6 double bond. Thymine glucol is also a useful model because alternative assay proceudres are available and they can selectively be produced in DNA by osmium tetroxide oxidation allowing the development of standards for subsequent measurement of DNA damage in x-irradiated DNA. We have also raised antibodies to dihydrothymine, a major radiolysis product produced in NDA under anaerobic conditions, to 5-hydroxy-5-methylhydantoin, the second most predominant stable radiolysis product producted under aerobic conditions, and to urea, a totally non-instructive DNA fragmentation product of thymine hydroperoxides. 29 refs., 2 figs

Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

Science.gov (United States)

Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

2012-03-14

We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

A twin Frisch-grid ionization chamber as a selective detector for the delayed gamma-spectroscopy of fission fragments

Energy Technology Data Exchange (ETDEWEB)

Gaudefroy, L., E-mail: laurent.gaudefroy@cea.fr [CEA, DAM, DIF, F-91297 Arpajon (France); Roger, T., E-mail: roger@ganil.fr [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Pancin, J., E-mail: pancin@ganil.fr [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Spitaels, C. [GANIL, CEA/DSM-CNRS/IN2P3, BP 55027, F-14076 Caen (France); Aupiais, J. [CEA, DAM, DIF, F-91297 Arpajon (France); Mottier, J. [Institut de Physique Nucléaire, Université Paris-Sud-11-CNRS-IN2P3, F-91406 Orsay (France)

2017-05-21

We present a twin Frisch-grid ionization chamber. The detector is meant to provide high selective power for the study of delayed gamma-ray spectroscopy of fission fragments produced via {sup 252}Cf spontaneous fission. A mean energy resolution on the kinetic energy of fission fragments of 675 keV (FWHM) is achieved and allows us to resolve masses of fragments for fission events where neutron emission is not energetically possible. The mean mass resolution measured for these particular events amounts to 0.54 mass units (FWHM). For fission events with neutron emission a resolution of 4 mass units (FWHM) is reported. Information on fragment emission angle is measured with a resolution of 0.1 on the difference of the cosines determined for both halves of the detector. A charge resolution of 4.5 charge units (FWHM) is also demonstrated.

A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

Directory of Open Access Journals (Sweden)

Erwan Quéméré

Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

NARCIS (Netherlands)

Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

1991-01-01

Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

International Nuclear Information System (INIS)

Ermolaeva, N.V.; Vodolazskaya, N.A.

1978-01-01

It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

Science.gov (United States)

Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

2009-01-01

The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

Photon-hadron fragmentation: theoretical situation

International Nuclear Information System (INIS)

Peschanski, R.

1983-07-01

Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

DNA based radiological dosimetry technology

International Nuclear Information System (INIS)

Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

2008-01-01

Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

DNA polymerase beta participates in mitochondrial DNA repair

DEFF Research Database (Denmark)

Sykora, P; Kanno, S; Akbari, M

2017-01-01

We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

New visible and selective DNA staining method in gels with tetrazolium salts.

Science.gov (United States)

Paredes, Aaron J; Naranjo-Palma, Tatiana; Alfaro-Valdés, Hilda M; Barriga, Andrés; Babul, Jorge; Wilson, Christian A M

2017-01-15

DNA staining in gels has historically been carried out using silver staining and fluorescent dyes like ethidium bromide and SYBR Green I (SGI). Using fluorescent dyes allows recovery of the analyte, but requires instruments such as a transilluminator or fluorimeter to visualize the DNA. Here we described a new and simple method that allows DNA visualization to the naked eye by generating a colored precipitate. It works by soaking the acrylamide or agarose DNA gel in SGI and nitro blue tetrazolium (NBT) solution that, when exposed to sunlight, produces a purple insoluble formazan precipitate that remains in the gel after exposure to light. A calibration curve made with a DNA standard established a detection limit of approximately 180 pg/band at 500 bp. Selectivity of this assay was determined using different biomolecules, demonstrating a high selectivity for DNA. Integrity and functionality of the DNA recovered from gels was determined by enzymatic cutting with a restriction enzyme and by transforming competent cells after the different staining methods, respectively. Our method showed the best performance among the dyes employed. Based on its specificity, low cost and its adequacy for field work, this new methodology has enormous potential benefits to research and industry. Copyright © 2016 Elsevier Inc. All rights reserved.

[Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

Science.gov (United States)

Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

2015-08-01

To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

Investigation of protein selectivity in multimodal chromatography using in silico designed Fab fragment variants.

Science.gov (United States)

Karkov, Hanne Sophie; Krogh, Berit Olsen; Woo, James; Parimal, Siddharth; Ahmadian, Haleh; Cramer, Steven M

2015-11-01

In this study, a unique set of antibody Fab fragments was designed in silico and produced to examine the relationship between protein surface properties and selectivity in multimodal chromatographic systems. We hypothesized that multimodal ligands containing both hydrophobic and charged moieties would interact strongly with protein surface regions where charged groups and hydrophobic patches were in close spatial proximity. Protein surface property characterization tools were employed to identify the potential multimodal ligand binding regions on the Fab fragment of a humanized antibody and to evaluate the impact of mutations on surface charge and hydrophobicity. Twenty Fab variants were generated by site-directed mutagenesis, recombinant expression, and affinity purification. Column gradient experiments were carried out with the Fab variants in multimodal, cation-exchange, and hydrophobic interaction chromatographic systems. The results clearly indicated that selectivity in the multimodal system was different from the other chromatographic modes examined. Column retention data for the reduced charge Fab variants identified a binding site comprising light chain CDR1 as the main electrostatic interaction site for the multimodal and cation-exchange ligands. Furthermore, the multimodal ligand binding was enhanced by additional hydrophobic contributions as evident from the results obtained with hydrophobic Fab variants. The use of in silico protein surface property analyses combined with molecular biology techniques, protein expression, and chromatographic evaluations represents a previously undescribed and powerful approach for investigating multimodal selectivity with complex biomolecules. © 2015 Wiley Periodicals, Inc.

A Rewritable, Random-Access DNA-Based Storage System.

Science.gov (United States)

Yazdi, S M Hossein Tabatabaei; Yuan, Yongbo; Ma, Jian; Zhao, Huimin; Milenkovic, Olgica

2015-09-18

We describe the first DNA-based storage architecture that enables random access to data blocks and rewriting of information stored at arbitrary locations within the blocks. The newly developed architecture overcomes drawbacks of existing read-only methods that require decoding the whole file in order to read one data fragment. Our system is based on new constrained coding techniques and accompanying DNA editing methods that ensure data reliability, specificity and sensitivity of access, and at the same time provide exceptionally high data storage capacity. As a proof of concept, we encoded parts of the Wikipedia pages of six universities in the USA, and selected and edited parts of the text written in DNA corresponding to three of these schools. The results suggest that DNA is a versatile media suitable for both ultrahigh density archival and rewritable storage applications.

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

Science.gov (United States)

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Laser mass spectrometry for DNA fingerprinting for forensic applications

Energy Technology Data Exchange (ETDEWEB)

Chen, C.H.; Tang, K.; Taranenko, N.I.; Allman, S.L.; Chang, L.Y.

1994-12-31

The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual`s DNA structure is identical within all tissues of their body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et al. found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endonuclease sites can provide the basis for identification. The major steps for conventional DNA fingerprinting include (1) specimen processing (2) amplification of selected DNA segments by PCR, and (3) gel electrophoresis to do the final DNA analysis. In this work we propose to use laser desorption mass spectrometry for fast DNA fingerprinting. The process and advantages are discussed.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

Science.gov (United States)

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

Directory of Open Access Journals (Sweden)

Nguyen-Hieu Tung

2012-09-01

Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

Sequence analysis of mitochondrial DNA hypervariable region III of ...

African Journals Online (AJOL)

The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

Science.gov (United States)

Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

2018-03-12

Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

OpenAIRE

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonst...

Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

Science.gov (United States)

Wood, S; Starr, T V; Shukin, R J

1986-01-01

We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

Fragment-based design of symmetrical bis-benzimidazoles as selective inhibitors of the trimethoprim-resistant, type II R67 dihydrofolate reductase.

