WorldWideScience

Sample records for selected fragment-length polymorphism

  1. Identification of amplified fragment length polymorphism (AFLP ...

    African Journals Online (AJOL)

    Identification of amplified fragment length polymorphism (AFLP) fragments linked to soybean mosaic virus resistance gene in Glycine soja and conversion to a sequence characterized amplified regions (SCAR) marker for rapid selection.

  2. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs......RI genomic DNA fragment, and a short, degenerated, oligonucleotide covering the remaining TspRI cohesive ends. Other cohesive ends are covered by a short degenerated oligonucleotide lacking the primer site. The ligation mixture is used as a template for amplification using a single primer corresponding...... for differentiation of the organisms without previous knowledge of their DNA sequence. The usefulness of the method is confirmed by genotyping of 70 previously characterized clinical E. coli isolates. The grouping obtained was identical to the results of REA-PFGE. Versatility of the method is highlighted, i.e. its...

  3. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  5. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  6. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  7. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Amplified fragment length polymorphism (AFLP) technology was used to reveal the genetic variation in six species of Cycas collected from eleven natural populations. Two sets of primer with 4-selective nucleotides were used in this study and 78% polymorphism was found. The results correlated with.

  8. Selection criteria for scoring amplified fragment length polymorphisms (AFLPs) positively affect the reliability of population genetic parameter estimates.

    Science.gov (United States)

    Herrmann, Doris; Poncet, Bénédicte N; Manel, Stéphanie; Rioux, Delphine; Gielly, Ludovic; Taberlet, Pierre; Gugerli, Felix

    2010-04-01

    A reliable data set is a fundamental prerequisite for consistent results and conclusions in population genetic studies. However, marker scoring of genetic fingerprints such as amplified fragment length polymorphisms (AFLPs) is a highly subjective procedure, inducing inconsistencies owing to personal or laboratory-specific criteria. We applied two alternative marker selection algorithms, the newly developed script scanAFLP and the recently published AFLPScore, to a large AFLP genome scan to test how population genetic parameters and error rates were affected. These results were confronted with replicated random selections of marker subsets. We show that the newly developed marker selection criteria reduced the mismatch error rate and had a notable influence on estimates of genetic diversity and differentiation. Both effects are likely to influence biological inference. For example, genetic diversity (HS) was 29% lower while genetic differentiation (FST) was 8% higher when applying scanAFLP compared with AFLPScore. Likewise, random selections of markers resulted in substantial deviations of population genetic parameters compared with the data sets including specific selection criteria. These randomly selected marker sets showed surprisingly low variance among replicates. We conclude that stringent marker selection and phenotype calling reduces noise in the data set while retaining patterns of population genetic structure.

  9. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able...

  10. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...

  11. Amplified restriction fragment length polymorphism in parasite genetics.

    Science.gov (United States)

    Masiga, D K; Tait, A; Turner, C M

    2000-08-01

    The amplified restriction fragment length polymorphism (AFLP) technique is a relatively new method for the analysis of polymorphism that has not yet been widely used in parasitology. In this article, Dan Masiga, Andy Tait and Mike Turner provide a brief introduction to AFLP and illustrate how it can be used in the investigation of marker inheritance in genetic crosses and in the analysis of polymorphism of field populations. They also briefly highlight the strengths and weaknesses of AFLP in comparison with other methods for detecting polymorphism and conclude that AFLP is a very useful addition to the range of techniques available.

  12. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  13. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  14. Analysis of genetic diversity identified by amplified fragment length polymorphism marker in hybrid wheat.

    Science.gov (United States)

    Ejaz, M; Qidi, Z; Gaisheng, Z; Na, N; Huiyan, Z; Qunzhu, W

    2015-08-07

    Amplified fragment length polymorphism markers were used to assess genetic diversity in 10 male sterile wheat crop lines (hetero-cytoplasm with the same nucleus) in relation to a restorer wheat line. These male sterile lines were evaluated using 64 amplified fragment length polymorphism primer combinations, and 13 primers produced polymorphic bands, generating a total 682 fragments. Of the 682 fragments, 113 were polymorphic. The polymorphic information content and marker index values demonstrated the utility of the primer combinations used in the present study. Unweighted pair group method with arithmetic mean and principal coordinate analysis of the genotypic data revealed clustering of accessions based on genetic relationships, and accessions were separated into 2 groups with their restorer line. Jaccard's similarity coefficient values suggested good variability among the male sterile lines, indicating their utility in breeding programs. The fallouts of analysis of molecular variance showed large within-group population variation, accounting for 77% of variation, while among-group comparison accounted for 23% of the total molecular variation, which was statistically significant. The molecular diversity observed in this study will be useful for selecting appropriate accessions for plant improvement and hybridization through molecular-breeding approaches and for developing suitable conservation strategies.

  15. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  16. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC...

  17. Application of amplified fragment length polymorphism (AFLPs) for ...

    African Journals Online (AJOL)

    Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...

  18. Transposition rates of Mycobacterium tuberculosis IS6110 restriction fragment length polymorphism patterns

    NARCIS (Netherlands)

    Eilers, Paul H. C.; van Soolingen, Dick; Thi Ngoc Lan, Nguyen; Warren, Rob M.; Borgdorff, Martien W.

    2004-01-01

    To determine the rate at which IS6110 restriction fragment length polymorphism (RFLP) patterns in Mycobacterium tuberculosis change over time, we applied a smooth nonparametric survival model to several data sets, including data from previous publications on the rate of change. The results strongly

  19. Use of Restriction Fragment Length Polymorphism of 18S rRNA ...

    African Journals Online (AJOL)

    The restriction fragment length polymorphism (RFLP) pattern of PCR products obtained was the same for T. brucei subspecies: T.b. brucei and T.b. gambiense but different for other trypanosome species and L. donovani. RFLP analysis was also done with genomic DNA from different trypanosome species, subspecies and ...

  20. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  1. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  2. Genetic Diversity and Sectional Relationships from an Amplified Fragment Length Polymorphism Analysis of Taiwan Bananas

    OpenAIRE

    Chang, Shu-Fen; Chang, Yueh-Long; Yen, Yung-Fu; Miyajima, Ikuo; Huang, Kuang-Liang

    2017-01-01

    Phylogenetic relationships among 19 Musa species or cultivars were examined through DNA fingerprinting with amplified fragment length polymorphism (AFLP) analysis. The AFLP analysis was performed on the Musa species or cultivars with 21 primer combinations, yielding a total of 6,348 DNA bands, among which 6,113 (96.3%) were polymorphic. M. itinerans var. formosana demonstrated 133 monomorphic bands, which is the most among all samples. Unweighted pair–group method with arithmetic averages was...

  3. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  4. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    OpenAIRE

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction pattern...

  5. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...... found by 16S rDNA analysis. The present data support previous observations regarding genetic homogeneity of M. capricolum subsp. capripneumoniae, and confirm the two evolutionary lines of descent found by analysis of 16S rRNA genes....

  6. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  7. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, J; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  8. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according to th...

  9. Genetic variation in an endemic salamander, Salamandra atra, using amplified fragment length polymorphism.

    Science.gov (United States)

    Riberon, Alexandre; Miaud, Claude; Guyetant, R; Taberlet, P

    2004-06-01

    The pattern of genetic differentiation of the endemic alpine salamander, Salamandra atra, has been studied using amplified fragment length polymorphism (AFLP) from 11 populations throughout the range of the two currently recognized subspecies, atra and aurorae. Five different primer combinations produced 706 bands and were analyzed by constructing a phylogenetic tree using NJ and principal component analysis. Significant genetic variation was revealed by AFLP between and within populations but, our results show a lack of genetic structure. AFLP markers seems to be unsuitable to investigate complex and recent diversification.

  10. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  11. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... to available epidemiological data. We conclude that this amplified fragment length polymorphism fingerprinting method may be a highly effective tool for molecular epidemiological studies of Campylobacter spp....

  12. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  13. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  14. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  15. Restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene.

    Science.gov (United States)

    Masina, P; Rando, A; Cocozza, S

    1984-10-01

    By Southern blot analysis, a restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene was detected. Two alleles, characterized by 9.7- and 12.4-kb BamHI fragments and by 15.3- and 18.0-kb HindIII fragments, have been detected in a small population of White New Zealand rabbits. The long allele is the most frequent (about 70%). The simultaneous changes in the restriction patterns of the two endonucleases and the constant distance between BamHI and HindIII sites in short and long fragments suggest the possibility that the two alleles arise from a rearrangement phenomenon involving a DNA segment 2.7 kb long. In addition, the presence of the two alleles in individuals genetically unrelated to the White New Zealand breed suggests that this polymorphism is widespread.

  16. Genetic variation in hemp and marijuana (Cannabis sativa L.) according to amplified fragment length polymorphisms.

    Science.gov (United States)

    Datwyler, Shannon L; Weiblen, George D

    2006-03-01

    Cannabis sativa L. (Cannabaceae) is one of the earliest known cultivated plants and is important in the global economy today as a licit and an illicit crop. Molecular markers distinguishing licit and illicit cultivars have forensic utility, but no direct comparison of hemp and marijuana amplified fragment length polymorphism (AFLP) has been made to date. Genetic variation was surveyed in three populations of fiber hemp and a potent cultivar of marijuana using AFLP markers. Ten primer pairs yielded 1206 bands, of which 88% were polymorphic. Eighteen bands represented fixed differences between all fiber populations and the drug cultivar. These markers have practical utility for (1) establishing conspiracy in the cultivation and distribution of marijuana, (2) identifying geographic sources of seized drugs, and (3) discriminating illegal, potent marijuana cultivars from hemp where the cultivation of industrial hemp is permitted.

  17. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  18. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  19. Restriction fragment length polymorphism typing of infectious bursal disease virus field strains in Turkey.

    Science.gov (United States)

    Sareyyüpoğlu, B; Akan, M

    2006-12-01

    Infectious bursal disease (IBD), also known as Gumboro disease, is a highly contagious, immunosuppressive disease of immature chickens. It is caused by IBD virus (IBDV) and is responsible for major economic losses in the poultry industry worldwide. In this study, 280 bursa samples from 56 commercially reared chicken flocks in Turkey with clinical symptoms of IBD were examined for IBDVs using the reverse transcription (RT)-polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) assay. The assay was conducted on a 743-bp fragment of the VP2 gene with the restriction enzymes BstNI, MboI, and SspI. The results indicate the existence of field isolates with new molecular patterns different from those previously published that may well be unique and specific to geographical regions.

  20. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  1. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  2. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...

  3. Direct endonuclease digestion and multi-analysis of restriction fragment length polymorphisms by microchip electrophoresis.

    Science.gov (United States)

    Akamine, Rie; Yatsushiro, Shouki; Yamamura, Shouhei; Kido, Jun-ichi; Shinohara, Yasuo; Baba, Yoshinobu; Kataoka, Masatoshi

    2009-12-05

    A high-performance multi-analysis system for genotypic mutation by means of restriction fragment length polymorphisms (RFLP) involving endonuclease treatment of PCR-amplified DNA on a microchip and subsequent analysis by microchip electrophoresis for DNA sizing was developed. A Hitachi SV1210 system, with which 12 samples can be analyzed on a plastic chip with good accuracy as to DNA sizing between 25 and 300 bp, was employed for RFLP analysis. We performed RFLP analysis of the ABO genotypes of blood donors for whom the ABO type was known. Six blood samples were analyzed by PCR to amplify two different regions of the genomic DNA, each of the amplified DNAs containing a different nucleotide polymorphism. To analyze the genes at polymorphic sites 261 and 526, restriction endonucleases Kpn I and Ban I were employed, respectively. When an amplified DNA was digested with each endonuclease on a microchip for 20 min, sequential analysis revealed the presence or absence of the respective restriction site. This analysis was performed within 7 min using a 1/10 volume of a DNA sample in comparison with the conventional method, and the estimated DNA size differed from the predicted size by less than 10 bp. The results indicate the potential of microchip electrophoresis for RFLP with on-chip direct endonuclease digestion and sequential analysis, offering high resolution in a short time.

  4. Coccidioides species determination: does sequence analysis agree with restriction fragment length polymorphism?

    Science.gov (United States)

    Johnson, Suzanne M; Carlson, Erin L; Pappagianis, Demosthenes

    2015-06-01

    Fifteen Coccidioides isolates were previously examined for genetic diversity using restriction fragment length polymorphism (RFLP); two fragment patterns were observed. Two isolates demonstrated one banding pattern (designated RFLP group I), while the remaining 13 isolates demonstrated a second pattern (designated RFLP group II). Recently, molecular studies supported the division of the genera Coccidioides into two species: Coccidioides posadasii and Coccidioides immitis. It has been assumed that the species division corresponds to the RFLP grouping. We tested this hypothesis by amplifying the ribosomal DNA internal transcribed spacer region as well as the dioxygenase, serine proteinase, and urease genes from 13 isolates previously examined by RFLP and then sequencing the PCR products. The appropriate species for each isolate was assigned using phylogenetically informative sites. The RFLP grouping agreed with the Coccidioides species assignment for all but one isolate, which may represent a hybrid. In addition, polymorphic sites among the four genes examined were in agreement for species assignment such that analysis of a single gene may be sufficient for species assignment.

  5. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  6. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  7. Investigating of yeast species in wine fermentation using terminal restriction fragment length polymorphism method.

    Science.gov (United States)

    Sun, Yue; Liu, Yanlin

    2014-04-01

    The objective of this study was to examine the potential of terminal restriction fragment length polymorphism (T-RFLP) in monitoring yeast communities during wine fermentation and to reveal new information on yeast community of Chinese enology. Firstly, terminal restriction fragment (TRF) lengths database was constructed using 32 pure yeast species. Ten of these species were firstly documented. The species except for Candida vini, Issatchenkia orientalis/Candida krusei, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cerevisiae, Saccharomyces kudriarzevii and Zygosaccharomyces bisporus could be distinguished by the T-RFLP targeting 5.8S-ITS rDNA. Moreover, the yeast communities in spontaneous fermentation of Chardonnay and Riesling were identified by T-RFLP and traditional methods, including colony morphology on Wallerstein Nutrient (WLN) medium and 5.8S-ITS-RFLP analysis. The result showed that T-RFLP profiles of the yeast community correlated well with that of the results identified by the traditional methods. The TRFs with the highest intensity and present in all the samples corresponded to Saccharomyces sp. Other species detected by both approaches were Hanseniaspora uvarum, Metschnikowia pulcherrima, Pichia minuta var. minuta, Saccharomycodes ludwigii/Torulaspora delbrueckii and Candida zemplinina. This study revealed that T-RFLP technique is a rapid and useful tool for monitoring the composition of yeast species during wine fermentation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Heterogeneity among Dermatophilus congolensis isolates demonstrated by restriction fragment length polymorphisms.

    Science.gov (United States)

    Faibra, D T

    1993-01-01

    There is evidence of antigenic diversity and of differences in virulence in Dermatophilus congolensis. For the understanding of the epidemiology of dermatophilosis it is important to distinguish between strains of the organism. Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. After restriction enzyme digestion of DNA by BamHI and Southern blotting, a rDNA probe consisting of plasmid pMC5 carrying a 4.8 kb insert of Mycoplasma capricolum DNA coding for the 5S, 23S and part of 16S rRNA allowed to distinguish 6 ribotypes of D. congolensis, based on their hybridized rDNA patterns. Particular ribotypes may be distributed over a wide geographical area. On the other hand, strains belonging to at least 5 different ribotypes may be found in one herd; this may partly explain the lack of success in immunization against dermatophilosis in the field.

  9. Restriction fragment length polymorphism catalog for molecular identification of Japanese Tetranychus spider mites (Acari: Tetranychidae).

    Science.gov (United States)

    Osakabe, Masahiro; Kotsubo, Yu; Tajima, Ryusen; Hinomoto, Norihide

    2008-08-01

    Species identification is a basic issue in biosecurity. Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) is a useful molecular diagnostic tool for species identification. However, the lack of transferability of data has been a serious shortcoming of this method. A RFLP catalog, i.e., a graph of PCR-RFLP patterns expected from sequence data, was devised as a tool to facilitate PCR-RFLP data sharing among laboratories. Twelve species of Tetranychus spider mites have been recorded in Japan to date. In this study, we analyzed DNA sequences of the internal transcribed spacer (ITS) region in nuclear ribosomal DNA of 11 Tetranychus species. For the species identification using PCR-RFLP, we chose six candidates from 131 restriction endonucleases and developed an RFLP catalog of all known Japanese Tetranychus species except Tetranychus neocaledonicus André. The RFLP catalog revealed that most Tetranychus species had diagnostic restriction fragments. The RFLP catalog is transferable and simple molecular diagnostic tool, and it has the ability to add more species and newly found intraspecific variations. Therefore, we believe that the RFLP catalog will contribute to biosecurity as a practical diagnostic tool for species identification of spider mites.

  10. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  11. Using amplified fragment length polymorphism analysis to differentiate isolates of Pasteurella multocida serotype 1

    Science.gov (United States)

    Blehert, D.S.; Jefferson, K.L.; Heisey, D.M.; Samuel, M.D.; Berlowski, B.M.; Shadduck, D.J.

    2008-01-01

    Avian cholera, an infectious disease caused by the bacterium Pasteurella multocida, kills thousands of North American wild waterfowl annually. Pasteurella multocida serotype 1 isolates cultured during a laboratory challenge study of Mallards (Anas platyrhynchos) and collected from wild birds and environmental samples during avian cholera outbreaks were characterized using amplified fragment length polymorphism (AFLP) analysis, a whole-genome DNA fingerprinting technique. Comparison of the AFLP profiles of 53 isolates from the laboratory challenge demonstrated that P. multocida underwent genetic changes during a 3-mo period. Analysis of 120 P. multocida serotype 1 isolates collected from wild birds and environmental samples revealed that isolates were distinguishable from one another based on regional and temporal genetic characteristics. Thus, AFLP analysis had the ability to distinguish P. multocida isolates of the same serotype by detecting spatiotemporal genetic changes and provides a tool to advance the study of avian cholera epidemiology. Further application of AFLP technology to the examination of wild bird avian cholera outbreaks may facilitate more effective management of this disease by providing the potential to investigate correlations between virulence and P. multocida genotypes, to identify affiliations between bird species and bacterial genotypes, and to elucidate the role of specific bird species in disease transmission. ?? Wildlife Disease Association 2008.

  12. Genetic variability of the stable fly assessed on a global scale using amplified fragment length polymorphism.

    Science.gov (United States)

    Kneeland, Kathleen M; Skoda, Steven R; Foster, John E

    2016-10-01

    The stable fly, Stomoxys calcitrans (L.) (Diptera: Muscidae), is a blood-feeding, economically important pest of animals and humans worldwide. Improved management strategies are essential and their development would benefit from studies on genetic diversity of stable flies. Especially if done on a global scale, such research could generate information necessary for the development and application of more efficient control methods. Herein we report on a genetic study of stable flies using amplified fragment length polymorphism, with samples of 10-40 individuals acquired from a total of 25 locations in the Nearctic, Neotropic, Palearctic, Afrotropic and Australasian biogeographical regions. We hypothesized that genetic differentiation would exist across geographical barriers. Although FST (0.33) was moderately high, the GST (0.05; representing genetic diversity between individuals) was very low; Nm values (representing gene flow) were high (9.36). The mismatch distribution and tests of neutrality suggested population expansion, with no genetic differentiation between locations. The analysis of molecular variance (AMOVA) results showed the majority of genetic diversity was within groups. The mantel test showed no correlation between geographic and genetic distance; this strongly supports the AMOVA results. These results suggest that stable flies did not show genetic differentiation but are panmictic, with no evidence of isolation by distance or across geographical barriers. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  13. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  14. Application of PCR-based restriction fragment length polymorphism for the identification of mycobacterial isolates.

    Science.gov (United States)

    Deepa, P; Therese, K L; Madhavan, H N

    2005-05-01

    Conventional identification of mycobacteria is achieved by standard biochemical tests that are time consuming, laborious and is not always conclusive. This study was thus undertaken to standardize a simple, rapid and cost-effective polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) using primers coding for the 16S - 23S rRNA spacer region to identify the mycobacterial isolates to the species level. The PCR with primers targeting the 16S-23S rRNA spacer region was standardized using the standard mycobacterial strains and applied on 51 clinical isolates. The PCR amplified products were subjected to RFLP using the restriction enzymes, Hae III, MspI and BstXI. The results obtained were compared with those of conventional biochemical tests. PCR was sensitive to detect 2.5 pg of H37Rv DNA (370 bp for slow grower mycobacteria) and 1.5 pg of M. fortuitum DNA (450 bp for rapid grower mycobacteria). Based on the PCRRFLP products obtained the 51 mycobacterial isolates were classified into 41 slow growers and 10 rapid growers. Among the 41 slow growers, 40 were identified as M. tuberculosis, one as M. xenopi and 10 rapid growers as M. fortuitum. PCR using primers targeting the 16S-23S rRNA spacer region was a reliable tool for rapid identification of mycobacterial isolates into slow and rapid growers within 4 h of isolation and further speciation by PCR-RFLP within 6-8 h.

  15. Using terminal restriction fragment length polymorphism (T-RFLP) to identify mycorrhizal fungi: a methods review.

    Science.gov (United States)

    Dickie, I A; FitzJohn, R G

    2007-06-01

    Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In this paper, we review the technique as it is used to identify species of mycorrhizal fungi and distinguish two different versions of the technique: peak-profile T-RFLP (the original version) and database T-RFLP. We define database T-RFLP as the use of T-RFLP to identify individual species within samples by comparison of unknown data with a database of known T-RFLP patterns. This application of T-RFLP avoids some of the pitfalls of peak-profile T-RFLP and allows T-RFLP to be applied to polyphyletic functional groups such as ectomycorrhizal fungi. The identification of species using database T-RFLP is subject to several sources of potential error, including (1) random erroneous matches of peaks to species, (2) shared T-RFLP profiles across species, and (3) multiple T-RFLP profiles within a species. A mathematical approximation of the risk of the first type of error as a function of experimental parameters is discussed. Although potentially less accurate than some other methods such as clone libraries, the high throughput of database T-RFLP permits much greater replication and may, therefore, be preferable for many ecological questions, particularly when combined with other techniques such as cloning.

  16. Mycobacterium tuberculosis complex differentiation using gyrB-restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Erica Chimara

    2004-11-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC members are causative agents of human and animal tuberculosis. Differentiation of MTBC members is required for appropriate treatment of individual patients and for epidemiological purposes. Strains from six MTBC species - M. tuberculosis, M. bovis subsp. bovis, M. bovis BCG, M. africanum, M. pinnipedii, and "M. canetti" - were studied using gyrB-restriction fragment length polymorphism (gyrB-RFLP analysis. A table was elaborated, based on observed restriction patterns and published gyrB sequences. To evaluate applicability of gyrB-RFLP at Instituto Adolfo Lutz, São Paulo, Mycobacterial Reference Laboratory, 311 MTBC clinical isolates, previously identified using traditional methods as M. tuberculosis (306, M. bovis (3, and M. bovis BCG (2, were analyzed by gyrB-RFLP. All isolates were correctly identified by the molecular method, but no distinction between M. bovis and M. bovis BCG was obtained. Differentiation of M. tuberculosis and M. bovis is of utmost importance, because they require different treatment schedules. In conclusion, gyrB-RFLP is accurate and easy-to-perform, with potential to reduce time needed for conventional differentiation methods. However, application for epidemiological studies remains limited, because it cannot differentiate M. tuberculosis from M. africanum subtype II, and "M. canetti", M. africanum subtype I from M. pinnipedii, and. M. bovis from M. bovis BCG.

  17. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  19. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  20. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  1. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  2. Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

    Science.gov (United States)

    Williams, Shelley Diane

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a

  3. Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.

    Science.gov (United States)

    Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

    1990-10-01

    Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster

  4. Restriction fragment length polymorphism pattern of Mycobacterium isolates from rodents in infected cattle farms.

    Science.gov (United States)

    Alizadeh, Khatereh; Mosavari, Nader; Nazari, Razieh

    2016-12-01

    Mycobacterium tuberculosis, the etiologic agent of tuberculosis, causes large-scale morbidity and mortality, particularly in developing countries. In recent years, there has been a significant increase in the drug-resistant ability of M. tuberculosis, triggering a major public health crisis. A detailed analysis of the evolution of the mycobacterial genome helps to better understand the genotype-phenotype relationship in this bacterium. Different strain typing methods have already revealed the worldwide diversity of mycobacterial isolates. Therefore, DNA-fingerprinting tools have been developed to improve tuberculosis case detection and control. Molecular typing techniques allow to detect and follow the spread of individual strains of the M. tuberculosis complex (MTC), complementing conventional epidemiological methods. Among these techniques, restriction fragment length polymorphism (RFLP) has been considered the standard method for genotyping of MTC. The aim of this work was to isolate M. tuberculosis from rodents in cattle farms contaminated with MTC located in the city of Booin-Zahra, Iran. A total of 100 samples were collected from the rodents in the contaminated farms and analyzed for the presence of Mycobacterium by growing the samples on Lowenstein-Jensen medium. All isolates were further identified by RFLP and DNA hybridization studies. As much as five samples showed the presence of Mycobacterium and these were subjected to PCR-16SrRNA, PCR-IS6110, and RD Typing (RD1, RD4, RD9, and RD12) methods. Further differentiation was performed with PvuII digestion (RFLP) and DNA hybridization using the polymorphic guanine/cytosine-rich repetitive sequences (PGRS) probe. The PGRS probe results classified two of the isolates as belonging to one cluster, whereas the remaining isolates were classified as belonging to different clusters. An analysis of the obtained genetic pattern and a comparison of these patterns with the genetic pattern of other infected farms allowed

  5. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  6. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...

  7. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...... polymorphism (AFLP). When making genetic trees, all three methods resulted in similar clustering that often corresponded with serotype, although some serotypes displayed more diversity than others. Of the three techniques, MLST was the easiest to interpret and compare between laboratories. Unfortunately...

  8. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  9. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  10. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    Science.gov (United States)

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  12. Genetic relationship and diversity in a sesame (Sesamum indicum L.) germplasm collection using amplified fragment length polymorphism (AFLP)

    Science.gov (United States)

    Laurentin, Hernán E; Karlovsky, Petr

    2006-01-01

    Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia), and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP). Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA). This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres. Future germplasm

  13. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    International Nuclear Information System (INIS)

    Szafer, F.; Brautbar, C.; Tzfoni, E.

    1987-01-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQβ, DQα, and DRβ cDNA probes. Hybridization with the DQβ probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQα and DRβ probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease

  14. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  15. Differentiation of mixed lactic acid bacteria communities in beverage fermentations using targeted terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Bokulich, Nicholas A; Mills, David A

    2012-08-01

    Lactic acid bacteria (LAB) are an important group of bacteria in beer and wine fermentations both as beneficial organisms and as spoilage agents. However, sensitive, rapid, culture-independent methods for identification and community analyses of LAB in mixed-culture fermentations are limited. We developed a terminal restriction fragment length polymorphism (TRFLP)-based assay for the detection and identification of lactic acid bacteria and Bacilli during wine, beer, and food fermentations. This technique can sensitively discriminate most species of Lactobacillales, and most genera of Bacillales, in mixed culture, as indicated by both bioinformatic predictions and empirical observations. This method was tested on a range of beer and wine fermentations containing mixed LAB communities, demonstrating the efficacy of this technique for discriminating LAB in mixed culture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Using Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis to Assess Microbial Community Structure in Compost Systems

    Science.gov (United States)

    Tiquia, Sonia M.

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified genes is a widely used fingerprinting technique in composting systems. This analysis is based on the restriction endonuclease digestion of fluorescently end-labeled PCR products. The digested product is mixed with a DNA size standard, itself labeled with a distinct fluorescent dye, and the fragments are then separated by capillary or gel electrophoresis using an automated sequencer. Upon analysis, only the terminal end-labeled restriction fragments are detected. An electropherogram is produced, which shows a profile of compost microbial community as a series of peaks of varying height. This technique has also been effectively used in the exploration of complex microbial environments and in the study of bacterial, archaeal, and eukaryal populations in natural habitats.

  17. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  18. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    Science.gov (United States)

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history.

  19. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  20. Association of restriction fragment length polymorphism in alcohol dehydrogenase 2 gene with alcohol induced liver damage.

    OpenAIRE

    Sherman, D I; Ward, R J; Warren-Perry, M; Williams, R; Peters, T J

    1993-01-01

    OBJECTIVE--To investigate the role of genetically determined differences in the enzymes of alcohol metabolism in susceptibility to liver damage from misusing alcohol. DESIGN--Use of pADH36 probe to study PVU II restriction length fragment polymorphism in alcohol dehydrogenase 2 gene in white alcohol misusers and controls. SETTING--Teaching hospital referral centres for liver disease and alcohol misuse. SUBJECTS--45 white alcohol misusers (38 with alcoholic liver disease) and 23 healthy contro...

  1. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  2. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  3. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  4. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  5. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  6. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  7. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  8. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  9. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  10. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  11. Restriction fragment length polymorphism in calpain (CAPN2 gene in crossbred cattle

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Cassiano Lara

    2012-12-01

    using the restriction enzyme HhaI. The meat tenderness analysis was evaluated in Longissimus dorsi by Warner-Bratzler Shear Forcer. The data of shear force (SF were analyzed by model that included genotype effect (AA, AB, BB, genetic group and, as a covariate, the age at slaughter. The allele A, considered the most favorable for meat tenderization, was more frequent in Angus x Nelore (AxN than Red Angus x Nelore (RxA, whose frequencies were 0,4697 and 0,3975, respectively. Significant effects were observed (p<0.05 of genetic group and genotype in FC. The average value of FC estimated for RxN was 32.24%, significantly (p<0.05 lesser that of AxN. All the averages of FC estimated for the genotypes AA, AB and BB, in two genetic groups differed (p<0.05 and were, respectively, 3.74, 5.43 and 7.43 in AxN and 2.64, 4.21 and 5.32 in RxN. The results obtained show that such polymorphism can assist the identification of animals for meat quality in crossbred Bos taurus taurus x Bos taurus indicus.

  12. PCR-restriction fragment length polymorphism analysis of indigenous nitrogen-fixing micro organisms lineages

    International Nuclear Information System (INIS)

    Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim

    2006-01-01

    The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)

  13. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  14. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping ba...

  15. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  16. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  17. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  18. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  19. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  20. On the power to detect differences between male and female mutation rates for Duchenne muscular dystrophy, using classical segregation analysis and restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Karel, E.R.; te Meerman, G J; Ten Kate, L P

    The power to detect departures from the theoretical proportion of new mutants in X-linked lethal disorders has been analyzed for several types of segregation analysis, including methods based on completely linked restriction fragment length polymorphisms. It is shown that all methods require large

  1. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  2. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  3. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  4. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-07-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  5. Amplified fragment length polymorphism used to investigate genetic variability of the stable fly (Diptera: Muscidae) across North America.

    Science.gov (United States)

    Kneeland, K M; Skoda, S R; Foster, J E

    2013-09-01

    The stable fly, Stomoxys calcitrans (L.), is a cosmopolitan pest of livestock and humans. The pestiferous nature and painful bite cause stress to cattle and other animals. The stress and resulting avoidance behaviors manifest as reductions in weight gain or milk production in cattle; estimated annual economic loss in the United States exceeds US$2 billion. Understanding the population genetics of stable flies could provide information on their population dynamics, origins of outbreaks, and geographical patterns of insecticide resistance, resulting in a tactical advantage for developing management strategies. Previous studies, mostly on a local scale, reported a high level of gene flow between locations. Here, we report results wherein amplified fragment length polymorphism was used to determine genetic diversity of stable fly samples consisting of 11-40 individuals from 12 locations representing the United States, Canada, and Panama. The Analysis of Molecular Variance showed that the majority of genetic diversity was within groups; very little was among groups. The F(ST) and G(ST) values were low ( 1.0). The tests of neutrality suggested population expansion, and no genetic differentiation was found between locations. These results show that stable flies have a high level of gene flow on a continental scale, with limited isolation owing to distance or geographical barriers.

  6. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    Energy Technology Data Exchange (ETDEWEB)

    Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  7. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  8. Prevalence of Trichomonas spp. in domestic pigeons in Shandong Province, China, and genotyping by restriction fragment length polymorphism.

    Science.gov (United States)

    Jiang, Xiyue; Sun, Jingjing; Wang, Fangkun; Li, Hongmei; Zhao, Xiaomin

    2016-05-01

    Oropharyngeal swabs (n = 609) were collected randomly from 80,000 domestic pigeons (Columba livia domestica) on five pigeon farms and at one pigeon slaughterhouse in Shandong Province, China, from September 2012 to July 2013. Trichomonas spp. were detected in 206/609 (33.8%) samples. The prevalence was 14.9-31.1%, depending on different levels of sanitation and management, and was 4.8% in nestling pigeons, 13.6% in breeding pigeons and 35.2% in adolescent pigeons. Trichomonas gallinae genotypes A and B, and Trichomonas tenax-like isolates were identified by PCR-restriction fragment length polymorphism (RFLP) analysis and sequencing of the 5.8S rDNA-internal transcribed spacer (ITS) regions. RFLP analysis with the restriction enzyme BsiEI generated different RFLP band patterns between T. gallinae and T.tenax-like isolates. When BsiEI RFLP analysis was combined with HaeIII RFLP analysis, all infection types of T. gallinae and T.tenax-like isolates could be identified. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  10. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  11. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  12. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  13. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  14. Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.

    Science.gov (United States)

    Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

    2009-06-01

    Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene.

  15. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  16. Molecular differentiation of Angiostrongylus costaricensis, A. cantonensis, and A. vasorum by polymerase chain reaction- restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2003-01-01

    Full Text Available Angiostrongylus cantonensis, A. costaricensis, and A. vasorum are etiologic agents of human parasitic diseases. Their identification, at present, is only possible by examining the adult worm after a 40-day period following infection of vertebrate hosts with the third-stage larvae. In order to obtain a diagnostic tool to differentiate larvae and adult worm from the three referred species, polymerase chain reaction-restriction fragment length polymorphism was carried out. The rDNA second internal transcribed spacer (ITS2 and mtDNA cytochrome oxidase I regions were amplified, followed by digestion of fragments with the restriction enzymes RsaI, HapII, AluI, HaeIII, DdeI and ClaI. The enzymes RsaI and ClaI exhibited the most discriminating profiles for the differentiation of the regions COI of mtDNA and ITS2 of rDNA respectively. The methodology using such regions proved to be efficient for the specific differentiation of the three species of Angiostrongylus under study.

  17. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  18. Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils.

    Science.gov (United States)

    Edel-Hermann, Véronique; Dreumont, Christiane; Pérez-Piqueres, Ana; Steinberg, Christian

    2004-03-01

    Monitoring the structure and dynamics of fungal communities in soils under agricultural and environmental disturbances is currently a challenge. In this study, a terminal restriction fragment length polymorphism (T-RFLP) fingerprinting method was developed for the rapid comparison of fungal community structures. The terminal restriction fragment polymorphism of different regions of the small-subunit (SSU) ribosomal RNA (rRNA) gene was simulated by sequence comparison using 10 restriction enzymes, and analyzed among three different soils using fungal-specific primers. Polymerase chain reaction amplification of the 3' end of the SSU rRNA gene with the primer nu-SSU-0817-5' and with the fluorescently labelled primer nu-SSU-1536-3', and digestion of the amplicons with AluI and MboI were found to be optimal and were used in a standardized T-RFLP procedure. Both the number and the intensity of terminal restriction fragments detected by capillary gel electrophoresis were integrated in correspondence analyses. Three soils with contrasting physicochemical properties were differentiated according to the structure of their fungal communities. Assessment of the impact on the fungal community structure of the amendment of two soils with compost or manure confirmed the reproducibility and the sensitivity of the method. Shifts in the community structure were detected between non-amended and amended soil samples. In both soils, the shift differed with the organic amendment applied. In addition, the fungal community structures of the two soils were affected in a different way by the same organic amendment. The fingerprinting method provides a rapid tool to investigate the effect of various perturbations on the fungal communities in soils.

  19. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  20. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  1. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  2. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  3. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    Energy Technology Data Exchange (ETDEWEB)

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  4. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  5. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  6. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis. Part 1: Fungal field study

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Tor P. Schultz; Susan V. Dieh

    2012-01-01

    The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. Field stakes, treated with 0.25 and 0.37 % ACQ-C, 0.1 and 0.25 % CTN, 2 % BHT alone, 0.1 and 0.25 % CTN...

  7. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    Science.gov (United States)

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  8. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  9. Application of restriction fragment length polymorphism analysis to simple and rapid genotyping of bovine viral diarrhea virus strains isolated in Japan.

    Science.gov (United States)

    Seki, Yoshihisa; Seimiya, Yukio M; Motokawa, Masato; Yaegashi, Gakuji; Nagai, Makoto; Hayashi, Michiko

    2008-04-01

    The E2 regions of 177 bovine viral diarrhea virus (BVDV) strains isolated in Japan between 1957 and 2006 were analyzed for genotyping. The strains were classified into 8 genotypes (1a, 1b, 1c, 1d, 1e, 1f, So and 2a) based on the phylogenetic analysis. The restriction fragment length polymorphism (RFLP) analysis of the RT-PCR products using 6 selected enzymes (Apo I, Mly I, BstAP I, Pvu II, Ear I, EcoR V) disclosed the cutting patterns classified into 11 groups (I-XI), each of that consisted of strains belonging to a single genotype. Namely, groups-I and -II were composed by genotype-1a strains, groups-III and -IV by 1b strains, and groups-V and -VI by 1c strains. Other groups-VII, -VIII, -IX, -X and -XI comprised genotypes-1d, -1e, -1f, -So and -2a strains, respectively. The results suggest that the RFLP analysis can simply and rapidly differentiate the 8 genotypes of BVDV strains.

  10. [Establishing a new genotyping method of hepatitis B virus by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) to analysis on S region and its application].

    Science.gov (United States)

    Peng, Liang; Ding, Jing-Juan; Zhang, Li-Sha

    2004-08-01

    To establish a new polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method of genotyping HBV using Mbo I, BsTN I, BsmA I, Hpa II and investigate the relationship between genotype and clinical spectrum of hepatitis B. 124 full-genomic HBV sequences and 13 S-genomic sequences were analyzed, genotype specific regions were identified by the restriction enzymes Mbo I, BsTN I, BsmA I, Hpa II. And 176 samples from different kinds of hepatitis B were genotyped by this method. Five samples had been randomly selected and directly sequenced their S gene, to assess the accuracy. In 176 serum samples of patients with hepatitis B from Guizhou area, genotype B and C were found in 56.8% and 43.2% respectively. The proportions of genotype B and C in ASC were 40.0% and 15.7% (chi-square = 12.16, P < 0.005); and they were 31.6% and 14.0% in CHB (chi-square = 7.88, P < 0.005). Genotyping HBV, based on S gene RFLP seems to be highly sensitive, differential and accurate and could be used in large-scale surveys. HBV genotype B and C are existed in Guizhou area.

  11. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism...... analysis. The method was used to compare ORF 1 sequences of two divergent European-type PRRSV strains. Our results indicated that the structural and replicase parts of these two strains had evolved at overall similar rates....

  12. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  13. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  14. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  15. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  16. Relationship between morphological and amplified fragment length ...

    African Journals Online (AJOL)

    Relationship between morphological and amplified fragment length polymorphism (AFLP) marker based genetic distance with heterosis in hot pepper (Capsicum annuum L.) SL Krishnamurthy, A Mohan Rao, K Madhavi Reddy, S Ramesh, Shailaja Hittalmani, Rao M. Gopinath ...

  17. Development of a polymerase chain reaction/restriction fragment length polymorphism method for Saccharomyces cerevisiae and Saccharomyces bayanus identification in enology.

    Science.gov (United States)

    Masneuf, I; Aigle, M; Dubourdieu, D

    1996-05-01

    Several yeast strains of the species Saccharomyces cerevisiae, S. bayanus and S. paradoxus, first identified by hybridization experiments and measurements of DNA/DNA homology, were characterized using polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis of the MET2 gene. There was no exception to the agreement between this method and classical genetic analyses for any of the strains examined, so PCR/RFLP of the MET2 gene is a reliable and fast technique for delimiting S. cerevisiae and S. bayanus. Enological strains classified as S. bayanus, S. chevalieri, and S. capensis gave S. cerevisiae restriction patterns, whereas most S. uvarum strains belong to S. bayanus. Enologists should no longer use the name of S. bayanus for S. cerevisiae Gal strains, and should consider S. bayanus as a distinct species.

  18. Encapsulation dehydration colligative cryoprotective strategies and amplified fragment length polymorphism markers to verify the identity and genetic stability of euglenoids following cryopreservation.

    Science.gov (United States)

    Harding, Keith; Miller, Julia; Timmermann, Hella; Lorenz, Maike; Day, John G; Friedl, Thomas

    2010-01-01

    An encapsulation/dehydration procedure was developed for Euglena gracilis Klebs as a 'model alga' to examine various cryoprotective regimes combined with controlled rate cooling to cryopreserve other Euglenoid taxa. Cryoprotective variables were optimised to enable reproducible growth following a combination of alginate encapsulation, sucrose osmotic dehydration, air desiccation, methanol treatment, cooling to -40 degrees C and plunging into liquid nitrogen (LN). Amplified Fragment Length Polymorphism (AFLP) analysis was adapted to: (i) verify algal identity by discriminating between different Euglenoids and (ii) examine the genetic stability of algal cultures prior to various stages of cryoprotective treatments and following exposure to LN. AFLPs were highly reproducible (> 99%) as reliable diagnostic markers, where a single DNA fragment change accounted for -0.4% of the detectable variation in an AFLP pattern. AFLP changes were detected in cryoprotective treatments following LN exposure. Successive stages of the dehydration and desiccation treatments did not accumulate AFLP changes indicating these are random events.

  19. Genetic Typing of Bovine Viral Diarrhoea Virus (BVDV by Restriction Fragment Length Polymorphism (RFLP and Identification of a New Subtype in Poland

    Directory of Open Access Journals (Sweden)

    Kuta Aleksandra

    2015-04-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis was developed for genetic typing of Polish strains of bovine viral diarrhoea virus (BVDV. The method was applied using 60 BVDV isolates, which included BVDV genotype 1, subtypes a, b, d, e, f, and g, and genotype 2a. RT-PCR products of the 5’untranslated region (5’UTR were digested using three enzymes. Restriction patterns classified the strains into seven groups, each with a specific and different pattern from other subtypes. These findings were confirmed by nucleotide sequencing and phylogenetic analysis. The results suggest that RFLP analysis is a simple, reliable, and fast genotyping method for BVDV strains in comparison with sequencing. This method can distinguish six subtypes of BVDV-1 including a new subtype 1e, identified exclusively by this method, and it allows differentiation of BVDV-1 from BVDV-2 genotype.

  20. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.

    2004-01-01

    health. The remaining 30 groups contained isolates from humans, chickens and associated food products, cattle, sheep, turkeys, ostriches and/or dogs. Strains assigned to serotypes 2, 6/7, 11 and 12 formed major clusters at the 77.6% S-level. Most other serotypes did not form homogeneous clusters......Aims: To use amplified fragment length polymorphism (AFLP) analysis to evaluate the genetic relatedness among 254 Campylobacter jejuni reference and field strains of diverse origin representing all defined 'Penner' serotypes for this species. Methods and Results: Field strains (n = 207) from human...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  1. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  2. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  3. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A...

  4. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A......Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...

  5. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  6. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  7. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  8. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  9. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  10. Female-only sex-linked amplified fragment length polymorphism markers support ZW/ZZ sex determination in the giant freshwater prawn Macrobrachium rosenbergii.

    Science.gov (United States)

    Jiang, Xue-Hui; Qiu, Gao-Feng

    2013-12-01

    Sex determination mechanisms in many crustacean species are complex and poorly documented. In the giant freshwater prawn, Macrobrachium rosenbergii, a ZW/ZZ sex determination system was previously proposed based on sex ratio data obtained by crosses of sex-reversed females (neomales). To provide molecular evidence for the proposed system, novel sex-linked molecular markers were isolated in this species. Amplified fragment length polymorphism (AFLP) using 64 primer combinations was employed to screen prawn genomes for DNA markers linked with sex loci. Approximately 8400 legible fragments were produced, 13 of which were uniquely identified in female prawns with no indication of corresponding male-specific markers. These AFLP fragments were reamplified, cloned and sequenced, producing two reliable female-specific sequence characterized amplified region (SCAR) markers. Additional individuals from two unrelated geographic populations were used to verify these findings, confirming female-specific amplification of single bands. Detection of internal polymorphic sites was conducted by designing new primer pairs based on these internal fragments. The internal SCAR fragments also displayed specificity in females, indicating high levels of variation between female and male specimens. The distinctive feature of female-linked SCAR markers can be applied for rapid detection of prawn gender. These sex-specific SCAR markers and sex-associated AFLP candidates unique to female specimens support a sex determination system consistent with female heterogamety (ZW) and male homogamety (ZZ). © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  11. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  12. Genetic Characterization of Campylobacter Jejuni and C. coli Isolated From Broilers Using flaA PCR-Restriction Fragment Length Polymorphism Method in Shiraz, Southern Iran.