Science.gov (United States)

Bastien, Dominic; Ebert, Maximilian C C J C; Forge, Delphine; Toulouse, Jacynthe; Kadnikova, Natalia; Perron, Florent; Mayence, Annie; Huang, Tien L; Vanden Eynde, Jean Jacques; Pelletier, Joelle N

2012-04-12

The continuously increasing use of trimethoprim as a common antibiotic for medical use and for prophylactic application in terrestrial and aquatic animal farming has increased its prevalence in the environment. This has been accompanied by increased drug resistance, generally in the form of alterations in the drug target, dihydrofolate reductase (DHFR). The most highly resistant variants of DHFR are known as type II DHFR, among which R67 DHFR is the most broadly studied variant. We report the first attempt at designing specific inhibitors to this emerging drug target by fragment-based design. The detection of inhibition in R67 DHFR was accompanied by parallel monitoring of the human DHFR, as an assessment of compound selectivity. By those means, small aromatic molecules of 150-250 g/mol (fragments) inhibiting R67 DHFR selectively in the low millimolar range were identified. More complex, symmetrical bis-benzimidazoles and a bis-carboxyphenyl were then assayed as fragment-based leads, which procured selective inhibition of the target in the low micromolar range (K(i) = 2-4 μM). The putative mode of inhibition is discussed according to molecular modeling supported by in vitro tests. © 2012 American Chemical Society

Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

Science.gov (United States)

Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

2004-09-01

Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

Homology of yeast photoreactivating gene fragment with human genomic digests

International Nuclear Information System (INIS)

Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

1984-01-01

Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

International Nuclear Information System (INIS)

Karentz, D.; Cleaver, J.E.

1985-01-01

Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

Directory of Open Access Journals (Sweden)

Olufunmilola Ibironke

2012-01-01

Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

The value of using DNA markers for beef bull selection in the seedstock sector.

Science.gov (United States)

Van Eenennaam, A L; van der Werf, J H J; Goddard, M E

2011-02-01

The objective of this study was to estimate the value derived from using DNA information to increase the accuracy of beef sire selection in a closed seedstock herd. Breeding objectives for commercial production systems targeting 2 diverse markets were examined using multiple-trait selection indexes developed for the Australian cattle industry. Indexes included those for both maternal (self-replacing) and terminal herds targeting either a domestic market, where steers are finished on pasture, or the export market, where steers are finished on concentrate rations in feedlots and marbling has a large value. Selection index theory was used to predict the response to conventional selection based on phenotypic performance records, and this was compared with including information from 2 hypothetical marker panels. In 1 case the marker panel explained a percentage of additive genetic variance equal to the heritability for all traits in the breeding objective and selection criteria, and in the other case to one-half of this amount. Discounted gene flow methodology was used to calculate the value derived from the use of superior bulls selected using DNA test information and performance recording over that derived from conventional selection using performance recording alone. Results were ultimately calculated as discounted returns per DNA test purchased by the seedstock operator. The DNA testing using these hypothetical marker panels increased the selection response between 29 to 158%. The value of this improvement above that obtained using traditional performance recording ranged from $89 to 565 per commercial bull, and $5,332 to 27,910 per stud bull. Assuming that the entire bull calf crop was tested to achieve these gains, the value of the genetic gain derived from DNA testing ranged from $204 to 1,119 per test. All values assumed that the benefits derived from using superior bulls were efficiently transferred along the production chain to the seedstock producer incurring

Investigation of DNA double strand breaks induced by α particle and 7Li ions

International Nuclear Information System (INIS)

Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

2006-01-01

α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

Exponential growth and selection in self-replicating materials from DNA origami rafts

Science.gov (United States)

He, Xiaojin; Sha, Ruojie; Zhuo, Rebecca; Mi, Yongli; Chaikin, Paul M.; Seeman, Nadrian C.

2017-10-01

Self-replication and evolution under selective pressure are inherent phenomena in life, and but few artificial systems exhibit these phenomena. We have designed a system of DNA origami rafts that exponentially replicates a seed pattern, doubling the copies in each diurnal-like cycle of temperature and ultraviolet illumination, producing more than 7 million copies in 24 cycles. We demonstrate environmental selection in growing populations by incorporating pH-sensitive binding in two subpopulations. In one species, pH-sensitive triplex DNA bonds enable parent-daughter templating, while in the second species, triplex binding inhibits the formation of duplex DNA templating. At pH 5.3, the replication rate of species I is ~1.3-1.4 times faster than that of species II. At pH 7.8, the replication rates are reversed. When mixed together in the same vial, the progeny of species I replicate preferentially at pH 7.8 similarly at pH 5.3, the progeny of species II take over the system. This addressable selectivity should be adaptable to the selection and evolution of multi-component self-replicating materials in the nanoscopic-to-microscopic size range.

DNA degrades during storage in formalin-fixed and paraffin-embedded tissue blocks.