    Science.gov (United States)

    Khoshbakht, Rahem; Tabatabaei, Mohammad; Hosseinzadeh, Saeid; Shirzad Aski, Hesamaddin; Seifi, Saeed

    2015-05-01

    Thermophilic campylobacters, particularly Campylobacter jejuni and C. coli are the main agents of human campylobacteriosis. Campylobacter contaminated chicken products is the most important source of foodborne gastroenteritis. Evaluation of genetic diversity among Campylobacter population is critical for understanding the epidemiology of this bacterium and developing effective control strategies against Campylobacter infections and other related disorders. The aim of this study was to investigate the polymorphism of thermophilic Campylobacter isolated from broiler fecal samples in Shiraz, southern Iran. Ninety Campylobacter isolates were recovered from broiler feces using enrichment process followed by cultivation method. The isolates were species typing on the basis of polymerase chain reaction (PCR) detection of 16SrRNA and multiplex PCR for determining two thermophilic species. To evaluate strain diversity of thermophilic Campylobacter isolates, flaA PCR-Restriction Fragment Length Polymorphism (RFLP) was performed using DdeI restriction enzyme. All 90 Campylobacter isolates confirmed by m-PCR were successfully typed using flaA-PCR-RFLP. Eleven different types were defined according to flaA-typing method and the RFLP patterns were located at three separate clusters in RFLP image analysis dendrogram. Campylobacter jejuni isolates significantly showed more variety than C. coli isolates. A relatively low genetic diversity existed among C. jejuni and C. coli isolated from broilers in Shiraz, southern Iran. In our knowledge, this was the first report of genetic diversity among broiler originated human pathogen thermophilic campylobacters in Shiraz, southern Iran.

  13. Genetic Diversity of African and Worldwide Strains of Ralstonia solanacearum as Determined by PCR-Restriction Fragment Length Polymorphism Analysis of the hrp Gene Region

    Science.gov (United States)

    Poussier, Stephane; Vandewalle, Peggy; Luisetti, Jacques

    1999-01-01

    The genetic diversity among a worldwide collection of 120 strains of Ralstonia solanacearum was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to R. solanacearum. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters. Each cluster included strains belonging to a single biovar, except for strains of biovars 3 and 4, which could not be separated. However, the biovar 1 strains showed rather extensive diversity since they were distributed into five clusters whereas the biovar 2 and the biovar 3 and 4 strains were gathered into one and two clusters, respectively. PCR-RFLP analysis of the hrp gene region confirmed the results of previous studies which split the species into an “Americanum” division including biovar 1 and 2 strains and an “Asiaticum” division including biovar 3 and 4 strains. However, the present study showed that most of the biovar 1 strains, originating from African countries (Reunion Island, Madagascar, Zimbabwe, and Angola) and being included in a separate cluster, belong to the “Asiaticum” rather than to the “Americanum” division. These African strains could thus have evolved separately from other biovar 1 strains originating from the Americas. PMID:10224018

  14. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  15. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  16. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  17. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  18. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  19. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  20. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  1. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  2. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  3. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  4. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  5. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards

    2013-06-01

    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  6. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  7. Genotyping of infectious bursal disease virus strains by restriction fragment length polymorphism analysis of the VP1, VP2, and VP3 genes.

    Science.gov (United States)

    Gomes, A D; Abreu, J T; Redondo, R A F; Martins, N R S; Resende, J S; Resende, M

    2005-12-01

    SUMMARY. This study aimed to genotype infectious bursal disease virus (IBDV) isolates from the Minas Gerais state poultry industry. RNA was extracted from bursae obtained from field cases without passage or commercial vaccines. Genetic subtyping of IBDV isolates and vaccine strains was carried out by the reverse transcriptase-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis. A 588-bp fragment in the VP1 gene, an 847-bp fragment in the VP2 gene, and a 320-bp fragment in the VP3 gene were amplified by PCR and digested with restriction enzymes PstI and ScaI (VP1); BamHI, BstEII, and PstI (VP2); and NcoI, ScaI, and XbaI (VP3). Our work shows that complementing the clinical history of the outbreaks with RT-PCR followed by RFLP analysis using PstI for VP1, BamHI for VP2, and XbaI for VP3 allowed an accurate classification of a causative agent as a very virulent IBDV.

  8. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  9. Analysis of genetic variability in endemic medicinal plants of genus Chlorophytum from the Indian subcontinent using amplified fragment length polymorphism marker.

    Science.gov (United States)

    Patil, Swapnil Mahadeo; Chandanshive, Vishal Vinayak; Tamboli, Asif Shabodin; Adsul, Avinash Asraji; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2015-12-01

    The genus Chlorophytum consists of medicinally important species like Chlorophytum borivilianum, C. tuberosum and C. attenuatum. Uncontrolled harvest of this plant from wild habitat due to its high commercial value made the species of this genus be listed in the Red Data Book of Indian plants as an endangered species. In India, approximately nineteen species of Chlorophytum are found; out of these, only C. borivilianum is cultivated commercially. The objective of this study was to measure genetic diversity, population structure and phylogenetic relationship among the species using Amplified Fragment Length Polymorphisms (AFLP). Fifteen pairs of primer (out of 64 primer pairs screened) were used to analyse the genetic diversity in eighteen species of genus Chlorophytum. Cluster analysis, estimation of the gene flow among the species and of the phylogeographic distribution of this genus were carried out using an AFLP data matrix. A high level of genetic diversity was observed on the basis of the percentage of polymorphic bands (99.91%), Shannon's information index (0.3592) and Nei's gene diversity (0.2085) at species level. Cluster analysis of UPGMA dendrogram, principal component analysis and Bayesian method analysis resolved these species in three different clusters, which was supported by morphological information. The Mantel test (r=0.4432) revealed a significant positive correlation between genetic and geographic distances. The collected data have an important implication in the identification, authentication, and conservation of the species of the genus Chlorophytum. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  10. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  11. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  12. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  13. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene.

    Science.gov (United States)

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species.

  14. Molecular identification of Mycobacterium tuberculosis complex by region of differentiation-typing and polymerase chain reaction-restriction fragment length polymorphism method.

    Science.gov (United States)

    Mirzaki, Seydeh Zeinab; Mosavari, Nader; Nazari, Razieh; Akbarian, Morteza

    2016-12-01

    Tuberculosis (TB) is one of the most common zoonotic infectious diseases in the world. Identification of Mycobacterium isolates is essential for proper treatment of TB. The aim of this study was to identify Mycobacterium isolates collected from TB patients in Alborz Province, Iran, by region of differentiation (RD)-typing. Fifty samples from tuberculosis patients were cultured in pyruvate and glycerinated Lowenstein-Jensen medium. DNA was extracted from the isolates by the van Solingen method and subjected to polymerase chain reaction (PCR)-16SrRNA, PCR-IS6110, and RD-typing with primers RD1, RD4, RD9, and RD12, respectively. Out of 50 isolates, only one isolate appeared negative in IS6110-PCR and was considered nontuberculosis complex. The remaining isolates gave PCR products of approximately 543bp, 245bp, 146bp, 172bp, 235bp, and 369bp with 16s-rRNA, IS6110-PCR, RD-1, RD-4, RD-9, and RD-12 PCR, respectively. PCR-restriction fragment length polymorphism of oxyR pseudogene confirmed the results. All isolates except one from Alborz Province appeared positive for Mycobacterium tuberculosis. Based on the obtained results, all isolates except one were identified as M. tuberculosis. The only negative isolate appeared 93% and 97% similar to Nocardia or Mycobacterium sp. (Mycobacterium neoaurum), respectively, based on sequencing and alignment of 16s-rRNA and hsp65. Accurate identification of Mycobacterium isolates is of utmost importance for proper and immediate treatment of TB patients. In this study, RD-typing appeared to be a suitable method for correct identification of M. tuberculosis isolates. Copyright © 2016.

  15. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  16. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  18. Use of mgc2-polymerase chain reaction-restriction fragment length polymorphism for rapid differentiation between field isolates and vaccine strains of Mycoplasma gallisepticum in Israel.

    Science.gov (United States)

    Lysnyansky, Inna; Garcia, Maricarmen; Levisohn, Sharon

    2005-06-01

    Increasing use of Mycoplasma gallisepticum (MG) live vaccines has led to a need for a rapid test for differentiation of MG field strains from the live vaccine strains ts-11 and 6/85. We examined the differentiating potential of diagnostic polymerase chain reaction (PCR) primers targeted to the gene mgc2, encoding a cytadherence-related surface protein uniquely present in MG. The mgc2-PCR diagnostic primers are specific for MG in tests of all avian mycoplasmas or bacteria present in the chicken trachea and are sensitive enough to readily detect MG in tracheal swabs from field outbreaks. Differentiation of vaccine strain ts-11 was based on identification of restriction enzyme sites in the 300-base-pair (bp) mgc2-PCR amplicon present in ts-11 and missing in MG isolates from field outbreaks in Israel. Restriction sites for the enzymes HaeII and SfaN1 were identified in the amplified region in strain ts-11 and were not found in 28 field isolates of MG, comprising a representative cross section of all the MG isolates from the period 1997-2003. In practice, differential diagnosis of MG is achieved within 1 day of submission of tracheal swab samples by mgc2-PCR amplification and restriction of the amplicon with HaeII, giving a 270-bp fragment for ts-11 or no restriction for other MG strains tested. Application of the mgc2-PCR-restriction fragment length polymorphism (mgc2-PCR-RFLP) assay enabled differential diagnosis of both components of a mixture of ts-11 and non-ts-11 DNA, detecting the field strain in the presence of a large excess of ts-11. The test was successfully applied in vivo for monitoring vaccinates in a ts-11 vaccine trial. In principle, the test may also be used to identify the 6/85 vaccine strain, which yields a 237-bp product, readily differentiated from the approximately 300-bp PCR product of all other strains tested. Further testing of field isolates will be necessary to determine the applicability of this test in the United States and other countries.

  19. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  20. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    OpenAIRE

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length ...

  1. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  2. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  3. Development and utility of cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLPs) linked to the Fom-2 fusarium wilt resistance gene in melon (Cucumis melo L.).

    Science.gov (United States)

    Zheng, X Y; Wolff, D W; Baudracco-Arnas, S; Pitrat, M

    1999-08-01

    Fusarium wilt, caused by Fusarium oxysporum Schlecht f. sp. melonis Snyder & Hans, is a worldwide soil-borne disease of melon (Cucumis melo L.). Resistance to races 0 and 1 of Fusarium wilt is conditioned by the dominant gene Fom-2. To facilitate marker-assisted backcrossing with selection for Fusarium wilt resistance, we developed cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLP) markers by converting RAPD markers E07 (a 1.25-kb band) and G17 (a 1.05-kb band), respectively. The RAPD-PCR polymorphic fragments from the susceptible line 'Vedrantais' were cloned and sequenced in order to construct primers that would amplify only the target fragment. The derived primers, E07SCAR-1/E07SCAR-2 from E07 and G17SCAR-1/G17SCAR-2 from G17, yielded a single 1.25-kb fragment (designated SCE07) and a 1.05-kb fragment (designated SCG17) (the same as RAPD markers E07 and G17), respectively, from both resistant and susceptible melon lines, thus demonstrating locus-specific associated primers. Potential CAPS markers were first revealed by comparing sequence data between fragments amplified from resistant (PI 161375) and susceptible ('Vedrantais') lines and were then confirmed by electrophoresis of restriction endonuclease digestion products. Twelve restriction endonucleases were evaluated for their potential use as CAPS markers within the SCE07 fragment. Three (BclI, MspI, and BssSI) yielded ideal CAPS markers and were subsequently subjected to extensive testing using an additional 88 diverse melon cultigens, 93 and 119 F(2) individuals from crosses of 'Vedrantais' x PI 161375 and 'Ananas Yokneam'×MR-1 respectively, and 17 families from a backcross BC(1)S(1) population derived from the breeding line 'MD8654' as a resistance source. BclI- and MspI-CAPS are susceptible-linked markers, whereas the BssSI-CAPS is a resistant-linked marker. The CAPS markers that resulted from double digestion by BclI and BssSI are co-dominant. Results

  4. Use of PCR-restriction fragment length polymorphism analysis to identify the main new world Leishmania species and analyze their taxonomic properties and polymorphism by application of the assay to clinical samples.

    Science.gov (United States)

    Rotureau, Brice; Ravel, Christophe; Couppié, Pierre; Pratlong, Francine; Nacher, Mathieu; Dedet, Jean-Pierre; Carme, Bernard

    2006-02-01

    At least 13 characterized Leishmania species are known to infect humans in South America. Five of these parasites are transmitted in the sylvatic ecotopes of the whole French Guianan territory and responsible for cutaneous leishmaniasis. For the diagnosis of cutaneous leishmaniasis, restriction fragment length polymorphism (RFLP) analyses have shown promising results. Thus, the end of the small subunit and internal transcribed spacer 1 of the rRNA genes were sequenced and targeted by PCR-RFLP analysis in the 10 main New World (NW) Leishmania species from the two subgenera. Then, the procedure was tested on 40 samples from patients with cutaneous leishmaniasis, and its results were compared with those of conventional methods. (i) The results of this simple genus-specific method were in agreement with those of previous isoenzyme analyses. (ii) This method distinguished the most medically relevant Leishmania species with only one enzyme (RsaI). (iii) This method could be performed directly on human biopsy specimens (sensitivity of 85.7%). Performing NW Leishmania species typing rapidly and easily in the field constitutes a very valuable improvement for detection of Leishmania spp. Revealing great diversity with several enzymes, this method could also be useful for taxonomic, ecological, and epidemiological studies in space and time.

  5. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  6. A Study on Campylobacter jejuni and Campylobacter coli through Commercial Broiler Production Chains in Thailand: Antimicrobial Resistance, the Characterization of DNA Gyrase Subunit A Mutation, and Genetic Diversity by Flagellin A Gene Restriction Fragment Length Polymorphism.

    Science.gov (United States)

    Thomrongsuwannakij, Thotsapol; Blackall, Patrick J; Chansiripornchai, Niwat

    2017-06-01

    chain reaction-restriction fragment length polymorphism of the flagellin A gene (flaA-RFLP) to determine their genetic relationships. Ten distinct clusters were recognized by flaA-RFLP typing. The results showed that horizontal transmission was the major route of Campylobacter transmission in this study. In conclusion, the emergence of MDR and high resistance rates to several antimicrobials are major concerns identified in this study. The prudent use of these agents and active surveillance of resistance at the farm level are essential steps to reduce the public health risks identified in this work.

  7. Close correlation between restriction fragment length polymorphism of the L-MYC gene and metastasis of human lung cancer to the lymph nodes and other organs

    International Nuclear Information System (INIS)

    Kawashima, Kazuko; Shikama, Hiroshi; Imoto, Kazuhiko; Izawa, Mitsuo; Nishimura, Susumu; Naruke, Tsuguo; Okabayashi, Kenzo

    1988-01-01

    Restriction length fragment polymorphism of the L-MYC gene was examined in DNAs from lung cancer tissues and normal tissues of 51 Japanese patients with lung cancer. In individual patients, no difference was seen between the restriction length fragments of the two alleles of L-MYC [6-kilobase (kb)] and 10-kb fragments in EcoRI digests in lung cancer tissues and normal tissues. But a striking correlation was found between the restriction length fragment polymorphism pattern of L-MYC and the extent of metastasis, particularly to the lymph nodes at the time of surgery: Patients with only the L band (10 kb) had few lymph node metastatic lesions, whereas patients with either the S band (6 kb) or the S and L bands almost always had lymph node metastatic lesion. A similar correlation was found between the presence of the S band and metastases to other organs. This correlation was particularly marked in cases of adenocarcinoma. These results indicate a clear genetic influence on metastases and a consequent poor prognosis for certain patients of lung cancer; L-MYC restriction length fragment polymorphism is thus shown to be a useful marker for predicting the metastatic potential of human lung cancer

  8. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  9. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  10. Most cases of cryptococcal meningitis in HIV-uninfected patients in Vietnam are due to a distinct amplified fragment length polymorphism-defined cluster of Cryptococcus neoformans var. grubii VN1.

    Science.gov (United States)

    Day, Jeremy N; Hoang, Thu N; Duong, Anh V; Hong, Chau T T; Diep, Pham T; Campbell, James I; Sieu, Tran P M; Hien, Tran T; Bui, Tien; Boni, Maciej F; Lalloo, David G; Carter, Dee; Baker, Stephen; Farrar, Jeremy J

    2011-02-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host.

  11. Most Cases of Cryptococcal Meningitis in HIV-Uninfected Patients in Vietnam Are Due to a Distinct Amplified Fragment Length Polymorphism-Defined Cluster of Cryptococcus neoformans var. grubii VN1▿

    Science.gov (United States)

    Day, Jeremy N.; Hoang, Thu N.; Duong, Anh V.; Hong, Chau T. T.; Diep, Pham T.; Campbell, James I.; Sieu, Tran P. M.; Hien, Tran T.; Bui, Tien; Boni, Maciej F.; Lalloo, David G.; Carter, Dee; Baker, Stephen; Farrar, Jeremy J.

    2011-01-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host. PMID:21159929

  12. Intestinal carriage of Campylobacter jejuni and Campylobacter coli among cattle from South-western Norway and comparative genotyping of bovine and human isolates by amplified-fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Vardund T

    2006-06-01

    Full Text Available Abstract In a survey conducted in 1999–2001, the carriage of thermotolerant Campylobacters in cattle was investigated, and the genetic diversity of C. jejuni within one herd was examined and compared with human isolates. C. jejuni, C. coli and other thermotolerant Campylobacter spp. were isolated from intestinal contents from 26%, 3% and 2% of 804 cattle, respectively. The carriage rate was higher in calves (46% than in adults (29%. Twenty-nine C. jejuni isolates from one herd and 31 human isolates from the study area were genotyped with amplified-fragment length polymorphism (AFLP. Eighty-three % of the bovine isolates fell into three distinct clusters with 95–100% similarity, persistent in the herd for 5–10 months. Among human isolates, 58% showed >90% similarity with bovine isolates. The results show that cattle are a significant and stable reservoir for C. jejuni in the study area. Transmission between individuals within the herd may be sufficient to maintain a steady C. jejuni population independent of environmental influx. The results of this study have provided new information on C. jejuni and C. coli transmission, and also on the carriage in cattle, genotypes stability and similarity between bovine and human isolates.

  13. Genetic characterization by amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Mariela Vázquez Calderón, Javier O Mijangos-Cortés, Manuel JL Zavala, L Felipe Sánchez Teyer, Adriana M Quiroz, Matilde Margarita G Ortiz, Amilcar Contreras M Fernando, Espadas G Francisco, Gabriela Fuentes Ortiz, Jorge M Santamaría ...

  14. Amplified Fragment Length Polymorphism markers reveal ...

    African Journals Online (AJOL)

    The understanding of between- and within-population genetic variation and its partitioning on the basis of geographic origin is crucial in designing efficient fishing and conservation strategies of populations and/or species. However, for Lake Malawi's cichlid species, such population genetic studies are hampered by a large ...

  15. Amplified fragment length polymorphism (AFLP) and genealogy ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

  16. Amplified fragment length polymorphisms (AFLPs) analysis of ...

    African Journals Online (AJOL)

    The taxonomy of species belonging to Solanum section Solanum (sometimes referred to as the Solanum nigrum complex or black nightshades) is known to be difficult and has resulted in extensive synonymy. Yet, these species play a significant role in nutrition and food security, especially in developing countries.

  17. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  18. Characterization of gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism: gut microbiota could be a diagnostic marker of coronary artery disease.

    Science.gov (United States)

    Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi

    2017-01-01

    The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.

  19. A novel method to infer the origin of polyploids from Amplified Fragment Length Polymorphism data reveals that the alpine polyploid complex of Senecio carniolicus (Asteraceae) evolved mainly via autopolyploidy.

    Science.gov (United States)

    Winkler, Manuela; Escobar García, Pedro; Gattringer, Andreas; Sonnleitner, Michaela; Hülber, Karl; Schönswetter, Peter; Schneeweiss, Gerald M

    2017-09-01

    Despite its evolutionary and ecological relevance, the mode of polyploid origin has been notoriously difficult to be reconstructed from molecular data. Here, we present a method to identify the putative parents of polyploids and thus to infer the mode of their origin (auto- vs. allopolyploidy) from Amplified Fragment Length Polymorphism (AFLP) data. To this end, we use Cohen's d of distances between in silico polyploids, generated within a priori defined scenarios of origin from a priori delimited putative parental entities (e.g. taxa, genetic lineages), and natural polyploids. Simulations show that the discriminatory power of the proposed method increases mainly with increasing divergence between the lower-ploid putative ancestors and less so with increasing delay of polyploidization relative to the time of divergence. We apply the new method to the Senecio carniolicus aggregate, distributed in the European Alps and comprising two diploid, one tetraploid and one hexaploid species. In the eastern part of its distribution, the S. carniolicus aggregate was inferred to comprise an autopolyploid series, whereas for western populations of the tetraploid species, an allopolyploid origin involving the two diploid species was the most likely scenario. Although this suggests that the tetraploid species has two independent origins, other evidence (ribotype distribution, morphology) is consistent with the hypothesis of an autopolyploid origin with subsequent introgression by the second diploid species. Altogether, identifying the best among alternative scenarios using Cohen's d can be straightforward, but particular scenarios, such as allopolyploid origin vs. autopolyploid origin with subsequent introgression, remain difficult to be distinguished. © 2016 John Wiley & Sons Ltd.

  20. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  1. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  2. Evaluation of the Epidemiological Relevance of Variable-Number Tandem-Repeat Genotyping of Mycobacterium bovis and Comparison of the Method with IS6110 Restriction Fragment Length Polymorphism Analysis and Spoligotyping†

    Science.gov (United States)

    Allix, Caroline; Walravens, Karl; Saegerman, Claude; Godfroid, Jacques; Supply, Philip; Fauville-Dufaux, Maryse

    2006-01-01

    Sources of Mycobacterium bovis contamination remain unclear for many cases of animal and human disease. A major limitation is the lack of sufficiently informative or epidemiologically well evaluated molecular methods for typing. Here, we report an evaluation of a high-throughput method based on 29 mycobacterial interspersed repetitive unit-variable-number tandem-repeat (MIRU-VNTR) loci to genotype 127 M. bovis isolates from cattle from 77 different Belgian farms, representative of a nationwide collection obtained from 1995 to 2003. MIRU-VNTR stability was demonstrated by analyzing a series of 74 isolates in total, obtained from different animals from a single farm or from different farms with an identified epidemiological link. The genotyping results and the genotypic diversity (h) were compared with those obtained by IS6110 restriction fragment length polymorphism (RFLP) analysis and spoligotyping. Among 68 isolates with no known epidemiological link, MIRU-VNTR typing discriminated better than either RFLP analysis or spoligotyping, with isolates taken individually (32 versus 16 and 17 genotypes; h = 0.91 versus 0.73 and 0.85, respectively) or in combination (32 versus 28 genotypes; h = 0.91 versus 0.92). Maximal resolution was already achieved with a subset of 9 loci. The observed congruence of the genetic relationships based on IS6110 RFLP analysis, spoligotyping, and MIRU-VNTR markers is consistent with a clonal population structure of M. bovis. These results support MIRU-VNTR typing as a convenient and discriminatory technique for analysis of the population structure of M. bovis in much greater detail and for addressing some still unresolved issues in the epidemiology of the pathogen. PMID:16757584

  3. Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

    Directory of Open Access Journals (Sweden)

    Roberto A. Caffaro-Filho

    2007-12-01

    Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

  4. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Directory of Open Access Journals (Sweden)

    Mohammad Asadzadeh

    Full Text Available Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp, C. orthopsilosis (109 bp, C. metapsilosis (217 bp and L. elongisporus (258 bp were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380 by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study was performed by amplified fragment length polymorphism (AFLP analysis. Phenotypically identified C. parapsilosis isolates (n = 380 were identified as C. parapsilosis sensu stricto (n = 361, C. orthopsilosis (n = 15, C. metapsilosis (n = 1 and L. elongisporus (n = 3 by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1 comprising 11 isolates recovered from 10

  5. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  6. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  7. A new and improved method based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for the determination of A1298C mutation in the methylenetetrahydrofolate reductase (MTHFR) gene.

    Science.gov (United States)

    Machnik, Grzegorz; Zapala, Malgorzata; Pelc, Ewa; Gasecka-Czapla, Monika; Kaczmarczyk, Grzegorz; Okopien, Boguslaw

    2013-01-01

    Intracellular folate homeostasis and metabolism is regulated by numerous genes. Among them, 5,10-methylenetetrahydrofolate reductase (MTHFR) is of special interest because of its involvement in regulation of the homocysteine level in the body as a result of folate metabolism. Moreover, some studies demonstrated that the homocysteine plasma level in individuals may be influenced by polymorphisms present in the MTHFR gene. Two common, clinically relevant mutations have been described: MTHFR C677T and MTHFR A1298C. Although several laboratory techniques allow genotyping of both polymorphisms, PCR-RFLP analysis is simple to perform, relatively cheap, and thus one of the most utilized. In the case of A1298C, the PCR-RFLP technique that utilizes MboII endonuclease class II requires an acrylamide gel electrophoresis, since agarose gel electrophoresis is unable to resolve short deoxyribonucleic acid (DNA) fragments after restriction digestion. Agarose gel electrophoresis is commonly preferred over that of acrylamide. To resolve this inconvenience, a novel PCR-RFLP, AjuI-based method to genotype A1298C alleles has been developed that can be performed on standard agarose gel.

  8. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Directory of Open Access Journals (Sweden)

    Roger Wumba

    2012-01-01

    in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n=19 among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3% and 5 type IV strains of E. bieneusi (26.3% were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo, and the concurrence of type I and type IV strains.

  9. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Science.gov (United States)

    Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

    2012-01-01

    Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

  10. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Candlish, J.K.; Gajra, B; Saha, N. [National Univ. of Singapore, Kuala Lumpur (Malaysia)] [and others

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  11. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  12. Identification of Human T-lymphotropic Virus Type I (HTLV-I Subtypes Using Restrited Fragment Length Polymorphism in a Cohort of Asymptomatic Carriers and Patients with HTLV-I-associated Myelopathy/tropical Spastic Paraparesis from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Aluisio AC Segurado

    2002-04-01

    Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.

  13. HLA DQJ3 restriction fragment length polymorphism and ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... We should like to thank Dr Fritz Bach, University of Minnesota, for generously providing the DQf3 probe; Dr R. Martell for his advice and constructive criticism; Chris Martin and Derek Taljaard for technical assistance and Veronique Bruneau for typing the manuscript. This work was supported by grants from ...

  14. HLA DQβ restriction fragment length polymorphism and rheumatQid ...

    African Journals Online (AJOL)

    Two variants of the HLA-DR4-linked DQw3 allele, namely OQw7 and DQw8, were analysed in patients of mixed ancestry (Cape Coloureds) with rheumatoid arthritis and in healthy individuals from the same population group using a DQ-β specific cDNA probe. The DQw7 allele, identified by 3,4 kb Hind III or 3,7 kb and 6,9 ...

  15. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Due to high degree of reproducibility, AFLP is now increasingly used in the determination of genetic diversity of a large number of wild plant species. In previous studies, AFLP has been used successfully for the reconstruction of the phylogeny of closely related species as well as in the studies of population ...

  16. Amplified Fragment Length Polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, ... as the main causes of crop losses in wheat. Of these, stem rust caused by Puccinia graminis f. sp. tritici (Pgt) is the main ..... estimated losses in major food and cash crops. Amsterdam: Elsevier, 808 p. Ordonez ...

  17. Amplified fragment length polymorphism of Puccinia graminis f. sp ...

    African Journals Online (AJOL)

    The developed AFLP fingerprints for the Ethiopian Pgt isolates reported herein could support the breeding program to develop strategies for the deployment of resistance genes in its continued effort to minimize the impact of stem rust on wheat in Ethiopia. Keywords: AFLP, wheat, stem rust, genetic diversity, population ...

  18. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  19. Testing independence of fragment lengths within VNTR loci

    Energy Technology Data Exchange (ETDEWEB)

    Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  20. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  1. Association between the polymorphisms of matrix ...

    African Journals Online (AJOL)

    Nadia I Sewelam

    2013-02-23

    Feb 23, 2013 ... tion fragment length polymorphism (RFLP) for amplified genomic DNA. The frequencies of the com- ... Meanwhile, the race selection should be paid more atten- tion since the pathogenesis of a disease might have different bases in different racial population groups. У 2013 Ain Shams University. Production ...

  2. Non-gradual variation in colour morphs of the strawberry poison frog Dendrobates pumilio: genetic and geographical isolation suggest a role for selection in maintaining polymorphism.

    Science.gov (United States)

    Rudh, Andreas; Rogell, Björn; Höglund, Jacob

    2007-10-01

    The relative roles that geographical isolation and selection play in driving population divergence remain one of the central questions in evolutionary biology. We approached this question by investigating genetic and morphological variation among populations of the strawberry poison frog, Dendrobates pumilio, in the Bocas del Toro archipelago, Panama. We found significant population genetic structure and isolation by distance based on amplified fragment length polymorphism markers. Snout vent length (SVL), coloration and the extent and size of dorsal black spots showed large variation among the studied populations. Differences in SVL correlated with genetic distance, whereas black spot patterns and other coloration parameters did not. Indeed, the latter characters were observed to be dramatically different between contiguous populations located on the same island. These results imply that neutral divergence among populations may account for the genetic patterns based on amplified fragment length polymorphism markers and SVL. However, selective pressures need to be invoked in order to explain the extraordinary variation in spot size and coverage, and coloration. We discuss the possibility that the observed variation in colour morphs is a consequence of a combination of local variation in both natural selection on an aposematic signal towards visual predators and sexual selection generated by colour morph-specific mate preferences.

  3. Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

    DEFF Research Database (Denmark)

    Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

    2001-01-01

    Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had th...

  4. Genomic Fingerprinting of the Vaccine Strain of Clostridium Tetani by Restriction Fragment Length Polymorphism Technique

    Directory of Open Access Journals (Sweden)

    Naser Harzandi

    2013-05-01

    Full Text Available Background: Clostridium tetani or Nicolaier’s bacillus is an obligatory anaerobic, Gram-positive, movable with terminal or sub terminal spore. The chromosome of C. tetani contains 2,799,250 bp with a G+C content of 28.6%. The aim of this study was identification and genomic fingerprinting of the vaccine strain of C. tetani.Materials and Methods: The vaccine strain of C. tetani was provided by Razi Vaccine and Serum Research Institute. The seeds were inoculated into Columbia blood agar and grown for 72 h and transferred to the thioglycolate broth medium for further 36 h culturing. The cultures were incubated at 35ºC in anaerobic conditions. DNA extraction with phenol/ chloroform method was performed. After extraction, the consistency of DNA was assayed. Next, the vaccine strain was digested using pvuII enzyme and incubated at 37ºC for overnight. The digested DNA was gel-electrophoresed by 1% agarose for a short time. Then, the gel was studied with Gel Doc system and transferred to Hybond N+membrane using standard DNA blotting techniques.Results: The vaccine strain of C. tetani genome was fingerprinted by RFLP technique. Our preliminary results showed no divergence exists in the vaccine strain used for the production tetanus toxoid during the periods of 1990-2011.Conclusion: Observation suggests that there is lack of significant changes in RFLP genomic fingerprinting profile of the vaccine strain. Therefore, this strain did not lose its efficiency in tetanus vaccine production. RFLP analysis is worthwhile in investigating the nature of the vaccine strain C. tetani.

  5. Culture, Polymerase Chain Reaction and Restriction Fragment Length Polymorphism Studies in Bartonella bacilliformis

    Science.gov (United States)

    1998-09-22

    bartonellosis were conclusively linked in 1885. Bartonellosis earned the name Carrion’s disease from a Peruvian medical student, Daniel Alcides Carrion . In 1885...the life of Daniel Alcides Carri6n. A. J. C. P. 1991. 95(4): s58-s66. 4. Gray GC, Johnson AA., Thornton SA., et al. An epidemic of Oroya Fever in the... Carrion linked the two phases of the disease through self-experimentation. Carrion inoculated himself with blood taken from the eruption of a patient

  6. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis.

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, P.H.M.

    2003-01-01

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  7. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  8. Genetic Characterization Of Syrian Erwinia Amylovora Strains By Amplified Fragment Length Polymorphism Technique

    International Nuclear Information System (INIS)

    Ammouneh, H.; Arabi, M.; Shoaib, A.

    2011-01-01

    Thirty Erwinia amylovora strains, collected from the main rosaceous crop-growing regions in Syria, were chosen as representatives of all major pathogenicity groups and were genetically studied by AFLP. Eight primer combinations were utilized and approximately 300 scorable bands in total were generated. Based on similarity coefficient, E. amylovora strains were placed into a main cluster containing two sub clusters, indicating very low genetic variations among the studied pathogen. The existence of two plasmids, pEA29 (present in nearly all E. amylovora isolates) and pEL60 (present mainly in Lebanese strains), was confirmed using multiplex PCR in all tested Syrian E. amylovora strains, indicating that Lebanese and Syrian isolates may share a common origin.(author)

  9. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes...

  10. Molecular marker analysis to differentiate a clonal selection of ...

    African Journals Online (AJOL)

    Lalit Kumar

    2013-04-03

    Apr 3, 2013 ... Microsatellite and amplified fragment length polymorphism (AFLP) markers were used to differentiate. Manjari Naveen, a clonal selection of Centennial Seedless variety of grape. Twenty one (21) microsatellite primers could not detect variation between parent variety and its clone. AFLP analysis.

  11. RESEARCH ARTICLE Analysis of polymorphisms and selective ...

    Indian Academy of Sciences (India)

    2017-01-27

    Jan 27, 2017 ... collected in Keningau, haplotypes K2, K9, K10, K11, K12, K13 and K14 were exclusively from Kudat while haplotypes K6 and K8 were found only from Kota Kinabalu. Haplotypes K4, K5 and K7 consisted of samples from all the three regions, indicating similar patterns of polymorphism from the different.

  12. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

    2000-01-01

    Sulpha agents, which act by inhibiting the enzyme dihydropteroate synthase (DHPS), are used widely for the treatment and prophylaxis of Pneumocystis carinii pneumonia (PCP). Recently, we have shown that mutations in the dihydropteroate synthase (DHPS) gene of Pneumocystis carinii f.sp hominis...

  13. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  14. Glutathione S-transferase P1 gene polymorphisms and susceptibility ...

    Indian Academy of Sciences (India)

    matched and ethnicity-matched healthy controls (n = 200) were genotyped for polymorphisms in GSTP1 using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Genotype distribution of g.313A>G and ...

  15. Gender based disruptive selection maintains body size polymorphism

    Indian Academy of Sciences (India)

    Darwinian fitness in holometabolous insects like the fruit fly Drosophila melanogaster is reported to be positively correlated with body size. If large individuals in a population have higher fitness, then one would expect directional selection to operate leading to uniformly large individuals. However, size polymorphism persists ...

  16. Molecular nucleation mechanisms and control strategies for crystal polymorph selection

    Science.gov (United States)

    van Driessche, Alexander E. S.; van Gerven, Nani; Bomans, Paul H. H.; Joosten, Rick R. M.; Friedrich, Heiner; Gil-Carton, David; Sommerdijk, Nico A. J. M.; Sleutel, Mike

    2018-04-01

    The formation of condensed (compacted) protein phases is associated with a wide range of human disorders, such as eye cataracts, amyotrophic lateral sclerosis, sickle cell anaemia and Alzheimer’s disease. However, condensed protein phases have their uses: as crystals, they are harnessed by structural biologists to elucidate protein structures, or are used as delivery vehicles for pharmaceutical applications. The physiochemical properties of crystals can vary substantially between different forms or structures (‘polymorphs’) of the same macromolecule, and dictate their usability in a scientific or industrial context. To gain control over an emerging polymorph, one needs a molecular-level understanding of the pathways that lead to the various macroscopic states and of the mechanisms that govern pathway selection. However, it is still not clear how the embryonic seeds of a macromolecular phase are formed, or how these nuclei affect polymorph selection. Here we use time-resolved cryo-transmission electron microscopy to image the nucleation of crystals of the protein glucose isomerase, and to uncover at molecular resolution the nucleation pathways that lead to two crystalline states and one gelled state. We show that polymorph selection takes place at the earliest stages of structure formation and is based on specific building blocks for each space group. Moreover, we demonstrate control over the system by selectively forming desired polymorphs through site-directed mutagenesis, specifically tuning intermolecular bonding or gel seeding. Our results differ from the present picture of protein nucleation, in that we do not identify a metastable dense liquid as the precursor to the crystalline state. Rather, we observe nucleation events that are driven by oriented attachments between subcritical clusters that already exhibit a degree of crystallinity. These insights suggest ways of controlling macromolecular phase transitions, aiding the development of protein

  17. Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus.

    Science.gov (United States)

    Passinho-Soares, Helna; Felix, Durvalina; Kaplan, Maria Auxiliadora; Margis-Pinheiro, Marcia; Margis, Rogério

    2006-08-01

    In Brazil, Plectranthus species are known as "boldo" and have been used in popular medicine for analgesic and dyspeptic purposes. Plectranthus need to be well identified in order to be used as commercially genuine medicinal plants. Here we describe AFLP DNA patterns able to distinguish among different Pectranthus species. The genetic variability of P. grandis Cramer, P. barbatus Andr. and P. ornatus Codd was analyzed with two sets of AFLP primers allowing detection of 241 loci. A total of 22 monomorphic loci were identified in P. barbatus, 15 in P. grandis and 30 in P. ornatus. Among these, 5 loci were informative and species-specific to P. barbatus, 3 to P. grandis and 2 loci were unique to P. ornatus. The AFLP pattern analyzed by different clustering methods assembled individuals according to their species. So far, AFLP represents a genuine and strong method to certify medicinal plant materials.

  18. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C-dubliniensis

    NARCIS (Netherlands)

    Borst, A; Theelen, B; Reinders, E; Boekhout, T; Fluit, AC; Savelkoul, PHM

    Non-Candida albicans Candida species are increasingly being isolated. These species show differences in levels of resistance to antimycotic agents and mortality. Therefore, it is important to be able to correctly identify the causative organism to the species level. Identification of C. dubliniensis

  19. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  20. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  1. Origin of Spanish invasion by the zebra mussel, Dreissena polymorpha (Pallas, 1771) revealed by amplified fragment length polymorphism (AFLP) fingerprinting

    NARCIS (Netherlands)

    Rajagopal, S.; Pollux, B.J.A.; Peters, J.L.; Cremers, G.; Moon- van der Staay, S.Y.; Alen, van T.; Eygensteyn, J.; Hoek, van A.H.A.M.; Palau, A.; Vaate, de A.B.; Velde, van der G.

    2009-01-01

    The zebra mussel, Dreissena polymorpha is an aquatic nuisance invasive species originally native to the Ponto-Caspian region where it is found in lakes and delta areas of large rivers draining into the Black and Caspian seas. The dispersal of D. polymorpha began at the end of the 18th century, at a

  2. Delineation of Campylobacter concisus genomospecies by amplified fragment length polymorphism analysis and correlation of results with clinical data

    DEFF Research Database (Denmark)

    Aabenhus, R.; On, Stephen L.W.; Siemer, Berit L.

    2005-01-01

    frequently isolated from immunocompetent patients and/or patients without concomitant infections that presented with fever, chronic diarrhea, and gut inflammation than was genomospecies 1, clustering with the type strain of oral origin. Bloody diarrhea was recorded only with C. concisus genomospecies 2......Campylobacter concisus has been as frequently isolated from human diarrhea as the important enteropathogen Campylobacter jejuni, but it also occurs in the feces of healthy individuals. The role of C concisus in human disease has been difficult to determine, since the species comprises at least two......, and numerical analysis of these data distributed the strains among four clusters. The clustering was of taxonomic significance: two clusters contained, respectively, the type strain (of oral origin) and a reference strain (from diarrhea) of each of the known genomospecies. Genomospecies 2 strains were more...

  3. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    Science.gov (United States)

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of misidentified isolates. In conclusion, the 18S-ITS1-5.8S region appears to be useful in detecting genetic variability among yeast species, which is valuable for taxonomic purposes and for species identification. We have established an RFLP database for yeast species identified in milk samples using the software GelCompar II and the RFLP database constitutes an initial method for veterinary yeast identification. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. GENETIC DIVERSITY OF VIBRIO CHOLERAE IN CHESAPEAKE BAY DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  5. GENETIC DIVERSITY OF CLINICAL AND ENVIRONMENTAL ISOLATES OF VIBRIO CHOLERAE DETERMINED BY AMPLIFIED FRAGMENT LENGTH POLYMORPHISM FINGERPRINTING. (R824995)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  6. Genotyping of Campylobacter jejuni strains from Danish broiler chickens by restriction fragment length polymorphism of the LPS gene cluster

    DEFF Research Database (Denmark)

    Knudsen, K.N.; Bang, Dang Duong; Nielsen, E.M.

    2005-01-01

    Aims: To apply and evaluate LG (LPS genes) genotyping, which is a genotyping method based on a cluster of genes involved in the synthesis of surface lipopolysaccharides (LPS) in Campylobacter species, for typing of Campylobacter jejuni isolates obtained from Danish broiler chickens. Furthermore...... and LG genotyping was low when applied to poultry isolates. This is in contrast to previous studies on isolates of human origin that reported a high correlation between results obtained by the two typing methods....

  7. Restriction fragment length polymorphism of rRNA genes for molecular typing of members of the family Legionellaceae

    DEFF Research Database (Denmark)

    Bangsborg, J M; Gerner-Smidt, P; Colding, H

    1995-01-01

    Typing of Legionella pneumophila remains important in the investigation of outbreaks of Legionnaires' disease and in the control of organisms contaminating hospital water. We found that the discriminatory power of a nonradioactive ribotyping method could be improved by combining results obtained...... of the combinations of enzymes used. Some strains belonging to the same serogroup were assigned to different ribotypes, and some ribotypes contained members of different serogroups, indicating, as others have found, that serogroup and genotype are not always related. The discriminatory power of the method...

  8. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. The role of predator selection on polymorphic aposematic poison frogs.

    Science.gov (United States)

    Noonan, Brice P; Comeault, Aaron A

    2009-02-23

    Demonstrations of interactions between diverse selective forces on bright coloration in defended species are rare. Recent work has suggested that not only do the bright colours of Neotropical poison frogs serve to deter predators, but they also play a role in sexual selection, with females preferring males similar to themselves. These studies report an interaction between the selective forces of mate choice and predation. However, evidence demonstrating phenotypic discrimination by potential predators on these polymorphic species is lacking. The possibility remains that visual (avian) predators possess an inherent avoidance of brightly coloured diurnal anurans and purifying selection against novel phenotypes within populations is due solely to non-random mating. Here, we examine the influence of predation on phenotypic variation in a polymorphic species of poison frog, Dendrobates tinctorius. Using clay models, we demonstrate a purifying role for predator selection, as brightly coloured novel forms are more likely to suffer an attack than both local aposematic and cryptic forms. Additionally, local aposematic forms are attacked, though infrequently, indicating ongoing testing/learning and a lack of innate avoidance. These results demonstrate predator-driven phenotypic purification within populations and suggest colour patterns of poison frogs may truly represent a 'magic trait'.

  10. Association between polymorphisms in selected inflammatory response genes and the risk of prostate cancer

    Directory of Open Access Journals (Sweden)

    Chen J

    2016-01-01

    Full Text Available Jun Chen,1,* Xue-Ming Ying,2,* Xue-Ming Huang,3 Peng Huang,4 Shao-Cong Yan1 1Department of Oncology, The First Affiliated Hospital of Nanchang University, Nanchang, 2Department of Oncology, Jingdezhen City People’s Hospital, Jingdezhen, 3Department of Urology, Research Institute, The First Affiliated Hospital of Nanchang University, 4The Medical School of Nanchang University, School of Public Health, Nanchang, People’s Republic of China*These authors contributed equally to this workAbstract: Inflammation represents an important event which facilitates prostate carcinogenesis. Genetic variations in inflammatory response genes could affect the level and function of the protein products, resulting in the differential prostate cancer risk among carriers of different variants. This study attempted to investigate the association of IL-4 rs2243250, IL-6 rs10499563, IL-8 rs4073, as well as NFKBIA rs2233406 and rs3138053 polymorphisms with prostate cancer risk in the Chinese population. Genotyping of the polymorphisms was performed by using polymerase chain reaction-restriction fragment length polymorphism technique on 439 prostate cancer patients and 524 controls, and the association of each polymorphic genotype with prostate cancer risk was evaluated by using logistic regression analysis based on allele, heterozygous, and homozygous comparison models, with adjustment to age and smoking status. We showed that the C allele of IL-4 rs2243250 polymorphism could increase prostate cancer risk (heterozygous comparison model: odds ratio [OR] =1.434, 95% confidence interval [CI] =1.092–1.881, P=0.009; homozygous comparison model: OR =2.301, 95% CI =1.402–3.775, P=0.001; allele comparison model: OR =1.509, 95% CI =1.228–1.853, P<0.001. On the other hand, the C allele of rs10499563 polymorphism could decrease prostate cancer risk (heterozygous comparison model: OR =0.694, 95% CI =0.525–0.918, P=0.010; homozygous comparison model: OR =0.499, 95% CI =0

  11. Genetic analysis among selected vernonia lines through seed oil ...

    African Journals Online (AJOL)

    PRECIOUS

    2010-01-11

    Jan 11, 2010 ... Vge-32 Areka (06° 48' N, 37° 43' E). Vge-36 Arsi-Negele (07° 00' N, 38° 35' E) most widely used DNA based molecular markers include restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), amplified fragment length polymer-.

  12. Multiplex-endonuclease genotyping approach (MEGA): a tool for the fine-scale detection of unlinked polymorphic DNA markers.

    NARCIS (Netherlands)

    Agbo, E.C.; Duim, B.; Majiwa, P.A.O.; Buscher, P.; Claassen, E.; Pas, te M.F.W.

    2003-01-01

    Restriction enzyme-detectable polymorphisms have been used for assessing genetic differences and generating informative genetic markers. The most detailed fingerprinting analyses have been obtained using the AFLP (amplified fragment length polymorphism) technique, which accesses subsets of

  13. Multiplex-endonuclease genotyping approach (MEGA): a tool for the fine-scale detection of unlinked polymorphic DNA markers

    NARCIS (Netherlands)

    Agbo, Eddy Chukwura; Duim, Birgitta; Majiwa, Phelix A. O.; Büscher, Philippe; Claassen, Eric; te Pas, Marinus F. W.

    2003-01-01

    Restriction enzyme-detectable polymorphisms have been used for assessing genetic differences and generating informative genetic markers. The most detailed fingerprinting analyses have been obtained using the AFLP (amplified fragment length polymorphism) technique, which accesses subsets of

  14. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

    2006-01-01

    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  15. Evolutionary algorithms for the selection of single nucleotide polymorphisms.

    Science.gov (United States)

    Hubley, Robert M; Zitzler, Eckart; Roach, Jared C

    2003-07-23

    Large databases of single nucleotide polymorphisms (SNPs) are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2) in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA), approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  16. Evolutionary algorithms for the selection of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zitzler Eckart

    2003-07-01

    Full Text Available Abstract Background Large databases of single nucleotide polymorphisms (SNPs are available for use in genomics studies. Typically, investigators must choose a subset of SNPs from these databases to employ in their studies. The choice of subset is influenced by many factors, including estimated or known reliability of the SNP, biochemical factors, intellectual property, cost, and effectiveness of the subset for mapping genes or identifying disease loci. We present an evolutionary algorithm for multiobjective SNP selection. Results We implemented a modified version of the Strength-Pareto Evolutionary Algorithm (SPEA2 in Java. Our implementation, Multiobjective Analyzer for Genetic Marker Acquisition (MAGMA, approximates the set of optimal trade-off solutions for large problems in minutes. This set is very useful for the design of large studies, including those oriented towards disease identification, genetic mapping, population studies, and haplotype-block elucidation. Conclusion Evolutionary algorithms are particularly suited for optimization problems that involve multiple objectives and a complex search space on which exact methods such as exhaustive enumeration cannot be applied. They provide flexibility with respect to the problem formulation if a problem description evolves or changes. Results are produced as a trade-off front, allowing the user to make informed decisions when prioritizing factors. MAGMA is open source and available at http://snp-magma.sourceforge.net. Evolutionary algorithms are well suited for many other applications in genomics.

  17. Research on the relativity between gene polymorphism and children cardiac insufficiency.

    Science.gov (United States)

    He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J

    2017-08-01

    We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.

  18. Interaction between estrogen receptor and retinol-binding protein-4 polymorphisms as a tool for the selection of prolific pigs

    Directory of Open Access Journals (Sweden)

    Iara Denise Vasconcellos Gonçalves

    2008-01-01

    Full Text Available The aim of the present study was to investigate the association of the estrogen receptor (ER-PvuII and retinol-binding protein 4 (RBP4-MspI gene polymorphisms and their interactions with prolificacy in a commercial synthetic pig line reared in Brazil. A total of 10,374 piglet records from 218 sows and 817 litters were used for litter size analysis. Only females with three or four farrowings were included in the analysis. The mean litter size ranged from 5.0 to 19.5 piglets. DNA was extracted from leukocytes by a standard method, and ER-PvuII and RBP4-MspI polymorphisms were characterized by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP technique. The association between alleles or genotypes and reproductive performance was analyzed using a general linear model including the interaction between the ER-PvuII and RBP4-MspI genotypes. For the ER-PvuII gene, the allele frequencies of allele A and allele B were 0.56 and 0.44, respectively. For the RBP4-MspI gene, the frequencies of alleles A1 and A2 were 0.29 and 0.71, respectively. The total number of piglets born (TNB, born alive (NBA, or number of mummies and stillborn piglets (NMUM and NSB per litter did not differ between the various ER-PvuII and RBP4-MspI genotypes. However, when the ER-PvuII and RBP4-MspI genotypes were considered together in each sow, TNB and NBA were 1.4 (p = 0.0026 and 0.9 (p = 0.019 higher in AA/A1 and AB/A1 animals, respectively, than in AA/A2 and BB/A1 animals. Likewise, TNB and NBA were 0.9 (p = 0.0258 and 0.8 (p = 0.0168 higher in BB/A2 and AB/A2 sows, respectively, than in AA/A2 and BB/A1 animals, but no difference was observed compared to AA/A1 and AB/A1 animals. The results showed larger litter sizes (TNB and NBA for sows carrying the ER-PvuII allele A and the RBP4-MspI genotype A1, and for animals carrying the ER-PvuII allele B and the RBP4-MspI genotype A2. In conclusion, the interaction between genotypes ER-PvuII and RBP4-MspI is

  19. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Chuen Yang Chua

    2017-09-05

    . Analysis of DNA sequence revealed that most of the nucleotide polymorphisms were synonymous and concentrated in domain I of PkAMA-1. Forteen haplotypes were identified based on amino acid variations and haplotype ...

  20. A Population Genetics Study of Anopheles Darlingi (Diptera: Culicidae) from Colombia Based on Random Amplified Polymorphic DNA-Polymerase Chain Reaction and Amplified Fragment Length Polymorphism Markers

    Science.gov (United States)

    2007-06-01

    of Aedes aegypti from Puerto Rico, Apostol et aI. (1996) found an expected heterozygosity of 0.354. similar to that found by Posso et al. (2003) in An...ing on the marker type used. In Ae. aegypt ; from Trinidad and Tobago, they found that the heterozygosity observed with the Rt-:LPs was significantly...Reiter P, Miller BR 1996. Population genctics with RAPD-PCR markers: thc breeding structurc of Aedes aeRypt; in Puerto Rico. Heredity 76: 325-334

  1. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Polymorphisms occurring in this surface antigen will cause major obstacles in developing effective malaria vaccines based on AMA-1. The objective of this study was to characterize ama1 gene in Plasmodium knowlesi isolates from Sabah. DNA was extracted from blood samples collected from Keningau, Kota Kinabalu and ...

  2. Selective loss of polymorphic mating types is associated with rapid phenotypic evolution during morphic speciation.

    Science.gov (United States)

    Corl, Ammon; Davis, Alison R; Kuchta, Shawn R; Sinervo, Barry

    2010-03-02

    Polymorphism may play an important role in speciation because new species could originate from the distinctive morphs observed in polymorphic populations. However, much remains to be understood about the process by which morphs found new species. To detail the steps of this mode of speciation, we studied the geographic variation and evolutionary history of a throat color polymorphism that distinguishes the "rock-paper-scissors" mating strategies of the side-blotched lizard, Uta stansburiana. We found that the polymorphism is geographically widespread and has been maintained for millions of years. However, there are many populations with reduced numbers of throat color morphs. Phylogenetic reconstruction showed that the polymorphism is ancestral, but it has been independently lost eight times, often giving rise to morphologically distinct subspecies/species. Changes to the polymorphism likely involved selection because the allele for one particular male strategy, the "sneaker" morph, has been lost in all cases. Polymorphism loss was associated with accelerated evolution of male size, female size, and sexual dimorphism, which suggests that polymorphism loss can promote rapid divergence among populations and aid species formation.

  3. The evolution of plumage polymorphism in birds of prey and owls: the apostatic selection hypothesis revisited.

    Science.gov (United States)

    Fowlie, M K; Krüger, O

    2003-07-01

    Co-evolution between phenotypic variation and other traits is of paramount importance for our understanding of the origin and maintenance of polymorphism in natural populations. We tested whether the evolution of plumage polymorphism in birds of prey and owls was supported by the apostatic selection hypothesis using ecological and life-history variables in birds of prey and owls and performing both cross taxa and independent contrast analyses. For both bird groups, we did not find any support for the apostatic selection hypothesis being the maintaining factor for the polymorphism: plumage polymorphism was not more common in taxa hunting avian or mammalian prey, nor in migratory species. In contrast, we found that polymorphism was related to variables such as sexual plumage dimorphism, population size and range size, as well as breeding altitude and breeding latitude. These results imply that the most likely evolutionary correlate of polymorphism in both bird groups is population size, different plumage morphs might simply arise in larger populations most likely because of a higher probability of mutations and then be maintained by sexual selection.

  4. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  5. Analysis of bovine growth hormone gene polymorphism of local and ...

    African Journals Online (AJOL)

    Analysis of bovine growth hormone gene polymorphism of local and Holstein cattle breeds in Kerman province of Iran using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) ... African Journal of Biotechnology ... RFLPs in this segment were studied using AluI restriction enzyme.

  6. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

  7. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  8. Detection of MspI polymorphism and the single nucleotide ...

    African Journals Online (AJOL)

    The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled, Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) technique. Also, this work aimed to identify the single nucleotide ...

  9. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... (Islam and Shepherd, 1992). But these markers were not considered suitable for large scale mapping. With the recent introduction of molecular biology, DNA based markers including polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), single nucleotide polymorphisms ...

  10. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  11. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  12. ZRT1 harbors an excess of nonsynonymous polymorphism and shows evidence of balancing selection in Saccharomyces cerevisiae

    OpenAIRE

    Engle, Elizabeth K.; Fay, Justin C.

    2012-01-01

    Estimates of the fraction of nucleotide substitutions driven by positive selection vary widely across different species. Accounting for different estimates of positive selection has been difficult, in part because selection on polymorphism within a species is known to obscure a signal of positive selection among species. While methods have been developed to control for the confounding effects of negative selection against deleterious polymorphism, the impact of balancing selection on estimate...

  13. Polymorphism and signatures of selection in the multimammate rat DQB gene

    DEFF Research Database (Denmark)

    de Bellocq, Joëlle Goüy; Leirs, Herwig

    2010-01-01

    sequence and there are strong signals of positive selection on peptide binding sites. Signals of recombination were found in the sequences suggesting that recombination has played a role in generating allelic diversity. Although trans-taxon polymorphism is present at the interspecific level in DQB exon 2...... sequences of Mus species, we did not find any evidence of allele sharing among Muridae genera. This indicates a temporal limit of DQB allele sharing in Muridae of less than 8 Mya. In conclusion, although DQB seems to be a good marker to investigate pathogen-driven selection, the polymorphism of gene copy...

  14. Selective Acceleration of Crystal Growth of Indomethacin Polymorphs by Low-Concentration Poly(ethylene oxide).

    Science.gov (United States)

    Shi, Qin; Zhang, Jie; Zhang, Chen; Jiang, Jing; Tao, Jun; Zhou, Dongshan; Cai, Ting

    2017-12-04

    Physical stability of pharmaceutical amorphous solid dispersions is one of the critical attributes to the successful development of the formulation. Herein, we studied the impact of low-concentration poly(ethylene oxide) (PEO) on the crystallization rates of three polymorphs of indomethacin (IMC, γ-, α-, and δ-form). We observed that the addition of 3% w/w PEO significantly increased the crystal growth rates of γ-form and α-form of IMC, but had a negligible effect on the δ-form. The reduction of the activation energy for the crystal growth of IMC polymorphs after adding the PEO follows the order γ-form > α-form > δ-form, which is consistent with the trend toward the accelerating effects of PEO on the crystal growth rates of three polymorphs. With the addition of low-concentration PEO, there is an increase of molecular mobility of IMC as evidenced by the decreased structural relaxation times and viscosities. This study suggests that the substantially different effects of PEO on the crystal growth rates of IMC polymorphs are attributable to the different adsorption of PEO on the crystal surface of those polymorphs, which in turn exerts a selective accelerating effect on IMC molecules to organize into the different crystalline phases. These findings are relevant for understanding the crystallization behavior of amorphous solid dispersions containing polymorphic drugs.

  15. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Chuen Yang Chua

    2017-09-05

    Sep 5, 2017 ... The presence of purifying selection and low nucleotide diversity indicated that domain II of Pkama1 can be used as a target for vaccine development. .... lected from hospitals of Kudat, Keningau and Queen. Elizabeth in 2012, after a written consent for sample collection was obtained. This study was ...

  16. Association of Interleukin-4 Receptor Gene Polymorphism with Chronic Periodontitis

    Directory of Open Access Journals (Sweden)

    M. Khoshhal

    2011-10-01

    Full Text Available Introduction & Objective: Periodontitis is a multifactorial disease in which host immune system and genetic factors have an important role in its pathogenesis. Genetic polymorphisms in cytokines and their receptors have been proposed as potential markers for periodontal diseases. The aim of the present study was to evaluate whether IL-4R gene polymorphism is associated with chronic periodontitis (CP or not? Materials & Methods: In this cross sectional study ninety non smoker patients (61 women and 29 men with chronic periodontitis were selected according to established criteria. They were categorized into three groups according to their clinical attachment level (CAL. Mutation at position 375(alanine/glutamine, 411(leucine/serine, 478(serine/proline, 406 (arginine/ cysteine in the IL-4R gene was detected by a polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP method.Results: The distribution of mutations for IL-4 polymorphism at amino acids 375 (P=0.41, 411(P=0.22, 478(P=0.17, 406(P=0.77 were not significantly different among mild, moderate and sever chronic periodontitis patients. Conclusion: This study suggests that there is no correlation between IL-4R polymorphism of chronic periodontitis.(Sci J Hamadan Univ Med Sci 2011;18(3:63-69

  17. Identification of Biomphalaria havanensis and Biomphalaria obstructa populations from Cuba using polymerase chain reaction and restriction fragment length polymorphism of the ribosomal RNA intergenic spacer

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2001-07-01

    Full Text Available In Cuba, several Biomphalaria species have been reported such as B. orbignyi, B. schrammi, B. helophila, B. havanensis and B. peregrina; only the latter three are considered as potential hosts of Schistosoma mansoni. The specific identification of Biomphalaria species is based on anatomical and morphological characters of genital organs and shells. The correct identification of these snails is complicated by the high variation in these characters, similarity among species and in some cases by the small size of the snails. In this paper, we reported the classical morphological identification, the use of PCR and RFLP analysis of the internal transcribed spacer region of the ribosomal RNA genes for molecular identification of seven snail populations from different localities in Cuba. Using morphological and molecular analysis, we showed that among the studied Cuban Biomphalaria populations only B. havanensis and B. obstructa species were found.

  18. Mycobacterium bovis: polymerase chain reaction identification in bovine Lymphonode biopsies and genotyping in isolates from Southeast Brazil by spolygotyping and restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Zanini MS

    2001-01-01

    Full Text Available Diagnosis of the Mycobacterium tuberculosis complex by direct PCR of mediastinal lymphnode DNA and microbiological tests were compared in cattle suspicious of bearing tuberculous-like lesions detected during slaughter. The PCR procedure applied on DNA samples (n=54 obtained by adding alpha -casein into the thiocyanate extraction mix was positive in 70% of the samples. PCR confirmed the identification of 23 samples (100% that grew in culture, 9 samples (60% that failed to grow in culture, plus 6 (37.5% samples that resulted in growth of bacterial contaminants. Genotyping by IS6110-RFLP and DR-spoligotyping analysis of seven samples revealed the presence of several polimorphisms. Seven of the isolates contained multiple copies of IS6110, thus defining the existence of five singular genotypes.

  19. IS6110 restriction fragment length polymorphism of Mycobacterium tuberculosis isolated from patients with pulmonary tuberculosis in Campinas, Brazil: evidence of intercontinental distribution of strains

    Directory of Open Access Journals (Sweden)

    Ana Lucia Roscani Calusni

    2003-07-01

    Full Text Available Tuberculosis (TB is a major concern in developing countries. In Brazil, few genotyping studies have been conducted to verify the number of IS6110 copies present in local prevalent strains of Mycobacterium tuberculosis, the distribution and clustering of strains. IS6110 DNA fingerprinting was performed on a sample of M. tuberculosis isolates from patients with AFB smear-positive pulmonary TB, at a hospital in Brazil. The IS6110 profiles were analyzed and compared to a M. tuberculosis database of the Houston Tuberculosis Initiative, Houston, US. Seventy-six fingerprints were obtained from 98 patients. All M. tuberculosis strains had an IS6110 copy number between 5-21 allowing for differentiation of the isolates. Human immunodeficiency virus infection was confirmed in nearly half the patients of whom data was available. Fifty-eight strains had unique patterns, while 17 strains were grouped in 7 clusters (2 to 6 strains. When compared to the HTI database, 6 strains matched isolates from El Paso, Ciudad de Juarez, Houston, and New York. Recently acquired infections were documented in 19% of cases. The community transmission of infection is intense, since some clustered strains were recovered during the four-year study period. The intercontinental dissemination of M. tuberculosis strains is suspected by demonstration of identical fingerprints in a distant country.

  20. [Comparison of usefulness between variable numbers of tandem repeats (VNTR) analysis and restriction fragment length polymorphism (RFLP) in the genotyping of Mycobacterium avium].

    Science.gov (United States)

    Kazumi, Yuko; Udagawa, Tadashi; Maeda, Shinji; Murase, Yoshirou; Sugawara, Isamu; Okumura, Masao; Azuma, Yuka; Goto, Mieko; Tsunematsu, Noriko

    2007-10-01

    Comparison of usefulness of IS1245 RFLP and VNTR in M. avium genotyping. Thirty-six cases (55 strains) from sputum and BALF and twelve cases (29 strains) isolated from blood of HIV-infected patients were used. VNTR and RFLP using IS1245 were performed. Multiple samples were taken from 16 patients and 52 clinical isolates were used for VNTR and RFLP for comparison. (1) VNTR and RFLP results were identical in 12 out of 16 cases whose samples were collected several times. (2) Eight isolates were obtained from one patient. In this eight isolates, there were the cases of M. avium polyclonal infection and of mixed infection with M. intracellulare. VNTR patterns were two types and RFLP were 5 kinds of different in this case. (3) VNTR patterns of six isolates from one HIV-infected patient were identical, but there were three variations in RFLP patterns. There were three cases of mixed infections with M. tuberculosis or M. intracellulare, and six strains polyclonal infection of M. avium (7.1 %) in 84 isolates. These 6 clinical isolates were derived from sputum or BALF (5 strains) and HIV-infected blood (one strain). VNTR patterns were similar in four pairs (9 strains) who did not contact closely, but they were distinguished clearly by RFLP. Seventeen strains had three or less IS1245-related bands in RFLP analyses of 89 strains. As there is a possibility of polyclonal infection with M. avium and mixed infection with other species, the single clonal infection should be confirmed first by VNTR. When single colony was obtained, VNTR and RFLP were performed for genotyping of M. avium. Furthermore, strains with less bands by RFLP should be carefully judged in terms of both VNTR and RFLP. It is recommended that the specimens should be collected from each patient several times.

  1. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  2. Molecular epidemiology of contagious bovine pleuropneumonia in Tanzania based on amplified fragment length polymorphism and pulsed-field gel electrophoresis analysis

    DEFF Research Database (Denmark)

    Kusiluka, L.J.M.; Ojeniyi, B.; Friis, N.F.

    2001-01-01

    anti vaccine strains. The strong genomic homogeneity among, M. mycoides SC strains associated with outbreaks of contagious bovine pleuropneumonia in different regions of Tanzania suggests that the outbreaks of the disease in the 1990-99 period might have been caused Ly a single epidemic clone. Moreover...

  3. Comparison of Variable-Number Tandem-Repeat Markers typing and IS1245 Restriction Fragment Length Polymorphism fingerprinting of Mycobacterium avium subsp. hominissuis from human and porcine origins

    Directory of Open Access Journals (Sweden)

    Marttila Harri

    2010-03-01

    Full Text Available Abstract Background Animal mycobacterioses are regarded as a potential zoonotic risk and cause economical losses world wide. M. avium subsp. hominissuis is a slow-growing subspecies found in mycobacterial infected humans and pigs and therefore rapid and discriminatory typing methods are needed for epidemiological studies. The genetic similarity of M. avium subsp. hominissuis from human and porcine origins using two different typing methods have not been studied earlier. The objective of this study was to compare the IS1245 RFLP pattern and MIRU-VNTR typing to study the genetic relatedness of M. avium strains isolated from slaughter pigs and humans in Finland with regard to public health aspects. Methods A novel PCR-based genotyping method, variable number tandem repeat (VNTR typing of eight mycobacterial interspersed repetitive units (MIRUs, was evaluated for its ability to characterize Finnish Mycobacterium avium subsp. hominissuis strains isolated from pigs (n = 16 and humans (n = 13 and the results were compared with those obtained by the conventional IS1245 RFLP method. Results The MIRU-VNTR results showed a discriminatory index (DI of 0,92 and the IS1245 RFLP resulted in DI 0,98. The combined DI for both methods was 0,98. The MIRU-VNTR test has the advantages of being simple, reproducible, non-subjective, which makes it suitable for large-scale screening of M. avium strains. Conclusions Both typing methods demonstrated a high degree of similarity between the strains of human and porcine origin. The parallel application of the methods adds epidemiological value to the comparison of the strains and their origins. The present approach and results support the hypothesis that there is a common source of M. avium subsp. hominissuis infection for pigs and humans or alternatively one species may be the infective source to the other.

  4. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  5. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Science.gov (United States)

    Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

    2016-01-01

    Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

  6. A novel Tth111I restriction fragment length polymorphism (RFLP) allows tracing of X-chromosome inactivation in the (Xid) hetrozygote

    Energy Technology Data Exchange (ETDEWEB)

    Shanmugam, V.; Sell, W.; Saha, B.K. [Emory Univ. of School of Medicine, Atlanta, GA (United States)] [and others

    1996-02-01

    The X-linked immunodeficiency (Xid) in CBA/N mice serves as a model for the X-linked agammaglobulinemia (XLA) syndrome in man. X-chromosome inactivation in F{sub 1} heterozygotes derived from CBA/N (X{sup xid}/X{sup xid}) and B6.Pgk-1a (X{sup +}/Y) was investigated by monitoring the methylation status of the individual Pgk-1 alleles, Pgk-1b and Pgk-1a, respectively, using a novel Tth111I RFLP. Results indicate that in circulating B lymphocytes of female heterozygotes, only the X chromosomes carrying the normal alleles (X{sup +}) are active (nonrandom inactivation of the X chromosome), whereas in non-B cells both the X chromosomes (X{sup +} and X{sup xid}) are active (random inactivation of the X chromosome). These results were further confirmed by direct evaluation of transcription of the Btk gene, the gene mutated both in Xid and in XLA. 36 refs., 2 figs., 2 tabs.

  7. [Application of restriction fragment length polymorphism-polymerase chain reaction-flaA and resistotype to identify potential undiagnosed outbreaks of campylobacteriosis in Spain].

    Science.gov (United States)

    Pérez-Boto, David; López-Portolés, José Antonio; Simón, Cristina; Echeita, María Aurora

    2014-01-01

    Outbreaks of campylobacteriosis are infrequent and usually involve a low number of patients, although it is estimated that many more remain undiagnosed. The most successful techniques for outbreak investigation in Campylobacter spp. (PFGE, MLST) have the drawback of being laborious and not available in many laboratories. During the year 2008, 352 isolates of C. jejuni and C. coli from 16 hospitals were received in our laboratory. All strains were genotyped by RFLP-PCR-flaA (flaA type) and phenotyped with their resistotype. It was established that the strains of the same species from the same hospital, isolated over a period of up to 11 days, with MIC values of±1 dilution with the same flaA type could belong to an outbreak. Strains that met these criteria would be later subtyped by KpnI-PFGE and MLST. A total of 23 out of 352 isolates, distributed in 10 groups, met the criteria for being associated with putative undiagnosed outbreaks. The similarity of the PFGE-profiles in 8 groups was greater than 95% among the isolates from each group. In 7 of the groups, the sequence types (MLST) were coincident. The use of 2 easy markers (resistotype and RFLP-PCR-flaA) may detect isolates probably belonging to an undiagnosed outbreak of campylobacteriosis. Accurate diagnosis requires other molecular markers and epidemiological data of each isolate. The study suggests that, as in other countries, the number of outbreaks of campylobacteriosis in Spain is probably underestimated. Copyright © 2013 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  8. Genetic Characterization of Campylobacter Jejuni and C. coli Isolated From Broilers Using flaA PCR-Restriction Fragment Length Polymorphism Method in Shiraz, Southern Iran

    OpenAIRE

    Khoshbakht, Rahem; Tabatabaei, Mohammad; Hosseinzadeh, Saeid; Shirzad Aski, Hesamaddin; Seifi, Saeed

    2015-01-01

    Background: Thermophilic campylobacters, particularly Campylobacter jejuni and C. coli are the main agents of human campylobacteriosis. Campylobacter contaminated chicken products is the most important source of foodborne gastroenteritis. Evaluation of genetic diversity among Campylobacter population is critical for understanding the epidemiology of this bacterium and developing effective control strategies against Campylobacter infections and other related disorders. Objectives: The aim of t...

  9. Natural selection on a leaf-shape polymorphism in the ivyleaf morning glory (Ipomoea hederacea).

    Science.gov (United States)

    Bright, Kerry L; Rausher, Mark D

    2008-08-01

    Leaf shape is one of the most variable plant traits. Previous work has provided much indirect evidence that leaf-shape variation is adaptive and that leaf shape influences thermoregulation, water balance, and resistance to natural enemies. Nevertheless, there is little direct evidence that leaf shape actually affects plant fitness. In this study, we first demonstrate that populations of the ivyleaf morning glory, Ipomoea hederacea, in North and South Carolina are frequently polymorphic at a locus that influences leaf shape. We then employ several field experiments to show that this polymorphism is subject to selection. In two of the experiments, at different sites, heterozygotes enjoyed a fitness advantage over both homozygotes. At a third site, in one year directional selection favored lobed leaves, whereas in a second year the pattern of fitnesses was consistent with similar directional selection or heterozygote superiority. Computer simulations of heterozygote advantage under the high selfing rates of I. hederacea indicate that balancing selection of the magnitude observed can by itself stabilize the polymorphism, although spatially and temporally variable selection may also contribute to its long-term maintenance.

  10. Are polymorphisms in metabolism protective or a risk for reduced white blood cell counts in a Chinese population with low occupational benzene exposures?

    Science.gov (United States)

    Ye, Ling-li; Zhang, Guang-hui; Huang, Jing-wen; Li, Yong; Zheng, Guo-qiao; Zhang, De-ting; Zhou, Li-fang; Tao, Xi-dan; Zhang, Jing; Ye, Yun-jie; Sun, Pin; Frank, Arthur; Xia, Zhao-lin

    2015-01-01

    Background: Genetic variations in metabolic enzyme genes may enhance hematotoxicity in benzene-exposed populations. Objective: To investigate the association between polymorphisms of metabolism genes and white blood cells (WBCs). Methods: Three hundred and eighty-five benzene-exposed workers and 220 unexposed indoor workers were recruited in China. We explored the relationship between metabolic enzymes polymorphisms [glutathione S-transferase T1/M1 (GSTT1/M1) null, glutathione S-transferase P1 (GSTP1)rs1695, Cytochrome P450 2E1 (CYP2E1) rs3813867, rs2031920, rs6413432, microsomal epoxide hydrolase (mEH) rs1051740, rs2234922] by polymerase chain reaction (PCR)–restriction fragment length polymorphism (RFLP) analysis and WBC. Results: The exposed group had lower WBC counts (Pbenzene-exposed workers in China, and we can make use of it to select susceptible population. PMID:26179485

  11. Seasonally fluctuating selection can maintain polymorphism at many loci via segregation lift.

    Science.gov (United States)

    Wittmann, Meike J; Bergland, Alan O; Feldman, Marcus W; Schmidt, Paul S; Petrov, Dmitri A

    2017-11-14

    Most natural populations are affected by seasonal changes in temperature, rainfall, or resource availability. Seasonally fluctuating selection could potentially make a large contribution to maintaining genetic polymorphism in populations. However, previous theory suggests that the conditions for multilocus polymorphism are restrictive. Here, we explore a more general class of models with multilocus seasonally fluctuating selection in diploids. In these models, the multilocus genotype is mapped to fitness in two steps. The first mapping is additive across loci and accounts for the relative contributions of heterozygous and homozygous loci-that is, dominance. The second step uses a nonlinear fitness function to account for the strength of selection and epistasis. Using mathematical analysis and individual-based simulations, we show that stable polymorphism at many loci is possible if currently favored alleles are sufficiently dominant. This general mechanism, which we call "segregation lift," requires seasonal changes in dominance, a phenomenon that may arise naturally in situations with antagonistic pleiotropy and seasonal changes in the relative importance of traits for fitness. Segregation lift works best under diminishing-returns epistasis, is not affected by problems of genetic load, and is robust to differences in parameters across loci and seasons. Under segregation lift, loci can exhibit conspicuous seasonal allele-frequency fluctuations, but often fluctuations may be small and hard to detect. An important direction for future work is to formally test for segregation lift in empirical data and to quantify its contribution to maintaining genetic variation in natural populations.

  12. Association between A59V polymorphism in exon 3 of leptin gene ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... We used the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique to screen for DNA polymorphisms of the leptin gene in 255 cows of Iranian Holstein. Amplified region is located in exon 3 of leptin gene. The genomic bovine leptin sequences, which consist of three ...

  13. Association of Gln27Glu polymorphism of the β-2- adrenergic ...

    African Journals Online (AJOL)

    A group of 66 patients with preeclampsia and 72 control subjects were analyzed for the Arg16Gly and Gln27Glu polymorphisms of the ADRB2 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Comparisons of the ADRB2 genotypes or alleles between different groups were performed ...

  14. A General Model of Negative Frequency Dependent Selection Explains Global Patterns of Human ABO Polymorphism

    Science.gov (United States)

    Villanea, Fernando A.; Safi, Kristin N.; Busch, Jeremiah W.

    2015-01-01

    The ABO locus in humans is characterized by elevated heterozygosity and very similar allele frequencies among populations scattered across the globe. Using knowledge of ABO protein function, we generated a simple model of asymmetric negative frequency dependent selection and genetic drift to explain the maintenance of ABO polymorphism and its loss in human populations. In our models, regardless of the strength of selection, models with large effective population sizes result in ABO allele frequencies that closely match those observed in most continental populations. Populations must be moderately small to fall out of equilibrium and lose either the A or B allele (Ne ≤ 50) and much smaller (Ne ≤ 25) for the complete loss of diversity, which nearly always involved the fixation of the O allele. A pattern of low heterozygosity at the ABO locus where loss of polymorphism occurs in our model is consistent with small populations, such as Native American populations. This study provides a general evolutionary model to explain the observed global patterns of polymorphism at the ABO locus and the pattern of allele loss in small populations. Moreover, these results inform the range of population sizes associated with the recent human colonization of the Americas. PMID:25946124

  15. A General Model of Negative Frequency Dependent Selection Explains Global Patterns of Human ABO Polymorphism.

    Directory of Open Access Journals (Sweden)

    Fernando A Villanea

    Full Text Available The ABO locus in humans is characterized by elevated heterozygosity and very similar allele frequencies among populations scattered across the globe. Using knowledge of ABO protein function, we generated a simple model of asymmetric negative frequency dependent selection and genetic drift to explain the maintenance of ABO polymorphism and its loss in human populations. In our models, regardless of the strength of selection, models with large effective population sizes result in ABO allele frequencies that closely match those observed in most continental populations. Populations must be moderately small to fall out of equilibrium and lose either the A or B allele (N(e ≤ 50 and much smaller (N(e ≤ 25 for the complete loss of diversity, which nearly always involved the fixation of the O allele. A pattern of low heterozygosity at the ABO locus where loss of polymorphism occurs in our model is consistent with small populations, such as Native American populations. This study provides a general evolutionary model to explain the observed global patterns of polymorphism at the ABO locus and the pattern of allele loss in small populations. Moreover, these results inform the range of population sizes associated with the recent human colonization of the Americas.

  16. A comparative assessment of ribosomal DNA polymorphisms in ...

    African Journals Online (AJOL)

    Southern blot hybridisation was carried out on the DNA digests transferred onto membrane using radioactive probe prepared from 16S and 23S rRNA from Escherichia coli. The pattern of bands which depended on restriction fragment length polymorphisms was used as a measure of minor genomic variation within the ...

  17. Calpastatin ( CAST ) gene polymorphism in Kajli, Lohi and Thalli ...

    African Journals Online (AJOL)

    Restriction fragment length polymorphisms (RFLPs) in the amplified fragments were studied using Msp1 restriction enzyme. Frequencies of MM, MN and NN genotypes were found to be 77, 20 and 3% in Lohi breed and 68, 26 and 6% in Kajli breed respectively. In Thalli sheep, only the MM (80%) and MN (20%) genotypes ...

  18. Maintenance of a genetic polymorphism with disruptive natural selection in stickleback.

    Science.gov (United States)

    Marchinko, Kerry B; Matthews, Blake; Arnegard, Matthew E; Rogers, Sean M; Schluter, Dolph

    2014-06-02

    The role of natural selection in the maintenance of genetic variation in wild populations remains a major problem in evolution. The influence of disruptive natural selection on genetic variation is especially interesting because it might lead to the evolution of assortative mating or dominance [1, 2]. In theory, variation can persist at a gene under disruptive natural selection, but the process is little studied and there are few examples [3, 4]. We report a stable polymorphism in the bony armor of threespine stickleback maintained with a deficit of heterozygotes at the major underlying gene, Ectodysplasin (Eda) [5]. The deficit vanishes at the embryo life stage only to re-emerge in adults, indicating that disruptive natural selection, rather than nonrandom mating, is the cause. The mechanism enabling long-term persistence of the polymorphism is unknown, but disruptive selection is predicted to be frequency dependent, favoring homozygous genotypes when they become rare. Further research on the ecological and evolutionary processes affecting individual genes will ultimately lead to a better understanding of the causes of genetic variation in populations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Synthesis Strategies for Ultrastable Zeolite GIS Polymorphs as Sorbents for Selective Separations

    Energy Technology Data Exchange (ETDEWEB)

    Oleksiak, Matthew D. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Ghorbanpour, Arian [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Conato, Marlon T. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Institute of Chemistry, University of the Philippines, Diliman Quezon City 1101 Philippines; McGrail, B. Peter [Applied Functional Materials, Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland WA 99354 USA; Grabow, Lars C. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Motkuri, Radha Kishan [Applied Functional Materials, Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland WA 99354 USA; Rimer, Jeffrey D. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA

    2016-09-02

    Designing zeolites with tunable physicochemical properties can substantially impact their performance in commercial applications such as adsorption, separations, catalysis, and drug delivery. Zeolite synthesis typically requires an organic structure-directing agent to obtain crystals with specific pore topology. Attempts to remove organics from syntheses to achieve commercially-viable methods of preparing zeolites often lead to the formation of impurities. Here, we present organic-free syntheses of two polymorphs of the small-pore zeolite P (GIS), P1 and P2. Using a combination of adsorption measurements and density functional theory calculations, we show that GIS polymorphs are selective adsorbents for H2O relative to other light gases (e.g., H2, N2, CO2).

  20. The M-OLAP Cube Selection Problem: A Hyper-polymorphic Algorithm Approach

    Science.gov (United States)

    Loureiro, Jorge; Belo, Orlando

    OLAP systems depend heavily on the materialization of multidimensional structures to speed-up queries, whose appropriate selection constitutes the cube selection problem. However, the recently proposed distribution of OLAP structures emerges to answer new globalization's requirements, capturing the known advantages of distributed databases. But this hardens the search for solutions, especially due to the inherent heterogeneity, imposing an extra characteristic of the algorithm that must be used: adaptability. Here the emerging concept known as hyper-heuristic can be a solution. In fact, having an algorithm where several (meta-)heuristics may be selected under the control of a heuristic has an intrinsic adaptive behavior. This paper presents a hyper-heuristic polymorphic algorithm used to solve the extended cube selection and allocation problem generated in M-OLAP architectures.

  1. Assessment of protein tyrosine phosphatases number 22 polymorphism prevalence among rheumatoid arthritis patients: A study on Iranian patients.

    Science.gov (United States)

    Salesi, Mansour; Boroujeni, Golshan Taghipour; Salehi, Mansoor; Karimzadeh, Hadi

    2014-01-01

    It has been proposed that Trp (620) allotype of protein tyrosine phosphatases number 22 (PTPN22) gene can intensify the susceptibility to rheumatoid arthritis (RA) and other autoimmune diseases. Thus, in this study, the prevalence of this polymorphism has been surveyed among RA patients compared with healthy persons. The samples were selected from Isfahan province (one of the most populated area of Iran). In this study, 100 patients (case group) and 100 healthy persons (control group) were participated voluntarily. The case group was selected from people who had referred to the rheumatology clinic of AlZahra University Hospital to follow-up their treatment and change their drugs dosage. The control group members, who were living in Isfahan province, mutually had similar age with patients. On a total, 22% of the case group was male and 75% of the control group was female. DNA was extracted from the blood sample of all cases and controls and the PTPN22 single nucleotide polymorphism (SNP) C1858> T gene polymorphism were studied using the polymerase chain reaction-restriction fragment length polymorphism method. PTPN22 SNP C1858> T gene polymorphism was observed in 11 persons (11%) of the case group and 8 persons (8%) of the control group. The results show that the difference was not statistically significant in Isfahan RA population (P = 0.47; OR = 1.42; 95% CI 0.55-3.69). Although, another study on Iranian population had shown that this polymorphism confers susceptibility to RA.

  2. Synthesis Strategies for Ultrastable Zeolite GIS Polymorphs as Sorbents for Selective Separations

    Energy Technology Data Exchange (ETDEWEB)

    Oleksiak, Matthew D. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Ghorbanpour, Arian [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Conato, Marlon T. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Institute of Chemistry, University of the Philippines, Diliman Quezon City 1101 Philippines; McGrail, B. Peter [Applied Functional Materials, Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland WA 99354 USA; Grabow, Lars C. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA; Motkuri, Radha Kishan [Applied Functional Materials, Energy and Environment Directorate, Pacific Northwest National Laboratory, Richland WA 99354 USA; Rimer, Jeffrey D. [Department of Chemical and Biomolecular Engineering, University of Houston, Houston TX 77204 USA

    2016-10-05

    Designing nanoporous zeolites with tunable physicochemical properties can substantially impact their performance in commercial applications spanning diverse areas such as adsorption, separations, catalysis, and drug delivery. Zeolite synthesis typically requires the use of an organic structure-directing agent to facilitate the formation of crystals with specific pore size and topology. Attempts to remove organics from syntheses to achieve commercially-viable methods of preparing zeolites often lead to the formation of unwanted crystal polymorphs (i.e., impurities). Here, we present an organic-free synthesis of the small-pore zeolite P (GIS framework topology) that can be selectively tailored to produce two pure polymorphs: P1 and P2. To this end, we developed kinetic phase diagrams that identify synthesis compositions leading to the formation of GIS (P1 and P2), as well as their structural analogues MER and PHI. Using a combination of adsorption measurements and density functional theory (DFT) calculations, we also show that both GIS polymorphs are highly selective adsorbents for H2O relative to other light gases (e.g,, H2, N2, CO2). These studies highlight the potential application of GIS materials for dehydration processes, while our findings also refute prior theoretical studies postulating that GIS-type zeolites are excellent materials for CO2 separation/sequestration. Moreover, there is an impetus for discovering novel small-pore zeolites that are shape-selective catalysts for the production of value-added chemicals (e.g., light olefins); thus, our discovery of more thermally-stable P2 opens new avenues for exploring the potential role of this material as a high-performance catalyst.

  3. Association of the dopamine D2 receptor rs1800497 polymorphism and eating behavior in Chilean children.

    Science.gov (United States)

    Obregón, Ana M; Valladares, Macarena; Goldfield, Gary

    2017-03-01

    Studies have established a strong genetic component in eating behavior. The TaqI A1 polymorphism (rs1800497) has previously been associated with obesity and eating behavior. Additionally, this polymorphism has been associated with diminished dopamine D2 receptor (DRD2) density, higher body mass, and food reinforcement. The aim of this study was to evaluate the association between the DRD2 rs1800497 polymorphism and eating behavior in Chilean children. This was a cross-sectional study in which we selected 258 children (44% girls, 56% boys; ages 8-14 y) with a wide variation in body mass index. Anthropometric measurements were performed by standard procedures. Eating behavior was assessed using the Eating in Absence of Hunger Questionnaire (EAHQ), Child Eating Behavior Questionnaire, and the Food Reinforcement Value Questionnaire. Genotype of the rs1800497 was determined by polymerase chain reaction-restriction fragment length polymorphism. Association of the TaqI A1 variant (T allele) with eating behavior was assessed using nonparametric tests. Compared with normal-weight children, the obese group demonstrated higher scores on the External Eating and Fatigue/Boredom subscales of the EAHQ. Higher scores were assessed in Food Responsiveness, Emotional Overeating, Enjoyment to Food and Desire to Drink subscales (P Food subscale in boys. The TaqI A1 polymorphism may be a risk factor for eating behavior traits that may predispose children to greater energy intake and obesity. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Association of reduced folate carrier-1 (RFC-1) polymorphisms with ischemic stroke and silent brain infarction.

    Science.gov (United States)

    Cho, Yunkyung; Kim, Jung O; Lee, Jeong Han; Park, Hye Mi; Jeon, Young Joo; Oh, Seung Hun; Bae, Jinkun; Park, Young Seok; Kim, Ok Joon; Kim, Nam Keun

    2015-01-01

    Stroke is the second leading cause of death in the world and in South Korea. Ischemic stroke and silent brain infarction (SBI) are complex, multifactorial diseases influenced by multiple genetic and environmental factors. Moderately elevated plasma homocysteine levels are a major risk factor for vascular diseases, including stroke and SBI. Folate and vitamin B12 are important regulators of homocysteine metabolism. Reduced folate carrier (RFC), a bidirectional anion exchanger, mediates folate delivery to a variety of cells. We selected three known RFC-1 polymorphisms (-43C>T, 80A>G, 696T>C) and investigated their relationship to cerebral infarction in the Korean population. We used the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to analyze associations between the three RFC-1 polymorphisms, disease status, and folate and homocysteine levels in 584 ischemic stroke patients, 353 SBI patients, and 505 control subjects. The frequencies of the RFC-1 -43TT, 80GG, and 696CC genotypes differed significantly between the stroke and control groups. The RFC-1 80A>G substitution was also associated with small artery occlusion and SBI. In a gene-environment analysis, the RFC-1 -43C>T, 80A>G, and 696T>C polymorphisms in the ischemic stroke group had combined effects with all environmental factors. In summary, we found that the RFC-1 -43C>T, 80A>G, and 696T>C polymorphisms may be risk factors for ischemic stroke.

  5. Vitamin D Receptor gene polymorphism may predict response to vitamin D intake and bone turnover

    Directory of Open Access Journals (Sweden)

    G Ahangari

    2010-01-01

    Full Text Available "n  "n Background and the purpose of the study:The molecular and functional basis of the VDR polymorphisms is fundamental to appreciate their potential clinical implications. The rationale of this study was to determine the level of serum vitamin D response to vitamin D intake in different genotypes of VDR (FokI polymorphism and its effect on the bone turnover in postmenopausal women.  Methods:The subjects for the study were 312 pre and post-menopausal women aged between 20-75 year randomly selected from the participants of Iranian multicenter osteoporosis study. After an overnight fast, 4ml of peripheral blood was taken and centrifuged to separate serum for measurement of serum parathyroid hormone, 25 hydroxyvitamin D, osteocalcin and cross laps. The FokI polymorphism in exon 2 of the VDR gene was detected by the polymerase chain reaction-restriction fragment length polymorphism Results and major conclusion: FOKI genotype predicted serum cross laps after adjustment for age, menopausal status, serum vitamin D (p<0.001 but did not find significant prediction regarding serum osteocalcin (p=0.3.Also in this model FOKI genotype predicted serum vitamin D after adjustment for age, menopausal status, calcium and vitamin D intake (p<0.001.VDR gene polymorphism may modifies response to vitamin D intake and predicts bone turnover.   "n 

  6. Beneficial laggards: multilevel selection, cooperative polymorphism and division of labour in threshold public good games

    Directory of Open Access Journals (Sweden)

    Számadó Szabolcs

    2010-11-01

    Full Text Available Abstract Background The origin and stability of cooperation is a hot topic in social and behavioural sciences. A complicated conundrum exists as defectors have an advantage over cooperators, whenever cooperation is costly so consequently, not cooperating pays off. In addition, the discovery that humans and some animal populations, such as lions, are polymorphic, where cooperators and defectors stably live together -- while defectors are not being punished--, is even more puzzling. Here we offer a novel explanation based on a Threshold Public Good Game (PGG that includes the interaction of individual and group level selection, where individuals can contribute to multiple collective actions, in our model group hunting and group defense. Results Our results show that there are polymorphic equilibria in Threshold PGGs; that multi-level selection does not select for the most cooperators per group but selects those close to the optimum number of cooperators (in terms of the Threshold PGG. In particular for medium cost values division of labour evolves within the group with regard to the two types of cooperative actions (hunting vs. defense. Moreover we show evidence that spatial population structure promotes cooperation in multiple PGGs. We also demonstrate that these results apply for a wide range of non-linear benefit function types. Conclusions We demonstrate that cooperation can be stable in Threshold PGG, even when the proportion of so called free riders is high in the population. A fundamentally new mechanism is proposed how laggards, individuals that have a high tendency to defect during one specific group action can actually contribute to the fitness of the group, by playing part in an optimal resource allocation in Threshold Public Good Games. In general, our results show that acknowledging a multilevel selection process will open up novel explanations for collective actions.