Science.gov (United States)

Guyard, Alice; Boyez, Alice; Pujals, Anaïs; Robe, Cyrielle; Tran Van Nhieu, Jeanne; Allory, Yves; Moroch, Julien; Georges, Odette; Fournet, Jean-Christophe; Zafrani, Elie-Serge; Leroy, Karen

2017-10-01

Formalin-fixed paraffin-embedded (FFPE) tissue blocks are widely used to identify clinically actionable molecular alterations or perform retrospective molecular studies. Our goal was to quantify degradation of DNA occurring during mid to long-term storage of samples in usual conditions. We selected 46 FFPE samples of surgically resected carcinomas of lung, colon, and urothelial tract, of which DNA had been previously extracted. We performed a second DNA extraction on the same blocks under identical conditions after a median period of storage of 5.5 years. Quantitation of DNA by fluorimetry showed a 53% decrease in DNA quantity after storage. Quantitative PCR (qPCR) targeting KRAS exon 2 showed delayed amplification of DNA extracted after storage in all samples but one. The qPCR/fluorimetry quantification ratio decreased from 56 to 15% after storage (p DNA analyzable by qPCR represented only 11% of the amount obtained at first extraction. Maximal length of amplifiable DNA fragments assessed with a multiplex PCR was reduced in DNA extracted from stored tissue, indicating that DNA fragmentation had increased in the paraffin blocks during storage. Next-generation sequencing was performed on 12 samples and showed a mean 3.3-fold decrease in library yield and a mean 4.5-fold increase in the number of single-nucleotide variants detected after storage. In conclusion, we observed significant degradation of DNA extracted from the same FFPE block after 4 to 6 years of storage. Better preservation strategies should be considered for storage of FFPE biopsy specimens.

Methods of introducing nucleic acids into cellular DNA

Energy Technology Data Exchange (ETDEWEB)

Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

2017-06-27

A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

DEFF Research Database (Denmark)

Christensen, H.; Angen, Øystein; Mutters, R.

2000-01-01

The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

Science.gov (United States)

Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

1974-01-01

DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

Science.gov (United States)

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

Science.gov (United States)

Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

2005-12-01

The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

Science.gov (United States)

Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

2014-08-01

This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

Science.gov (United States)

Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

2010-03-31

The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

Science.gov (United States)

Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

2016-12-01

The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

Origin of DNA in human serum and usefulness of serum as a material for DNA typing.

Science.gov (United States)

Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I

2001-06-01

The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.

Luminescent platinum(II) complexes with functionalized N-heterocyclic carbene or diphosphine selectively probe mismatched and abasic DNA

OpenAIRE

Che, CM; Chen, T; To, WP; Zou, T; FUNG, SK; Lok, CN; YANG, C; Cao, B

2016-01-01

The selective targeting of mismatched DNA overexpressed in cancer cells is an appealing strategy in designing cancer diagnosis and therapy protocols. Few luminescent probes that specifically detect intracellular mismatched DNA have been reported. Here we used Pt(II) complexes with luminescence sensitive to subtle changes in the local environment and report several Pt(II) complexes that selectively bind to and identify DNA mismatches. We evaluated the complexes' DNA-binding characteristics by ...

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

Science.gov (United States)

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

Science.gov (United States)

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

Science.gov (United States)

Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

2015-01-01

Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

Directory of Open Access Journals (Sweden)

Tatsuya Ishikawa

2017-06-01

Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

On some surprising statistical properties of a DNA fingerprinting technique called AFLP

NARCIS (Netherlands)

Gort, G.

2010-01-01

AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

Science.gov (United States)

Srinivasan, Krishnamoorthy; Sharma, Shyam S

2011-11-20

Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

Multiple tag labeling method for DNA sequencing

Science.gov (United States)

Mathies, R.A.; Huang, X.C.; Quesada, M.A.

1995-07-25

A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

Science.gov (United States)

Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

2004-01-01

RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

Effect of Cisplatin on the Flexibility of Linear DNA

International Nuclear Information System (INIS)

Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye

2011-01-01

With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)

Monoclonal antibody to the rat glucocorticoid receptor. Relationship between the immunoreactive and DNA-binding domain

International Nuclear Information System (INIS)

Eisen, L.P.; Reichman, M.E.; Thompson, E.B.; Gametchu, B.; Harrison, R.W.; Eisen, H.J.