  7. Evidences for balancing selection from PAH-BglII and PAH-EcoRI polymorphisms in Isfahan population

    Directory of Open Access Journals (Sweden)

    Zahra Fazeli Attar

    2010-01-01

    Full Text Available Two polymorphic markers including BglII and EcoRI, were identified at intron 1 and intron 5 of PAH gene. In order to test whether these polymorphisms are behaving as neutral alleles or are being subjected to selective pressures in Isfahan population, 110 individuals were genotyped by PCR-RFLP. The Arlequin input file was prepared by use of phase-known haplotype data and Neutrality tests (Tajima D test and Fu’s Fs test were done using Arlequin program. 42 individuals were found heterozygous for both polymorphisms whose haplotype phase remained unknown. The BglII-EcoRI haplotype phase was known only at 68 individuals who were used for preparation of input file. Tajima's D value and Fs value at Isfahan population were 1.7 and 1.02, respectively. Positive values of Fs and D>0 indicated that these polymorphisms are under selection pressure at Isfahan population. Although these polymorphisms were in the non-coding region of PAH gene, but these were not neutral alleles and positive values of these tests provided evidence for balancing selection of these polymorphisms at Isfahan population. The results of this study could improve our understanding of evolutionary history and structure of Isfahan population.

  8. Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines

    NARCIS (Netherlands)

    Loywyck, V.; Bed'hom, B.; Pinard-van der Laan, M.H.; Pitel, F.; Verrier, E.; Bijma, P.

    2008-01-01

    We investigated the joint evolution of neutral and selected genomic regions in three chicken lines selected for immune response and in one control line. We compared the evolution of polymorphism of 21 supposedly neutral microsatellite markers versus 30 microsatellite markers located in seven

  9. Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication

    Directory of Open Access Journals (Sweden)

    Jafari A

    1999-11-01

    Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in  Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native  fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.

  10. Microsatellite DNA polymorphism in selectively controlled Apis mellifera carnica and Apis mellifera caucasica populations from Poland

    Directory of Open Access Journals (Sweden)

    Nikolova Stanimila R.

    2015-01-01

    Full Text Available Genetic polymorphism in selectively controlled honeybee populations of A. m. carnica and A. m. caucasica in Poland, was characterized by microsatellite DNA analysis. All honeybee samples were analyzed for nine microsatellite loci: Ac011; A024; A043; A088; Ap226; Ap238; Ap243; Ap249 and Ap256, which were found to be polymorphic in both populations. The mean number of alleles per locus was 6.222 for A. m. carnica and 4.556 for A. m. caucasica. Average observed and expected heterozygosity values were calculated as 0.976 and 0.734 in A. m. carnica and as 0.933 and 0.603 in A. m. caucasica, respectively. For the nine microsatellite loci, a total of 76 alleles were found in both populations. Thirty-five private alleles were observed in A. m. carnica and 20 in A. m. caucasica. Information about allele frequencies, FST values and genotypic differentiation is given. Nei’s genetic distance between studied populations of A. m. carnica and A. m. caucasica was calculated as 0.384.

  11. A Locked Nucleic Acid Probe Based on Selective Salt-Induced Effect Detects Single Nucleotide Polymorphisms

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2015-01-01

    Full Text Available Detection of single based genetic mutation by using oligonucleotide probes is one of the common methods of detecting single nucleotide polymorphisms at known loci. In this paper, we demonstrated a hybridization system which included a buffer solution that produced selective salt-induced effect and a locked nucleic acid modified 12 nt oligonucleotide probe. The hybridization system is suitable for hybridization under room temperature. By using magnetic nanoparticles as carriers for PCR products, the SNPs (MDR1 C3435T/A from 45 volunteers were analyzed, and the results were consistent with the results from pyrophosphoric acid sequencing. The method presented in this paper differs from the traditional method of using molecular beacons to detect SNPs in that it is suitable for research institutions lacking real-time quantitative PCR detecting systems, to detect PCR products at room temperature.

  12. Polymorphism of Growth Hormone Gene in Selecting Etawah Crossbred (PE Goats

    Directory of Open Access Journals (Sweden)

    Tri Eko Susilorini

    2017-12-01

    Full Text Available Although Etawah Crossbred (PE goat is considered to be dual purpose (meat and milk goat, it is mainly raised for meat production. Since early 1990, there has been a growing interest of the farmer in some places to raise PE goat for milk production without sacrificing its role to produce kids for meat. Although milk yield of PE goat was not as high as milk yield of some other dairy goats, the ability of PE goat to cope with harsh local environment, particularly climate and feed conditions, was an advantage. Therefore, raising PE goat would still be an important part of farmer activities in the rural areas in Indonesia. Identification of the genes underlying livestock production traits leads to more efficient breeding programs and it is a promising way to improve production traits of farm animals. Growth hormone is a polypeptide hormone which is the major regulator of the metabolic procedures of growth and development and it is encoded by GH gene. The objective of this study was to detect the genetic polymorphism of GH gene in major Etawah Crossbred (PE goat using PCR-RFLP. The PCR amplified fragment were digested with HaeIII endonuclease and the result showed the presence of two genotype CC and CD. The total frequency were 47.0% and 53.0% for CC and CD genotype respectively in 94 tested goats. Statistical analysis showed that in the fragment amplified by the pair of  primer, CD genotype had significant higher birth weight and weight of 100 days old (weaning weight than CC genotype (P<0.01. In conclusion that GH gene may be a mayor gene or linked to the mayor gene to affect the weight traits and the polymorphic site could be used to select the goat weight in marker-assisted selection program.

  13. Polymorphism of the SCNN1g Gene and its Association with Eggshell Quality

    Directory of Open Access Journals (Sweden)

    Kheirkhah Z

    2017-06-01

    Full Text Available Eggshell quality is the main trait to assess egg quality. Marker assisted selection can be used to improve this trait. During eggshell formation, a mass of inorganic minerals is deposited. The Sodium Channel (SCNN1 gene family plays an essential role in cation transportation and SCNN1g is a member of this gene family. The objective of this study was to estimate the frequency of SCNN1g gene variants and to find its associations with eggshell quality in Hy-Line breed. 100 hens were randomly selected and their eggs and blood samples were collected. DNA was extracted and purified using the phenol-chloroform method and genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis. GLM procedure of SAS software was used to evaluate the association of SCNN1g gene polymorphism with egg weight, specific gravity, eggshell strength, eggshell weight, and eggshell thickness. Based on the polymorphism of SCNN1g gene, three genotypes were observed including AA, AG, and GG with frequencies of 0.26, 0.57, and 0.17, respectively. Genotype only had a significant effect on eggshell strength (P < 0.05. Other traits were not significantly influenced by genotypes of this gene. Therefore, introducing this gene in marker-assisted selection programs may improve eggshell strength of Hy-Line breed.

  14. [TATA box polymorphisms in genes of commercial and laboratory animals and plants associated with selectively valuable traits].

    Science.gov (United States)

    Suslov, V V; Ponomarenko, P M; Ponomarenko, M P; Drachkova, I A; Arshinova, T V; Savinkova, L K; Kolchanov, N A

    2010-04-01

    Most of more than 11 million experimentally established polymorphisms, accumulated in dbSNP, were identified in the intergenic spacers or coding DNA regions. This fact enables interpretation of the former polymorphisms as neutral, while the latter make clear the biological sense of the associated mutant phenotypes, "the defect of certain proteins". The association of polymorphisms in regulatory DNA regions with mutant phenotypes is poorly studied. Specifically, the defects in certain DNA/protein binding sites were identified in less than 500 cases. In TATA-containing genes of eukaryotes the TATA box, the TBP (TATA-binding protein) binding site, is located about 30 bp upstream from the transcription start site. Interaction between DNA and TBP triggers assemblage of the preinitiation complex. For 37 TATA box polymorphisms in the genes of commercial and laboratory animals and plants, the effect on TBP-binding activity was evaluated using the equilibrium equation for the four subsequent steps of TBP/TATA box binding (nonspecific binding sliding recognition stabilization). According to the GenBank data, these 37 polymorphisms were associated with the changes in a number of selectively valuable traits. Statistically significant congruence of in silico analysis performed with mutant phenotypes (a TATA box mutations in specified genes on selectively valuable traits of the species, varieties, and breeds.

  15. Trans-species polymorphism and selection in the MHC class II DRA genes of domestic sheep.

    Directory of Open Access Journals (Sweden)

    Keith T Ballingall

    Full Text Available Highly polymorphic genes with central roles in lymphocyte mediated immune surveillance are grouped together in the major histocompatibility complex (MHC in higher vertebrates. Generally, across vertebrate species the class II MHC DRA gene is highly conserved with only limited allelic variation. Here however, we provide evidence of trans-species polymorphism at the DRA locus in domestic sheep (Ovis aries. We describe variation at the Ovar-DRA locus that is far in excess of anything described in other vertebrate species. The divergent DRA allele (Ovar-DRA*0201 differs from the sheep reference sequences by 20 nucleotides, 12 of which appear non-synonymous. Furthermore, DRA*0201 is paired with an equally divergent DRB1 allele (Ovar-DRB1*0901, which is consistent with an independent evolutionary history for the DR sub-region within this MHC haplotype. No recombination was observed between the divergent DRA and B genes in a range of breeds and typical levels of MHC class II DR protein expression were detected at the surface of leukocyte populations obtained from animals homozygous for the DRA*0201, DRB1*0901 haplotype. Bayesian phylogenetic analysis groups Ovar-DRA*0201 with DRA sequences derived from species within the Oryx and Alcelaphus genera rather than clustering with other ovine and caprine DRA alleles. Tests for Darwinian selection identified 10 positively selected sites on the branch leading to Ovar-DRA*0201, three of which are predicted to be associated with the binding of peptide antigen. As the Ovis, Oryx and Alcelaphus genera have not shared a common ancestor for over 30 million years, the DRA*0201 and DRB1*0901 allelic pair is likely to be of ancient origin and present in the founding population from which all contemporary domestic sheep breeds are derived. The conservation of the integrity of this unusual DR allelic pair suggests some selective advantage which is likely to be associated with the presentation of pathogen antigen to T

  16. Trans-species polymorphism and selection in the MHC class II DRA genes of domestic sheep.

    Science.gov (United States)

    Ballingall, Keith T; Rocchi, Mara S; McKeever, Declan J; Wright, Frank

    2010-06-30

    Highly polymorphic genes with central roles in lymphocyte mediated immune surveillance are grouped together in the major histocompatibility complex (MHC) in higher vertebrates. Generally, across vertebrate species the class II MHC DRA gene is highly conserved with only limited allelic variation. Here however, we provide evidence of trans-species polymorphism at the DRA locus in domestic sheep (Ovis aries). We describe variation at the Ovar-DRA locus that is far in excess of anything described in other vertebrate species. The divergent DRA allele (Ovar-DRA*0201) differs from the sheep reference sequences by 20 nucleotides, 12 of which appear non-synonymous. Furthermore, DRA*0201 is paired with an equally divergent DRB1 allele (Ovar-DRB1*0901), which is consistent with an independent evolutionary history for the DR sub-region within this MHC haplotype. No recombination was observed between the divergent DRA and B genes in a range of breeds and typical levels of MHC class II DR protein expression were detected at the surface of leukocyte populations obtained from animals homozygous for the DRA*0201, DRB1*0901 haplotype. Bayesian phylogenetic analysis groups Ovar-DRA*0201 with DRA sequences derived from species within the Oryx and Alcelaphus genera rather than clustering with other ovine and caprine DRA alleles. Tests for Darwinian selection identified 10 positively selected sites on the branch leading to Ovar-DRA*0201, three of which are predicted to be associated with the binding of peptide antigen. As the Ovis, Oryx and Alcelaphus genera have not shared a common ancestor for over 30 million years, the DRA*0201 and DRB1*0901 allelic pair is likely to be of ancient origin and present in the founding population from which all contemporary domestic sheep breeds are derived. The conservation of the integrity of this unusual DR allelic pair suggests some selective advantage which is likely to be associated with the presentation of pathogen antigen to T-cells and the

  17. DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis

    DEFF Research Database (Denmark)

    Morling, N; Friis, J; Fugger, L

    1991-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...

  18. DNA polymorphism of HLA class II genes in primary biliary cirrhosis

    DEFF Research Database (Denmark)

    Morling, Niels; Dalhoff, K; Fugger, L

    1992-01-01

    We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary ...

  19. Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...

    African Journals Online (AJOL)

    The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...

  20. Inference of selection based on temporal genetic differentiation in the study of highly polymorphic multigene families.

    Directory of Open Access Journals (Sweden)

    Mark McMullan

    Full Text Available The co-evolutionary arms race between host immune genes and parasite virulence genes is known as Red Queen dynamics. Temporal fluctuations in allele frequencies, or the 'turnover' of alleles at immune genes, are concordant with predictions of the Red Queen hypothesis. Such observations are often taken as evidence of host-parasite co-evolution. Here, we use computer simulations of the Major Histocompatibility Complex (MHC of guppies (Poecilia reticulata to study the turnover rate of alleles (temporal genetic differentiation, G'(ST. Temporal fluctuations in MHC allele frequencies can be ≥≤order of magnitude larger than changes observed at neutral loci. Although such large fluctuations in the MHC are consistent with Red Queen dynamics, simulations show that other demographic and population genetic processes can account for this observation, these include: (1 overdominant selection, (2 fluctuating population size within a metapopulation, and (3 the number of novel MHC alleles introduced by immigrants when there are multiple duplicated genes. Synergy between these forces combined with migration rate and the effective population size can drive the rapid turnover in MHC alleles. We posit that rapid allelic turnover is an inherent property of highly polymorphic multigene families and that it cannot be taken as evidence of Red Queen dynamics. Furthermore, combining temporal samples in spatial F(ST outlier analysis may obscure the signal of selection.

  1. Genetic polymorphism and natural selection in the malaria parasite Plasmodium falciparum.

    OpenAIRE

    Escalante, A A; Lal, A A; Ayala, F J

    1998-01-01

    We have studied the genetic polymorphism at 10 Plasmodium falciparum loci that are considered potential targets for specific antimalarial vaccines. The polymorphism is unevenly distributed among the loci; loci encoding proteins expressed on the surface of the sporozoite or the merozoite (AMA-1, CSP, LSA-1, MSP-1, MSP-2, and MSP-3) are more polymorphic than those expressed during the sexual stages or inside the parasite (EBA-175, Pfs25, PF48/45, and RAP-1). Comparison of synonymous and nonsyno...

  2. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  3. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  4. AICDA single nucleotide polymorphism in common variable immunodeficiency and selective IgA deficiency.

    Science.gov (United States)

    Farhadi, E; Nemati, S; Amirzargar, A A; Hirbod-Mobarakeh, A; Nabavi, M; Soltani, S; Mahdaviani, S A; Shahinpour, S; Arshi, S; Nikbin, B; Aghamohammadi, A; Rezaei, N

    2014-01-01

    Primary antibody deficiencies (PADs) are a heterogeneous group of disorders, characterised by increased susceptibility to recurrent bacterial infections. Common variable immunodeficiency (CVID) is the most important PAD from the clinical point of view and selective IgA deficiency (IgAD) is the most common PAD. However, the underlying gene defect in both is still unknown. As a recent study in Europe showed an association between a single nucleotide polymorphism (SNP) of AICDA gene with PADs, this study was performed to evaluate such an association in Iranian patients. Fifty-eight patients with PAD, including 39 CVID and 19 IgAD, as well as 34 healthy volunteers, were enrolled in this study. Genotyping was done in all groups for an intronic SNP in AICDA (rs2580874), using real-time PCR genotyping assay. The less frequent genotype of AICDA in IgAD patients was AA, seen in 10.5% of the patients, which was much lower than the 30.8% in CVID patients and 38.2% in the controls. However, these differences were not significant. Indeed the GG genotype in the patients with PADs was seen in 20.7%, compared to 8.8% in the controls without any significant difference. There was no significant association between the previously reported genetic variant of AICDA gene and the development of CVID or IgAD, but further multi-center studies are also needed. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  5. Polymorphisms of glutathione S-transferase and methylenetetrahydrofolate reductase genes in Moldavian patients with ulcerative colitis: Genotype-phenotype correlation.

    Science.gov (United States)

    Varzari, Alexander; Deyneko, Igor V; Tudor, Elena; Turcan, Svetlana

    2016-02-01

    Glutathione S-transferases (GSTM1, GSTT1, and GSTP1) and methylenetetrahydrofolate reductase (MTHFR) are important enzymes for protection against oxidative stress. In addition, MTHFR has an essential role in DNA synthesis, repair, and methylation. Their polymorphisms have been implicated in the pathogenesis of ulcerative colitis (UC). The aim of the present study was to investigate the role of selected polymorphisms in these genes in the development of UC in the Moldavian population. In a case-control study including 128 UC patients and 136 healthy individuals, GSTM1 and GSTT1 genotypes (polymorphic deletions) were determined using multiplex polymerase chain reaction (PCR). The GSTP1 rs1695 (Ile105Val), MTHFR rs1801133 (C677T), and MTHFR rs1801131 (A1298C) polymorphisms were studied with restriction fragment length polymorphism (RFLP) analysis. Genotype-phenotype correlations were examined using logistic regression analysis. None of the genotypes, either alone or in combination, showed a strong association with UC. The case-only sub-phenotypic association analysis showed an association of the MTHFR rs1801133 polymorphism with the extent of UC under co-dominant (p corrected = 0.040) and recessive (p corrected = 0.020; OR = 0.15; CI = 0.04-0.63) genetic models. Also, an association between the MTHFR rs1801131 polymorphism and the severity of UC was reported for the over-dominant model (p corrected = 0.023; coefficient = 0.32; 95% CI = 0.10-0.54). The GST and MTHFR genotypes do not seem to be a relevant risk factor for UC in our sample. There was, however, evidence that variants in MTHFR may influence the clinical features in UC patients. Additional larger studies investigating the relationship between GST and MTHFR polymorphisms and UC are required.

  6. Association of polymorphisms in the leptin and thyroglobulin genes with meat quality and carcass traits in beef cattle

    Directory of Open Access Journals (Sweden)

    Thiago Dutra de Carvalho

    2012-10-01

    Full Text Available The objective of the present study was to estimate the allelic and genotypic frequencies of the polymorphisms E2FB (AY138588.1: c.305C> T, located in the leptin gene (LEP, and TG5 (X05380.1:g.-422C>T, located in the thyroglobulin gene (TG, and evaluate the association of these polymorphisms in crossbred cattle of seven distinct genetic groups with the following traits: slaughter weight (SW, hot carcass weight (HCW, hot carcass yield (HCY, carcass fat thickness (CFT, ribeye area (REA, marbling (MARM and shear force (SF. The animals were genotyped using the PCR-RFLP (Polymorphism Chain Reaction-Restriction Fragment Length Polymorphism technique, using 201 products obtained from F1 Caracu × Nellore, Angus × Nellore and Valdostana × Nellore cows, mated to Canchim, Caracu and Red Angus bulls (only Caracu × Nellore cows were used with Red Angus bulls. The allelic and genotypic frequencies were compared using the Chi-squared test. Associations between the genotype of each polymorphism and the traits were analyzed using the General Linear Model (GLM of statistical software SAS. The least squares means of genotypes of the polymorphisms were compared using Student's t test. The E2FB polymorphism in the LEP gene was associated with CFT, showing the potential for use in national programs for genetic improvement of beef cattle, through the inclusion of SNP in genotyping commercial tests. The TG5 polymorphism in the TG gene was not associated with any of the evaluated traits and was considered ineffective for selection of beef cattle in Brazilian herds.

  7. Restriction site polymorphisms in the pig beta-globin gene cluster.

    Science.gov (United States)

    Rando, A; Masina, P

    1985-01-01

    A restriction fragment length polymorphism was detected in pig DNA digested with Hind III restriction endonuclease and probed with rabbit beta 1-globin gene. Eight different phenotypes were observed and for six of them family data demonstrated that they are determined by three alleles. As this polymorphism is not found with four other restriction endonucleases (Bam HI, Eco RI, Kpn I, and Pst I), single point mutations are proposed to explain the observed differences.

  8. Carbonate mineralization via an amorphous calcium carbonate (ACC) pathway: Tuning polymorph selection by Mg, pH, and mixing environment

    Science.gov (United States)

    Dove, P. M.; Blue, C.; Mergelsberg, S. T.; Giuffre, A. J.; Han, N.; De Yoreo, J. J.

    2017-12-01

    Mineral formation by nonclassical processes is widespread with many pathways that include aggregation of nanoparticles, oriented attachment of fully formed crystals, and sequential nucleation/transformation of amorphous phases (De Yoreo et al., 2015, Science). Field observations indicate amorphous calcium carbonate (ACC) can be the initial precipitate when local conditions promote high supersaturations for short time periods. Examples include microbial mats, marine porewaters that undergo pulses of increased alkalinity, closed basin lakes, and sabkhas. The crystalline products exhibit diverse morphologies and complex elemental and isotopic signatures. This study quantifies relationships between solution composition and the crystalline polymorphs that transform from ACC (Blue et al., GCA, 2017). Our experimental design synthesized ACC under controlled conditions for a suite of compositions by tuning input pH, Mg/Ca, and total carbonate concentration. ACC products were allowed to transform within output suspensions under stirred or quiescent mixing while characterizing the polymorph and composition of evolving solutions and solids. We find that ACC transforms to crystalline polymorphs with a systematic relationship to solution composition to give a quantitative framework based upon solution aMg2+/aCa2+ and aCO32-/aCa2+. We also measure a polymorph-specific evolution of pH and Mg/Ca during the transformation that indicates the initial polymorph to form. Pathway is further modulated by stirring versus quiescent conditions. The findings reconcile discrepancies among previous studies of ACC to crystalline products and supports claims that monohydrocalcite may be an overlooked, transient phase during formation of some aragonite and calcite deposits. Organic additives and extreme pH are not required to tune composition and polymorph. Insights from this study reiterate the need to revisit long-standing dogmas regarding controls on CaCO3 polymorph selection. Classical models

  9. Drift, admixture, and selection in human evolution: a study with DNA polymorphisms.

    OpenAIRE

    Bowcock, A M; Kidd, J R; Mountain, J L; Hebert, J M; Carotenuto, L; Kidd, K K; Cavalli-Sforza, L L

    1991-01-01

    Accuracy of evolutionary analysis of populations within a species requires the testing of a large number of genetic polymorphisms belonging to many loci. We report here a reconstruction of human differentiation based on 100 DNA polymorphisms tested in five populations from four continents. The results agree with earlier conclusions based on other classes of genetic markers but reveal that Europeans do not fit a simple model of independently evolving populations with equal evolutionary rates. ...

  10. Geography and genography: prediction of continental origin using randomly selected single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramoni Marco F

    2007-03-01

    Full Text Available Abstract Background Recent studies have shown that when individuals are grouped on the basis of genetic similarity, group membership corresponds closely to continental origin. There has been considerable debate about the implications of these findings in the context of larger debates about race and the extent of genetic variation between groups. Some have argued that clustering according to continental origin demonstrates the existence of significant genetic differences between groups and that these differences may have important implications for differences in health and disease. Others argue that clustering according to continental origin requires the use of large amounts of genetic data or specifically chosen markers and is indicative only of very subtle genetic differences that are unlikely to have biomedical significance. Results We used small numbers of randomly selected single nucleotide polymorphisms (SNPs from the International HapMap Project to train naïve Bayes classifiers for prediction of ancestral continent of origin. Predictive accuracy was tested on two independent data sets. Genetically similar groups should be difficult to distinguish, especially if only a small number of genetic markers are used. The genetic differences between continentally defined groups are sufficiently large that one can accurately predict ancestral continent of origin using only a minute, randomly selected fraction of the genetic variation present in the human genome. Genotype data from only 50 random SNPs was sufficient to predict ancestral continent of origin in our primary test data set with an average accuracy of 95%. Genetic variations informative about ancestry were common and widely distributed throughout the genome. Conclusion Accurate characterization of ancestry is possible using small numbers of randomly selected SNPs. The results presented here show how investigators conducting genetic association studies can use small numbers of arbitrarily

  11. The role of thermal niche selection in maintenance of a colour polymorphism in redback salamanders (Plethodon cinereus

    Directory of Open Access Journals (Sweden)

    Niewiarowski Peter H

    2006-07-01

    Full Text Available Abstract Background In eastern North America two common colour morphs exist in most populations of redback salamanders (Plethodon cinereus. Previous studies have indicated that the different morphs may be adapted to different thermal niches and the morphological variation has been linked to standard metabolic rate at 15°C in one population of P. cinereus. It has therefore been hypothesized that a correlated response to selection on metabolic rate across thermal niches maintains the colour polymorphism in P. cinereus. This study tests that hypothesis. Results We found that the two colour morphs do sometimes differ in their maintenance metabolic rate (MMR profiles, but that the pattern is not consistent across populations or seasons. We also found that when MMR profiles differ between morphs those differences do not indicate that distinct niches exist. Field censuses showed that the two colour morphs are sometimes found at different substrate temperatures and that this difference is also dependent on census location and season. Conclusion While these morphs sometimes differ in their maintenance energy expenditures, the differences in MMR profile in this study are not consistent with maintenance of the polymorphism via a simple correlated response to selection across multiple niches. When present, differences in MMR profile do not indicate the existence of multiple thermal niches that consistently mirror colour polymorphism. We suggest that while a relationship between colour morph and thermal niche selection appears to exist it is neither simple nor consistent.

  12. Association of vitamin D receptor gene polymorphisms with polycystic ovary syndrome among Indian women

    Directory of Open Access Journals (Sweden)

    Shilpi Dasgupta

    2015-01-01

    Full Text Available Background & objectives: The Vitamin-D receptor (VDR regulates vitamin D levels and calcium metabolism in the body and these are known to be associated with endocrine dysfunctions, insulin resistance and type-2 diabetes in polycystic ovarian syndrome (PCOS. Studies on VDR polymorphisms among PCOS women are sparse. We undertook this study to investigate the association pattern of VDR polymorphisms (Cdx2, Fok1, Apa1 and Taq1 with PCOS among Indian women. Methods: For the present study, 250 women with PCOS and 250 normal healthy control women were selected from Hyderabad city, Telangana, India. The four VDR polymorphisms were genotyped and analysed using ASM-PCR (allele specific multiple PCR and PCR-RFLP (restriction fragment length polymorphism. Results: The genotype and allele frequency distributions of only Cdx2 showed significant difference between the PCOS cases and control women, indicating protective role of this SNP against PCOS phenotype. However, significant association was observed between VDR genotypes and some of the PCOS specific clinical/biochemical traits. For example, Fok1 showed a significant genotypic difference for the presence of infertility and Cdx2 genotpes showed association with testosterone levels. Further, the two haplotypes, ACCA and ACTA, were found to be significantly associated with PCOS indicating haplotype specific risk. Interpretation & conclusions: Although VDR polymorphisms have not shown significant association with PCOS, in view of functional significance of the SNPs considered, one cannot yet rule out the possibility of their association with PCOS. Further, specifically designed studies on large cohorts are required to conclusively establish the role of VDR polymorphisms in PCOS, particularly including data on vitamin D levels.

  13. Differential distribution and association of FTO rs9939609 gene polymorphism with obesity: A cross-sectional study among two tribal populations of India with East-Asian ancestry.

    Science.gov (United States)

    Ningombam, Somorjit Singh; Chhungi, Varhlun; Newmei, Masan Kambo; Rajkumari, Sunanda; Devi, Naorem Kiranmala; Mondal, Prakash Ranjan; Saraswathy, Kallur Nava

    2018-03-20

    The fat mass and obesity associated (FTO) rs9939609 gene polymorphism is most widely studied in terms of obesity in various populations. Recently, the prevalence of obesity has been reported to be very high among the North-Eastern State of India. The major aim of the present study is to understand the extent of FTO rs9939609 gene polymorphism and its association with obesity among the two North-East Indian tribal populations with similar East Asian ancestry. Somatometric data and fasting blood sample were collected from 521 tribal individuals (258 Liangmai and 263 Mizo) of Manipur after obtaining written informed consent. Genotyping of FTO rs9939609 single nucleotide polymorphism (SNP) was done using restriction fragment length polymorphism method for PCR-amplified fragments. Both the presently studied populations were not following Hardy-Weinberg law. The prevalence of obesity and minor allele frequency of FTO rs9939609 polymorphism was found to be significantly higher among the Mizo tribe compared to that of Liangmai. The selected polymorphism was found to be significantly associated with obesity (BMI) only among the Liangmai tribe (Odds ratio-3.0; 95% CI-1.4, 6.4; p-0.003), after adjusting for age and occupation. Age-cohort wise distribution and absolute fitness analysis indicated the lower fitness of minor allele in the higher age group among the Liangmai tribe. To the best of the author's knowledge this is the first study, associating FTO rs9939609 gene polymorphism and obesity in the North-eastern Indian tribal populations with East-Asian ancestry. This study revealed the FTO rs9939609 polymorphism is observed to be associated with obesity only among the Liangmai tribe not among the Mizo tribe. The differential distribution and association observed in the two selected tribes, inhabited in a similar geographical region, could be attributed to differences in their migratory histories in terms of both route and time of settlement. Copyright © 2018 Elsevier B

  14. Immunogenetics of rheumatoid arthritis and primary Sjögren's syndrome: DNA polymorphism of HLA class II genes

    DEFF Research Database (Denmark)

    Morling, Niels; Andersen, V; Fugger, L

    1992-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the Major Histocompatability Complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DFB in 24 patients with rheumatoid arthritis (RA), in 19 patients with primary Sjögren's syndrome (primary SS), and healthy Danes. T...

  15. Multi-generational imputation of single nucleotide polymorphism marker genotypes and accuracy of genomic selection.

    Science.gov (United States)

    Toghiani, S; Aggrey, S E; Rekaya, R

    2016-07-01

    Availability of high-density single nucleotide polymorphism (SNP) genotyping platforms provided unprecedented opportunities to enhance breeding programmes in livestock, poultry and plant species, and to better understand the genetic basis of complex traits. Using this genomic information, genomic breeding values (GEBVs), which are more accurate than conventional breeding values. The superiority of genomic selection is possible only when high-density SNP panels are used to track genes and QTLs affecting the trait. Unfortunately, even with the continuous decrease in genotyping costs, only a small fraction of the population has been genotyped with these high-density panels. It is often the case that a larger portion of the population is genotyped with low-density and low-cost SNP panels and then imputed to a higher density. Accuracy of SNP genotype imputation tends to be high when minimum requirements are met. Nevertheless, a certain rate of genotype imputation errors is unavoidable. Thus, it is reasonable to assume that the accuracy of GEBVs will be affected by imputation errors; especially, their cumulative effects over time. To evaluate the impact of multi-generational selection on the accuracy of SNP genotypes imputation and the reliability of resulting GEBVs, a simulation was carried out under varying updating of the reference population, distance between the reference and testing sets, and the approach used for the estimation of GEBVs. Using fixed reference populations, imputation accuracy decayed by about 0.5% per generation. In fact, after 25 generations, the accuracy was only 7% lower than the first generation. When the reference population was updated by either 1% or 5% of the top animals in the previous generations, decay of imputation accuracy was substantially reduced. These results indicate that low-density panels are useful, especially when the generational interval between reference and testing population is small. As the generational interval

  16. Detection of DGAT1 gene polymorphism and its effect on selected biochemical indicators in dairy cows after calving

    Directory of Open Access Journals (Sweden)

    Lenka Lešková

    2013-01-01

    Full Text Available The aim of the study was to detect DGAT1 K232A polymorphism in 57 dairy cows of the Slovak Spotted breed and its crossbreds, and to assess possible effect of the given polymorphism on selected metabolic indices in blood serum after calving. Using the PCR-RFLP method with improved primers enabling better differentiation of genotypes we identified 45 homozygotes for alanine variant in this locus (AA genotype, 2 homozygotes for lysine variant (KK genotype, and 10 heterozygotes (AK genotype. Genotype frequencies were 0.790 for AA genotype, 0.175 for AK genotype, and only 0.035 for KK genotype. Allele frequencies were counted as 0.877 for A allele and 0.123 for K allele. In both groups of animals (AA and AK genotype increased mean values above the upper reference limit of lactate dehydrogenase, and total bilirubin, and decreased levels below the lower reference limit of triglycerides were detected. In the group of animals with AA genotype we also noticed decreased levels of non-esterified fatty acids. On the other hand, increased serum concentrations of total immunoglobulins were found in animals with AK and KK genotype. This is the first study concerning DGAT1 polymorphism in the Slovak Spotted breed and its association with selected biochemical indicators.

  17. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

    Science.gov (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

    2016-01-01

    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  18. Role of selected polymorphisms in determining muscle fiber composition in Japanese men and women.

    Science.gov (United States)

    Kumagai, Hiroshi; Tobina, Takuro; Ichinoseki-Sekine, Noriko; Kakigi, Ryo; Tsuzuki, Takamasa; Zempo, Hirofumi; Shiose, Keisuke; Yoshimura, Eiichi; Kumahara, Hideaki; Ayabe, Makoto; Higaki, Yasuki; Yamada, Ryo; Kobayashi, Hiroyuki; Kiyonaga, Akira; Naito, Hisashi; Tanaka, Hiroaki; Fuku, Noriyuki

    2018-01-18

    Genetic polymorphisms and sex differences are suggested to affect muscle fiber composition; however, no study has investigated the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences. Therefore, the present study examined the effects of genetic polymorphisms on muscle fiber composition with respect to sex differences in Japanese population. The present study included 211 healthy Japanese individuals (102 men and 109 women). Muscle biopsies were obtained from the vastus lateralis to determine the proportion of myosin heavy chain isoforms (MHC-I, MHC-IIa, and MHC-IIx). Moreover, we analysed polymorphisms in ACTN3 (rs1815739), ACE (rs4341), HIF1A (rs11549465), VEGFR2 (rs1870377), and AGTR2 (rs11091046) by TaqMan SNP genotyping assays. The proportion of MHC-I was 9.8% lower in men than in women, whereas the proportion of MHC-IIa and MHC-IIx was higher in men than in women (5.0% and 4.6%, respectively). Men with ACTN3 RR+RX genotype had 4.8% higher proportion of MHC-IIx than those with ACTN3 XX genotype. Moreover, men with ACE ID+DD genotype had 4.7% higher proportion of MHC-I than those with ACE II genotype. Furthermore, combined genotype of ACTN3 R577X and ACE I/D was significantly correlated with proportion of MHC-I (r = -0.23) and MHC-IIx (r = 0.27) in men. In contrast, no significant correlation was observed between the examined polymorphisms and muscle fiber composition in women. These results suggest that the ACTN3 R577X and ACE I/D polymorphisms independently affect the proportion of human skeletal muscle fibers MHC-I and MHC-IIx in men but not in women.

  19. Assessment of protein tyrosine phosphatases number 22 polymorphism prevalence among rheumatoid arthritis patients: A study on Iranian patients

    Directory of Open Access Journals (Sweden)

    Mansour Salesi

    2014-01-01

    Full Text Available Background: It has been proposed that Trp (620 allotype of protein tyrosine phosphatases number 22 (PTPN22 gene can intensify the susceptibility to rheumatoid arthritis (RA and other autoimmune diseases. Thus, in this study, the prevalence of this polymorphism has been surveyed among RA patients compared with healthy persons. The samples were selected from Isfahan province (one of the most populated area of Iran. Materials and Methods: In this study, 100 patients (case group and 100 healthy persons (control group were participated voluntarily. The case group was selected from people who had referred to the rheumatology clinic of AlZahra University Hospital to follow-up their treatment and change their drugs dosage. The control group members, who were living in Isfahan province, mutually had similar age with patients. On a total, 22% of the case group was male and 75% of the control group was female. DNA was extracted from the blood sample of all cases and controls and the PTPN22 single nucleotide polymorphism (SNP C1858> T gene polymorphism were studied using the polymerase chain reaction-restriction fragment length polymorphism method. Results: PTPN22 SNP C1858> T gene polymorphism was observed in 11 persons (11% of the case group and 8 persons (8% of the control group. Conclusion: The results show that the difference was not statistically significant in Isfahan RA population (P = 0.47; OR = 1.42; 95% CI 0.55-3.69. Although, another study on Iranian population had shown that this polymorphism confers susceptibility to RA.

  20. Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Patrícia Carvalho de Sequeira

    2005-11-01

    Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  1. Analysis of polymorphisms and selective pressures on ama1gene in ...

    Indian Academy of Sciences (India)

    The apical membrane antigen-1 (AMA-1) of Plasmodium spp. is a merozoite surface antigen that is essential for the recognition and invasion of erythrocytes. Polymorphisms occurring in this surface antigen will cause major obstacles in developing effective malaria vaccines based on AMA-1. The objective of this study was ...

  2. Molecular marker-assisted selection for resistance to pathogens in tomato

    International Nuclear Information System (INIS)

    Barone, A.; Frusciante, L.

    2007-01-01

    Since the 1980s, the use of molecular markers has been suggested to improve the efficiency of releasing resistant varieties, thus overcoming difficulties met with classical breeding. For tomato, a high-density molecular map is available in which more than 40 resistance genes are localized. Markers linked to these genes can be used to speed up gene transfer and pyramiding. Suitable PCR markers targeting resistance genes were constructed directly on the sequences of resistance genes or on restriction fragment length polymorphisms (RFLPs) tightly linked to them, and used to select resistant genotypes in backcross schemes. In some cases, the BC 5 generation was reached, and genotypes that cumulated two homozygous resistant genes were also obtained. These results supported the feasibility of using marker-assisted selection (MAS) in tomato and reinforcing the potential of this approach for other genes, which is today also driven by the development of new techniques and increasing knowledge about the tomato genome. (author)

  3. Selection Component Analysis of Natural Polymorphisms using Population Samples Including Mother-Offspring Combinations, II

    DEFF Research Database (Denmark)

    Jarmer, Hanne Østergaard; Christiansen, Freddy Bugge

    1981-01-01

    Population samples including mother-offspring combinations provide information on the selection components: zygotic selection, sexual selection, gametic seletion and fecundity selection, on the mating pattern, and on the deviation from linkage equilibrium among the loci studied. The theory...

  4. Lack of association between brain-derived neurotrophic factor Val66Met polymorphism and aggressive behavior in schizophrenia.

    Science.gov (United States)

    Guan, Xuan; Dong, Zai-Quan; Tian, Yuan-Yuan; Wu, Li-Na; Gu, Yan; Hu, Ze-Qing; Zhang, Xiao

    2014-01-30

    We investigated the association of the Val66Met gene polymorphism in the Brain-Derived Neurotrophic Factor (BDNF) gene with aggressive behavior among Southern Han Chinese schizophrenia patients. We used polymerase chain reaction-restriction fragment length polymorphism to determine the genotypes and the Modified Overt Aggression Scale (MOAS) to measure aggressive behavior. No significant differences in genotype or allele distribution of Val66Met were identified between aggressive and non-aggressive schizophrenia patients. © 2013 Published by Elsevier Ireland Ltd.

  5. Natural Selection and Recombination Rate Variation Shape Nucleotide Polymorphism Across the Genomes of Three Related Populus Species.

    Science.gov (United States)

    Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K

    2016-03-01

    A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. Copyright © 2016 by the Genetics Society of America.

  6. Analysis of polymorphisms and selective pressures on ama1 gene in Plasmodium knowlesi isolates from Sabah, Malaysia.

    Science.gov (United States)

    Chua, Chuen Yang; Lee, Ping Chin; Lau, Tiek Ying

    2017-09-01

    The apical membrane antigen-1 (AMA-1) of Plasmodium spp. is a merozoite surface antigen that is essential for the recognition and invasion of erythrocytes. Polymorphisms occurring in this surface antigen will cause major obstacles in developing effective malaria vaccines based on AMA-1. The objective of this study was to characterize ama1 gene in Plasmodium knowlesi isolates from Sabah. DNA was extracted from blood samples collected from Keningau, Kota Kinabalu and Kudat. The Pkama1 gene was amplified using nested PCR and subjected to bidirectional sequencing. Analysis of DNA sequence revealed that most of the nucleotide polymorphisms were synonymous and concentrated in domain I of PkAMA-1. Forteen haplotypes were identified based on amino acid variations and haplotype K5 was the most common haplotype. d N /d S ratios implied that purifying selection was prevalent in Pkama1 gene. Fu and Li's D and F values further provided evidence of negative selection acting on domain II of Pkama1. Lownucleotide diversitywas also detected for the Pkama1 sequences,which is similar to reports on Pkama1 from Peninsular Malaysia and Sarawak. The presence of purifying selection and low nucleotide diversity indicated that domain II of Pkama1 can be used as a target for vaccine development.

  7. DNA polymorphism at the casein loci in sheep.

    Science.gov (United States)

    Di Gregorio, P; Rando, A; Pieragostini, E; Masina, P

    1991-01-01

    By using seven endonucleases and four bovine cDNA probes specific for alpha S1-, alpha S2-, beta-, and kappa-casein genes, nine restriction fragment length polymorphisms (RFLPs) have been found in the sheep orthologous DNA regions. In contrast to the low level of variation observed at the protein level, these DNA polymorphisms determine a high level of heterozygosity and, therefore, represent useful tools for genetic analyses since they can also be obtained without the need for gene expression. In fact, informative matings suggest that in sheep, as in cattle, the four loci are linked.

  8. Association of Pro12Ala polymorphism of PPAR-γ2 Gene and diabetic retinopathy in type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Yong-Qing Liu

    2013-06-01

    Full Text Available AIM: To observe the relationship between Prol2Ala polymorphism of peroxisome proliferator activated receptor-γ2(PPAR-γ2gene and diabetic retinopathy(DRwith type 2 diabetic mellitus(T2DMof the Han nationality in Shanxi province. METHODS: Totally 90 patients with T2DM were selected into our research, who were at the age of 40 to 70 years old, diabetic duration from 10 to 20 years, blood pressure PPAR-γ2 gene were determined by polymerase chain reaction-restriction fragment length polymorphisms(PCR-RFLPassay in all the patients. RESULTS: PCR results showed that there were 2 alleles and 3 genotypes in the groups. The frequency of genotype PP, PA, AA were 40.0%, 53.3%, 6.7% in NDR group, 70.0%, 30.0%, 0.0% in BDR group, 76.7%, 23.3%, 0% in PDR group, respectively. The allele frequency(χ2=10.208and gene frequency(χ2=10.351were statistically significant(PCONCLUSION: The alanine variant of Prol2Ala polymorphism of PPAR-γ2 gene is associated with DR in type 2 diabetes among the Hans in Shanxi area, and the Ala allele might be a protective factor for the development of diabetic retinopathy.

  9. Association of phospholipase A2 receptor 1 polymorphisms with idiopathic membranous nephropathy in Chinese patients in Taiwan

    Directory of Open Access Journals (Sweden)

    Liao Wen-Ling

    2010-10-01

    Full Text Available Abstract Background Idiopathic membranous nephropathy (IMN is one of the most common forms of autoimmune nephritic syndrome in adults. The purpose of this study is to evaluate whether polymorphisms of PLA2R1 affect the development of IMN. Methods Taiwanese-Chinese individuals (129 patients with IMN and 106 healthy controls were enrolled in this study. The selected single nucleotide polymorphisms (SNPs in PLA2R1 were genotyped by real-time polymerase chain reaction using TaqMan fluorescent probes, and were further confirmed by polymerase chain reaction-restriction fragment length polymorphism. The roles of the SNPs in disease progression were analyzed. Results Genotype distribution was significantly different between patients with IMN and controls for PLA2R1 SNP rs35771982 (p = 0.015. The frequency of G allele at rs35771982 was significantly higher in patients with IMN as compared with controls (p = 0.005. In addition, haplotypes of PLA2R1 may be used to predict the risk of IMN (p = 0.004. Haplotype H1 plays a role in an increased risk of IMN while haplotype H3 plays a protective role against this disease. None of these polymorphisms showed a significant and independent influence on the progression of IMN and the risk of end-stage renal failure and death (ESRF/death. High disease progression in patients having C/T genotype at rs6757188 and C/G genotype at rs35771982 were associated with a low rate of remission. Conclusions Our results provide new evidence that genetic polymorphisms of PLA2R1 may be the underlying cause of IMN, and the polymorphisms revealed by this study warrant further investigation.

  10. Unusual scarcity of restriction site polymorphism in the human thyroglobulin gene. A linkage study suggesting autosomal dominance of a defective thyroglobulin allele

    NARCIS (Netherlands)

    Baas, F.; Bikker, H.; van Ommen, G. J.; de Vijlder, J. J.

    1984-01-01

    Chromosomal DNA prepared from 90 unrelated individuals, mainly of Caucasian origin, was screened for restriction fragment length polymorphisms in the 3' 220 kilobase pairs (kb) of the human thyroglobulin (Tg) gene. The probes used were Tg cDNA fragments and subcloned single-copy genomic segments,

  11. A large-scale population-based study of the association of vitamin D receptor gene polymorphisms with bone mineral density.

    NARCIS (Netherlands)

    P.L.A. van Dalen; C.M. van Duijn (Cornelia); J.C. Birkenhäger (Jan); J.P.T.M. van Leeuwen (Hans); H.A.P. Pols (Huib); A.G. Uitterlinden (André); A. Hofman (Albert)

    1996-01-01

    textabstractConflicting results have been reported on the association between restriction fragment length polymorphisms (RFLPs) at the vitamin D receptor (VDR) gene locus (i.e., for BsmI, ApaI, and TaqI) and bone mineral density (BMD). We analyzed this association in a large population-based sample

  12. 5-HTTLPR polymorphism is linked to neural mechanisms of selective attention in preschoolers from lower socioeconomic status backgrounds.

    Science.gov (United States)

    Isbell, Elif; Stevens, Courtney; Hampton Wray, Amanda; Bell, Theodore; Neville, Helen J

    2016-12-01

    While a growing body of research has identified experiential factors associated with differences in selective attention, relatively little is known about the contribution of genetic factors to the skill of sustained selective attention, especially in early childhood. Here, we assessed the association between the serotonin transporter linked polymorphic region (5-HTTLPR) genotypes and the neural mechanisms of selective attention in young children from lower socioeconomic status (SES) backgrounds. Event-related potentials (ERPs) were recorded during a dichotic listening task from 121 children (76 females, aged 40-67 months), who were also genotyped for the short and long allele of 5-HTTLPR. The effect of selective attention was measured as the difference in ERP mean amplitudes elicited by identical probe stimuli embedded in stories when they were attended versus unattended. Compared to children homozygous for the long allele, children who carried at least one copy of the short allele showed larger effects of selective attention on neural processing. These findings link the short allele of the 5-HTTLPR to enhanced neural mechanisms of selective attention and lay the groundwork for future studies of gene-by-environment interactions in the context of key cognitive skills. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. 5-HTTLPR polymorphism is linked to neural mechanisms of selective attention in preschoolers from lower socioeconomic status backgrounds

    Directory of Open Access Journals (Sweden)

    Elif Isbell

    2016-12-01

    Full Text Available While a growing body of research has identified experiential factors associated with differences in selective attention, relatively little is known about the contribution of genetic factors to the skill of sustained selective attention, especially in early childhood. Here, we assessed the association between the serotonin transporter linked polymorphic region (5-HTTLPR genotypes and the neural mechanisms of selective attention in young children from lower socioeconomic status (SES backgrounds. Event-related potentials (ERPs were recorded during a dichotic listening task from 121 children (76 females, aged 40–67 months, who were also genotyped for the short and long allele of 5-HTTLPR. The effect of selective attention was measured as the difference in ERP mean amplitudes elicited by identical probe stimuli embedded in stories when they were attended versus unattended. Compared to children homozygous for the long allele, children who carried at least one copy of the short allele showed larger effects of selective attention on neural processing. These findings link the short allele of the 5-HTTLPR to enhanced neural mechanisms of selective attention and lay the groundwork for future studies of gene-by-environment interactions in the context of key cognitive skills.

  14. Associations of TGFBR1 and TGFBR2 gene polymorphisms with the risk of hypospadias: a case-control study in a Chinese population.

    Science.gov (United States)

    Han, Xin-Rui; Wen, Xin; Wang, Shan; Hong, Xiao-Wu; Fan, Shao-Hua; Zhuang, Juan; Wang, Yong-Jian; Zhang, Zi-Feng; Li, Meng-Qiu; Hu, Bin; Shan, Qun; Sun, Chun-Hui; Bao, Ya-Xing; Lin, Meng; He, Tan; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

    2017-10-31

    This case-control study investigated the association of transforming growth factor-β (TGF-β) receptor type I and II ( TGFBR1 and TGFBR2 ) gene polymorphisms with the risk of hypospadias in a Chinese population. One hundred and sixty two patients suffering from hypospadias were enrolled as case group and 165 children who underwent circumcision were recruited as control group. Single nucleotide polymorphisms (SNPs) in TGFBR1 and TGFBR2 genes were selected on the basis of genetic data obtained from HapMap. PCR-restriction fragment length polymorphism (PCR-RFLP) was performed to identify TGFBR1 and TGFBR2 gene polymorphisms and analyze genotype distribution and allele frequency. Logistic regression analysis was conducted to estimate the risk factors for hypospadias. No significant difference was found concerning the genotype and allele frequencies of TGFBR1 rs4743325 polymorphism between the case and control groups. However, genotype and allele frequencies of TGFBR2 rs6785358 in the case group were significantly different in contrast with those in the control group. Patients carrying the G allele of TGFBR2 rs6785358 polymorphism exhibited a higher risk of hypospadias compared with the patients carrying the A allele ( P <0.05). The TGFBR2 rs6785358 genotype was found to be significantly related to abnormal pregnancy and preterm birth (both P <0.05). The frequency of TGFBR2 rs6785358 GG genotype exhibited significant differences amongst patients suffering from four different pathological types of hypospadias. Logistic regression analysis revealed that preterm birth, abnormal pregnancy, and TGFBR2 rs6785358 were the independent risk factors for hypospadias. Our study provides evidence that TGFBR2 rs6785358 polymorphism might be associated with the risk of hypospadias. © 2017 The Author(s).

  15. A Manganese Superoxide Dismutase (SOD2 Gene Polymorphism in Insulin-Dependent Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Flemming Pociot

    1993-01-01

    Full Text Available Interleukin I (lL-I is selectively cytotoxic to the insulin producing beta cell of pancreatic islets. This effect may be due to IL-I induced generation of reactive oxygen species and nitric oxide. Since beta cells contain low amounts of the superoxide radical scavenger enzyme manganese superoxide dismutase (MnSOD, this may leave beta cells more susceptible to IL-I than other cell types. Genetic variation in the MnSOD locus could reflect differences in scavenger potential. We, therefore, studied possible restriction fragment length polymorphisms (RFLPs of this locus in patients with insulin-dependent diabetes mellitus (100M (n= 154 and control individuals (n=178, Taql revealed a double diallelic RFLP in patients as well as in controls. No overall difference in allelic or genotype frequencies were observed between 100M patients and control individuals (p=0.11 and no significant association of any particular RFLP pattern with 100M was found. Structurally polymorphic MnSOD protein variants with altered activities have been reported. If genetic variation results in MnSOD variants with reduced activities, the MnSOD locus may still be a candidate gene for 100M susceptibility. Whether the RFLPs reported in this study reflects differences in gene expression level, protein level and/or specific activity of the protein is yet to be studied.

  16. Compatibility of selected plant-based shortening as lard substitute: microstructure, polymorphic forms and textural properties

    Directory of Open Access Journals (Sweden)

    N. A.M. Yanty

    2017-03-01

    Full Text Available A study was carried out to determine the compatibility of three plant-based shortening mixtures to lard shortening (LD in terms of microstructure, polymorphic forms, and textural properties. The shortenings of binary, ternary, and quaternary fat mixtures were prepared according to a standard procedure by blending mee fat (MF with palm stearin (PS in a 99:1 (w/w ratio; avocado fat (Avo with PS and cocoa butter (CB in a 84:7:9 (w/w ratio; palm oil (PO with PS, soybean oil (SBO and CB in a 38:5:52:5 (w/w ratio, respectively. The triacylglycerol composition, polymorphic forms, crystal morphology, and textural properties of the shortening were evaluated. This study found that all three plant-based shortenings and LD shortening were similar with respect to their consistency, hardness and compression and adhesiveness values. However, all plant-based shortening was found to be dissimilar to LD shortening with respect to microstructure.

  17. Compatibility of selected plant-based shortening as lard substitute: microstructure, polymorphic forms and textural properties

    International Nuclear Information System (INIS)

    Yanty, N.A.M.; Marikkar, J.M.N.; Miskandar, M.S.; Bockstaele, F. Van; Dewettinck, K.; Nusantoro, B.P.

    2017-01-01

    A study was carried out to determine the compatibility of three plant-based shortening mixtures to lard shortening (LD) in terms of microstructure, polymorphic forms, and textural properties. The shortenings of binary, ternary, and quaternary fat mixtures were prepared according to a standard procedure by blending mee fat (MF) with palm stearin (PS) in a 99:1 (w/w) ratio; avocado fat (Avo) with PS and cocoa butter (CB) in a 84:7:9 (w/w) ratio; palm oil (PO) with PS, soybean oil (SBO) and CB in a 38:5:52:5 (w/w) ratio, respectively. The triacylglycerol composition, polymorphic forms, crystal morphology, and textural properties of the shortening were evaluated. This study found that all three plant-based shortenings and LD shortening were similar with respect to their consistency, hardness and compression and adhesiveness values. However, all plant-based shortening was found to be dissimilar to LD shortening with respect to microstructure. [es

  18. CYP1A1 MspI Polymorphism and Cervical Carcinoma Risk in the Multi-Ethnic Population of Malaysia: a Case-Control Study.

    Science.gov (United States)

    Tan, Yee Hock; Sidik, Shiran Mohd; Syed Husain, Sharifah Noor Akmal; Lye, Munn Sann; Chong, Pei Pei

    2016-01-01

    Tobacco smoking is considered a risk factor for cervical cancer development due to the presence of tobacco based carcinogenic metabolites in cervical cells of female smokers. In this study, we investigated the role of the T3801C (MspI) polymorphism of CYP1A1, a gene encoding an enzyme necessary for the initiation of tobacco based carcinogen metabolism, on cervical cancer risk. The T to C substitution may alter CYP1A1 activities, potentially elevating cervical cancer risk. Since results of gene-disease association studies vary according to the study population, the multi-ethnic population of Malaysia provides an excellent representative cohort for identifying and comparing the cervical cancer risk among the 3 major ethnics in Southeast Asia in relation to CYP1A1 MspI polymorphism. A total of 195 Thin Prep Pap smear samples from HPV negative and cancer free females were randomly selected as controls while 106 formalin fixed paraffin embedded samples from females with invasive cervical cancer were randomly selected for the cases group. The polymorphisms were identified using restriction fragment length polymorphism (RFLP) PCR. We found no significant associations between CYP1A1 MspI polymorphism and cervical cancer in the general Malaysian female population. However, upon ethnic stratification, the variant C/C genotype was significantly associated with a 4.66-fold increase in cervical cancer risk in Malay females (95% CI= 1.21-17.9; p=0.03). No significant association was observed in the Chinese and Indian females. Additionally, there were no significant associations in the dominant model and allele frequency model analysis in both the general and ethnically stratified female population of Malaysia. Our findings suggest that the C/C genotype of CYP1A1 MspI polymorphism is associated with the development of cervical carcinoma in the Malay females of Malaysia.

  19. Tumour necrosis factor-α polymorphism as one of the complex inherited factors in pemphigus

    Directory of Open Access Journals (Sweden)

    Jolanta Dorota Torzecka

    2003-01-01

    Full Text Available The aim of our study was to analyse a significance of tumour necrosis factor (TNF-α promoter gene polymorphisms in relation to the HLA-DR locus in genetic predisposition to pemphigus. TNF-α gene polymorphisms in position -238 and -308 were identified using a modified polymerase chain reaction-restriction fragment length polymorphism method in 53 patients with pemphigus (38 with pemphigus vulgaris, 15 with pemphigus foliaceus and 87 healthy controls. The HLA-DRB1 locus was typed using the polymerase chain reaction SSO method in all the patients and 152 population controls.

  20. Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

    DEFF Research Database (Denmark)

    Kastern, W.; Dyrberg, T.; Scholler, J.

    1984-01-01

    DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

  1. [Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China].

    Science.gov (United States)

    Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju

    2006-04-01

    To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.

  2. The N363S polymorphism of the glucocorticoid receptor and metabolic syndrome factors in men

    DEFF Research Database (Denmark)

    Buemann, Benjamin; Black, Eva; Holst, Claus

    2005-01-01

    OBJECTIVE: To test the associations between the N363S polymorphism of the glucocorticoid receptor gene (NR3C1) and factors related to the metabolic syndrome in middle-aged men with and without juvenile-onset obesity. RESEARCH METHODS AND PROCEDURES: This study included two groups of middle-aged men...... with the obese men (n = 299; age, 50 +/- 7 years). The subjects were genotyped for the N363S polymorphism by polymerase chain reaction-restriction fragment length polymorphism. Body composition was measured by DXA. Glucose metabolism was evaluated by an oral glucose tolerance test, and the Matsudas index...

  3. Comparison of the gut microbiota composition between obese and non-obese individuals in a Japanese population, as analyzed by terminal restriction fragment length polymorphism and next-generation sequencing.

    Science.gov (United States)

    Kasai, Chika; Sugimoto, Kazushi; Moritani, Isao; Tanaka, Junichiro; Oya, Yumi; Inoue, Hidekazu; Tameda, Masahiko; Shiraki, Katsuya; Ito, Masaaki; Takei, Yoshiyuki; Takase, Kojiro

    2015-08-11

    Obesity has become one of the most serious social problems in developed countries, including Japan. The relationship between the gut microbiota and obesity has recently attracted the attention of many researchers. Although the gut microbiota was long thought to contribute to obesity, the exact association remains largely unknown. We examined the human gut microbiota composition in a Japanese population in order to determine its relationship to obesity. Stool samples from 23 non-obese subjects (body mass index [BMI] gut microbiota compositions and that certain bacterial species were significantly associated with each group (obese: Blautia hydrogenotorophica, Coprococcus catus, Eubacterium ventriosum, Ruminococcus bromii, Ruminococcus obeum; non-obese: Bacteroides faecichinchillae, Bacteroides thetaiotaomicron, Blautia wexlerae, Clostridium bolteae, Flavonifractor plautii). Gut microbial properties differ between obese and non-obese subjects in Japan, suggesting that gut microbiota composition is related to obesity.

  4. Characterization of a three bacteria mixed culture in a chemostat: evaluation and application of a quantitative terminal-restriction fragment length polymorphism (T-RFLP) analysis for absolute and species specific cell enumeration.

    Science.gov (United States)

    Schmidt, Julia K; König, Brigitte; Reichl, Udo

    2007-03-01

    Growth dynamics of Pseudomonas aeruginosa, Burkholderia cepacia, and Staphylococcus aureus in a batch and chemostat, were investigated as a laboratory model system for persistent infections in cystic fibrosis. Most species-specific enumeration methods for mixed cultures are laborious or only qualitative, and therefore impede generation of quantitative data required for validation of mathematical models. Here, a quantitative T-RFLP method was evaluated and applied for specific and absolute cell number enumerations. The method was tested to be unbiased by quantitative sample composition and allowed reproducible enumerations of mixed cultures. For assay validation, samples of defined concentration containing one, two or three species were quantified. Logarithmically transformed absolute cell numbers of single-species dilutions were linear within a lower working range of 10(4)-10(6) cfu/mL (species-dependent) and an upper working range of 10(10) cfu/mL. Quantifications of single species (10(6)-10(10) cfu/mL) spiked with one or two other species agreed well with single species controls. Differences between slopes of first order linear regression of spiked and pure dilution series were insignificant. Coefficient of variation of defined mixed replicates was maximum 4.39%, of a three-species chemostat it was maximum 1.76%. T-RFLP monitoring of pure cultures in parallel shake flasks and of a three-species mixed chemostat gave very consistent results. Coexistence of at least two species after a time period equivalent to more than 33 volume exchanges was found. This result was not predicted from pure cultures clearly indicating the need for quantitative mixed culture experiments to better understand microbial growth dynamics and for mathematical model validation.

  5. Comparison of a Variable-Number Tandem-Repeat (VNTR) Method for Typing Mycobacterium avium with Mycobacterial Interspersed Repetitive-Unit-VNTR and IS1245 Restriction Fragment Length Polymorphism Typing▿ †

    OpenAIRE

    Inagaki, Takayuki; Nishimori, Kei; Yagi, Tetsuya; Ichikawa, Kazuya; Moriyama, Makoto; Nakagawa, Taku; Shibayama, Takami; Uchiya, Kei-ichi; Nikai, Toshiaki; Ogawa, Kenji

    2009-01-01

    Mycobacterium avium complex (MAC) infections are increasing annually in various countries, including Japan, but the route of transmission and pathophysiology of the infection remain unclear. Currently, a variable-number tandem-repeat (VNTR) typing method using the Mycobacterium avium tandem repeat (MATR) loci (MATR-VNTR) is employed in Japan for epidemiological studies using clinical isolates of M. avium. In this study, the usefulness of this MATR-VNTR typing method was compared with that of ...

  6. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  7. Analysis of the locus D1S80 by amplified fragment length polymorphism technique (AMP-FLP). Frequency distribution in Danes. Intra and inter laboratory reproducibility of the technique

    DEFF Research Database (Denmark)

    Thymann, M; Nellemann, L J; Masumba, G

    1993-01-01

    -FLP) analysis of the D1S80 locus demonstrated 21 alleles and a heterozygosity of 77%. Of the 231 possible phenotypes, 57 were observed. All mother/child pairs shared at least one D1S80 allele. The D1S80 typing results in 70 Danes were compared to the results obtained on the same samples in another laboratory...

  8. Designation of the European Working Group on Legionella Infection (EWGLI) amplified fragment length polymorphism types of Legionella pneumophila serogroup 1 and results of intercentre proficiency testing Using a standard protocol

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bergmans, A

    2002-01-01

    Infections (EWGLI) AFLP types, (ii). describes the EWGLI AFLP types identified for the 130 strains in the EWGLI culture collection, and (iii). reports the results of a newly introduced international programme of proficiency testing. Following preliminary analysis of 20 epidemiologically unrelated isolates...... (recorded as AFLP type 001-016 or untypeable) was determined by participants with reference to these 16 AFLP types, either visually or using gel analysis software where available, and reported to the coordinating centre. Nine of the 12 strains, including an epidemiologically related pair and two pairs...

  9. Association between polymorphisms of the IKZF3 gene and systemic lupus erythematosus in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Xinze Cai

    Full Text Available OBJECTIVE: It has been reported that IKAROS family of zinc finger 3 (IKZF3-deficient mice spontaneously develop human systemic lupus erythematosus (SLE-like phenotypes and produce anti-dsDNA Ab leading to immune complex-mediated glomerulonephritis. Polymorphism of the IKZF3 gene corresponds with the susceptibility to several immune-related diseases. Our intention was to establish an association between polymorphisms in the IKZF3 gene and SLE in the Chinese Han population. METHODS: The study involved obtaining blood samples for DNA extraction and genotyping the 4 selected single-nucleotide polymorphisms (SNPs in IKZF3, including rs12150079, rs9909593, rs907091, and rs2872507, by performing PCR restriction fragment length polymorphism analysis (PCR-RFLP. A group of 366 SLE patients were compared to 455 healthy controls. RESULTS: A significant decrease in frequencies of the rs907091 CC genotype and C allele appeared in the SLE patients unlike that observed in the controls (p = 0.001 and 0.015, respectively. The frequencies of the rs12150079 genotype and allele were different between the SLE patients and the control individuals, although the significance was only marginal (p = 0.046 and 0.049, respectively. In addition, a significantly low frequency of the GGCG haplotype was observed in the SLE patients, suggesting that it may provide protection against SLE (p = 0.011. CONCLUSION: To the best of our knowledge, this is the first study to demonstrate an important association between polymorphisms in IKZF3 and SLE in the Chinese Han population. A strong association between rs907091 in the IKZF3 gene and SLE was identified.

  10. Methylenetetrahydrofolate reductase polymorphisms in myeloid leukemia patients from Northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Cynara Gomes Barbosa

    2008-01-01

    Full Text Available Methylenetetrahydrofolate reductase (MTHFR: EC 1.5.1.20 polymorphisms are associated to acute lymphoid leukemia in different populations. We used the polymerase chain reaction and the restriction fragment length polymorphism method (PCR-RFLP to investigate MTHFR C677T and A1298C polymorphism frequencies in 67 patients with chronic myeloid leukemia (CML, 27 with acute myeloid leukemia FAB subtype M3 (AML-M3 and 100 apparently healthy controls. The MTHFR mutant allele frequencies were as follows: CML = 17.2% for C677T, 21.6% for A1298C; AML-M3 = 22.2% for C677T, 24.1% for A1298C; and controls = 20.5% for C677T, 21% for A1298C. Taken together, our results provide evidence that MTHFR polymorphisms have no influence on the development of CML or AML-M3.

  11. PSA and androgen-related gene (AR, CYP17, and CYP19) polymorphisms and the risk of adenocarcinoma at prostate biopsy

    DEFF Research Database (Denmark)

    dos Santos, Rodrigo Mattos; de Jesus, Carlos Márcio Nóbrega; Trindade Filho, José Carlos Souza

    2008-01-01

    The aim of the present study was to examine the impact of polymorphisms in prostate-specific antigen (PSA) and androgen-related genes (AR, CYP17, and CYP19) on prostate cancer (PCa) risk in selected high-risk patients who underwent prostate biopsy. Blood samples and prostate tissues were obtained...... for DNA analysis. Single-nucleotide polymorphisms in the 50-untranslated regions (UTRs) of the PSA (substitution A>G at position-158) and CYP17 (substitution T>C at 50-UTR) genes were detected by polymerase chain reaction (PCR)-restriction fragment length polymorphism assays. The CAG and TTTA repeats...... in the AR and CYP19 genes, respectively, were genotyped by PCR-based GeneScan analysis. Patients with the GG genotype of the PSA gene had a higher risk of PCa than those with the AG or AA genotype (OR=3.79, p=0.00138). The AA genotype was associated with lower PSA levels (6.44 +/- 1.64 ng=mL) compared...

  12. Distribution of CYP17α polymorphism and selected physiochemical factors of uterine leiomyoma in Barbados

    Science.gov (United States)

    Alleyne, Angela T.; Austin, Shane; Williams, Angela

    2014-01-01

    Uterine leiomyoma is a major reproductive health disease among women and in particular Black women. The present study sought to determine whether a single nucleotide polymorphism (SNP) of CYP17 (rs743572) was associated with the risk of developing uterine leiomyoma (UL) in affected women in Barbados; a majority Black population. It also sought to determine if BMI, waist circumference and oestradiol levels were associated with UL in this group. A total of 96 random persons were assessed in a case–control study using a PCR-RFLP assay, and measurements of body mass index, waist circumference, and oestradiol levels were also assessed. Our results showed no genetic association with the risk of UL and this gene. The genetic distribution of CYP 17α- alleles resembled a normal Hardy–Weinberg distribution, and a relatively low risk of 0.25 at a confidence interval at 95%, of UL disease development. However, a significant association was found between oestradiol levels and fibroids, as well as oestradiol levels and BMI, at P physiochemical factors comprising BMI, waist circumference, and oestrogen levels are disease indicators in this population. In conclusion, our findings suggest that obesity and its associated risk factors are important in a majority Black Caribbean population, although the sample size needs to be increased. PMID:25606420

  13. Do Biochemical Markers and Apa I Polymorphism in IGF-II Gene Play a Role in the Association of Birth Weight and Later BMI?

    Science.gov (United States)

    Wu, Junqing; Ren, Jingchao; Li, Yuyan; Wu, Yinjie; Gao, Ersheng

    2013-01-01

    The aim of the study was to explore the mechanisms underlying the association of birth weight with later body mass index (BMI) from the biochemical markers related to metabolism and the Apa I polymorphism in IGF-II gene. A total of 300 children were selected randomly from the Macrosomia Birth Cohort in Wuxi, China. The height and weight were measured and blood samples were collected. Plasma concentrations of 8 biochemical markers were detected. Apa I polymorphism was analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Biochemical markers were detected for 296 subjects and 271 subjects were genotyped for the Apa I polymorphism. No association was found between birth weight and 8 biochemical markers. In boys, the BMIs of AA, AG and GG genotypes were 16.10 ± 2.24 kg/m(2), 17.40 ± 3.20 kg/m(2), 17.65 ± 2.66 kg/m(2). And there was statistical difference among the three genotypes. But in girls, there was no statistical difference. The birth weights of AA, AG and GG genotypes were 3751.13 ± 492.43 g, 3734.00 ± 456.88 g, 3782.00 ± 461.78 g. And there was no statistical difference among the three genotypes. Biochemical markers are not associated with birth weight. Apa I polymorphism may be related to childhood BMI, but it may be not associated with birth weight. Therefore, biochemical markers and Apa I polymorphism might not play a role in the association of birth weight and BMI.

  14. Searching for speciation genes: molecular evidence for selection associated with colour morphotypes in the Caribbean reef fish genus Hypoplectrus.

    Directory of Open Access Journals (Sweden)

    Ben G Holt

    Full Text Available Closely related species that show clear phenotypic divergence, but without obvious geographic barriers, can provide opportunities to study how diversification can occur when opportunities for allopatric speciation are limited. We examined genetic divergence in the coral reef fish genus Hypoplectrus (family: Serranidae, which comprises of 10-14 morphotypes that are distinguished solely by their distinct colour patterns, but which show little genetic differentiation. Our goal was to detect loci that show clear disequilibrium between morphotypes and across geographical locations. We conducted Amplified Fragment Length Polymorphism molecular analysis to quantify genetic differentiation among, and selection between, morphotypes. Three loci were consistently divergent beyond neutral expectations in repeated pair-wise morphotype comparisons using two different methods. These loci provide the first evidence for genes that may be associated with colour morphotype in the genus Hypoplectrus.

  15. Expression and Association of SCD Gene Polymorphisms and Fatty Acid Compositions in Chicken Cross

    Directory of Open Access Journals (Sweden)

    A. Furqon

    2017-12-01

    Full Text Available Stearoyl-CoA desaturase (SCD is an integral membrane protein of endoplasmic reticulum (ER that catalyzes the rate limiting step in the monounsaturated fatty acids from saturated fatty acids. Selection for fatty acids traits based on molecular marker assisted selection is needed to increase a value of chicken meat. This study was designed to analyze expression and associations of SCD gene polymorphisms with fatty acid traits in F2 kampung-broiler chicken cross. A total of 62 F2 kampung-broiler chicken cross (29 males and 33 females were used in this study. Fatty acid traits were measured at 26 weeks of age. Samples were divided into two groups based on fatty acid traits (the highest and the lowest. Primers in exon 2 region were designed from the genomic chicken sequence. The SNP g.37284A>G was detected and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method was then used to genotype. The expression of SCD gene was analyzed using quantitative real time PCR (qRT-PCR. The result showed that there were three genotypes (AA, AG, and GG found in this study. The SCD|AciI polymorphism was significantly associated with palmitoleic acid (C16:1, fatty acids total and saturated fatty acid in 26 weeks old of F2 kampung-broiler chicken cross (P<0.05. The SCD gene was expressed for polyunsaturated fatty acids in liver tissue in two groups of chickens. In conclusion, the SCD gene could be a candidate gene that affects fatty acids traits in F2 kampung-broiler chicken cross.

  16. Heme oxygenase-1 promoter polymorphisms and risk of spina bifida.

    Science.gov (United States)

    Fujioka, Kazumichi; Yang, Wei; Wallenstein, Matthew B; Zhao, Hui; Wong, Ronald J; Stevenson, David K; Shaw, Gary M

    2015-09-01

    Spina bifida is the most common form of neural tube defects (NTDs). Etiologies of NTDs are multifactorial, and oxidative stress is believed to play a key role in NTD development. Heme oxygenase (HO), the rate-limiting enzyme in heme degradation, has multiple protective properties including mediating antioxidant processes, making it an ideal candidate for study. The inducible HO isoform (HO-1) has two functional genetic polymorphisms: (GT)n dinucleotide repeats and A(-413)T SNP (rs2071746), both of which can affect its promoter activity. However, no study has investigated a possible association between HO-1 genetic polymorphisms and risk of NTDs. This case-control study included 152 spina bifida cases (all myelomeningoceles) and 148 non-malformed controls obtained from the California Birth Defects Monitoring Program reflecting births during 1990 to 1999. Genetic polymorphisms were determined by polymerase chain reaction and amplified fragment length polymorphisms/restriction fragment length polymorphisms using genomic DNA extracted from archived newborn blood spots. Genotype and haplotype frequencies of two HO-1 promoter polymorphisms between cases and controls were compared. For (GT)n dinucleotide repeat lengths and the A(-413)T SNP, no significant differences in allele frequencies or genotypes were found. Linkage disequilibrium was observed between the HO-1 polymorphisms (D': 0.833); however, haplotype analyses did not show increased risk of spina bifida overall or by race/ethnicity. Although, an association was not found between HO-1 polymorphisms and risk of spina bifida, we speculate that the combined effect of low HO-1 expression and exposures to known environmental oxidative stressors (low folate status or diabetes), may overwhelm antioxidant defenses and increase risk of NTDs and warrants further study. © 2015 Wiley Periodicals, Inc.

  17. Effect of Complement Factor B Gene Polymorphisms on Age-Related Macular Degeneration in North-East of Iran Population

    Directory of Open Access Journals (Sweden)

    N. Roshani Pour

    2017-09-01

    Full Text Available Aims: Age-related macular degeneration (AMD is the most prevalent cause of irreversible blindness and debilitating in old stages, in developed and developing countries that engage the central part of the retina or macula. The aim of this study was to evaluate the relationship of the rs4151667 position of the complement factor B gene polymorphism with AMD (dry type with geographic atrophy phenotype in the North East of Iran population. ­Materials & Methods:­ In this descriptive cross-sectional study in 2015-2016, 44 AMD patients (dry type with geographic atrophy phenotype were randomly selected from Gonabad City, Iran, health centers as the patient group. 50 healthy individuals from the same society that have no relative relations with each other or the patients, but were adapted by age and sex to the patient group, were selected as the control group. The ­­polymorphism of rs4151667 (c.26T>A­ position of the complement factor B gene was determined for all samples by Restriction Fragment Length Polymorphism (RFLP. Data was analyzed the Chi-square test in 2x2.Contingency software. Findings: The frequency of TT genotype in AMD patients (95.5% was significantly (p=0.048 more than the control group (88.0%, but the frequency of AT genotype in AMD patients (4.5% was significantly (p=0.025 less than the control group (12.0%. Conclusion: The polymorphism of rs4151667 (c.26T>A position of complement factor B is effective on the development of AMD in North East of Iran population.

  18. Homocysteine metabolism and the associations of global DNA methylation with selected gene polymorphisms and nutritional factors in patients with dementia.

    Science.gov (United States)

    Bednarska-Makaruk, Małgorzata; Graban, Ałła; Sobczyńska-Malefora, Agata; Harrington, Dominic J; Mitchell, Michael; Voong, Kieran; Dai, Letian; Łojkowska, Wanda; Bochyńska, Anna; Ryglewicz, Danuta; Wiśniewska, Anna; Wehr, Hanna

    2016-08-01

    Epigenetics (particularly DNA methylation) together with environmental and genetic factors, are key to understanding the pathogenesis of many diseases including dementia. Disturbances in DNA methylation have already been implicated in dementia. Homocysteine metabolism, with folate and vitamin B12 as essential cofactors, is integral to methylation processes. We evaluated in a case-control study the association of global DNA methylation, homocysteine, folate and vitamin B12 status with dementia. Selected polymorphisms of genes previously associated with dementia development and the influence of various factors on DNA methylation were also investigated. 102 patients with dementia (53 with Alzheimer's disease, 17 with vascular dementia and 32 with mixed dementia) were recruited. The non-demented controls consisted of 45 age-matched subjects without dementia and 47 individuals with mild cognitive impairment. Global DNA methylation was determined by Imprint Methylated DNA Quantification Kit MDQ1 (Sigma-Aldrich, Gillingham, Dorset, UK). Plasma homocysteine, serum folate and vitamin B12 were determined by chemiluminescence. Plasma and erythrocyte 5-methyltetrahydrofolate and plasma methylmalonic acid (markers of folate and vitamin B12 status) were measured by HPLC. APOE, PON1 p.Q192R, MTHFR 677C>T (c.665C>T) and IL1B-511C>T polymorphisms were identified using PCR-RFLP methods. Patients with dementia had significantly higher concentrations of homocysteine (p=0.012) and methylmalonic acid (p=0.016) and lower folate (p=0.002) and plasma 5-methyltetrahydrofolate (p=0.005) than non-demented subjects. There was no difference in DNA methylation between patients and controls. A non-significant tendency to higher DNA methylation in patients with vascular dementia (p=0.061) was observed. Multivariate regression analysis of all recruited individuals demonstrated a significant positive association between DNA methylation and folate (p=0.013), creatinine (p=0.003) concentrations and IL

  19. Association between STK11 Gene Polymorphisms and Coronary Artery Disease in Type 2 Diabetes in Han Population in China

    Directory of Open Access Journals (Sweden)

    Xiaowei Ma

    2017-01-01

    Full Text Available Background. Recent studies indicated that the Serine threonine kinase 11 (STK11, which is a key regulator of the AMP-activated protein kinase (AMPK, plays a crucial role in cardiovascular system. This study aimed to investigate whether genetic variations in the STK11 gene affect the risk of coronary artery disease (CAD in Chinese type 2 diabetics. Methods. 5 haplotype-tagging single nucleotide polymorphisms (SNPs were selected, and 288 CAD-positive cases and 159 CAD-negative controls with type 2 diabetes were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay. Results. The carriers of minor allele A at rs12977689 had a higher risk of CAD compared to the homozygotes of CC (OR = 1.572, 95% CI = 1.039–2.376, p=0.035, and the difference was still significant after adjustment for the other known CAD risk factors (OR′ = 1.184, 95%  CI′ = 1.036–1.353, p′=0.013. Conclusion. Genetic variability at STK11 locus is associated with CAD risk in type 2 diabetes in the Chinese population.

  20. Uniqueness of polymorphism for a discrete, selection-migration model with genetic dominance

    Science.gov (United States)

    James F. Selgrade; James H. Roberds

    2009-01-01

    The migration into a natural population of a controlled population, e.g., a transgenic population, is studied using a one island selection-migration model. A 2-dimensional system of nonlinear difference equations describes changes in allele frequency and population size between generations. Biologically reasonable conditions are obtained which guarantee the existence...

  1. Analysis of the population structure of Uruguayan Creole cattle as inferred from milk major gene polymorphisms

    Directory of Open Access Journals (Sweden)

    Gonzalo Rincón

    2006-01-01

    Full Text Available The ancestors of Uruguayan Creole cattle were introduced by the Spanish conquerors in the XVII century, following which the population grew extensively and became semi-feral before the introduction of selected breeds. Today the Uruguayan Creole cattle genetic reserve consists of 575 animals. We used the tetra primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR to analyze the kappa-casein, beta-casein, alphaS1-casein and alpha-lactoalbumin gene polymorphisms and restriction fragment length polymorphism PCR (RFLP-PCR for the beta-lactoglobulin and the acylCoA:diacyl glycerol acyltransferase 1 (DGAT1 genes. The kappa-casein and beta-lactoglobulin genes presented very similar A and B allele frequencies, while the alphas1-casein and alpha-lactoalbumin gene B alleles showed much higher frequencies than the corresponding A alleles. The beta-casein B allele was not found in the population sampled. There was a very high frequency of the DGAT1 gene A allele which is associated with low milk fat content and high milk yield. All loci were in Hardy-Weinberg equilibrium and the level of heterozygosity agreed with the high genetic diversity observed in a previous analysis of this population. Preservation of the allelic richness observed in the Uruguayan Creole cattle should be considered for future dairy management and livestock genetic improvement. The results also emphasize the value of the tetra primers ARMS-PCR technique as a rapid, easy and economical way of genotyping cattle breeds for milk gene single nucleotide polymorphisms.

  2. Relationships among MTHFR a1298c gene polymorphisms and methylation status of Dact1 gene in transitional cell carcinomas.

    Science.gov (United States)

    Cheng, Huan; Lu, Meng; Mao, Li-Jun; Wang, Jun-Qi; Li, Wang; Wen, Ru-Min; Chen, Jia-Cun

    2012-01-01

    The purpose of this study was to determine the relationship between methylation status of the Dact1 gene and MTHFR a1298c polymorphic forms in transitional cell carcinoma tissues in a Chinese population. Polymorphisms of folate metabolism enzyme gene MTHFR were assessed by restrictive fragment length polymorphism (RFLP) methods and PCR-based DNA methylation analysis was used to determine the CpG island methylation status of the Dact1 gene. Associations between the methylation status of the Dact1 gene and clinical characteristics, as well as MTHFR a1298c polymorphisms, were analyzed. aberrant methylation of the Dact1 gene was found in 68.3% of cancer tissues and 12.4% of normal tissues,. The methylation rate of the Dact1 gene in cancer tissues was significantly higher in patients with lymph node metastasis than in those without lymph node metastasis (46.3% vs. 17.2%, P = 0.018). No association was found between aberrant DNA methylation and selected factors including sex, age, tobacco smoking, alcohol consumption and green tea consumption. After adjusting for potential confounding variables, variant allele of MTHFR a1298c was found to be associated with methylation of the Dact1 gene. Compared with wild type CC, the odds ratio was 4.33 (95% CI: 1.06-10.59) for AC and 4.95 (95% CI: 1.18-12.74) for AA. The N stage in TNM staging and the occurrence of lymph node metastasis were associated with an MTHFR 1298 AAμAC genotype (Pmethylation status of the Dact1 gene, aberrant CpG island methylation of which is closely related to the genesis and progression of transitional cell carcinoma.

  3. Association of TP53 and MDM2 polymorphisms with survival in bladder cancer patients treated with chemoradiotherapy

    International Nuclear Information System (INIS)

    Shinohara, Asano; Sakano, Shigeru; Hinoda, Yuji; Nishijima, Jun; Kawai, Yoshihisa; Misumi, Taku; Nagao, Kazuhiro; Hara, Takahiko; Matsuyama, Hideyasu

    2009-01-01

    Platinum-based chemoradiotherapy (CRT) as bladder conservation therapy has shown promising results for muscle-invasive bladder cancer. However, CRT might diminish survival as a result of the delay in cystectomy for some patients with non-responding bladder tumors. Because the p53 tumor suppression pathway, including its MDM2 counterpart, is important in chemotherapy- and radiotherapy-associated effects, functional polymorphisms in the TP53 and MDM2 genes could influence the response to treatment and the prognosis following CRT. We investigated associations between two such polymorphisms, and p53 overexpression, and response or survival in bladder cancer patients treated with CRT. The study group comprised 96 patients who underwent CRT for transitional cell carcinoma of the bladder. Single nucleotide polymorphisms (SNPs) in TP53 (codon 72, arginine>proline) and MDM2 (SNP3O9, T>G) were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP), and nuclear expression levels of p53 were examined using immunohistochemistry. None of the genotypes or p53 overexpression was significantly associated with response to CRT. However, patients with MDM2 T/G+G/G genotypes had improved cancer-specific survival rates after CRT (P=0.009). In multivariate analysis, the MDM2 T/G+G/G genotypes, and more than two of total variant alleles in TP53 and MDM2, were independently associated with improved cancer-specific survival (P=0.031 and P=0.015, respectively). In addition, MDM2 genotypes were significantly associated with cystectomy-free survival (P=0.030). These results suggest that the TP53 and MDM2 genotypes might be useful prognostic factors following CRT in bladder cancer, helping patient selection for bladder conservation therapy. (author)

  4. Association of polymorphisms MTHFR C677T and A1298C with risk of colorectal cancer, genetic and epigenetic characteristic of tumors, and response to chemotherapy.

    Science.gov (United States)

    Fernández-Peralta, Antonia M; Daimiel, Lydia; Nejda, Nargisse; Iglesias, Daniel; Medina Arana, Vicente; González-Aguilera, Juan J

    2010-02-01

    The enzyme MTHFR plays an important role in folate metabolism, and folate is implicated in carcinogenesis due to its role in DNA methylation, repair, and synthesis. We analyze the relationship of MTHFR C677T and A1298C polymorphisms with biological, clinicopathological, genetic and epigenetic features of tumors, and the patient outcome after treatment with 5-FU-based chemotherapy to determine the contribution of MTHFR genotypes in the risk of colorectal cancer (CRC) and in the response to therapy. Genomic DNA of 143 Spanish sporadic CRC and 103 controls was analyzed by polymerase chain reaction/restriction fragment length polymorphism and sequencing. The C677T polymorphism has protective effect on CRC showing TT genotype an odds ratios of 0.06 (95% confidence interval (CI): 0.10-0.32) and the CT of 0.51 (95% CI: 0.3-0.87). MTHFR A1298C polymorphism is not associated with CRC risk. Patients with 1298CC and AC genotypes exhibit worse survival than those with the wild genotype (log rank, p = 0.001), whereas C677T genotypes do not affect patient survival (log rank, p = 0.92). MTHFR 677T allele carriers responded better to 5-FU-based chemotherapy than patients with the wild CC genotype (log rank, p = 0.05). The variant C allele of A1298C affects negatively the response to 5-FU-based chemotherapy (log rank, p = 0.009). The variant allele of the C677T has a protective effect on CRC development, whereas the variant allele of the A1298C does not produce any effect on disease risk. Both MTHFR polymorphisms are relevant and independent factors of patient outcome after 5FU-based treatment of CRC, and MTHFR genotyping may be of predictive benefit in selecting treatment regimens.

  5. Sequencing and annotation of the chloroplast DNAs and identification of polymorphisms distinguishing normal male-fertile and male-sterile cytoplasms of onion.

    Science.gov (United States)

    von Kohn, Christopher; Kiełkowska, Agnieszka; Havey, Michael J

    2013-12-01

    Male-sterile (S) cytoplasm of onion is an alien cytoplasm introgressed into onion in antiquity and is widely used for hybrid seed production. Owing to the biennial generation time of onion, classical crossing takes at least 4 years to classify cytoplasms as S or normal (N) male-fertile. Molecular markers in the organellar DNAs that distinguish N and S cytoplasms are useful to reduce the time required to classify onion cytoplasms. In this research, we completed next-generation sequencing of the chloroplast DNAs of N- and S-cytoplasmic onions; we assembled and annotated the genomes in addition to identifying polymorphisms that distinguish these cytoplasms. The sizes (153 538 and 153 355 base pairs) and GC contents (36.8%) were very similar for the chloroplast DNAs of N and S cytoplasms, respectively, as expected given their close phylogenetic relationship. The size difference was primarily due to small indels in intergenic regions and a deletion in the accD gene of N-cytoplasmic onion. The structures of the onion chloroplast DNAs were similar to those of most land plants with large and small single copy regions separated by inverted repeats. Twenty-eight single nucleotide polymorphisms, two polymorphic restriction-enzyme sites, and one indel distributed across 20 chloroplast genes in the large and small single copy regions were selected and validated using diverse onion populations previously classified as N or S cytoplasmic using restriction fragment length polymorphisms. Although cytoplasmic male sterility is likely associated with the mitochondrial DNA, maternal transmission of the mitochondrial and chloroplast DNAs allows for polymorphisms in either genome to be useful for classifying onion cytoplasms to aid the development of hybrid onion cultivars.

  6. [Application of double created restriction site PCR-RFLP to identify MGMT gene polymorphisms].

    Science.gov (United States)

    Wang, Wei; Miao, Wenbin; Qiu, Yulan; Xia, Zhaolin

    2008-01-01

    To develop a proper assay for identifying single nucleotide polymorphisms( SNPs) of the MGMT gene. PCR primers were designed by create restriction site (CRS) method, then polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was adopted to identify four SNPs in MGMT gene. By PCR, one primer pair yielded target products containing MGMT84 SNP site, and the other primer pair yielded target products containing MGMT143, 160, 178 SNP sites. Four restriction enzymes were adopted to identify the four SNPs, respectively. The effects of PCR and RFLP were good. The methods for four SNPs of MGMT determinated by CRS-PCR-RFLP theory could be facility, economy, and rapidness.

  7. GENETIC POLYMORPHISM AT THE K-CASEIN LOCUS IN A DAIRY HERD OF ROMANIAN SPOTTED AND BROWN OF MARAMURES BREEDS

    Directory of Open Access Journals (Sweden)

    ILIE DANIELA

    2007-01-01

    Full Text Available Caseins are a family of milk proteins that exist in several molecular forms and arethe main proteins present in the bovine milk. Genetic variation of these proteins hasbeen associated with the quality and quantity of cheese derived from milk.This study was focused on possibilities to evaluate the frequency of the K-casein Ballele in dairy herds from the Research and Development Station for Bovine RaisingArad in order to have breeding programs that target an increase in the frequency ofthe B allele in the dairy cattle population.In order to differentiate the favorable genotype for superior composition and highercheese yield, we used simple DNA extraction method from fresh blood andtechniques based on DNA analysis, which include polymerase chain reaction andrestriction fragment length polymorphisms (PCR-RFLP methods. Employing thesetechniques we were able to determine the k-casein genotype of all individuals in agiven population under selection, regardless of sex, age or physiological stage.As a result, it is now possible to include information on milk protein genotypes intomarker assisted selection programs and consequently improve response to selection.

  8. GENETIC POLYMORPHISM AT THE K-CASEIN LOCUS IN A DAIRY HERD OF ROMANIAN SPOTTED AND BROWN OF MARAMURES BREEDS

    Directory of Open Access Journals (Sweden)

    DANIELA ILIE

    2007-05-01

    Full Text Available Caseins are a family of milk proteins that exist in several molecular forms and arethe main proteins present in the bovine milk. Genetic variation of these proteins hasbeen associated with the quality and quantity of cheese derived from milk.This study was focused on possibilities to evaluate the frequency of the K-casein Ballele in dairy herds from the Research and Development Station for Bovine RaisingArad in order to have breeding programs that target an increase in the frequency ofthe B allele in the dairy cattle population.In order to differentiate the favorable genotype for superior composition and highercheese yield, we used simple DNA extraction method from fresh blood andtechniques based on DNA analysis, which include polymerase chain reaction andrestriction fragment length polymorphisms (PCR-RFLP methods. Employing thesetechniques we were able to determine the k-casein genotype of all individuals in agiven population under selection, regardless of sex, age or physiological stage.As a result, it is now possible to include information on milk protein genotypes intomarker assisted selection programs and consequently improve response to selection.