1985-01-01

The region of the glucocorticoid receptor that reacted with a monoclonal antibody (BUGR-1) was identified. In order to identify the immunoreactive region, the rat liver glucocorticoid receptor was subjected to limited proteolysis; immunoreactive fragments were identified by Western blotting. The monoclonal antibody reacted with both the undigested Mr approximately 97,000 receptor subunit and a Mr approximately 45,000 fragment containing the steroid-binding and DNA-binding domains. Digestion by trypsin also produced two steroid-binding fragments of Mr approximately 27,000 and 31,000 which did not react with the antibody and an immunoreactive Mr approximately 16,000 fragment. This Mr approximately 16,000 fragment was shown to bind to DNA-cellulose, indicating that it contained a DNA-binding domain of the receptor. The undigested receptor must have steroid associated with it to undergo activation to a DNA-binding form. However, the Mr approximately 16,000 immunoreactive fragment binds to DNA-cellulose even if it is obtained by digestion of the steroid-free holoreceptor which does not itself bind to DNA

Transcriptional blockages in a cell-free system by sequence-selective DNA alkylating agents.

Science.gov (United States)

Ferguson, L R; Liu, A P; Denny, W A; Cullinane, C; Talarico, T; Phillips, D R

2000-04-14

There is considerable interest in DNA sequence-selective DNA-binding drugs as potential inhibitors of gene expression. Five compounds with distinctly different base pair specificities were compared in their effects on the formation and elongation of the transcription complex from the lac UV5 promoter in a cell-free system. All were tested at drug levels which killed 90% of cells in a clonogenic survival assay. Cisplatin, a selective alkylator at purine residues, inhibited transcription, decreasing the full-length transcript, and causing blockage at a number of GG or AG sequences, making it probable that intrastrand crosslinks are the blocking lesions. A cyclopropylindoline known to be an A-specific alkylator also inhibited transcription, with blocks at adenines. The aniline mustard chlorambucil, that targets primarily G but also A sequences, was also effective in blocking the formation of full-length transcripts. It produced transcription blocks either at, or one base prior to, AA or GG sequences, suggesting that intrastrand crosslinks could again be involved. The non-alkylating DNA minor groove binder Hoechst 33342 (a bisbenzimidazole) blocked formation of the full-length transcript, but without creating specific blockage sites. A bisbenzimidazole-linked aniline mustard analogue was a more effective transcription inhibitor than either chlorambucil or Hoechst 33342, with different blockage sites occurring immediately as compared with 2 h after incubation. The blockages were either immediately prior to AA or GG residues, or four to five base pairs prior to such sites, a pattern not predicted from in vitro DNA-binding studies. Minor groove DNA-binding ligands are of particular interest as inhibitors of gene expression, since they have the potential ability to bind selectively to long sequences of DNA. The results suggest that the bisbenzimidazole-linked mustard does cause alkylation and transcription blockage at novel DNA sites. in addition to sites characteristic of

Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

International Nuclear Information System (INIS)

Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

2008-01-01

Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

Energy Technology Data Exchange (ETDEWEB)

Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

2014-06-01

The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

Influence of DNA conformation on radiation-induced single-strand breaks

International Nuclear Information System (INIS)

Barone, F.; Belli, M.; Mazzei, F.

1994-01-01

We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)

Selective alkylation of T-T mismatched DNA using vinyldiaminotriazine-acridine conjugate.

Science.gov (United States)

Onizuka, Kazumitsu; Usami, Akira; Yamaoki, Yudai; Kobayashi, Tomohito; Hazemi, Madoka E; Chikuni, Tomoko; Sato, Norihiro; Sasaki, Kaname; Katahira, Masato; Nagatsugi, Fumi

2018-02-16

The alkylation of the specific higher-order nucleic acid structures is of great significance in order to control its function and gene expression. In this report, we have described the T-T mismatch selective alkylation with a vinyldiaminotriazine (VDAT)-acridine conjugate. The alkylation selectively proceeded at the N3 position of thymidine on the T-T mismatch. Interestingly, the alkylated thymidine induced base flipping of the complementary base in the duplex. In a model experiment for the alkylation of the CTG repeats DNA which causes myotonic dystrophy type 1 (DM1), the observed reaction rate for one alkylation increased in proportion to the number of T-T mismatches. In addition, we showed that primer extension reactions with DNA polymerase and transcription with RNA polymerase were stopped by the alkylation. The alkylation of the repeat DNA will efficiently work for the inhibition of replication and transcription reactions. These functions of the VDAT-acridine conjugate would be useful as a new biochemical tool for the study of CTG repeats and may provide a new strategy for the molecular therapy of DM1.