  9. Adiponectin gene polymorphism is selectively associated with the concomitant presence of metabolic syndrome and essential hypertension.

    Directory of Open Access Journals (Sweden)

    Hsin-Bang Leu

    Full Text Available OBJECTIVE: Cardiovascular risk increases with the presence of both metabolic syndrome (MetS and hypertension (HTN. Although the adiponectin (ADIPOQ gene has been reported to be involved in MetS, its association with HTN remained undetermined. This study aimed to investigate the association of ADIPOQ gene with the phenotypes of HTN and MetS. METHODS: A total of 962 participants from 302 families from the Taiwan young-onset hypertension genetic study were enrolled. Plasma adiponectin were measured, and association analysis was conducted by using GEE regression-based method. Another study, of 1448 unrelated participants, was conducted to replicate the association between ADIPOQ gene and variable phenotypes of MetS with or without HTN. RESULTS: Among 962 subjects from family samples, the lowest plasma adiponectin value was observed in MetS with HTN component (9.3±0.47 µg/ml compared with hypertensives (13.4±0.74 µg /ml or MetS without HTN (11.9±0.60 µg/ml, P<0.05. The SNP rs1501299 (G276T in ADIPOQ gene was found associated with the presence of HTN in MetS (odds ratio for GG+GT vs. TT = 2.46; 95% CI: 1.14-5.3, p = 0.02, but not rs2241766 (T45G. No association of ADIPOQ gene with HTN alone or MetS without HTN was observed. The significant association of the SNP rs1501299 (G276T with the phenotype of presence of HTN in MetS was confirmed (odds ratio for GG+GT vs. TT = 2.15; 95% CI: 1.1-4.3 in the replication study. CONCLUSIONS: ADIPOQ genetic variants were selectively and specifically associated with the concomitant presence of MetS and HTN, suggesting potential genetic linkage between MetS and HTN.

  10. Continental-scale footprint of balancing and positive selection in a small rodent (Microtus arvalis).

    Science.gov (United States)

    Fischer, Martin C; Foll, Matthieu; Heckel, Gerald; Excoffier, Laurent

    2014-01-01

    Genetic adaptation to different environmental conditions is expected to lead to large differences between populations at selected loci, thus providing a signature of positive selection. Whereas balancing selection can maintain polymorphisms over long evolutionary periods and even geographic scale, thus leads to low levels of divergence between populations at selected loci. However, little is known about the relative importance of these two selective forces in shaping genomic diversity, partly due to difficulties in recognizing balancing selection in species showing low levels of differentiation. Here we address this problem by studying genomic diversity in the European common vole (Microtus arvalis) presenting high levels of differentiation between populations (average F ST = 0.31). We studied 3,839 Amplified Fragment Length Polymorphism (AFLP) markers genotyped in 444 individuals from 21 populations distributed across the European continent and hence over different environmental conditions. Our statistical approach to detect markers under selection is based on a Bayesian method specifically developed for AFLP markers, which treats AFLPs as a nearly codominant marker system, and therefore has increased power to detect selection. The high number of screened populations allowed us to detect the signature of balancing selection across a large geographic area. We detected 33 markers potentially under balancing selection, hence strong evidence of stabilizing selection in 21 populations across Europe. However, our analyses identified four-times more markers (138) being under positive selection, and geographical patterns suggest that some of these markers are probably associated with alpine regions, which seem to have environmental conditions that favour adaptation. We conclude that despite favourable conditions in this study for the detection of balancing selection, this evolutionary force seems to play a relatively minor role in shaping the genomic diversity of the

  11. Continental-scale footprint of balancing and positive selection in a small rodent (Microtus arvalis.

    Directory of Open Access Journals (Sweden)

    Martin C Fischer

    Full Text Available Genetic adaptation to different environmental conditions is expected to lead to large differences between populations at selected loci, thus providing a signature of positive selection. Whereas balancing selection can maintain polymorphisms over long evolutionary periods and even geographic scale, thus leads to low levels of divergence between populations at selected loci. However, little is known about the relative importance of these two selective forces in shaping genomic diversity, partly due to difficulties in recognizing balancing selection in species showing low levels of differentiation. Here we address this problem by studying genomic diversity in the European common vole (Microtus arvalis presenting high levels of differentiation between populations (average F ST = 0.31. We studied 3,839 Amplified Fragment Length Polymorphism (AFLP markers genotyped in 444 individuals from 21 populations distributed across the European continent and hence over different environmental conditions. Our statistical approach to detect markers under selection is based on a Bayesian method specifically developed for AFLP markers, which treats AFLPs as a nearly codominant marker system, and therefore has increased power to detect selection. The high number of screened populations allowed us to detect the signature of balancing selection across a large geographic area. We detected 33 markers potentially under balancing selection, hence strong evidence of stabilizing selection in 21 populations across Europe. However, our analyses identified four-times more markers (138 being under positive selection, and geographical patterns suggest that some of these markers are probably associated with alpine regions, which seem to have environmental conditions that favour adaptation. We conclude that despite favourable conditions in this study for the detection of balancing selection, this evolutionary force seems to play a relatively minor role in shaping the genomic

  12. Frequency of Factor V Leiden and Prothrombin Polymorphism in South of Iran

    Directory of Open Access Journals (Sweden)

    Javad Dehbozorgian

    2009-06-01

    Full Text Available Normal hemostasis requires balanced regulation of prothromboticand antithrombotic factors. Inherited alteration of factor Vand prothrombin gene, the G20210A mutation, increases the resistanceof factor V to degradation and booster production ofprothrombin respectively. These alterations can increase hypercoagulabilityleading to thrombotic consequences. We aimed toassess the frequencies of these mutations in a group of the populationof southern Iran. In total, 198 healthy volunteers with theage range of 1-64 years were selected and screened for factor VLeiden and prothrombin mutations using polymerase chain reactionand restriction fragment length polymorphism techniques.The carrier frequencies for factor V Leiden and prothrombin mutationin the studied cohort were 4.1% and 3.07%, respectively.In the studied area, the allele frequency of factor V ishigher than the prothrombin G20210A mutation (0.0204 v0.0153. According to the data and Hardy-Weinberger equation,the total risk of thrombosis caused by homozygosity andheterozygosity of factor V Leiden, prothrombin G20210A mutationand compound heterozygosity of these mutations areabout 1 in 500 individuals.

  13. Genetic polymorphism of the kappa-casein gene in Brazilian cattle.

    Science.gov (United States)

    Azevedo, A L S; Nascimento, C S; Steinberg, R S; Carvalho, M R S; Peixoto, M G C D; Teodoro, R L; Verneque, R S; Guimarães, S E F; Machado, M A

    2008-07-15

    Frequencies of kappa-casein gene alleles were determined in 1316 animals from the Brazilian Bos indicus genetic groups (Sindhi cows, Gyr sires, Gyr cows, Guzerat sires, Guzerat cows, Nellore sires, and Gyr x Holstein crossbreds) by means of polymerase chain reaction-restriction fragment length polymorphism analysis using two independent restriction nucleases (Hinf I and HaeIII). The genotyping of kappa-casein alleles (A and B) is of practical importance, since the B allele is found to correlate with commercially valuable parameters of cheese yielding efficiency. The frequencies of the B allele of kappa-casein among breeds ranged from 0.01 to 0.30. The Sindhi breed had the highest frequency for the B allele (0.30), while the frequencies of this allele in other breeds ranged from 0.01 to 0.18. A wide variation in the B allele frequency among B. indicus breeds was found suggesting that molecular selection for animals carrying the B allele could impact breeding programs for dairy production.

  14. Fc receptor gamma subunit polymorphisms and systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Al-Ansari, Aliya; Ollier, W.E.; Gonzalez-Gay, Miguel A.; Gul, Ahmet; Inanac, Murat; Ordi, Jose; Teh, Lee-Suan; Hajeer, Ali H.

    2004-01-01

    To investigate the possible association between Fc receptor gamma polymorphisms and systemic lupus erythematosus (SLE). We have investigated the full FcR gamma gene for polymorphisms using polymerase chain reaction (PCR)-single strand confirmational polymorphisms and DNA sequencing .The polymorphisms identified were genotype using PCR-restriction fragment length polymorphism. Systemic lupus erythematosus cases and controls were available from 3 ethnic groups: Turkish, Spanish and Caucasian. The study was conducted in the year 2001 at the Arthritis Research Campaign, Epidemiology Unit, Manchester University Medical School, Manchester, United Kingdom. Five single nucleotide polymorphisms were identified, 2 in the promoter, one in intron 4 and, 2 in the 3'UTR. Four of the 5 single nucleotide polymorphisms (SNPs) were relatively common and investigated in the 3 populations. Allele and genotype frequencies of all 4 investigated SNPs were not statistically different cases and controls. fc receptor gamma gene does not appear to contribute to SLE susceptibility. The identified polymorphisms may be useful in investigating other diseases where receptors containing the FcR gamma subunit contribute to the pathology. (author)

  15. Single nucleotide polymorphisms unravel hierarchical divergence and signatures of selection among Alaskan sockeye salmon (Oncorhynchus nerka populations

    Directory of Open Access Journals (Sweden)

    Habicht Christopher

    2011-02-01

    Full Text Available Abstract Background Disentangling the roles of geography and ecology driving population divergence and distinguishing adaptive from neutral evolution at the molecular level have been common goals among evolutionary and conservation biologists. Using single nucleotide polymorphism (SNP multilocus genotypes for 31 sockeye salmon (Oncorhynchus nerka populations from the Kvichak River, Alaska, we assessed the relative roles of geography (discrete boundaries or continuous distance and ecology (spawning habitat and timing driving genetic divergence in this species at varying spatial scales within the drainage. We also evaluated two outlier detection methods to characterize candidate SNPs responding to environmental selection, emphasizing which mechanism(s may maintain the genetic variation of outlier loci. Results For the entire drainage, Mantel tests suggested a greater role of geographic distance on population divergence than differences in spawn timing when each variable was correlated with pairwise genetic distances. Clustering and hierarchical analyses of molecular variance indicated that the largest genetic differentiation occurred between populations from distinct lakes or subdrainages. Within one population-rich lake, however, Mantel tests suggested a greater role of spawn timing than geographic distance on population divergence when each variable was correlated with pairwise genetic distances. Variable spawn timing among populations was linked to specific spawning habitats as revealed by principal coordinate analyses. We additionally identified two outlier SNPs located in the major histocompatibility complex (MHC class II that appeared robust to violations of demographic assumptions from an initial pool of eight candidates for selection. Conclusions First, our results suggest that geography and ecology have influenced genetic divergence between Alaskan sockeye salmon populations in a hierarchical manner depending on the spatial scale. Second

  16. Association of brain-derived neurotrophic factor valine to methionine polymorphism with sexual dysfunction following selective serotonin reuptake inhibitor treatment in female patients with major depressive disorder.

    Science.gov (United States)

    Nazree, Nur Elia; Mohamed, Zahurin; Reynolds, Gavin P; Mohd Zain, Shamsul; Masiran, Ruziana; Sidi, Hatta; Chong, Lu Ann; Hway, Anne Yee; Adlan, Aida Syarinaz; Zainal, Nor Zuraida

    2016-12-01

    The occurrence of female sexual dysfunction (FSD) in patients with major depressive disorder (MDD) receiving selective serotonin reuptake inhibitors (SSRIs) treatment gives negative impacts on patients' quality of life and causes treatment discontinuation. We aimed to investigate whether genetic polymorphism of identified candidate gene is associated with FSD in our study population. This is a cross-sectional study. A total of 95 female patients with MDD who met the criteria of the study were recruited and were specifically assessed on the sexual function by trained psychiatrists. Patients' DNA was genotyped for BDNF Val66Met polymorphism using real-time polymerase chain reaction. The prevalence of FSD in this study is 31.6%. In the FSD group, patients with problematic marriage were significantly more frequent compared with patients who did not have problematic marriage (P = 0.009). Significant association was detected in the lubrication domain with BDNF Val66Met polymorphism (P = 0.030) using additive genetic model, with even stronger association when using the recessive model (P = 0.013). This study suggested that there was no significant association between BDNF Val66Met with FSD. However, this polymorphism is significantly associated with lubrication disorder in patients treated with SSRIs. © 2015 Wiley Publishing Asia Pty Ltd.

  17. Selection, trans-species polymorphism, and locus identification of major histocompatibility complex class IIβ alleles of New World ranid frogs

    Science.gov (United States)

    Kiemnec-Tyburczy, Karen M.; Richmond, Jonathan Q.; Savage, Anna E.; Zamudio, Kelly R.

    2010-01-01

    Genes encoded by the major histocompatibility complex (MHC) play key roles in the vertebrate immune system. However, our understanding of the evolutionary processes and underlying genetic mechanisms shaping these genes is limited in many taxa, including amphibians, a group currently impacted by emerging infectious diseases. To further elucidate the evolution of the MHC in frogs (anurans) and develop tools for population genetics, we surveyed allelic diversity of the MHC class II ??1 domain in both genomic and complementary DNA of seven New World species in the genus Rana (Lithobates). To assign locus affiliation to our alleles, we used a "gene walking" technique to obtain intron 2 sequences that flanked MHC class II?? exon 2. Two distinct intron sequences were recovered, suggesting the presence of at least two class II?? loci in Rana. We designed a primer pair that successfully amplified an orthologous locus from all seven Rana species. In total, we recovered 13 alleles and documented trans-species polymorphism for four of the alleles. We also found quantitative evidence of selection acting on amino acid residues that are putatively involved in peptide binding and structural stability of the ??1 domain of anurans. Our results indicated that primer mismatch can result in polymerase chain reaction (PCR) bias, which influences the number of alleles that are recovered. Using a single locus may minimize PCR bias caused by primer mismatch, and the gene walking technique was an effective approach for generating single-copy orthologous markers necessary for future studies of MHC allelic variation in natural amphibian populations. ?? 2010 Springer-Verlag.

  18. Identification of polymorphism in exons 7 and 12 of lactoferrin gene and its association with incidence of clinical mastitis in Murrah buffalo.

    Science.gov (United States)

    Dinesh, Krishanender; Verma, Archana; Das Gupta, Ishwar; Thakur, Yash Pal; Verma, Nishant; Arya, Ashwani

    2015-04-01

    Lactoferrin gene is one of the important candidate genes for mastitis resistance. The gene is located on chromosome BTA 22 and consists of 17 exons spanning over 34.5 kb of genomic DNA. The present study was undertaken with the objectives to identify allelic variants in exons 7 and 12 of lactoferrin gene and to analyze association between its genetic variants and incidence of clinical mastitis in Murrah buffalo. The amplification of exons 7 and 12 of lactoferrin gene yielded amplicons of 232- and 461-bp sizes. PCR-restriction fragment length polymorphism (RFLP) analysis of 232-bp amplicon using BccI restriction enzyme revealed three genotypes (AA, AB, and BB) with frequencies of 0.62, 0.22, and 0.16, respectively. The frequencies of two alleles, A and B, were estimated as 0.73 and 0.27. Hpy188I-RFLP for 461-bp amplicon revealed polymorphism with three genotypes, CC, CD, and DD, with respective frequencies of 0.06, 0.39, and 0.56, whereas frequencies for C and D alleles were 0.25 and 0.75. The chi-square (χ(2)) analysis revealed a significant association between incidence of clinical mastitis and genetic variants of exon 7, and animals of AA genotype of exon 7 were found to be least susceptible to mastitis. The findings indicate potential scope for incorporation of lactoferrin gene in selection and breeding of Murrah buffaloes for improved genetic resistance to mastitis.

  19. Common Polymorphism A1298C in Methylenetetrahydrofolate Reductase Gene Is not a Risk Factor for Coronary Artery Disease in Selected Iranian Patients

    Directory of Open Access Journals (Sweden)

    Mojgan Mirakhori

    2007-08-01

    Full Text Available Background: Coronary artery disease (CAD is emerging as a major public health concern in most developing countries. During the past 10 years, the vast majority of over 100 case-control retrospective studies have shown that elevated plasma homocysteine level is a strong independent risk factor for coronary artery disease. Methylenetetrahydrofolate reductase (MTHFR is a key enzyme in folate and homocysteine metabolism. A second polymorphism, A1298C, in MTHFR gene, is reported to be associated with decreased enzyme activity and may give rise to elevated blood homocysteine level and increased risk of coronary artery disease. Methods: In the present study we used PCR-RFLP analysis to investigate the association between A1298C polymorphism and blood homocysteine level and the risk of CAD in 100 patients compared to 100 normal controls. Results: The frequency of mutated allele and genotype distribution showed no significant difference between patient and control groups. Although the elevated level in blood homocysteine were observed in Iranian CAD cases compared to the normal control, the A1298C polymorphism was not associated with increased CAD risk in studied population as supported by a P value>0.05 and chi-square equal to 0.697.Conclusion: An increased plasma homocysteine concentration confers an independent risk factor for CAD. Although A1298C polymorphism in MTHFR gene has effects on enzyme activity but our findings do not support a major role for this polymorphism in homocysteine metabolism and it can not be considered a major risk factor for coronary artery disease in a selected Iranian population.

  20. Analysis of selected glutathione S-transferase gene polymorphisms in Malaysian type 2 diabetes mellitus patients with and without cardiovascular disease.

    Science.gov (United States)

    Etemad, A; Vasudevan, R; Aziz, A F A; Yusof, A K M; Khazaei, S; Fawzi, N; Jamalpour, S; Arkani, M; Mohammad, N A; Ismail, P

    2016-04-07

    Type 2 diabetes mellitus (T2DM) is believed to be associated with excessive production of reactive oxygen species. Glutathione S-transferase (GST) polymorphisms result in decreased or absent enzyme activity and altered oxidative stress, and have been associated with cardiovascular disease (CVD). The present study assessed the effect of GST polymorphisms on the risk of developing T2DM in individuals of Malaysian Malay ethnicity. A total of 287 subjects, consisting of 87 T2DM and 64 CVD/T2DM patients, as well as 136 healthy gender- and age-matched controls were genotyped for selected polymorphisms to evaluate associations with T2DM susceptibility. Genomic DNA was extracted using commercially available kits, and GSTM1, GSTT1, and α-globin sequences were amplified by multiplex polymerase chain reaction. Biochemical parameters were measured with a Hitachi autoanalyzer. The Fisher exact test, the chi-square statistic, and means ± standard deviations were calculated using the SPSS software. Overall, we observed no significant differences regarding genotype and allele frequencies between each group (P = 0.224 and 0.199, respectively). However, in the combined analysis of genotypes and blood measurements, fasting plasma glucose, HbA1c, and triglyceride levels, followed by age, body mass index, waist-hip ratio, systolic blood pressure, and history of T2DM significantly differed according to GST polymorphism (P ˂ 0.05). Genetically induced absence of the GSTT1 enzyme is an independent and powerful predictor of premature vascular morbidity and death in individuals with T2DM, and might be triggered by cigarette smoking's oxidative effects. These polymorphisms could be screened in other ethnicities within Malaysia to determine further possible risk factors.

  1. One-dimensional self-confinement promotes polymorph selection in large-area organic semiconductor thin films.

    Science.gov (United States)

    Giri, Gaurav; Li, Ruipeng; Smilgies, Detlef-M; Li, Er Qiang; Diao, Ying; Lenn, Kristina M; Chiu, Melanie; Lin, Debora W; Allen, Ranulfo; Reinspach, Julia; Mannsfeld, Stefan C B; Thoroddsen, Sigurdur T; Clancy, Paulette; Bao, Zhenan; Amassian, Aram

    2014-04-16

    A crystal's structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes.

  2. One-dimensional self-confinement promotes polymorph selection in large-area organic semiconductor thin films

    KAUST Repository

    Giri, Gaurav

    2014-04-16

    A crystal\\'s structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes. © 2014 Macmillan Publishers Limited.

  3. Genetic analysis of polymorphisms in the kalirin gene for association with age-at-onset in European Huntington disease patients

    Directory of Open Access Journals (Sweden)

    Tsai Yu-Chun

    2012-06-01

    Full Text Available Abstract Background Huntington disease (HD is caused by an expanded CAG repeat in the HD gene. Although the length of the CAG repeat strongly correlates with the age-at-onset (AAO, AAO in HD individuals may differ dramatically in spite of similar expanded CAG repeat lengths. Additional genetic or environmental factors are thought to influence the disease onset. Several modifier genes have been discovered so far but they do not fully explain the variability of AAO in HD. To potentially identify a novel genetic modifier, we analyzed single nucleotide polymorphisms (SNPs in the kalirin (KALRN gene. Kalirin is a protein crucially involved in spine plasticity and its interaction with huntingtin-associated protein-1 (HAP-1 and a potential protein dysfunction might contribute to spine pathogenesis in HD. Methods The selected SNPs were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and association of SNPs with AAO was investigated with the framework of linear models in an analysis of variance and covariance. Results Eleven SNPs in the kalirin gene were examined in an association study in European HD patients. The ten coding SNPs under investigation were monomorphic, whereas SNP rs10934657 in the promoter region showed a minor allele frequency >1%. An analysis of covariance together with the influence of the expanded HD allele was applied in 680 HD patients. SNP rs10934657 did not affect the AAO of the examined HD population. Conclusions The results did not reveal an association between the analyzed kalirin polymorphisms and the AAO in HD. However, it does not exclude other SNPs of the kalirin gene as susceptible genetic modifiers.

  4. A brain-derived neurotrophic factor polymorphism Val66Met identifies fibromyalgia syndrome subgroup with higher body mass index and C-reactive protein.

    Science.gov (United States)

    Xiao, Yangming; Russell, I Jon; Liu, Ya-Guang

    2012-08-01

    A common single nucleotide polymorphism (SNP) in the gene of brain-derived neurotrophic factor (BDNF) results from a substitution at position 66 from valine (Val) to methionine (Met) and may predispose to human neuropsychiatric disorders. We proposed to determine whether these BDNF gene SNPs were associated with fibromyalgia syndrome (FMS) and/or any of its typical phenotypes. Patients with FMS (N = 95) and healthy normal controls (HNC, N = 58) were studied. Serum high-sensitivity C-reactive protein (hsCRP) levels were measured using an enzyme-linked immunosorbent assay (ELISA). The BDNF SNPs were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).The BDNF SNP distribution was 65 (68%) Val/Val, 28 (30%) Val/Met, and 2 (2%) Met/Met for FMS and 40 (69%), 17(29%), and 1 (2%) for HNC, respectively. The serum high-sensitivity C-reactive protein (hsCRP)and body mass index (BMI) in FMS were higher than in HNC. The FMS with BDNF Val66Val had significantly higher mean BMI (P = 0.0001) and hsCRP (P = 0.02) than did FMS carrying the Val66Met genotype. This pattern was not found in HNC. Phenotypic measures of subjective pain, pain threshold, depression, or insomnia did not relate to either of the BDNF SNPs in FMS. The relative distribution BDNF SNPs did not differ between FMS and HNC. The BDNF Val66Met polymorphism is not selective for FMS. The BDNF Val66Val SNP identifies a subgroup of FMS with elevated hsCRP and higher BMI. This is the first study to associate a BDNF polymorphism with a FMS subgroup phenotype.

  5. Single feature polymorphism (SFP)-based selective sweep identification and association mapping of growth-related metabolic traits in Arabidopsis thaliana.

    Science.gov (United States)

    Childs, Liam H; Witucka-Wall, Hanna; Günther, Torsten; Sulpice, Ronan; Korff, Maria V; Stitt, Mark; Walther, Dirk; Schmid, Karl J; Altmann, Thomas

    2010-03-20

    Natural accessions of Arabidopsis thaliana are characterized by a high level of phenotypic variation that can be used to investigate the extent and mode of selection on the primary metabolic traits. A collection of 54 A. thaliana natural accession-derived lines were subjected to deep genotyping through Single Feature Polymorphism (SFP) detection via genomic DNA hybridization to Arabidopsis Tiling 1.0 Arrays for the detection of selective sweeps, and identification of associations between sweep regions and growth-related metabolic traits. A total of 1,072,557 high-quality SFPs were detected and indications for 3,943 deletions and 1,007 duplications were obtained. A significantly lower than expected SFP frequency was observed in protein-, rRNA-, and tRNA-coding regions and in non-repetitive intergenic regions, while pseudogenes, transposons, and non-coding RNA genes are enriched with SFPs. Gene families involved in plant defence or in signalling were identified as highly polymorphic, while several other families including transcription factors are depleted of SFPs. 198 significant associations between metabolic genes and 9 metabolic and growth-related phenotypic traits were detected with annotation hinting at the nature of the relationship. Five significant selective sweep regions were also detected of which one associated significantly with a metabolic trait. We generated a high density polymorphism map for 54 A. thaliana accessions that highlights the variability of resistance genes across geographic ranges and used it to identify selective sweeps and associations between metabolic genes and metabolic phenotypes. Several associations show a clear biological relationship, while many remain requiring further investigation.

  6. Single feature polymorphism (SFP-based selective sweep identification and association mapping of growth-related metabolic traits in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Stitt Mark

    2010-03-01

    Full Text Available Abstract Background Natural accessions of Arabidopsis thaliana are characterized by a high level of phenotypic variation that can be used to investigate the extent and mode of selection on the primary metabolic traits. A collection of 54 A. thaliana natural accession-derived lines were subjected to deep genotyping through Single Feature Polymorphism (SFP detection via genomic DNA hybridization to Arabidopsis Tiling 1.0 Arrays for the detection of selective sweeps, and identification of associations between sweep regions and growth-related metabolic traits. Results A total of 1,072,557 high-quality SFPs were detected and indications for 3,943 deletions and 1,007 duplications were obtained. A significantly lower than expected SFP frequency was observed in protein-, rRNA-, and tRNA-coding regions and in non-repetitive intergenic regions, while pseudogenes, transposons, and non-coding RNA genes are enriched with SFPs. Gene families involved in plant defence or in signalling were identified as highly polymorphic, while several other families including transcription factors are depleted of SFPs. 198 significant associations between metabolic genes and 9 metabolic and growth-related phenotypic traits were detected with annotation hinting at the nature of the relationship. Five significant selective sweep regions were also detected of which one associated significantly with a metabolic trait. Conclusions We generated a high density polymorphism map for 54 A. thaliana accessions that highlights the variability of resistance genes across geographic ranges and used it to identify selective sweeps and associations between metabolic genes and metabolic phenotypes. Several associations show a clear biological relationship, while many remain requiring further investigation.

  7. Polymorphism of the IL13 gene may be associated with Uterine leiomyomas in Slovenian women

    Directory of Open Access Journals (Sweden)

    Krsteski J

    2016-12-01

    Full Text Available Uterine leiomyomas (ULM are a common cause of solid pelvic tumors in women. Their etiopathogenesis remains unclear. Interleukins (ILs and their receptors can influence tumor biology of ULM. The aim of this study was to evaluate single nucleotide polymorphisms (SNPs exhibited in the genes IL4 (rs2070874, IL4R (rs1801275, IL12RB1 (rs11575934, IL12B (rs6887695, IL13 (rs20541 and IL23R (rs7517847 as risk factors for ULM in Slovenian women and to identify associations between corresponding clinical parameters and the analyzed SNPs. In addition, solitary and multiple ULM were compared to identify clinical and/or genetic parameters influencing their occurrence. We conducted a case-control study that included 181 women with leiomyomas and 133 control subjects. Genotyping of selected SNPs was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and high resolution melting (HRM techniques. The TT genotype of rs20541 (IL13 was significantly associated with decreased risk of ULM compared to both the CC and CT genotypes [p = 0.018; odds ratio (OR = 0.184; 95% confidence interval (95% CI = 0.048-0.7121. Using genetic and clinical data to develop a predictive model with logistic regression, we found that adenomyosis, higher age at diagnosis, family history of ULM occurrence, earlier menarche, lower number of pregnancies and lower age at first sexual intercourse, the G allele and genotypes AG and GG of rs1801275 (IL4R were associated with an increased risk of multiple ULM occurrence. We also found an association between rs20541 (IL13 and 17ß-estradiol serum levels in patients with multiple ULM (p 0.003. Our study showed, for the first time, that rs20541 (IL13 may contribute to susceptibility of ULM development and that rs1801275 (IL4R can predispose patients to develop multiple ULM.

  8. Relationship between estrogen receptor 1 gene polymorphisms and postmenopausal osteoporosis of the spine in Chinese women.

    Science.gov (United States)

    Shang, D P; Lian, H Y; Fu, D P; Wu, J; Hou, S S; Lu, J M

    2016-06-03

    The purpose of this study was to evaluate single nucleotide polymorphism (SNP) variants of the estrogen receptor 1 gene (ESR1) at rs2234693 and rs9340799, as well as to investigate the relationship between ESR gene polymorphisms and postmenopausal osteoporosis (OP) of the spine in Chinese women. We recruited 198 postmenopausal women with OP and 276 healthy women between May 2012 and September 2015 in Zhongshan Hospital. Dual energy x-ray absorptiometry was used to measure the bone mineral density (BMD) of the lumbar vertebrae in all subjects. In addition, PCR-restriction fragment length polymorphism based analysis was conducted to identify the genotypes of ESR1. The distribution of ESR1 in the osteoporosis group and the control group was determined; the relationship between ESR polymorphisms and BMD was analyzed. The distributions of BMD were: TT women.

  9. Ethnic differences in the prevalence of polymorphisms in CYP7A1, CYP7B1 AND CYP27A1 enzymes involved in cholesterol metabolism

    Directory of Open Access Journals (Sweden)

    Vera Dias

    2011-01-01

    Full Text Available It is well known that drug disposition and response are greatly determined by the activities of drug metabolizing enzymes, which are polymorphic. Some of these polymorphisms are clinically relevant and presented an ethnic-dependent pattern of distribution. The characterization of the genetic distribution of different populations allows the selection of therapeutic options in accordance with the genetic background, with the objective to avoid adverse reactions and inefficacy of the treatment. In this work, we studied selected genetic polymorphisms in drug metabolizing enzymes in three different ethnic groups - Portugal, Mozambique and Colombia. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP genotyping methods were developed for drug metabolizing enzymes, namely, cholesterol 7α-hydroxylase (CYP7A1 (−203A>C, −346C>T, −496C>T, N233S, G347S, sterol 27-hydroxylase (CYP27A1 (R164W, A169V, D273N, V400A and oxysterol 7α-hydroxylase (CYP7B1 (−116C>G, R324H, 1774C>T to characterize the allelic distribution of these polymorphisms among three different ethnic/geographic origins. A total of 12 CYP7A1, CYP27A1 and CYP7B1 genetic variants were genotyped in a sample of 92 Portuguese, 151 Mozambican and 91 Colombian subjects. The variants N233S in CYP7A1 and 1774C>T in CYP7B1 were not detected in any population studied. The promoter polymorphisms in CYP7A1 (−203A>C, −346C>T, −496C>T had high frequency in the three ethnic groups. G347S (CYP7A1, R164W, A169V and V400A (CYP27A1 were present in a low frequency but with a similar distribution in the three ethnic groups. Significant differences were observed for D273N (CYP27A1, −346C>T (CYP7A1, −116C>G and R324H (CYP7B1Our results demonstrate a high variability of drug metabolizing enzymes between the different populations analyzed, indicating that at least some of these polymorphisms are ethnic specific.

  10. Ethnic differences in the prevalence of polymorphisms in CYP7A1, CYP7B1 AND CYP27A1 enzymes involved in cholesterol metabolism.

    Science.gov (United States)

    Dias, Vera; Ribeiro, V

    2011-07-01

    It is well known that drug disposition and response are greatly determined by the activities of drug metabolizing enzymes, which are polymorphic. Some of these polymorphisms are clinically relevant and presented an ethnic-dependent pattern of distribution. The characterization of the genetic distribution of different populations allows the selection of therapeutic options in accordance with the genetic background, with the objective to avoid adverse reactions and inefficacy of the treatment. In this work, we studied selected genetic polymorphisms in drug metabolizing enzymes in three different ethnic groups - Portugal, Mozambique and Colombia. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) genotyping methods were developed for drug metabolizing enzymes, namely, cholesterol 7α-hydroxylase (CYP7A1) (-203A>C, -346C>T, -496C>T, N233S, G347S), sterol 27-hydroxylase (CYP27A1) (R164W, A169V, D273N, V400A) and oxysterol 7α-hydroxylase (CYP7B1) (-116C>G, R324H, 1774C>T) to characterize the allelic distribution of these polymorphisms among three different ethnic/geographic origins. A total of 12 CYP7A1, CYP27A1 and CYP7B1 genetic variants were genotyped in a sample of 92 Portuguese, 151 Mozambican and 91 Colombian subjects. The variants N233S in CYP7A1 and 1774C>T in CYP7B1 were not detected in any population studied. The promoter polymorphisms in CYP7A1 (-203A>C, -346C>T, -496C>T) had high frequency in the three ethnic groups. G347S (CYP7A1), R164W, A169V and V400A (CYP27A1) were present in a low frequency but with a similar distribution in the three ethnic groups. Significant differences were observed for D273N (CYP27A1), -346C>T (CYP7A1), -116C>G and R324H (CYP7B1)Our results demonstrate a high variability of drug metabolizing enzymes between the different populations analyzed, indicating that at least some of these polymorphisms are ethnic specific.

  11. DNA Sequence Variation and Selection of Tag Single-Nucleotide Polymorphisms at Candidate Genes for Drought-Stress Response in Pinus taeda L.

    Science.gov (United States)

    González-Martínez, Santiago C.; Ersoz, Elhan; Brown, Garth R.; Wheeler, Nicholas C.; Neale, David B.

    2006-01-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (πsil = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from ∼0.50 to ∼0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of ∼30–40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine. PMID:16387885

  12. AFLP polymorphisms allow high resolution genetic analysis of American Tegumentary Leishmaniasis agents circulating in Panama and other members of the Leishmania genus.

    Directory of Open Access Journals (Sweden)

    Carlos M Restrepo

    Full Text Available American Tegumentary Leishmaniasis is caused by parasites of the genus Leishmania, and causes significant health problems throughout the Americas. In Panama, Leishmania parasites are endemic, causing thousands of new cases every year, mostly of the cutaneous form. In the last years, the burden of the disease has increased, coincident with increasing disturbances in its natural sylvatic environments. The study of genetic variation in parasites is important for a better understanding of the biology, population genetics, and ultimately the evolution and epidemiology of these organisms. Very few attempts have been made to characterize genetic polymorphisms of parasites isolated from Panamanian patients of cutaneous leishmaniasis. Here we present data on the genetic variability of local isolates of Leishmania, as well as specimens from several other species, by means of Amplified Fragment Length Polymorphisms (AFLP, a technique seldom used to study genetic makeup of parasites. We demonstrate that this technique allows detection of very high levels of genetic variability in local isolates of Leishmania panamensis in a highly reproducible manner. The analysis of AFLP fingerprints generated by unique selective primer combinations in L. panamensis suggests a predominant clonal mode of reproduction. Using fluorescently labeled primers, many taxon-specific fragments were identified which may show potential as species diagnostic fragments. The AFLP permitted a high resolution genetic analysis of the Leishmania genus, clearly separating certain groups among L. panamensis specimens and highly related species such as L. panamensis and L. guyanensis. The phylogenetic networks reconstructed from our AFLP data are congruent with established taxonomy for the genus Leishmania, even when using single selective primer combinations. Results of this study demonstrate that AFLP polymorphisms can be informative for genetic characterization in Leishmania parasites, at

  13. Evidence for selection in response to radiation exposure: Pinus sylvestris in the Chernobyl exclusion zone

    International Nuclear Information System (INIS)

    Kuchma, Oleksandra; Finkeldey, Reiner

    2011-01-01

    Changes of genetic structures due to viability selection are likely to occur in populations exposed to rapidly and extremely changing environmental conditions after catastrophic events. However, very little is known about the extent of selective responses and in particular the proportion of the genome involved in putatively adaptive reactions for non-model plants. We used amplified fragment length polymorphisms (AFLPs) in order to investigate genetic differences between pine (Pinus sylvestris) trees which were partially exposed to extreme environmental conditions. Genetic variation patterns of pines exposed to high radiation in the Chernobyl exclusion zone with or without phenotypic stress symptoms were compared to control trees with a similar origin. Six percent of the investigated loci (15 of 222 loci) were identified as candidates for selective responses. Moderate differentiation was observed between groups of trees showing either weak or strong phenotypic responses to high radiation levels. - Highlights: → Genetic variation patterns of pines exposed to high radiation were investigated. → Pines with or without phenotypic stress symptoms were compared to control trees. → AFLP markers were used to reveal evidences of selection processes. → 15 of 222 loci are identified as candidates for selective responses. → Moderate differentiation is observed between irradiated and control trees. - Genetic responses to the exposure of trees to radiation in the Chernobyl zone may involve adaptive changes at a comparatively large part of the genome.

  14. The Prediction of the Expected Current Selection Coefficient of Single Nucleotide Polymorphism Associated with Holstein Milk Yield, Fat and Protein Contents

    Directory of Open Access Journals (Sweden)

    Young-Sup Lee

    2016-01-01

    Full Text Available Milk-related traits (milk yield, fat and protein have been crucial to selection of Holstein. It is essential to find the current selection trends of Holstein. Despite this, uncovering the current trends of selection have been ignored in previous studies. We suggest a new formula to detect the current selection trends based on single nucleotide polymorphisms (SNP. This suggestion is based on the best linear unbiased prediction (BLUP and the Fisher’s fundamental theorem of natural selection both of which are trait-dependent. Fisher’s theorem links the additive genetic variance to the selection coefficient. For Holstein milk production traits, we estimated the additive genetic variance using SNP effect from BLUP and selection coefficients based on genetic variance to search highly selective SNPs. Through these processes, we identified significantly selective SNPs. The number of genes containing highly selective SNPs with p-value <0.01 (nearly top 1% SNPs in all traits and p-value <0.001 (nearly top 0.1% in any traits was 14. They are phosphodiesterase 4B (PDE4B, serine/threonine kinase 40 (STK40, collagen, type XI, alpha 1 (COL11A1, ephrin-A1 (EFNA1, netrin 4 (NTN4, neuron specific gene family member 1 (NSG1, estrogen receptor 1 (ESR1, neurexin 3 (NRXN3, spectrin, beta, non-erythrocytic 1 (SPTBN1, ADP-ribosylation factor interacting protein 1 (ARFIP1, mutL homolog 1 (MLH1, transmembrane channel-like 7 (TMC7, carboxypeptidase X, member 2 (CPXM2 and ADAM metallopeptidase domain 12 (ADAM12. These genes may be important for future artificial selection trends. Also, we found that the SNP effect predicted from BLUP was the key factor to determine the expected current selection coefficient of SNP. Under Hardy-Weinberg equilibrium of SNP markers in current generation, the selection coefficient is equivalent to 2*SNP effect.

  15. Possibilities for marker-assisted selection in aquaculture breeding schemes

    International Nuclear Information System (INIS)

    Sonesson, A.K.

    2007-01-01

    FAO estimates that there are around 200 species in aquaculture. However, only a few species have ongoing selective breeding programmes. Marker-assisted selection (MAS) is not used in any aquaculture breeding scheme today. The aim of this chapter, therefore, is to review briefly the current status of aquaculture breeding schemes and to evaluate the possibilities for MAS of aquaculture species. Genetic marker maps have been published for some species in culture. The marker density of these maps is, in general, rather low and the maps are composed of many amplified fragment length polymorphism (AFLP) markers anchored to few microsatellites. Some quantitative trait loci (QTL) have been identified for economically important traits, but they are not yet mapped at a high density. Computer simulations of within-family MAS schemes show a very high increase in genetic gain compared with conventional family-based breeding schemes, mainly due to the large family sizes that are typical for aquaculture breeding schemes. The use of genetic markers to identify individuals and their implications for breeding schemes with control of inbreeding are discussed. (author)

  16. MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener

    2014-01-01

    Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

  17. XRCC1 gene polymorphisms and risk of ameloblastoma.

    Science.gov (United States)

    Yanatatsaneejit, Pattamawadee; Boonsuwan, Titiporn; Mutirangura, Apiwat; Kitkumthorn, Nakarin

    2013-06-01

    Ameloblastoma is a common benign odontogenic tumour with inherently aggressive behaviour. Genetic susceptibility of single nucleotide polymorphism (SNP) can likely predict ameloblastoma at risk patients but this data remains limited. Here, we studied XRCC1 polymorphism as a risk factor for ameloblastoma. Eighty-two ameloblastoma samples and blood from 140 healthy controls were used to perform polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for XRCC1 at codons 194, 280 and 399, and confirmed by sequence analysis. Compare to healthy control, a significant increase was noted in the occurrence of polymorphism at codon 194 and 399 in ameloblastoma patients. At codon 194, tryptophan encoded by T, was the susceptibility allele showed an ODD ratio of (95% CI)=1.62 (1.05-2.48), p=0.027. At codon 399, glycine encoded by A was the susceptibility allele showing ODD ratio of (95% CI)=1.83 (1.19-2.84), p=0.005. Moreover at codon 399, we found AG as the susceptibility genotype (2.06 (1.14-3.72), p=0.015). However, we did not find any significant increase in polymorphic occurrence in ameloblastoma patients at codon 280. For haplotype analysis of 3 codons, we found GGC as protective haplotype, and AGT as the risk haplotype. Our data suggest that polymorphism at codons 194 and 399, likely contributes to the risk of developing ameloblastoma. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Family Polymorphism

    DEFF Research Database (Denmark)

    Ernst, Erik

    2001-01-01

    This paper takes polymorphism to the multi-object level. Traditional inheritance, polymorphism, and late binding interact nicely to provide both flexibility and safety — when a method is invoked on an object via a polymorphic reference, late binding ensures that we get the appropriate implementat......This paper takes polymorphism to the multi-object level. Traditional inheritance, polymorphism, and late binding interact nicely to provide both flexibility and safety — when a method is invoked on an object via a polymorphic reference, late binding ensures that we get the appropriate...

  19. Selection of optimal spawning pairs to maintain genetic variation among captive populations of Acipenseridae based on the polymorphism of microsatellite loci

    Directory of Open Access Journals (Sweden)

    Kaczmarczyk Dariusz

    2016-06-01

    Full Text Available The American paddlefish, Polyodon spathula (Walbaum, is an endangered acipenserid fish. Its wild populations are supplemented with stocking material that is obtained by conducting artificial spawning in aquaculture conditions. When fish are bred in captivity, it is important to select breeding pairs that will produce the most genetically diverse progeny, since this permits maintaining the fitness of wild populations. Breeding pairs of land animals are selected successfully based on the polymorphism of their microsatellite loci. This theoretical paper asks how to adapt this technique to fish so that American paddlefish spawners can be paired with the aim of producing restocking material in aquaculture that maintains genetic variation. To test our calculating techniques, we used actual data on the polymorphism of the microsatellites from paddlefish broodstock at the Pogorze fish farm (Poland. The data enabled us to do calculations that showed which spawner pairs would create the most genetically diverse offspring and how to assemble sets of spawning pairs that would be best for maintaining genetic variation. The method presented in this paper can be used for breeding fish in aquaculture to help conserve species. It could also be used in a computer program which would automate calculations and present them in easy-to-read tables and graphs.

  20. Association between H-RAS T81C genetic polymorphism and gastrointestinal cancer risk: A population based case-control study in China

    International Nuclear Information System (INIS)

    Zhang, Yongjing; Jin, Mingjuan; Liu, Bing; Ma, Xinyuan; Yao, Kaiyan; Li, Qilong; Chen, Kun

    2008-01-01

    Gastrointestinal cancer, such as gastric, colon and rectal cancer, is a major medical and economic burden worldwide. However, the exact mechanism of gastrointestinal cancer development still remains unclear. RAS genes have been elucidated as major participants in the development and progression of a series of human tumours and the single nucleotide polymorphism at H-RAS cDNA position 81 was demonstrated to contribute to the risks of bladder, oral and thyroid carcinoma. Therefore, we hypothesized that this polymorphisms in H-RAS could influence susceptibility to gastrointestinal cancer as well, and we conducted this study to test the hypothesis in Chinese population. A population based case-control study, including 296 cases with gastrointestinal cancer and 448 healthy controls selected from a Chinese population was conducted. H-RAS T81C polymorphism was genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) assay. In the healthy controls, the TT, TC and CC genotypes frequencies of H-RAS T81C polymorphism, were 79.24%, 19.87% and 0.89%, respectively, and the C allele frequency was 10.83%. Compared with TT genotype, the TC genotype was significantly associated with an increased risk of gastric cancer (adjusted OR = 3.67, 95%CI = 2.21–6.08), while the CC genotype showed an increased risk as well (adjusted OR = 3.29, 95%CI = 0.54–19.86), but it was not statistically significant. In contrast, the frequency of TC genotype was not significantly increased in colon cancer and rectal cancer patients. Further analysis was performed by combining TC and CC genotypes compared against TT genotype. As a result, a statistically significant risk with adjusted OR of 3.65 (95%CI, 2.22–6.00) was found in gastric cancer, while no significant association of H-RAS T81C polymorphism with colon cancer and rectal cancer was observed. These findings indicate, for the first time, that there is an H-RAS T81C polymorphism existing in Chinese population

  1. Association between H-RAS T81C genetic polymorphism and gastrointestinal cancer risk: A population based case-control study in China

    Directory of Open Access Journals (Sweden)

    Li Qilong

    2008-09-01

    Full Text Available Abstract Background Gastrointestinal cancer, such as gastric, colon and rectal cancer, is a major medical and economic burden worldwide. However, the exact mechanism of gastrointestinal cancer development still remains unclear. RAS genes have been elucidated as major participants in the development and progression of a series of human tumours and the single nucleotide polymorphism at H-RAS cDNA position 81 was demonstrated to contribute to the risks of bladder, oral and thyroid carcinoma. Therefore, we hypothesized that this polymorphisms in H-RAS could influence susceptibility to gastrointestinal cancer as well, and we conducted this study to test the hypothesis in Chinese population. Methods A population based case-control study, including 296 cases with gastrointestinal cancer and 448 healthy controls selected from a Chinese population was conducted. H-RAS T81C polymorphism was genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP assay. Results In the healthy controls, the TT, TC and CC genotypes frequencies of H-RAS T81C polymorphism, were 79.24%, 19.87% and 0.89%, respectively, and the C allele frequency was 10.83%. Compared with TT genotype, the TC genotype was significantly associated with an increased risk of gastric cancer (adjusted OR = 3.67, 95%CI = 2.21–6.08, while the CC genotype showed an increased risk as well (adjusted OR = 3.29, 95%CI = 0.54–19.86, but it was not statistically significant. In contrast, the frequency of TC genotype was not significantly increased in colon cancer and rectal cancer patients. Further analysis was performed by combining TC and CC genotypes compared against TT genotype. As a result, a statistically significant risk with adjusted OR of 3.65 (95%CI, 2.22–6.00 was found in gastric cancer, while no significant association of H-RAS T81C polymorphism with colon cancer and rectal cancer was observed. Conclusion These findings indicate, for the first time, that there

  2. [Association between ameloblastin gene polymorphisms and the susceptibility to dental fluorosis].

    Science.gov (United States)

    Jiao, Yong-zhuo; Mu, Li-hong; Wang, Ying-xiong; An, Wei; Jiang, Miao

    2013-01-01

    To study the distribution of ameloblastin (AMBN) gene polymorphism in coal-fire caused fluorosis (CFCF) in Chongqing municipality and the relationship between AMBN gene polymorphism and the susceptibility to dental fluorosis. Under a case-control study, 100 children aged 8 - 12 and 30 adults with dental fluorosis were enrolled in Wushan and Fengjie counties of Chongqing from December 2010 to February 2011. Another 100 children aged 8 - 12 and 30 adults with non-dental fluorosis were chosen as internal control groups together with 50 children and 30 adults without dental fluorosis were selected as external control groups in the non-epidemic area of Yubei district. DNA was extracted from peripheral blood sample of these people. Genotype of AMBN gene 7 extron 538_540delGGA, 10 extron 657A > G and 13 extron 986C > T loci were detected using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The rates of 7 extron 538_540delGGA loci among case, internal and external control groups were as follows: GGA/GGA-/- 61.2% (74/121), 78.5% (102/130), 74.3% (52/70) ; GGA/-: 24.0% (29/121), 15.4% (20/130), 22.9% (16/70) ; -/-: 14.8% (18/121), 6.1% (8/130), 2.8% (2/70), the difference was statistically significant (χ(2) = 14.353 P 0.05). CC appeared as 81.0% (98/121), 90.0% (117/130), 87.1% (61/70) while CT as 19.0% (23/121), 10.0% (13/130), 12.9% (9/70), with difference not statistically significant (χ(2) = 4.319, P > 0.05). In comparing with the two control groups, the frequency of GGA/GGA was decreasing (χ(2) values were 8.957, 3.405, respectively, P fluorosis (OR values were 2.7, 5.9, respectively, P fluorosis (OR = 2.1, P T loci polymorphism in AMBN gene might serve as the susceptibility factors causing the coal-fired fluorosis.

  3. Selective crystal growth of polymorphs and crystal-to-crystal thermal phase transition of non-peripherally alkyl-substituted phthalocyanine and tetrabenzotriazaporphyrin

    Science.gov (United States)

    Ohmori, Masashi; Nakano, Chika; Fujii, Akihiko; Shimizu, Yo; Ozaki, Masanori

    2017-06-01

    Selective crystal growth of polymorphs and crystal-to-crystal thermal phase transition of non-peripherally alkyl-substituted macrocycle molecules, such as octapentylphthalocyanine (C5PcH2), octahexylphthalocyanine (C6PcH2), and octahexyltetrabenzotriazaporphyrin (C6TBTAPH2) have been investigated. Two types of single crystals, called α-type and β-type, were separately grown by controlling the recrystallization conditions, and the crystal structures were determined by single-crystal X-ray structure analysis. The irreversible crystal-to-crystal thermal phase transition from α-type to β-type were observed by the differential scanning calorimetry and temperature-controlled X-ray structure analysis. The selective crystal growth of the α-type or β-type and the irreversible crystal-to-crystal thermal phase transition have been discussed by taking the alkyl-substituent distribution into consideration.

  4. Different Patterns of pfcrt and pfmdr1 Polymorphisms in P. falciparum Isolates from Nigeria and Brazil: The Potential Role of Antimalarial Drug Selection Pressure

    Science.gov (United States)

    Gbotosho, Grace O.; Folarin, Onikepe A.; Bustamante, Carolina; Pereira da Silva, Luis Hildebrando; Mesquita, Elieth; Sowunmi, Akintunde; Zalis, Mariano G.; Oduola, Ayoade M. J.; Happi, Christian T.

    2012-01-01

    The effect of antimalarial drug selection on pfcrt and pfmdr1 polymorphisms in Plasmodium falciparum isolates from two distinct geographical locations was determined in 70 and 18 P. falciparum isolates from Nigeria and Brazil, respectively, using nested polymerase chain reaction and direct DNA sequencing approaches. All isolates from Brazil and 72% from Nigeria harbored the mutant SVMNT and CVIET pfcrt haplotype, respectively. The pfcrt CVMNT haplotype was also observed in (7%) of the Nigerian samples. One hundred percent (100%) and 54% of the parasites from Brazil and Nigeria, respectively, harbored wild-type pfmdr1Asn86. We provide first evidence of emergence of the CVMNT haplotype in West Africa. The high prevalence of pfcrt CVIET and SVMNT haplotypes in Nigeria and Brazil, respectively, is indicative of different selective pressure by chloroquine and amodiaquine. Continuous monitoring of pfcrt SVMNT haplotype is required in endemic areas of Africa, where artesunate-amodiaquine combination is used for treatment of acute uncomplicated malaria. PMID:22302850

  5. Polymorphisms and haplotypes in methylenetetrahydrofolate reductase gene and head and neck squamous cell carcinoma risk.

    Science.gov (United States)

    Galbiatti, Ana Lívia Silva; Ruiz, Mariangela Torreglosa; Rodrigues, Juliana Olsen; Raposo, Luiz Sérgio; Maníglia, José Victor; Pavarino, Érika Cristina; Goloni-Bertollo, Eny Maria

    2012-01-01

    Functional polymorphisms in genes encoding enzymes involved in folate metabolism might modulate head and neck carcinoma risk because folate participates in DNA methylation and synthesis. We therefore conducted a case-control study of 853 individuals (322 head and neck cancer cases and 531 non-cancer controls) to investigate associations among MTHFR C677T and MTHFR A1298C polymorphisms and head and neck squamous cell carcinoma risk. Interactions between these two polymorphisms and risk factors and clinical histopathological parameters were also evaluated. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to genotype the polymorphisms and Chi-square test and multiple logistic regression were used for statistical analyses. The variables age≥49 years, male gender, tobacco habits and alcohol consumption, MTHFR 1298 AC or CC genotypes, combined genotypes with two or more polymorphic alleles and 677T and 1298C polymorphic alleles were associated with increased risk for this disease (PA1298C polymorphism was more frequent in patients with oral cavity as primary site (PA1298C polymorphism has higher risk for this disease.

  6. Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

    Science.gov (United States)

    Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

    2016-01-01

    We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

  7. Relationship between Occupational Stress, 5-HT2A Receptor Polymorphisms and Mental Health in Petroleum Workers in the Xinjiang Arid Desert: A Cross-Sectional Study.

    Science.gov (United States)

    Jiang, Ting; Ge, Hua; Sun, Jian; Li, Rong; Han, Rui; Liu, Jiwen

    2017-04-10

    At present, there is growing interest in research examining the relationship between occupational stress and mental health. Owing to the socioeconomic impact of occupational stress and the unique environment of petroleum workers in Xinjiang, a cross-sectional study was carried out between April and December 2015 to investigate the relationship between occupational stress, 5-hydroxytryptamine receptor (5-HTR2A) genotype, and mental health. A total of 1485 workers were selected. The Symptom Checklist 90 was used to assess nine classes of psychological symptoms. Work-related stressors were evaluated using the Occupational Stress Inventory-Revised Edition. Levels of 5-HTR2A (the Tl02C and A-1438G single nucleotide polymorphism in the 5-HTR2A gene) were measured by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The findings of the present study revealed a high prevalence rate of mental health problems (40.29%) in petroleum workers stationed in the arid desert, and suggested a strong correlation between occupational stress and mental health. The TC and CC genotype of Tl02C were found to be protective factors against mental health problems (odds ratio (OR) = 0.455, 95% confidence interval (CI): = 0.269-0.771, odds ratio (OR) = 0.340, 95% confidence interval (CI): 0.162-0.716). AG and GG genotype of A-1438G [odds ratio (OR) 1 = 2.729, 95% confidence interval (CI): 1.433-5.195; odds ratio (OR) 2 = 2.480, 95% confidence interval (CI): 1.221-5.037] were revealed as risk factors. These data provide evidence that occupational stress and 5-HTR2A gene polymorphism contributes to the incidence of mental health problems.

  8. A polymorphism in the melanocortin 4 receptor gene (MC4R:c.92C>T) is associated with diabetes mellitus in overweight domestic shorthaired cats.

    Science.gov (United States)

    Forcada, Y; Holder, A; Church, D B; Catchpole, B

    2014-01-01

    Feline diabetes mellitus (DM) shares many pathophysiologic features with human type 2 DM. Human genome-wide association studies have identified genes associated with obesity and DM, including melanocortin 4 receptor (MC4R), which plays an important role in energy balance and appetite regulation. To identify single nucleotide polymorphisms (SNPs) in the feline MC4R gene and to determine whether any SNPs are associated with DM or overweight body condition in cats. Two-hundred forty domestic shorthaired (DSH) cats were recruited for the study. Of these, 120 diabetics were selected (60 overweight, 60 lean), along with 120 nondiabetic controls (60 overweight and 60 lean). Males and females were equally represented. A prospective case-control study was performed. Genomic DNA was extracted from blood samples and used as template for PCR amplification of the feline MC4R gene. The coding region of the gene was sequenced in 10 cats to identify polymorphisms. Subsequently, genotyping by restriction fragment length polymorphism (RFLP) analysis assessed MC4R:c.92C > T allele and genotype frequencies in each group of cats. No significant differences in MC4R:c.92C>T allele or genotype frequencies were identified between nondiabetic overweight and lean cats. In the overweight diabetic group, 55% were homozygous for the MC4R:c.92C allele, compared to 33% of the lean diabetics and 30% of the nondiabetics. The differences between the overweight diabetic and the nondiabetics were significant (P overweight DSH cats, similar to the situation in humans. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  9. Relationship between Occupational Stress, 5-HT2A Receptor Polymorphisms and Mental Health in Petroleum Workers in the Xinjiang Arid Desert: A Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Ting Jiang

    2017-04-01

    Full Text Available At present, there is growing interest in research examining the relationship between occupational stress and mental health. Owing to the socioeconomic impact of occupational stress and the unique environment of petroleum workers in Xinjiang, a cross-sectional study was carried out between April and December 2015 to investigate the relationship between occupational stress, 5-hydroxytryptamine receptor (5-HTR2A genotype, and mental health. A total of 1485 workers were selected. The Symptom Checklist 90 was used to assess nine classes of psychological symptoms. Work-related stressors were evaluated using the Occupational Stress Inventory-Revised Edition. Levels of 5-HTR2A (the Tl02C and A-1438G single nucleotide polymorphism in the 5-HTR2A gene were measured by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP. The findings of the present study revealed a high prevalence rate of mental health problems (40.29% in petroleum workers stationed in the arid desert, and suggested a strong correlation between occupational stress and mental health. The TC and CC genotype of Tl02C were found to be protective factors against mental health problems (odds ratio (OR = 0.455, 95% confidence interval (CI: = 0.269–0.771, odds ratio (OR = 0.340, 95% confidence interval (CI: 0.162–0.716. AG and GG genotype of A-1438G [odds ratio (OR 1 = 2.729, 95% confidence interval (CI: 1.433–5.195; odds ratio (OR 2 = 2.480, 95% confidence interval (CI: 1.221–5.037] were revealed as risk factors. These data provide evidence that occupational stress and 5-HTR2A gene polymorphism contributes to the incidence of mental health problems.

  10. Analysis of Positive Selection at Single Nucleotide Polymorphisms Associated with Body Mass Index Does Not Support the "Thrifty Gene" Hypothesis.

    Science.gov (United States)

    Wang, Guanlin; Speakman, John R

    2016-10-11

    The "thrifty gene hypothesis" suggests genetic susceptibility to obesity arises because of positive selection for alleles that favored fat deposition and survival during famines. We used public domain data to locate signatures of positive selection based on derived allele frequency, genetic diversity, long haplotypes, and differences between populations at SNPs identified in genome-wide association studies (GWASs) for BMI. We used SNPs near the lactase (LCT), SLC24A5, and SLC45A2 genes as positive controls and 120 randomly selected SNPs as negative controls. We found evidence for positive selection (p positive selection for the protective allele (i.e., for leanness). The widespread absence of signatures of positive selection, combined with selection favoring leanness at some alleles, does not support the suggestion that obesity provided a selective advantage to survive famines, or any other selective advantage. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Examination of Growth Hormone (GH) Gene Polymorphism and its Association with Body Weight and Selected Body Dimensions in Ducks.

    Science.gov (United States)

    Mazurowski, Artur; Frieske, Anna; Kokoszynski, Dariusz; Mroczkowski, Sławomir; Bernacki, Zenon; Wilkanowska, Anna

    2015-01-01

    The main objective of the study was to assess the polymorphism in intron 2 of the GH gene and its association with some morphological traits (body weight--BW, length of trunk with neck--LTN, length of trunk--LT, chest girth--CG, length of breast bone--LBB, length of shank--LS). Polymorphism in intron 2 of the GH gene was evaluated for four duck populations (Pekin ducks AF51, Muscovy ducks from a CK and CRAMMLCFF mother and Mulard ducks). Genetic polymorphism was determined with the PCR-RFLP method using the BsmFI restriction enzyme. In the studied duck sample two alleles (GH(C) and GH(T)) and three genotypes (GH/TT, GH/CT, GH/CC) were found at locus GH/BsmFI. In both groups of Muscovies and in Mulards the dominant allele was GH(T). On the contrary in Pekin ducks AF51, the frequency of both alleles was found to be similar. The most frequent genotype in the examined ducks was GH/TT. In Pekin ducks AF51 three genotypes were observed, while in Mulard ducks and in male Muscovy ducks from a mother marked as CK, two genotypes (GH/TT and GH/CT) were identified. Muscovy duck females from a CK mother and all males and females of Muscovy duck from a CRAMMLCFF mother were monomorphic with only the GH/TTgenotype detected. The results showed that males of Pekin duck AF51 with the GH/TT genotype were characterized by higher (P GH/CC and GH/CTgenotype. In females of Pekin ducks AF51, this same trend was observed; individuals with GH/TT genotype were superior (P GH/TT genotype were distinguished by higher values of all evaluated traits compared to ducks with GH/CT and GH/CC genotypes, however most of the recorded differences were not significant. The only trait markedly impacted (P GH gene intron 2 was the LS value in males.

  12. The -2518 A/G MCP-1 polymorphism as a risk factor of inflammatory bowel disease.

    Science.gov (United States)

    Walczak, Anna; Przybyłowska, Karolina; Sygut, Andrzej; Dziki, Lukasz; Chojnacki, Cezary; Chojnacki, Jan; Dziki, Adam; Majsterek, Ireneusz

    2012-05-01

    Inflammatory bowel diseases (IBD) are disorders originated from immune disturbances. The AIM OF THE STUDY was to evaluate the association between the -2518 A/G MCP-1 polymorphism and the risk of IBD development. Genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Study group consisted of 197 subjects with IBD (120 with ulcerative colitis and 77 with Crohn's disease) as well as 210 healthy controls. The presence of the -2518 G/G MCP-1 genotype in the investigated groups seems to be connected with higher risk of inflammatory bowel disease as well as Crohn's disease only (OR 2.26; 95% CI 1.44-3.54 and OR 2.08; 95% CI 1.21-3.46, respectively). Our data showed that the -2518 A/G MCP-1 polymorphism might be associated with the IBD occurrence and might be used as predictive factor of these diseases in a Polish population.

  13. Isolation and characterization of sixteen polymorphic microsatellite loci in the golden apple snail Pomacea canaliculata.

    Science.gov (United States)

    Chen, Lian; Xu, Haigen; Li, Hong; Wu, Jun; Ding, Hui; Liu, Yan

    2011-01-01

    We report the characterization of 16 polymorphic microsatellite markers in the golden apple snail, Pomacea canaliculata, a pest registered in the list of "100 of the world's worst invasive alien species". The fast isolation by AFLP (Amplified Fragment Length Polymorphism) of sequences containing repeats (FIASCO) method was used to isolate microsatellite loci, and polymorphism was explored with 29 individuals collected in an invasive region from China. These primers showed a number of alleles per locus ranging from three to 13. The ranges of observed and expected heterozygosity were 0.310-0.966 and 0.523-0.898, respectively. These microsatellite markers described here will be useful for population genetic studies of P. canaliculata.

  14. Isolation and Characterization of Sixteen Polymorphic Microsatellite Loci in the Golden Apple Snail Pomacea canaliculata

    Directory of Open Access Journals (Sweden)

    Yan Liu

    2011-09-01

    Full Text Available We report the characterization of 16 polymorphic microsatellite markers in the golden apple snail, Pomacea canaliculata, a pest registered in the list of “100 of the world’s worst invasive alien species”. The fast isolation by AFLP (Amplified Fragment Length Polymorphism of sequences containing repeats (FIASCO method was used to isolate microsatellite loci, and polymorphism was explored with 29 individuals collected in an invasive region from China. These primers showed a number of alleles per locus ranging from three to 13. The ranges of observed and expected heterozygosity were 0.310–0.966 and 0.523–0.898, respectively. These microsatellite markers described here will be useful for population genetic studies of P. canaliculata.

  15. Assessment of Tools for Marker-Assisted Selection in a Marine Commercial Species: Significant Association between MSTN-1 Gene Polymorphism and Growth Traits

    Directory of Open Access Journals (Sweden)

    Irma Sánchez-Ramos

    2012-01-01

    Full Text Available Growth is a priority trait from the point of view of genetic improvement. Molecular markers linked to quantitative trait loci (QTL have been regarded as useful for marker-assisted selection in complex traits as growth. Polymorphisms have been studied in five candidate genes influencing growth in gilthead seabream (Sparus aurata: the growth hormone (GH, insulin-like growth factor-1 (IGF-1, myostatin (MSTN-1, prolactin (PRL, and somatolactin (SL genes. Specimens evaluated were from a commercial broodstock comprising 131 breeders (from which 36 males and 44 females contributed to the progeny. In all samples eleven gene fragments, covering more than 13,000 bp, generated by PCR-RFLP, were analyzed; tests were made for significant associations between these markers and growth traits. ANOVA results showed a significant association between MSTN-1 gene polymorphism and growth traits. Pairwise tests revealed several RFLPs in the MSTN-1 gene with significant heterogeneity of genotypes among size groups. PRL and MSTN-1 genes presented linkage disequilibrium. The MSTN-1 gene was mapped in the centromeric region of a medium-size acrocentric chromosome pair.

  16. The-1131T > C Polymorphism in the Apolipoprotein A5 Gene is Related to Hypertriglyceridemia in Taiwanese Aborigines

    Directory of Open Access Journals (Sweden)

    Meng-Chuan Huang

    2008-04-01

    Full Text Available The prevalence of hypertriglyceridemia, considered to be an independent risk factor for the development of cardiovascular disease, is high in Taiwanese aborigines. This study was undertaken to examine the effect of the -1131T > C polymorphism in the apolipoprotein A5 gene on serum triglyceride levels in female Taiwanese aborigines. This was a cross-sectional study, and a total of 316 unrelated female Taiwanese aborigines were genotyped at the -1131T > C polymorphism in apolipoprotein A5 using the polymerase chain reaction-restriction fragment length polymorphism method. Serum triglyceride ≥150 mg/dL was defined as the hypertriglyceridemia group and triglyceride C polymorphism of the Apo A5 gene influences serum triglyceride levels in female Taiwanese aborigines, and that differences exist in the frequency of the C allele among people of various ethnicities.

  17. Low density lipoprotein receptor gene Ava II polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    Directory of Open Access Journals (Sweden)

    Wu Dong-Feng

    2011-02-01

    Full Text Available Abstract Background Several common genetic polymorphisms in the low density lipoprotein receptor (LDL-R gene have associated with modifications of serum total cholesterol (TC and low density lipoprotein cholesterol (LDL-C levels, but the results are not consistent in different populations. Bai Ku Yao is a special subgroup of the Yao minority in China. The present study was undertaken to detect the association of LDL-R gene Ava Ⅱ polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 1024 subjects of Bai Ku Yao and 792 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the LDL-R gene Ava Ⅱ polymorphism was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum TC, high density lipoprotein cholesterol (HDL-C, LDL-C, apolipoprotein (Apo A1 and the ratio of ApoA1 to ApoB were lower in Bai Ku Yao than in Han (P - and A+ alleles was 65.5% and 34.5% in Bai Ku Yao, and 80.7% and 19.3% in Han (P -A-, A-A+ and A+A+ genotypes was 42.6%, 45.9% and 11.5% in Bai Ku Yao, and 64.9%, 31.6% and 3.5% in Han (P P 3.20 mmol/L subgroups in Bai Ku Yao (P P P P +A+ genotype had higher serum LDL-C, TC, HDL-C or ApoA1 levels than the subjects with A-A+ and A-A- genotypes. Spearman rank correlation analysis revealed that the levels of LDL-C in Bai Ku Yao and HDL-C in Han were correlated with genotypes (P P Conclusions The association of LDL-R gene Ava Ⅱ polymorphism and serum lipid levels is different between the Bai Ku Yao and Han populations. The discrepancy might partly result from different LDL-R gene Ava Ⅱ polymorphism or LDL-R gene-enviromental interactions.

  18. Multi-drug resistance 1 genetic polymorphism and prediction of chemotherapy response in Hodgkin's Lymphoma

    Directory of Open Access Journals (Sweden)

    Haddadin William J

    2011-07-01

    Full Text Available Abstract Background The human multi-drug resistance gene (MDR1, which encodes the major trans-membrane transporter P-glycoprotein (P-gp, was found to be associated with susceptibility to cancer and response to chemotherapy. The C3435T Polymorphism of MDR1 gene was correlated with expression levels and functions of P-gp. Here, we studied the association between MDR1 C3435T polymorphism and susceptibility to Hodgkin lymphoma (HL and patient's response to ABVD chemotherapy regimen. Methods a total of 130 paraffin embedded tissue samples collected from HL patients were analyzed to identify the C3435T polymorphism. As a control group, 120 healthy subjects were enrolled in the study. The C3435T Polymorphism was genotyped by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP method. Data analysis was carried out using the statistical package SPSS version 17 to compute all descriptive statistics. Chi-square and Fisher exact tests were used to evaluate the genotype distribution and allele frequencies of the studied polymorphism. Results these studies revealed that the frequency of T allele was significantly higher in HL patients compared to the controls (P 0.05. Conclusions these results suggest that MDR1 C3435T polymorphism might play a role in HL occurrence; however this polymorphism is not correlated with the clinical response to ABVD.

  19. Association Study of Transforming Growth Factor Alpha TaqI Polymorphism and the Risk of Cleft Lip and/or Palate in an Iranian Population.

    Science.gov (United States)

    Bagheri, Fahimeh; Ebadifar, Asghar; Khorram Khorshid, Hamid Reza; Kamali, Koorosh

    2017-10-16

    The aim of this study is to evaluate the association of TGFA TaqI polymorphism with nonsyndromic cleft lip and/or palate (NSCLP) in an Iranian population. In this case-control study, 113 children with NSCLP and 209 controls were included. Genotyping of the TaqI polymorphism was performed by polymerase chain reaction and restriction fragment length polymorphism methods. A p-value of control group (p = 0.422) were in Hardy-Weinberg equilibrium. There was no statistically significant difference in the genotype distribution (p = 0.059) and allele frequency (p = 0.065) of the TGFA TaqI polymorphism in the NSCLP and control groups. TGFA TaqI polymorphism was not associated with the risk of NSCLP in Iranian children. Birth Defects Research 109:1386-1389, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Methylenetetrahydrofolate reductase gene polymorphisms in Egyptian Turner Syndrome patients.

    Science.gov (United States)

    Ismail, Manal F; Zarouk, Waheba A; Ruby, Mona O; Mahmoud, Wael M; Gad, Randa S

    2015-01-01

    Folate metabolism dysfunctions can result in DNA hypomethylation and abnormal chromosome segregation. Two common polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) encoding gene (C677T and A1298C) reduce MTHFR activity, but when associated with aneuploidy, the results are conflicting. Turner Syndrome (TS) is an interesting model for investigating the association between MTHFR gene polymorphisms and nondisjunction because of the high frequency of chromosomal mosaicism in this syndrome. To investigate the association of MTHFR gene C677T and A1298C polymorphisms in TS patients and their mothers and to correlate these polymorphisms with maternal risk of TS offspring. MTHFR C677T and A1298C polymorphisms were genotyped in 33 TS patients, their mothers and 15 healthy females with their mothers as controls using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing technique. Genotype and allele frequencies of both C677T and A1298C were not significantly different between TS cases and controls. There were no significant differences in C677T genotype distribution between the TS mothers and controls (p=1). The MTHFR 1298AA and 1298AC genotypes were significantly increased in TS mothers Vs. control mothers (p=0.002). The C allele frequency of the A1298C polymorphism was significantly different between the TS mothers and controls (p=0.02). The association of A1298C gene polymorphism in TS patients was found to increase with increasing age of both mothers (p=0.026) and fathers (p=0.044) of TS cases. Our findings suggest a strong association between maternal MTHFR A1298C and risk of TS in Egypt.

  1. Quinine treatment selects the pfnhe-1 ms4760-1 polymorphism in Malian patients with Falciparum malaria.

    Science.gov (United States)

    Kone, Aminatou; Mu, Jianbing; Maiga, Hamma; Beavogui, Abdoul H; Yattara, Omar; Sagara, Issaka; Tekete, Mamadou M; Traore, Oumar B; Dara, Antoine; Dama, Souleymane; Diallo, Nouhoum; Kodio, Aly; Traoré, Aliou; Björkman, Anders; Gil, Jose P; Doumbo, Ogobara K; Wellems, Thomas E; Djimde, Abdoulaye A

    2013-02-01

    The mechanism of Plasmodium falciparum resistance to quinine is not known. In vitro quantitative trait loci mapping suggests involvement of a predicted P. falciparum sodium-hydrogen exchanger (pfnhe-1) on chromosome 13. We conducted prospective quinine efficacy studies in 2 villages, Kollé and Faladié, Mali. Cases of clinical malaria requiring intravenous therapy were treated with standard doses of quinine and followed for 28 days. Treatment outcomes were classified using modified World Health Organization protocols. Molecular markers of parasite polymorphisms were used to distinguish recrudescent parasites from new infections. The prevalence of pfnhe-1 ms4760-1 among parasites before versus after quinine treatment was determined by direct sequencing. Overall, 163 patients were enrolled and successfully followed. Without molecular correction, the mean adequate clinical and parasitological response (ACPR) was 50.3% (n = 163). After polymerase chain reaction correction to account for new infections, the corrected ACPR was 100%. The prevalence of ms4760-1 increased significantly, from 26.2% (n = 107) before quinine treatment to 46.3% (n = 54) after therapy (P = .01). In a control sulfadoxine-pyrimethamine study, the prevalence of ms4760-1 was similar before and after treatment. This study supports a role for pfnhe-1 in decreased susceptibility of P. falciparum to quinine in the field.

  2. Genome-wide survey of single-nucleotide polymorphisms reveals fine-scale population structure and signs of selection in the threatened Caribbean elkhorn coral, Acropora palmata

    Directory of Open Access Journals (Sweden)

    Meghann K. Devlin-Durante

    2017-11-01

    Full Text Available The advent of next-generation sequencing tools has made it possible to conduct fine-scale surveys of population differentiation and genome-wide scans for signatures of selection in non-model organisms. Such surveys are of particular importance in sharply declining coral species, since knowledge of population boundaries and signs of local adaptation can inform restoration and conservation efforts. Here, we use genome-wide surveys of single-nucleotide polymorphisms in the threatened Caribbean elkhorn coral, Acropora palmata, to reveal fine-scale population structure and infer the major barrier to gene flow that separates the eastern and western Caribbean populations between the Bahamas and Puerto Rico. The exact location of this break had been subject to discussion because two previous studies based on microsatellite data had come to differing conclusions. We investigate this contradiction by analyzing an extended set of 11 microsatellite markers including the five previously employed and discovered that one of the original microsatellite loci is apparently under selection. Exclusion of this locus reconciles the results from the SNP and the microsatellite datasets. Scans for outlier loci in the SNP data detected 13 candidate loci under positive selection, however there was no correlation between available environmental parameters and genetic distance. Together, these results suggest that reef restoration efforts should use local sources and utilize existing functional variation among geographic regions in ex situ crossing experiments to improve stress resistance of this species.

  3. Genome-wide survey of single-nucleotide polymorphisms reveals fine-scale population structure and signs of selection in the threatened Caribbean elkhorn coral, Acropora palmata.

    Science.gov (United States)

    Devlin-Durante, Meghann K; Baums, Iliana B

    2017-01-01

    The advent of next-generation sequencing tools has made it possible to conduct fine-scale surveys of population differentiation and genome-wide scans for signatures of selection in non-model organisms. Such surveys are of particular importance in sharply declining coral species, since knowledge of population boundaries and signs of local adaptation can inform restoration and conservation efforts. Here, we use genome-wide surveys of single-nucleotide polymorphisms in the threatened Caribbean elkhorn coral, Acropora palmata , to reveal fine-scale population structure and infer the major barrier to gene flow that separates the eastern and western Caribbean populations between the Bahamas and Puerto Rico. The exact location of this break had been subject to discussion because two previous studies based on microsatellite data had come to differing conclusions. We investigate this contradiction by analyzing an extended set of 11 microsatellite markers including the five previously employed and discovered that one of the original microsatellite loci is apparently under selection. Exclusion of this locus reconciles the results from the SNP and the microsatellite datasets. Scans for outlier loci in the SNP data detected 13 candidate loci under positive selection, however there was no correlation between available environmental parameters and genetic distance. Together, these results suggest that reef restoration efforts should use local sources and utilize existing functional variation among geographic regions in ex situ crossing experiments to improve stress resistance of this species.

  4. Efficiency of selection, as measured by single nucleotide polymorphism variation, is dependent on inbreeding rate in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Demontis, Ditte; Pertoldi, Cino; Loeschcke, Volker

    2009-01-01

    over homozygous individuals by natural selection, either by associative over-dominance or balancing selection, or a combination of both. Furthermore, we found a significant polynomial correlation between genetic variance and wing size and shape in the fast inbred lines. This was caused by a greater......It is often hypothesized that slow inbreeding causes less inbreeding depression than fast inbreeding at the same absolute level of inbreeding. Possible explanations for this phenomenon include the more efficient purging of deleterious alleles and more efficient selection for heterozygote...... genetic variance than fast inbreeding. These results increase our understanding of the genetic basis of the common observation that slow inbred lines express less inbreeding depression than fast inbred lines. In addition, this has more general implications for the importance of selection in maintaining...

  5. [Correlation of matrix metalloproteinase-9 polymorphisms with chronic periodontitis in Uygur adults].

    Science.gov (United States)

    Ma, T; Li, D D; Huang, P; Zhao, J

    2017-06-09

    Objective: To investigate the association between matrix metalloproteinase-9 (MMP-9) polymorphisms and chronic periodontitis in Uygur adults. Methods: A total of 196 patients with chronic periodontitis and 97 healthy controls were selected from 2 500 Uygur people. Buccal swab samples were taken, the genomic DNA was extracted and the genotype distribution and allele frequency of MMP-9 were determined by PCR-restriction fragment length polymorphism (PCR-RFLP). The distribution of genotypes, allele frequencies and risk factors were analyzed by chi-square test and multiple logistic regression. Results: Significant difference was found between healthy controls and the mild periodontitis and moderate to severe periodontitis in the MMP-9 1562C/T CC genotype expression (χ(2)=9.901, P= 0.002; χ(2)=13.397, P< 0.001), and detectable rate of MMP-9 1562C/T CC genotype in the three groups was 31.3%(30/96), 53.5% (53/99), 27.8%(27/97), respectively. The detectable rate of CT genotype expression in the three groups were 65.6% (63/96), 45.5% (45/99), 69.1% (67/97) respectively and there was significant difference between healthy controls and mild periodontitis and between the mild periodontitis and moderate to severe periodontitis (χ(2)=8.025, P= 0.005; χ(2)=11.159, P< 0.001). There was also significant difference in allele frequency between healthy controls and mild periodontitis and between mild periodontitis and moderate to severe periodontitis (χ(2)=6.270, P= 0.012; χ(2)=8.184, P= 0.004). Logistic analysis showed that age under 35 years old was the protective factor of chronic periodontitis ( OR= 0.061, 95% CI =0.035-0.108, P< 0.001) while the male and CT genotype were the risk factors of chronic periodontitis ( OR= 2.392, 95% CI =1.496-3.819, P< 0.001; OR= 1.280, 95% CI =0.794-2.067, P= 0.031). Conclusions: The susceptibility to chronic periodontitis in Uygur adults in Moyu county of Xinjiang is related to the age and gender and polymorphism of MMP-9. The age over 35

  6. Contrasting patterns of polymorphism and selection in bacterial-sensing toll-like receptor 4 in two house mouse subspecies

    Czech Academy of Sciences Publication Activity Database

    Fornůsková, Alena; Bryja, Josef; Vinkler, M.; Macholán, Miloš; Piálek, Jaroslav

    2014-01-01

    Roč. 4, č. 14 (2014), s. 2931-2944 ISSN 2045-7758 R&D Projects: GA ČR GA206/08/0640 Institutional support: RVO:68081766 ; RVO:67985904 Keywords : adaptive evolution * arms race * directional selection * host–pathogen interaction * MAMPs * Mus musculus * parasite-mediated selection * pattern-recognition receptors Subject RIV: EG - Zoology Impact factor: 2.320, year: 2014

  7. Estimation of BDNF gene polymorphism and predisposition to dependence development for selected psychoactive compounds: genetic aspects of addiction with the selected drugs, amphetamine, tetrahydrocannabinol and opiates.

    Science.gov (United States)

    Biskupska, J; Borowiak, K S; Karlin-Grazewicz, K; Janus, T; Waloszczyk, P; Potocka-Banas, B; Machoy-Mokrzynska, A; Ossowski, A; Ciechanowicz, A

    2013-03-01

    The etiology of drug addiction, a central nervous system (CNS) disease, is not fully known. This complex problem is believed to be connected with concurrently affecting genetic, psychological and environmental factors. The development of addiction is connected with CNS reinforcement system and dopaminergic neurotransmission. Molecular processes are postulated to be of universal character and allow to presume a similar mechanism of dependence for both ethanol and other substances. Therefore, elements of dopaminergic transmission become excellent candidates for the examination of genetic influence on the development of addiction. A relationship between alcoholic disease and the presence of TaqIA1 and DRD2 alleles permits to initiate another investigation of gene-coding DRD2 dopamine receptor. The latest results indicate the importance of brain-derived neurotrophic factor (BDNF) in the regulation of dopaminergic route. The purpose of this research was to reveal the relationship between the Val66Met BDNF gene polymorphism and dependence of psychoactive agent. The examinations were performed with the Local Research Ethics Committee approval and patient's consent. The study group consisted of 100 patients (88 men and 12 women) aged 18-52 years, qualified for research program according to the International Classification of Diseases, Tenth Revision (ICD-10) requirements, medical examination and detailed questionnaire.

  8. Molecular ecology and selection in the drought-related Asr gene polymorphisms in wild and cultivated common bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    2012-01-01

    Background The abscisic acid (ABA) pathway plays an important role in the plants’ reaction to drought stress and ABA-stress response (Asr) genes are important in controlling this process. In this sense, we accessed nucleotide diversity at two candidate genes for drought tolerance (Asr1 and Asr2), involved in an ABA signaling pathway, in the reference collection of cultivated common bean (Phaseolus vulgaris L.) and a core collection of wild common bean accessions. Results Our wild population samples covered a range of mesic (semi-arid) to very dry (desert) habitats, while our cultivated samples presented a wide spectrum of drought tolerance. Both genes showed very different patterns of nucleotide variation. Asr1 exhibited very low nucleotide diversity relative to the neutral reference loci that were previously surveyed in these populations. This suggests that strong purifying selection has been acting on this gene. In contrast, Asr2 exhibited higher levels of nucleotide diversity, which is indicative of adaptive selection. These patterns were more notable in wild beans than in cultivated common beans indicting that natural selection has played a role over long time periods compared to farmer selection since domestication. Conclusions Together these results suggested the importance of Asr1 in the context of drought tolerance, and constitute the first steps towards an association study between genetic polymorphism of this gene family and variation in drought tolerance traits. Furthermore, one of our major successes was to find that wild common bean is a reservoir of genetic variation and selection signatures at Asr genes, which may be useful for breeding drought tolerance in cultivated common bean. PMID:22799462

  9. PLA2 polymorphism of platelet glycoprotein IIb/IIIa but not Factor V Leiden and prothrombin G20210A polymorphisms is associated with venous thromboembolism and more recurrent events in central Iran.

    Science.gov (United States)

    Pourgheysari, Batoul; Boroujeni, Hamid Rouhi; Hasheminia, Ali Mohammad; Drees, Fatima

    2013-07-01

    Inherited thrombophilic gene polymorphisms have been linked to the pathogenesis of venous thromboembolism (VTE). As there are very limited data of these polymorphisms in the Iranian population, we aimed to investigate the correlation between them and VTE in central Iran. Seventy-two unrelated VTE patients and 306 healthy control individuals were recruited for the study. Genotyping from venous blood with EDTA for the factor V Leiden (FVL), prothrombin (FII) G20210A, methylenetetrahydrofolate reductase (MTHFR) C677T and PLA2 polymorphism of platelet glycoprotein IIb/IIIa were undertaken by PCR-restriction fragment length polymorphism (PCR-RFLP). A total of 57 investigated polymorphisms with a mean of 0.79 per individual and 151 with a mean of 0.49 were found in patients and controls, respectively (Pgenetic risk factor (P=0.007) and more recurrent events occurred in such patients. Patients with PLA2 polymorphism had more recurrent events than the other patients (P=0.02). Patients with more than one genetic risk factor and recurrent events were younger. The prevalence of these polymorphisms is different from some previously published data in other populations, but is consistent with some others. Higher prevalence of PLA2 polymorphism of GPIIa/IIIb in VTE patients is indicative of the impact of this polymorphism in the pathogenesis of VTE in this population. Because of the impact of coinheritance on the recurrence and the age of occurrence, such patients may need to be managed differently.

  10. Association of Methylenetetrahydrafolate Reductase Gene Polymorphism (MTHFR) in Patients with Gallbladder Cancer.

    Science.gov (United States)

    Dixit, Ruhi; Singh, Gyanendra; Pandey, Manoj; Basu, Somprakas; Bhartiya, Satyanam Kumar; Singh, K K; Shukla, Vijay Kumar

    2016-03-01

    5,10-Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism and plays a major role in DNA methylation. There are two popular MTHFR polymorphisms known as C677T and A1298C which are found to be involved in folate metabolism and lowering the enzyme activity, thus may be linked with cancer development. This study aims to look at the association of these polymorphisms in gallbladder cancer. Thirty patients each with gallbladder cancer, cholelithiasis, and normal gallbladder were genotyped for the above-given polymorphisms by PCR-restriction fragment length polymorphism (RFLP) method. C677T MTHFR polymorphism was not associated (χ(2) = 2.44, p = 0.85) with an increased likelihood of having gallbladder cancer. A1298C was significantly associated (χ(2) = 28.87, p A1298C was significantly correlated with grade (r = 0.337, p A1298C polymorphism may be associated with risk of developing gallbladder cancer, and there is no association between C677T polymorphism and gallbladder cancer.

  11. GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

    International Nuclear Information System (INIS)

    Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir

    2005-01-01

    Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

  12. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

    Science.gov (United States)

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

    2017-07-01

    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  13. Association between INS-VNTR polymorphism and polycystic ovary syndrome in a Korean population.

    Science.gov (United States)

    Yun, Ji-Hyun; Gu, Bon-Hee; Kang, Yu-Bin; Choi, Bum-Chae; Song, Sangjin; Baek, Kwang-Hyun

    2012-07-01

    Polycystic ovary syndrome (PCOS) is a common disorder in women of reproductive ages. But its etiology is not fully understood yet. Variability in the number of tandem repeats of the insulin gene (INS-VNTR) is known to associate with PCOS, and it is associated with an increased risk of diabetes mellitus and other cardiovascular diseases. The aim of our study was to analyze an association between the INS-VNTR polymorphism and PCOS in a Korean population. The -23/Hph I polymorphism was used as a surrogate marker for INS-VNTR polymorphism and a total of 218 PCOS patient and 141 control DNAs were analyzed by restriction fragment length polymorphism method. Statistical analysis of genotyping results were performed using HapAnalyzer. χ² test and logistic regression were used to analyze the association between two groups. A p value VNTR polymorphism (p = 0.0544, odds ratio = 1.69). Our present data demonstrate that INS-VNTR polymorphism is not related with PCOS in Korean women. Thus, it is suggested that INS-VNTR polymorphism is not a key factor in the etiology and the pathogenesis of PCOS in a Korean population.

  14. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

    2014-03-01

    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  15. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population

    Directory of Open Access Journals (Sweden)

    Irfan Yousuf Wani

    2016-01-01

    Full Text Available Introduction: Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. Materials and Methods: The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP. Results: Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. Conclusion: We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  16. Selection of a seed orchard of Eucalyptus dunnii based on genetic diversity criteria calculated using molecular markers.

    Science.gov (United States)

    Marcucci Poltri, S N; Zelener, N; Rodriguez Traverso, J; Gelid, P; Hopp, H E

    2003-06-01

    A Eucalyptus dunnii Maiden breeding population of 46 accessions originated in Australia and selected for fitness to subtropical and cold environments was screened by Amplified Fragment Length Polymorphism (AFLP) and microsatellite markers to obtain quantitative estimates of genetic diversity. A randomly chosen group of AFLP primers generated 205 AFLP bands that were used to fingerprint the genotypes and to evaluate genetic relationships among accessions. Sixty-eight percent (140) of the bands were polymorphic markers. The mean diversity index (DI) was 0.33 and about 52% of the loci had values greater than 0.4. Cluster analysis derived from similarity indices (SI) revealed no particular grouping among accessions suggesting the absence of closely related genotypes, except for five pairs of genotypes. Bootstrap analysis results confirmed the suitability of AFLP to describe genetic relationships in this breeding population. In addition, four highly informative microsatellites were used to construct an identification matrix that discriminated nearly all of the genotypes. Mean values for the number of alleles per locus, DI and SI among accessions were 13, 0.78 and 0.19, respectively, indicating that the breeding population has high genetic diversity. However, several genotypes showed the presence of single microsatellite bands suggesting a putatively important degree of homozygosity. Molecular data were used to design a clonal seed orchard. To achieve this aim, the nine most divergent pairs of genotypes were chosen, thereby retaining 95.2% of the total number of alleles from the 140 polymorphic AFLP loci and the four microsatellite loci analyzed. Mean DI and SI for AFLP and microsatellites showed no significant differences between the original breeding population and the selected seed orchard, confirming that a seed orchard can be designed with a limited number of individuals, which allows similar accessions to be discarded and avoids inbreeding.