DNA hybridization sensing for cytogenetic analysis

DEFF Research Database (Denmark)

Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line

2013-01-01

are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

Science.gov (United States)

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

The use of a DNA stabilizer in human dental tissues stored under different temperature conditions and time intervals

Science.gov (United States)

TERADA, Andrea Sayuri Silveira Dias; da SILVA, Luiz Antonio Ferreira; GALO, Rodrigo; de AZEVEDO, Aline; GERLACH, Raquel Fernanda; da SILVA, Ricardo Henrique Alves

2014-01-01

Objective The present study evaluated the use of a reagent to stabilize the DNA extracted from human dental tissues stored under different temperature conditions and time intervals. Material and Methods A total of 161 teeth were divided into two distinct groups: intact teeth and isolated dental pulp tissue. The samples were stored with or without the product at different time intervals and temperature. After storage, DNA extraction and genomic DNA quantification were performed using real-time PCR; the fragments of the 32 samples that represented each possible condition were analyzed to find the four pre-selected markers in STR analysis. Results The results of the quantification showed values ranging from 0.01 to 10,246.88 ng/μL of DNA. The statistical difference in the quantity of DNA was observed when the factors related to the time and temperature of storage were analyzed. In relation to the use of the specific reagent, its use was relevant in the group of intact teeth when they were at room temperature for 30 and 180 days. The analysis of the fragments in the 32 selected samples was possible irrespective of the amount of DNA, confirming that the STR analysis using an automated method yields good results. Conclusions The use of a specific reagent showed a significant difference in stabilizing DNA in samples of intact human teeth stored at room temperature for 30 and 180 days, while the results showed no justification for using the product under the other conditions tested. PMID:25141206

Fragment emission from modestly excited nuclear systems

Energy Technology Data Exchange (ETDEWEB)

Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

1996-07-08

Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

Selection and characterization of single stranded DNA aptamers recognizing fumonisin B1

International Nuclear Information System (INIS)

Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping; Zhu, Changqing; Jiang, Yuan

2014-01-01

We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B 1 (FB 1 ). FB 1 is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB 1 were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB 1 via aptasensors. (author)

Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.

Science.gov (United States)

Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko

2016-01-01

The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

Sequence-selective targeting of duplex DNA by peptide nucleic acids

DEFF Research Database (Denmark)

Nielsen, Peter E

2010-01-01

Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...

Selection Of Drought Resistant Mutants In Rice Using DNA Markers

International Nuclear Information System (INIS)

Nguyen Duc Thanh; Le Thi Bich Thuy; Dang Thi Minh Lua

2008-01-01

In recent years, the marker - assisted selection (MAS) strategy have been used for selection of traits that are difficult and costly performed measurement and score. Selection for a well-developed root system could improve the drought resistance of rice as the plant would avoid water stress by absorbing water from the soil. There were several reports on map construction and identification of the markers tightly linked to morphological and physiological traits related to drought resistance in rice, in particular, root traits in upland and lowland rice (Champoux et al., 1995; Ray et al., 1996; Price et al., 1997, 2000; Yadav et al., 1997). In this report, we present the results on selection of drought resistance mutants in rice using the DNA markers tightly linked to root traits favorable for drought resistance. The mutant rice lines were obtained from irradiated seeds and calluses by gamma ray. The selection was performed at M2 mutants using the DNA markers linked to maximum root length (MRL), root weight to shoot weight ratio (RW/SR), and weight of deep root to shoot weight ratio (DRW/SR). The obtained results showed that there were many lines possessed drought resistant markers. In addition, there is a number of lines have altered genome. Several lines having drought markers proved to be more resistant to drought in green-house test. These lines could be useful for further test and development of drought resistant varieties. (author)

Quantitative comparison between in vivo DNA adduct formation from exposure to selected DNA-reactive carcinogens, natural background levels of DNA adduct formation and tumour incidende in rodent bioassays

NARCIS (Netherlands)

Paini, A.; Scholz, G.; Marin-Kuan, M.; Schilter, B.; O'Brien, J.; Bladeren, van P.J.; Rietjens, I.

2011-01-01

This study aimed at quantitatively comparing the occurrence/formation of DNA adducts with the carcinogenicity induced by a selection of DNA-reactive genotoxic carcinogens. Contrary to previous efforts, we used a very uniform set of data, limited to in vivo rat liver studies in order to investigate

Gene prediction in metagenomic fragments: A large scale machine learning approach

Directory of Open Access Journals (Sweden)

Morgenstern Burkhard

2008-04-01

Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

DNA Sequences of RAPD Fragments in the Egyptian cotton ...

African Journals Online (AJOL)

Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

Directory of Open Access Journals (Sweden)

Saeed Samarghandian

2013-01-01

Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis

Science.gov (United States)

Khan, Sharik R.; Kuzminov, Andrei

2013-01-01

Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235

Studies on DNA damage: discordant responses of rate of DNA disentanglement (viscosimetrically evaluated) and alkaline elution rate, obtained for several compounds. Possible explanations of the discrepancies.

Science.gov (United States)

Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L

1983-12-01

Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.

Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

Science.gov (United States)

Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

2004-11-01

Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.

Science.gov (United States)

Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A

2016-06-01

Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.

利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

Institute of Scientific and Technical Information of China (English)

范惠玲; 白生文; 李华清; 孙万仓

2016-01-01

Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系，也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官，并分离与自交亲和性有关的 cDNA 片段，以芸芥的一对近等基因系，自交亲和系（SC）与自交不亲和系（SI）为试材，利用差异显示 RT-PCR �

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

Science.gov (United States)

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Fragment approaches in structure-based drug discovery

International Nuclear Information System (INIS)

Hubbard, Roderick E.

2008-01-01

Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets

DNA strand breakage by 125I-decay in oligoDNA

International Nuclear Information System (INIS)

Lobachevsky, P.; Martin, R.F.

1996-01-01

Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights

In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

Directory of Open Access Journals (Sweden)

Ryan M. Williams

2014-01-01

Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

Selective alkylation of T–T mismatched DNA using vinyldiaminotriazine–acridine conjugate

Science.gov (United States)

Onizuka, Kazumitsu; Usami, Akira; Yamaoki, Yudai; Kobayashi, Tomohito; Hazemi, Madoka E; Chikuni, Tomoko; Sato, Norihiro; Sasaki, Kaname; Katahira, Masato

2018-01-01

Abstract The alkylation of the specific higher-order nucleic acid structures is of great significance in order to control its function and gene expression. In this report, we have described the T–T mismatch selective alkylation with a vinyldiaminotriazine (VDAT)–acridine conjugate. The alkylation selectively proceeded at the N3 position of thymidine on the T–T mismatch. Interestingly, the alkylated thymidine induced base flipping of the complementary base in the duplex. In a model experiment for the alkylation of the CTG repeats DNA which causes myotonic dystrophy type 1 (DM1), the observed reaction rate for one alkylation increased in proportion to the number of T–T mismatches. In addition, we showed that primer extension reactions with DNA polymerase and transcription with RNA polymerase were stopped by the alkylation. The alkylation of the repeat DNA will efficiently work for the inhibition of replication and transcription reactions. These functions of the VDAT–acridine conjugate would be useful as a new biochemical tool for the study of CTG repeats and may provide a new strategy for the molecular therapy of DM1. PMID:29309639

Carbon ion induced DNA double-strand breaks in melanophore B16

International Nuclear Information System (INIS)

Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu

1997-01-01

DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

Science.gov (United States)

Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

2012-06-01

A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

Improved production and function of llama heavy chain antibody fragments by molecular evolution

NARCIS (Netherlands)

Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.

2000-01-01

The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In

Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

International Nuclear Information System (INIS)

Dallas, J.F.

1988-01-01

A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

Construction of recombinant DNA clone for bovine viral diarrhea virus

International Nuclear Information System (INIS)

Yeo, S.G.; Cho, H.J.; Masri, S.A.

1992-01-01

Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

International Nuclear Information System (INIS)

Hartley, J.A.; Forrow, S.M.; Souhami, R.L.

1990-01-01

Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove

Size distribution of DNA molecules recovered from non-denaturing filter elution

International Nuclear Information System (INIS)

Bloecher, D.; Iliakis, G.

1991-01-01

DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

Amplification of a transcriptionally active DNA sequence in the human brain

International Nuclear Information System (INIS)

Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

1986-01-01

The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days