  17. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  18. The combination of Ile225Thr polymorphism of Fcg receptor IIB gene and hypersensitiveness as risk factor for human systemic lupus erythematosus in chinese populations

    Directory of Open Access Journals (Sweden)

    Pan Faming

    2007-01-01

    Full Text Available Background: The aim of this study was to investigate the role of FcgRIIB gene in susceptibility to systemic lupus erythematosus (SLE using family-based association study and to examine possible interaction between the Ile225Thr (rs1050501, exon 5 polymorphism of Fcg receptor IIB gene and hypersensitivity. Objectives: A total of 119 patients with SLE from 95 nuclear families, aged 14 to 78 years, according to the American College of Rheumatology (ACR 1997 criteria were recruited. In addition, 316 family members of these patients were also genotyped. Seventy patients and their 70 normal siblings from 95 nuclear families were selected by the case-combined-control design. Materials and Methods: A family-based association study was used to explore the relationship between gene polymorphism and SLE. We studied a single-nucleotide polymorphisms (SNPs encoding non-synonymous substitution in the FcgRIIB gene with respect to genetic susceptibility to SLE, the FcgRIIB gene were genotyped by restriction fragment length polymorphism (RFLP method. The interaction of gene-environment was assessed by conditional logistic regression model. Results: Among 119 SLE patients, The frequencies of FcgRIIB Ile225Ile, Ile225Thr and Thr 225 Thr genotypes were 8.1%, 61.3% and 30.6%. Univariate (single-marker family-based association tests (FBATs demonstrated that variant allele at SNP rs1050501, in exon 5 of FcgRIIB gene was significantly associated with genetic susceptibility to SLE in additive model (exon 5, Z=3.707, P =0.00020. Transmission/disequilibrium test (TDT and sibship disequilibuium test (SDT analysis showed an excess of the allele of 225Thr ( Ile225Thr loci from heterozygous parents to affected offspring (c 2=7.14, P =0.0105; Moreover, conditional logistic regression results showed that there was statistically significant multiplicative interaction of FcgRa!B gene and the Hypersensitiveness [c 2=5.013, P =0.024; OR=2.444, CI (1.126-5.309]. Conclusions: Our

  19. A MITE-based genotyping method to reveal hundreds of DNA polymorphisms in an animal genome after a few generations of artificial selection

    Directory of Open Access Journals (Sweden)

    Tetreau Guillaume

    2008-10-01

    Full Text Available Abstract Background For most organisms, developing hundreds of genetic markers spanning the whole genome still requires excessive if not unrealistic efforts. In this context, there is an obvious need for methodologies allowing the low-cost, fast and high-throughput genotyping of virtually any species, such as the Diversity Arrays Technology (DArT. One of the crucial steps of the DArT technique is the genome complexity reduction, which allows obtaining a genomic representation characteristic of the studied DNA sample and necessary for subsequent genotyping. In this article, using the mosquito Aedes aegypti as a study model, we describe a new genome complexity reduction method taking advantage of the abundance of miniature inverted repeat transposable elements (MITEs in the genome of this species. Results Ae. aegypti genomic representations were produced following a two-step procedure: (1 restriction digestion of the genomic DNA and simultaneous ligation of a specific adaptor to compatible ends, and (2 amplification of restriction fragments containing a particular MITE element called Pony using two primers, one annealing to the adaptor sequence and one annealing to a conserved sequence motif of the Pony element. Using this protocol, we constructed a library comprising more than 6,000 DArT clones, of which at least 5.70% were highly reliable polymorphic markers for two closely related mosquito strains separated by only a few generations of artificial selection. Within this dataset, linkage disequilibrium was low, and marker redundancy was evaluated at 2.86% only. Most of the detected genetic variability was observed between the two studied mosquito strains, but individuals of the same strain could still be clearly distinguished. Conclusion The new complexity reduction method was particularly efficient to reveal genetic polymorphisms in Ae. egypti. Overall, our results testify of the flexibility of the DArT genotyping technique and open new

  20. Genetic polymorphisms in paraoxonase 1 and G protein-coupled receptor 77, and the risk of glucose-6-phosphate dehydrogenase deficiency in a Saudi population

    Science.gov (United States)

    Alharbi, Khalid K.

    2015-01-01

    Objectives: To investigate the role of amino acid substitution variants Q192R and C698T in the development of glucose-6-phosphate dehydrogenase (G6PD) deficiency in a Saudi male population. Methods: This case-control study was carried out in 200 Saudi male individuals: 100 patients with G6PD deficiency, and 100 control subjects collected between July and August 2011 in the Taif region of Saudi Arabia. A total of 2100 male Saudi individuals were screened by a fluorescence spot test, and 100 with G6PD deficiency were selected. Two common variants PON1 (rs662) and C5L2 (rs149572881) were genotyped using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results: The results showed that the R allele and QR genotype were associated with the Q192R polymorphism in PON1 (R versus Q odds ratio [OR], 1.72; 95% confidence interval [95% CI], 1.1-2.6; p=0.01; and QR versus QQ: OR, 1.98; 95% CI, 1.1-3.6; p=0.02). All the C698T genotypes and allele frequencies in C5L2 were almost similar in both the cases and controls (CT versus CC: OR, 2.04; 95% CI, 0.3-11.4; p=0.40; and T versus C: OR, 2.02; 95% CI, 0.3-11.1; p=0.41). Conclusions: These findings suggest the association of PON1 with G6PD deficiency in the Saudi male population studied herein. Future studies, including correlation analyses between the clinical features and genotypes in populations of different ethnicities, are warranted to confirm the disease association with these genetic mutations. PMID:25935173

  1. Frequencies of glutathione s-transferase (GSTM1, GSTM3 AND GSTT1) polymorphisms in a Malaysian population.

    Science.gov (United States)

    Alshagga, Mustafa A; Mohamed, Norazlina; Nazrun Suhid, Ahmad; Abdel Aziz Ibrahim, Ibrahim; Zulkifli Syed Zakaria, Syed

    2011-08-01

    Glutathione S-transferase (GST) is a xenobiotic metabolising enzyme (XME), which may modify susceptibility in certain ethnic groups, showing ethnic dependent polymorphism. The aim of this study was to determine GSTM1, GSTM3 and GSTT1 gene polymorphisms in a Malaysian population in Kuala Lumpur. Blood or buccal swab samples were collected from 137 Form II students from three schools in Wilayah Persekutuan Kuala Lumpur. Genotyping was done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Glutathione-S-transferase GSTM3 gene frequencies were 89% for AA, 10% for AB and 1% for BB. The gene frequencies for deleted GSTM1 and GSTT1 were 66% and 18% respectively. This study suggested that the Malay population is at risk for environmental diseases and provides the basis for gene-environment association studies to be carried out.

  2. Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

    Science.gov (United States)

    Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

    2015-01-01

    This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

  3. [Correlation analysis of G870A CCND1 gene polymorphism with digestive system tumors].

    Science.gov (United States)

    Yang, Shu-Min; Shi, Ya-Lin

    2016-11-20

    To study the correlation of G870A CCND1 gene polymorphism and digestive system tumors. From August 2010 to August 2014, 164 digestive system cancer patients (including 82 patients with gastric cancer and 82 with colorectal cancer) and 82 healthy subjects (control group) were examined with PCR-restriction fragment length polymorphism (PCR-RFLP). The distribution of CCND1 gene G870A frequency in the 3 groups and its association with tumor staging and grading were analyzed. The frequencies of the GG, GA and AA genotypes in G870A CCND1 gene loci in patients with gastric cancer and colorectal cancer differed significantly from those in the control group (Pdigestive system tumors (Pdigestive system cancer risk than the GG genotype (Pdigestive system tumors. The allele A is associated with an increased risk of digestive system tumors and correlated with the tumor differentiation and staging of the tumor.

  4. Whole-Genome Characteristics and Polymorphic Analysis of Vietnamese Rice Landraces as a Comprehensive Information Resource for Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Hien Trinh

    2017-01-01

    Full Text Available Next generation sequencing technologies have provided numerous opportunities for application in the study of whole plant genomes. In this study, we present the sequencing and bioinformatic analyses of five typical rice landraces including three indica and two japonica with potential blast resistance. A total of 688.4 million 100 bp paired-end reads have yielded approximately 30-fold coverage to compare with the Nipponbare reference genome. Among them, a small number of reads were mapped to both chromosomes and organellar genomes. Over two million and eight hundred thousand single nucleotide polymorphisms (SNPs and insertions and deletions (InDels in indica and japonica lines have been determined, which potentially have significant impacts on multiple transcripts of genes. SNP deserts, contiguous SNP-low regions, were found on chromosomes 1, 4, and 5 of all genomes of rice examined. Based on the distribution of SNPs per 100 kilobase pairs, the phylogenetic relationships among the landraces have been constructed. This is the first step towards revealing several salient features of rice genomes in Vietnam and providing significant information resources to further marker-assisted selection (MAS in rice breeding programs.

  5. R497K polymorphism in epidermal growth factor receptor gene is associated with the risk of acute coronary syndrome

    Directory of Open Access Journals (Sweden)

    Pan Xin-Min

    2008-07-01

    Full Text Available Abstract Background Previous studies suggested that genetic polymorphisms in the epidermal growth factor receptor (EGFR gene had been implicated in the susceptibility to some tumors and inflammatory diseases. EGFR has been recently implicated in vascular pathophysiological processes associated with excessive remodeling and atherosclerosis. Acute coronary syndrome (ACS is a clinical manifestation of preceding atherosclerosis. Our purpose was to investigate the association of the EGFR polymorphism with the risk of ACS. In this context, we analyzed the HER-1 R497K and EGFR intron 1 (CAn repeat polymorphisms in 191 patients with ACS and 210 age- and sex-matched controls in a Chinese population, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP strategy and direct sequencing. Results There were significant differences in the genotype and allele distribution of R497K polymorphism of the EGFR gene between cases and controls. The Lys allele had a significantly increased risk of ACS compared with the Arg allele (adjusted OR = 1.49, 95% CI: 1.12–1.98, adjusted P = 0.006. However, no significant relationship between the number of (CAn repeats of EGFR intron 1 (both alleles P = 0.911. Considering these two polymorphisms together, there was no statistically significant difference between the two groups. Conclusion R497K polymorphism of the EGFR gene is significantly associated with the risk of ACS. Our data suggests that R497K polymorphism may be used as a genetic susceptibility marker of the ACS.

  6. Impact of COMT Val 108/158 Met and DRD2 Taq1B gene polymorphisms on vulnerability to cigarette smoking of Thai males.

    Science.gov (United States)

    Suriyaprom, Kanjana; Tungtrongchitr, Rungsunn; Harnroongroj, Talabporn

    2013-03-01

    The nicotine in cigarette smoke can stimulate the dopaminergic reward pathways. The catechol O-methyltransferase gene (COMT) and dopamine receptor 2 gene (DRD2) are dopamine-related genes. Genetic polymorphisms in these two genes are potential candidates in determining an individual's predisposition to cigarette smoking. The purposes of this study were to examine the association between two polymorphisms in COMT Val (108/158) Met and DRD2 Taq1B and anthropometric-biochemical parameters and to ascertain the association between these polymorphisms and cigarette smoking. The levels of anthropometric-biochemical parameters were determined. COMT Val (108/158) Met and DRD2 Taq1B polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism technique. With regard to COMT Val (108/158) Met and DRD2 Taq1B polymorphisms, no differences were found in anthropometric-biochemical variables, except for thiocyanate concentration. Smoking status was significantly associated with COMT Val (108/158) Met polymorphism, but not associated with DRD2 Taq1B polymorphism. Logistic regression analysis showed that COMT Val (108/158) Met gene polymorphism, educational status, parental smoking, and alcohol consumption had statistically significant impacts on cigarette smoking. The results suggest that COMT Val (108/158) Met genetic polymorphisms, but not DRD2 Taq1B, may influence susceptibility to cigarette smoking among Thai males.

  7. Association of the methylenetetrahydrofolate reductase polymorphism in Korean patients with childhood acute lymphoblastic leukemia.

    Science.gov (United States)

    Kim, Nam Keun; Chong, So Young; Jang, Moon Ju; Hong, Seung Ho; Kim, Heung Sik; Cho, Eun Kyung; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Oh, Doyeun

    2006-01-01

    Methylenetetrahydrofolate reductase plays a central role in converting folate to methyl donor for DNA methylation. Recently, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) mutations were discovered to be associated with childhood acute lymphoblastic leukemia (ALL), as well as colon cancer, lymphoma, esophageal and stomach cancer. Therefore, it was hypothesized that the MTHFR polymorphisms are associated with the risk of childhood ALL in the Korean population. DNA samples taken from 66 patients with ALL and 100 age-matched controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay for detection of MTHFR C677T and A1298C mutations. The frequency of the AC genotype for MTHFR A1298C polymorphism was significantly different between the controls and the cases (OR, 2.22; CI, 95% 1.09-4.51, p=0.03). The 1298AC+CC genotype was also significantly different (OR, 2.11; 95% CI, 1.06-4.22; p=0.049). There was, however, no significant difference for MTHFR C677T polymorphism and combined genotype frequencies between the two groups. Although no consistent results on associations between MTHFR A 1298C polymorphism and ALL in the populations studied were obtained, the A1298C polymorphism, at least in Koreans, may be a genetic determinant among childhood ALL patients.

  8. Risk conferred by FokI polymorphism of vitamin D receptor (VDR) gene for essential hypertension.

    Science.gov (United States)

    Swapna, N; Vamsi, U Mohana; Usha, G; Padma, T

    2011-09-01

    The vitamin D receptor (VDR) gene serves as a good candidate gene for susceptibility to several diseases. The gene has a critical role in regulating the renin-angiotensin system (RAS) influencing the regulation of blood pressure. Hence determining the association of VDR polymorphisms with essential hypertension is expected to help in the evaluation of risk for the condition. The aim of this study was to evaluate association between VDRFok I polymorphism and genetic susceptibility to essential hypertension. Two hundred and eighty clinically diagnosed hypertensive patients and 200 normotensive healthy controls were analyzed for Fok I (T/C) [rs2228570] polymorphism by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Genotype distribution and allele frequencies in patients and controls, and odds ratios (ORs) were calculated to predict the risk for developing hypertension by the individuals of different genotypes. The genotype distribution and allele frequencies of Fok I (T/C) [rs2228570] VDR polymorphism differed significantly between patients and controls (χ(2) of 18.0; 2 degrees of freedom; P = 0.000). FF genotype and allele F were at significantly greater risk for developing hypertension and the risk was elevated for both the sexes, cases with positive family history and habit of smoking. Our data suggest that VDR gene Fok I polymorphism is associated with the risk of developing essential hypertension.

  9. Genetic Polymorphism at Acaca Locus and Its Relationship With Productive Performances in Ettawa Crossbred Goat

    Directory of Open Access Journals (Sweden)

    Sucik Maylinda

    2015-04-01

    Full Text Available Research with aim to estimate genetic polymorphism at ACACA (Acetyl-coenzyme A carboxylase locus in Ettawa Crossbred goat wan its relationship with production traits was done at goat population in Batu, Lawang and Ampel Gading. 46 female goats were taken it’s blood sample to isolate the DNA and continue with PCR (Polymerase Chain Reaction and RFLP (Restricted Fragment Length Polymorphism. PCR was used to amplify ACACA gene fragment in intron 3’ about 200 bp with primer F : 5’ – AGT GTA GAA GGG ACA GCC CAG C – 3’ and R : 5’ – GTG GAA TGA CAC ATG GAG AGG G – 3’; RFLP was used to test mutation of that fragment in particular place (point using restriction enzyme RSA1. Variables were alelles and genotypes composition in population, milk and fat content, and birth weight of kid. Result showed that (a genetic polymorphism at locus ACACA in three location was high that is 44,22 %, with allele frequency of G (p = 33 % and allele T (q = 67 %; (b no relationship between the high polymorphism with productive performance of goat in fat and protein content, and birth weight of kid. It was concluded that in goat population there was a high polymorphism at ACACA gene, and that polymorphism was not related to production.

  10. Xmni polymorphism and disease severity in patients with beta thalassemia from northern Pakistan

    International Nuclear Information System (INIS)

    Hanif, T.B.; Ahmed, S.; Anwar, J.

    2015-01-01

    Thalassemia is a heterogeneous disorder and several genetic factors influence the severity of thalassemia. An accurate and early diagnosis of a mild thalassemia genotype helps to avoid unnecessary transfusion and its complications. The aim of this study is to identify the association between XmnI polymorphism and disease severity in patients with ?-thalassemia from northern Pakistan. Methods: The cross sectional study was conducted at the Department of Haematology, Armed Forces Institute of Pathology (AFIP) Rawalpindi, from September 2006 to June 2009. A total of 90 subjects including 30 with thalassemia major, 30 with thalassemia intermedia and 30 normal individuals were studied. DNA from each subject was tested for 15 ?-thalassemia mutations and the presence of XmnI polymorphism using Amplification Refractory Mutation System and Restriction Fragment Length Polymorphism respectively. Results: One normal and one thalassemia major subject were found to be positive for homozygous and heterozygous XmnI polymorphism respectively. Among the thalassemia intermedia group, XmnI polymorphism was found in 12/30 patients, of whom 10 were homozygous and 2 were heterozygous for it. Conclusion: XmnI polymorphism is an important genotypic factor in Pakistani population for making a prospective diagnosis of thalassemia intermedia and predicting the severity of the disease. (author)

  11. Polymorphisms of toll-like receptor 2 and 4 genes in Chagas disease

    Directory of Open Access Journals (Sweden)

    German Zafra

    2008-02-01

    Full Text Available The aim of this study was to test the possible implication of toll-like receptor 2 (TLR2 and TLR4 gene polymorphisms in determining the susceptibility to Chagas' disease. Genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism in 475 individuals from Colombia, 143 seropositive with chagasic cardiomyopathy, 132 seropositive asymptomatic and 200 seronegative. The TLR2 arginine to glutamine substitution at residue 753(Arg753Gln polymorphism was absent in the groups analyzed. The TLR4 Asp299Gly and Thr399Ile polymorphisms are in linkage disequilibrium and we observed a very low frequency of these polymorphisms in our study population (2.6% and 1.8% respectively. The overall TLR2 and TLR4 alleles and genotype distribution in seronegative and seropositive were not significantly different. We compared the frequencies between asymptomatic patients and those with chagasic cardiomyopathy and we did not observe any significant differences in the distribution of alleles or genotypes. In summary, this study corroborates the low frequency of TLR2 and TLR4 polymorphisms observed in other populations and suggest that these do not play an important role in Chagas' disease. The validation of these findings in independent cohorts is needed to firmly establish a role for TLR2 and TLR4 variants in Chagas' disease.

  12. Association of CD28 and CTLA-4 gene polymorphisms with aggressive periodontitis in Brazilians.

    Science.gov (United States)

    e Silva, M R M A; Moreira, P R; da Costa, G C; Saraiva, A M; de Souza, P E A; Amormino, S A F; da Costa, J E; Gollob, K J; Dutra, W O

    2013-09-01

    Susceptibility to and severity of periodontal disease is influenced by gene polymorphisms related to the immune response. Co-stimulatory molecules, such as CD28 and CTLA-4, are critical in the development of such responses. Our hypothesis is that polymorphisms in genes that code for these molecules may be associated with periodontitis. The aim of the study was to investigate the association between +17 (T/C) CD28 and +49 (A/G) CTLA-4 gene polymorphisms and periodontitis in Brazilians. Genomic DNA was obtained from oral swabs of 424 individuals categorized into three groups (control group, aggressive, and chronic periodontitis) considering clinical parameters such as probing depth and clinical attachment loss. The genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism. There was an association between the T(-) genotype of the CD28 polymorphism and aggressive periodontitis (P = 0.04). Moreover, the A(+) genotype for CTLA-4 was associated with greater clinical attachment loss in non-smokers with aggressive periodontitis (P = 0.006, OR = 16.25, CI = 2.25-117.11). These findings show that T(-) in CD28 + 17 (T/C) and the A(+) in CTLA-4 +49 (A/G) genotypes are associated with susceptibility to aggressive periodontal disease. Thus, our study highlights these polymorphisms as potential genetic susceptibility markers of periodontitis in Brazilians. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Investigation on estrogen receptor alpha gene polymorphisms in Iranian women with recurrent pregnancy loss

    Science.gov (United States)

    Mahdavipour, Marzieh; Idali, Farah; Zarei, Saeed; Talebi, Saeed; Fatemi, Ramina; Jeddi-Tehrani, Mahmood; Pahlavan, Somayeh; Rajaei, Farzad

    2014-01-01

    Background: Recurrent pregnancy loss (RPL) is a multifactorial disorder. Environmental factors and genetics can affect pregnancy outcomes. Objective: Conflicting data suggest an association between estrogen receptor alpha (ESR1) gene polymorphisms and RPL. In this study, such association was investigated in Iranian women with RPL. Materials and Methods: In this case control study, blood samples were collected from 244 women with a history of three or more consecutive pregnancy losses and 104 healthy women with at least two live births. Using polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP), we studied -397C/T and -351A/G polymorphisms on ESR1 gene in case and control subjects. Results: The genotypic frequencies of -397C/T and -351A/G polymorphisms on ESR1were not significantly different between RPL and control groups (p=0.20 and p=0.09, respectively). A significantly negative correlation was observed between -397C/T and -351A/G (r=-0.852, p<0.001) in RPL women and complete linkage disequilibrium between the investigated polymorphisms was found (D’: 0.959; r-square= 0.758, p<0.001). Conclusion: This investigation suggests that the analyzed polymorphisms on ESR1gene are not associated with an increased risk of RPL in the studied population. PMID:25071847

  14. Genetic maps of polymorphic DNA loci on rat chromosome 1

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Yan-Ping; Remmers, E.F.; Longman, R.E. [National Institutes of Health, Bethesda, MD (United States)] [and others

    1996-09-01

    Genetic linkage maps of loci defined by polymorphic DNA markers on rat chromosome 1 were constructed by genotyping F2 progeny of F344/N x LEW/N, BN/SsN x LEW/N, and DA/Bkl x F344/Hsd inbred rat strains. In total, 43 markers were mapped, of which 3 were restriction fragment length polymorphisms and the others were simple sequence length polymorphisms. Nineteen of these markers were associated with genes. Six markers for five genes, {gamma}-aminobutyric acid receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}1 (Adrb1), carcinoembryonic antigen gene family member 1 (Cgm1), and lipogenic protein S14 (Lpgp), and 20 anonymous loci were not previously reported. Thirteen gene loci (Myl2, Aldoa, Tnt, Igf2, Prkcg, Cgm4, Calm3, Cgm3, Psbp1, Sa, Hbb, Ins1, and Tcp1) were previously mapped. Comparative mapping analysis indicated that the large portion of rat chromosome 1 is homologous to mouse chromosome 7, although the homologous to mouse chromosome 7, although the homologs of two rat genes are located on mouse chromosomes 17 and 19. Homologs of the rat chromosome 1 genes that we mapped are located on human chromosomes 6, 10, 11, 12, 15, 16, and 19. 38 refs., 1 fig., 3 tabs.

  15. Preparation and evaluation of famotidine polymorphs.

    Science.gov (United States)

    Nagaraju, Ravouru; Prathusha, Ande Penchala; Subhash Chandra Bose, Penjury; Kaza, Rajesh; Bharathi, Koganti

    2010-06-01

    The main objective of this study was to compare the behaviour of drug release among the famotidine polymorphs prepared by using various additives and solvents, by solvent evaporation method. The famotidine polyvinyl pyrrolidone polymorphs with different concentrations (0.5, 1 and 1.5%) were prepared by using solvent evaporation method. In these polymorphs of different concentrations 1% w/v polymorphs showed better release. Similarly, famotidine polymorphs of Tween 80 with different concentrations, polyethylene glycol 1% w/v and methanol was prepared. Famotidine polymorphs prepared the PVP (1% w/v) showed better drug release and solubility. DSC, FTIR, SEM and XRD studies were carried out. DSC studies revealed that PVP polymorphs were found to stable compared to other polymorphs. FTIR studies of the polymorphs prepared indicated that there was an interaction found in all polymorphs except PVP polymorphs indicating the absence of drug-additive interaction. SEM studies of PVP and methanol polymorphs revealed that they are tabular and prismatic and columnar respectively. These changes in morphology were due to variations in face dimensions and also properties of additives and solvent used in the preparation. XRD studies revealed that there is an increase in crystallinity in methanol polymorphs when compared to PVP polymorphs and pure drug. The mechanism of drug release was determined using zero order, first order and Hixon-Crowel equations. From the drug release kinetics these polymorphs followed first order and Hixon-Crowel release kinetics, exhibited fair linearity in their dissolution data. Further, in vivo studies were carried out for the evaluation of antiulcer activity. Based upon the drug release pattern and its kinetics only two of the prepared polymorphs of famotidine i.e. famotidine PVP polymorphs and famotidine methanol polymorphs were selected for animal studies. Antiulcer studies were carried out using pylorus ligation model and estimation of antioxidant

  16. Potential link between genetic polymorphisms of catechol-O-methyltransferase and dopamine receptors and treatment efficacy of risperidone on schizophrenia

    Directory of Open Access Journals (Sweden)

    Han JY

    2017-12-01

    Full Text Available Jiyang Han,1 Yan Li,2 Xumei Wang1 1Department of Psychiatry, Shengjing Hospital of China Medical University, Shenyang, Liaoning, China; 2Department of Cell Biology, Key Laboratory of Cell Biology, Ministry of Public Health, China Medical University, Shenyang, Liaoning, China Objective: The current study aimed to explore the association of single nucleotide polymorphisms (SNPs within catechol-O-methyltransferase (COMT and dopamine receptors with schizophrenia and genetic association with risperidone treatment response.Methods: A total of 690 schizophrenic patients (case group were selected and 430 healthy people were included as the controls. All patients received risperidone treatment continuously for 8 weeks. Next, peripheral venous blood samples were collected and were subjected to polymerase chain reaction-restriction fragment length polymorphism to amplify and genotype the SNPs within COMT and dopamine receptors. Then, correlation analysis was conducted between Positive and Negative Syndrome Scale improvement rates and SNPs within COMT and the dopamine receptor gene.Results: The allele of DRD1 rs11749676 (A emerged as a key element in reducing schizophrenia risk with statistical significance (P<0.001. Remarkably, alleles of COMT rs165774 (G, DRD2 rs6277 (T, and DRD3 rs6280 (C were associated with raised predisposition to schizophrenia (all P<0.001. Regarding DRD1 rs11746641, DRD1 rs11749676, DRD2 rs6277, and DRD3 rs6280, the case group exhibited a lesser frequency of heterozygotes in comparison with wild homozygotes genotype (all P<0.001. SNPs (COMT rs4680, DRD2 rs6275, DRD2 rs1801028, and DRD2 rs6277 were remarkably associated with improvement rates of PANSS total scores (P<0.05. SNPs (COMT rs165599 and DRD2 rs1801028 were significantly associated with risperidone efficacy on negative symptoms (P<0.05.Conclusion: COMT SNPs and dopamine receptor SNPs were correlated with prevalence of schizophrenia and risperidone treatment efficacy of

  17. The peroxisome proliferator-activated receptor delta +294T > C polymorphism and alcohol consumption on serum lipid levels

    Directory of Open Access Journals (Sweden)

    Wei Xian-Liang

    2011-12-01

    Full Text Available Abstract Background The single nucleotide polymorphism (SNP of peroxisome proliferator-activated receptor delta (PPARD gene affects serum lipid profiles, but to what extent alcohol consumption interferes with this association remains unknown. The present study was undertaken to compare the association of PPARD +294T > C (rs2016520 polymorphism and serum lipid levels in the nondrinkers and drinkers. Methods A total of 685 unrelated nondrinkers and 497 drinkers aged 15-82 were randomly selected from our previous stratified randomized cluster samples. Genotyping of the PPARD +294T > C was performed by polymerase chain reaction and restriction fragment length polymorphism. Interactions of the PPARD +294T > C genotypes and alcohol consumption on serum lipid levels were detected by using a factorial regression analysis after controlling for potential confounders. Results The levels of triglyceride (TG, high-density lipoprotein cholesterol (HDL-C, apolipoprotein (Apo A1, and the ratio of ApoA1 to ApoB were higher in drinkers than in nondrinkers (P P > 0.05 for all. The frequencies of TT, TC and CC genotypes were 56.0%, 36.4% and 7.6% in nondrinkers, and 57.2%, 38.0% and 4.8% in drinkers (P > 0.05; respectively. The frequencies of T and C alleles were 74.2% and 25.8% in nondrinkers, and 76.2% and 23.8% in drinkers (P > 0.05; respectively. There was also no significant difference in the genotypic and allelic frequencies between males and females in both groups (P > 0.05 for all. The levels of TC in nondrinkers were different among the three genotypes (P = 0.01, the C allele carriers had higher serum TC levels than the C allele noncarriers. The levels of all seven lipid traits in drinkers were not different among the three genotypes (P > 0.05 for all. The interactions of PPARD +294T > C genotypes and alcohol consumption on serum lipid levels were not detected in the drinkers (P >0.05 for all. Multiple linear regression analysis showed that serum TC, HDL

  18. Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit

    Directory of Open Access Journals (Sweden)

    E.M. Abdel-Kafy

    2016-09-01

    Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.

  19. Common selective serotonin reuptake inhibitor side effects in older adults associated with genetic polymorphisms in the serotonin transporter and receptors: data from a randomized controlled trial.

    Science.gov (United States)

    Garfield, Lauren D; Dixon, David; Nowotny, Petra; Lotrich, Francis E; Pollock, Bruce G; Kristjansson, Sean D; Doré, Peter M; Lenze, Eric J

    2014-10-01

    Antidepressant side effects are a significant public health issue, associated with poor adherence, premature treatment discontinuation, and, rarely, significant harm. Older adults assume the largest and most serious burden of medication side effects. We investigated the association between antidepressant side effects and genetic variation in the serotonin system in anxious, older adults participating in a randomized, placebo-controlled trial of the selective serotonin reuptake inhibitor (SSRI) escitalopram. Adults (N = 177) aged ≥ 60 years were randomized to active treatment or placebo for 12 weeks. Side effects were assessed using the Udvalg fur Kliniske Undersøgelser side-effect rating scale. Genetic polymorphisms were putative functional variants in the promoters of the serotonin transporter and 1A and 2A receptors (5-HTTLPR [L/S + rs25531], HTR1A rs6295, HTR2A rs6311, respectively). Four significant drug-placebo side-effect differences were found: increased duration of sleep, dry mouth, diarrhea, and diminished sexual desire. Analyses using putative high- versus low-transcription genotype groupings revealed six pharmacogenetic effects: greater dry mouth and decreased sexual desire for the low- and high-expressing serotonin transporter genotypes, respectively, and greater diarrhea with the 1A receptor low-transcription genotype. Diminished sexual desire was experienced significantly more by high-expressing genotypes in the serotonin transporter, 1A, or 2A receptors. There was not a significant relationship between drug concentration and side effects nor a mean difference in drug concentration between low- and high-expressing genotypes. Genetic variation in the serotonin system may predict who develops common SSRI side effects and why. More work is needed to further characterize this genetic modulation and to translate research findings into strategies useful for more personalized patient care. Published by Elsevier Inc.

  20. Methylenetetrahydrofolate reductase gene A1298C polymorphism in pediatric stroke--case-control and family-based study.

    Science.gov (United States)

    Balcerzyk, Anna; Niemiec, Paweł; Kopyta, Ilona; Emich-Widera, Ewa; Pilarska, Ewa; Pienczk-Ręcławowicz, Karolina; Kaciński, Marek; Wendorff, Janusz; Żak, Iwona

    2015-01-01

    Moderate hyperhomocysteinemia is one of the risk factors of pediatric stroke. Methylenetetrahydrofolate reductase (MTHFR) is an important enzyme, which regulates homocysteine metabolism, and some polymorphisms of gene encoding this enzyme are associated with a decreased activity of the enzyme. The aim of the study was to assess an association between the A1298C polymorphism and pediatric stroke. We also evaluated a possible synergistic effect of A1298C and C677T polymorphisms of this gene. The study group consisted of 88 children after ischemic stroke, 142 of their parents and 111 controls. The A1298C polymorphism was genotyped using the restriction fragment length polymorphism method. We used 2 study designs: a case-control model and a family-based association test. The Statistica 7.1 and EpiInfo 6 softwares were used in all analyses. We did not observe any statistically significant differences either in the transmission of the A allele in the family-based test or in the frequency of the A allele in the patients group compared with the controls. We also did not notice any significant additive or synergistic effects between the A1298C and C677T polymorphisms. An analysis of the results obtained in this study and a critical review of previously published studies indicate that the A1298C polymorphism of the MTHFR gene is not related to ischemic stroke in children. Copyright © 2015 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  1. Role of the VDR Bsm I and Apa I polymorphisms in the risk of colorectal cancer in Kashmir.

    Science.gov (United States)

    Rasool, Sabha; Kadla, Showkat A; Rasool, Vamiq; Qazi, Falak; Khan, Tanzeela; Shah, Nisar A; Ganai, Bashir A

    2014-01-01

    A case-control study aiming to evaluate the relationship between Bsm I and Apa I restriction fragment gene polymorphisms and colorectal cancer (CRC) was carried out in Kashmir, including a total of 368 subjects (180 cases and 188 controls). DNA samples extracted from the blood of the subjects were analyzed for 3' untranslated region (3' UTR) Apa I and Bsm I polymorphisms using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR). A statistically significant 2.7-fold increased risk was observed in individuals found homozygous for the presence of the 'b' allele, in comparison to subjects homozygous for the 'B' allele (odds ratio (OR) 2.7, 95% confidence interval (CI) 1.49-4.86 (Bsm I)), and a statistically insignificant 2-fold increased risk was found among individuals with the 'aa' genotype, as compared to subjects with the 'AA' genotype (OR 2.017, 95% CI 0.86-4.7). Our study also yielded statistically significant results when the Apa I polymorphism was stratified by age (≤ 50 years) and dwelling area (rural area), and the Bsm I polymorphism by gender (male gender), suggesting a possible role of Apa I and Bsm I polymorphisms in the etiology of CRC in Kashmir. We conclude that Apa I and Bsm I single-nucleotide polymorphisms (SNPs) in the vitamin D receptor gene (VDR) might be associated with susceptibility to CRC among Kashmiris. © 2014 S. Karger GmbH, Freiburg.

  2. Association between the catechol-o-methyltransferase val158met polymorphism with susceptibility and severity of carpal tunnel syndrome

    Directory of Open Access Journals (Sweden)

    Erkol İnal E

    2015-12-01

    Full Text Available Carpal tunnel syndrome (CTS is the most common entrapment neuropathy of the upper extremity. In this study, we aimed to clarify the relationships between the catechol-O-methyltransferase (COMT gene Val158Met (rs4680 polymorphism and development, functional and clinical status of CTS. Ninety-five women with electro diagnostically confirmed CTS and 95 healthy controls were enrolled in the study. The functional and clinical status of the patients was measured by the Turkish version of the Boston Questionnaire and intensity of pain related to the past 2 weeks was evaluated on a visual analog scale (VAS. The Val158Met polymorphism was determined using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP, method. We divided patients according to the genotypes of the Val158Met polymorphism as Val/Val, Val/Met and Met/Met. There were not any significant differences in terms of Val158Met polymorphisms between patients and healthy controls (p >0.05. We also did not find any relationships between the Val158Met polymorphism and CTS (p >0.05. In conclusion, although we did not find any relationships between CTS and the Val158Met polymorphism, we could not generalize this result to the general population. Future studies are warranted to conclude precise associations.

  3. Glutathione S-Transferase P1 (GSTP1 gene polymorphism increases age-related susceptibility to hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Kuo Wu-Hsien

    2010-03-01

    Full Text Available Abstract Background Hepatocellular carcinoma (HCC is one of the most frequent malignant neoplasms in the world. Genetic polymorphism has been reported to be a factor increasing the risk of HCC. Phase II enzymes such as glutathione s-transferases (GSTP1, GSTA1 play important roles in protecting cells against damage induced by carcinogens. The aim of this study was to estimate the relationship of the GSTP1 and GSTA1 gene polymorphisms to HCC risk and clinico-pathological status. Methods Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP was used to measure GSTP1 (A→G and GSTA1 (C→T gene polymorphisms in 386 healthy controls and 177 patients with HCC. Results Neither gene polymorphism was associated with the clinico-pathological status of HCC and serum expression of liver-related clinico-pathological markers. No association between the GSTA1 gene polymorphism and HCC susceptibility was found. However, in the younger group, aged ≤ 57 years, individuals with AG or GG alleles of GSTP1 had a 2.18-fold (95%CI = 1.09-4.36; p = 0.02 and 5.64-fold (95%CI = 1.02-31.18; p = 0.04 risk, respectively, of developing HCC compared to individuals with AA alleles, after adjusting for other confounders. Conclusion AG and GG alleles of GSTP1 gene polymorphisms may be considered as factors increasing the susceptibility to and risk of HCC in Taiwanese aged ≤ 57 years.

  4. Analysis of MMP-7 and TIMP-2 gene polymorphisms in coronary artery disease and myocardial infarction: A Turkish case-control study

    Directory of Open Access Journals (Sweden)

    Ebru Alp

    2017-02-01

    Full Text Available Matrix metalloproteinase (MMP and tissue inhibitors of metalloproteinase (TIMP have a significant role in tissue remodeling related to cardiac function. In earlier studies, MMP-7 A-181G (rs11568818, C-153T (rs11568819, C-115T (rs17886546, and TIMP-2 G-418C (rs8179090 polymorphisms have been studied in various diseases. However, association between coronary artery disease (CAD and these polymorphisms has been poorly studied. The goal of this study is to investigate the association of CAD and myocardial infarction (MI with MMP-7 or TIMP-2 polymorphisms. This study included 122 CAD patients and 132 control individuals. DNA was extracted from whole blood. Polymerase chain reaction-restriction fragment length polymorphism and automated direct sequencing method were used for genotyping of these polymorphisms. No significant differences were found between MMP-7 A-181G, C-115T, and TIMP-2 G-418C polymorphism and CAD or MI in a Turkish population. Despite the fact that the genotypes of MMP-7 C-153T polymorphism had no significant differences among MI and control groups, allele frequencies of C-153T polymorphism were significantly different between the two groups. Our study is the first report to clarify the appreciable relationship between MMP-7 C-153T polymorphism and MI development in CAD patients. However, these findings also need to be confirmed in other populations so we can improve our knowledge about the genetic factors affecting the development of CAD.

  5. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    Triton X-100 lysis method.17 DNA (1 - 3 ~g) was amplified by. PCR using 1 unit of Taq1 polymerase in 50 ~l of reaction mixture containing polymerase buffer and 1 pmol of oligonucleotides. The primers used were: 5' GAGCGCTCTCGAGGAGTACAC 3' [bp 2238 - 2258] and. 5' GACTGGCTTCCACTGCTGTGC 3' [bp 2956 ...

  6. Fragment Length Distributions and Collision Probabilities for AFLP Markers

    NARCIS (Netherlands)

    Gort, G.; Koopman, W.J.M.; Stein, A.

    2006-01-01

    AFLP is a DNA fingerprinting technique frequently used in plant and animal sciences. A drawback of the technique is the occurrence of multiple DNA fragments of the same length in a single AFLP lane, which we name a collision. In this article we quantify the problem. The well-known birthday problem

  7. Specific analysis of the intron 22 XbaI polymorphism of the human factor VIII gene using long-distance PCR.

    Science.gov (United States)

    De Brasi, C D; Bowen, D J; Collins, P W; Larripa, I B

    1999-12-01

    A rapid, non-radioactive, PCR-based method to genotype the XbaI restriction fragment length polymorphism of the human factor VIII gene is described. The method uses long-distance PCR followed by XbaI restriction digestion and agarose gel electrophoresis. The 6.6 kb amplification product includes a constant XbaI site, which provides a digestion control. The specificity of the method was challenged by a blind experiment with 16 genomic DNA samples previously genotyped by Southern blot analysis: a perfect correlation was obtained between genotypes determined using Southern blot and PCR.

  8. PERMANENT GENETIC RESOURCES: Development of 52 new polymorphic SSR markers from cherimoya (Annona cherimola Mill.): transferability to related taxa and selection of a reduced set for DNA fingerprinting and diversity studies.

    Science.gov (United States)

    Escribano, P; Viruel, M A; Hormaza, J I

    2008-03-01

    Fifty-two single locus polymorphic microsatellites were developed using two genomic libraries digested with HaeIII and RsaI of cherimoya cv. Fino de Jete enriched in CT/AG repeats. A total of 222 alleles were detected with the selected simple sequence repeats (SSRs). The observed and expected heterozygosities ranged from 0.08 to 0.73 and from 0.20 to 0.84, respectively. Most of the SSRs were transferable to other species in the Annonaceae. A set of 20 microsatellites was selected to facilitate the exchange of data among laboratories. © 2007 The Authors.

  9. A Comprehensive Study of Genic Variation in Natural Populations of Drosophila Melanogaster. IV. Mitochondrial DNA Variation and the Role of History Vs. Selection in the Genetic Structure of Geographic Populations

    OpenAIRE

    Hale, L. R.; Singh, R. S.

    1991-01-01

    Preliminary studies with restriction fragment length polymorphisms of mitochondrial DNA (mtDNA) in natural populations of Drosophila melanogaster revealed considerable variation in terms of nucleotide sequence and overall size. In this report we present data from more isofemale lines and more restriction enzymes, and explore the utility of the data in inferring a colonization history of this species. Size variation in the noncoding A + T-rich region is particularly plentiful, with size varian...

  10. Endothelial nitric oxide synthase polymorphisms and adaptation of parasympathetic modulation to exercise training.

    Science.gov (United States)

    Silva, Bruno M; Neves, Fabricia J; Negrão, Marcelo V; Alves, Cleber R; Dias, Rodrigo G; Alves, Guilherme B; Pereira, Alexandre C; Rondon, Maria U; Krieger, José E; Negrão, Carlos E; DA Nóbrega, Antonio Claudio Lucas

    2011-09-01

    There is a large interindividual variation in the parasympathetic adaptation induced by aerobic exercise training, which may be partially attributed to genetic polymorphisms. Therefore, we investigated the association among three polymorphisms in the endothelial nitric oxide gene (-786T>C, 4b4a, and 894G>T), analyzed individually and as haplotypes, and the parasympathetic adaptation induced by exercise training. Eighty healthy males, age 20-35 yr, were genotyped by polymerase chain reaction-restriction fragment length polymorphism analysis, and haplotypes were inferred using the software PHASE 2.1. Autonomic modulation (i.e., HR variability and spontaneous baroreflex sensitivity) and peak oxygen consumption (VO(2peak)) were measured before and after training (running, moderate to severe intensity, three times per week, 60 min·day(-1), during 18 wk). Training increased VO(2peak) (P baroreflex sensitivity after training (change: wild type (-786TT) = 2% ± 89% vs polymorphic (-786TC/CC) = -28% ± 60%, median ± quartile range, P = 0.03), and parasympathetic modulation was marginally reduced in subjects with the 894T polymorphic allele (change: wild type (894GG) = 8% ± 67% vs polymorphic (894GT/TT) = -18% ± 59%, median ± quartile range, P = 0.06). Furthermore, parasympathetic modulation percent change was different between the haplotypes containing wild-type alleles (-786T/4b/894G) and polymorphic alleles at positions -786 and 894 (-786C/4b/894T) (-6% ± 56% vs -41% ± 50%, median ± quartile range, P = 0.04). The polymorphic allele at position -786 and the haplotype containing polymorphic alleles at positions -786 and 894 in the endothelial nitric oxide gene were associated with decreased parasympathetic modulation after exercise training.

  11. T300A GENETIC POLYMORPHISM: a susceptibility factor for Crohn’s disease?

    Directory of Open Access Journals (Sweden)

    Bruno Lorenzo SCOLARO

    2014-06-01

    Full Text Available ContextCrohn’s disease is characterized by a chronic and debilitating inflammatory disorder of the gastrointestinal tract. Several factors may contribute to its development. From extensive studies of the human genome, the polymorphism T300A of the gene ATG16L1 (autophagy-related 16-like 1 has been related to increased risk of developing this disease.ObjectivesAnalyze the role of polymorphism T300A (rs2241880 in patients with Crohn’s disease.Methods238 samples from (control group and 106 samples from patients with Crohn’s disease recruited at five Southern Brazilian reference centers were evaluated. The genotyping consisted of the amplification via Polymerase Chain Reaction of the genomic segment encompassing T300A, followed by Restriction Fragment Length Polymorphism analysis. The amplicons and fragments were separated by agarose gel electrophoresis and confirmed under ultraviolet light.ResultsThe genotype AG was more prevalent among patients and controls (50% vs 44.8%, followed by genotypes AA (26.4% vs 35.1% and GG (23.6% vs 20.1%. The frequency of the allele G of the polymorphism T300A was higher in the group of patients with Crohn’s disease (48.6% than in controls (42.4%, although not reaching statistical significance.ConclusionsIt was not possible to confirm the increased susceptibility on development of Crohn’s disease conferred by polymorphism T300A.

  12. Association of Interleukin-17 polymorphism (-197G/A in chronic and localized aggressive periodontitis

    Directory of Open Access Journals (Sweden)

    Harshal Liladhar CHAUDHARI

    2016-01-01

    Full Text Available Abstract Interleukin 17(IL-17 is a pro-inflammatory cytokine produced mainly by Th17 cells. The present study was undertaken to investigate a possible association between IL-17 A genetic polymorphism at (-197A/G and susceptibility to chronic and localized aggressive periodontitis (LAgP in an Indian population. The study was carried out on 105 subjects, which included 35 LAgP patients, 35 chronic periodontitis patients and 35 healthy controls. Blood samples were drawn from the subjects and analyzed for IL-17 genetic polymorphism at (-197A/G, by using the polymerase chain reaction-restriction fragment length polymorphism method. A statistically significant difference was seen in the genotype distribution among chronic periodontitis patients, LAgP patients and healthy subjects. There was a significant difference in the distribution of alleles among chronic periodontitis patients, LAgP patients and healthy subjects. The odds ratio for A allele versus G allele was 5.1 between chronic periodontitis patients and healthy controls, and 5.1 between LAgp patients and healthy controls. Our study concluded that IL-17 A gene polymorphism at (-197A/G is linked to chronic periodontitis and LAgP in Indian population. The presence of allele A in the IL-17 gene polymorphism (-197A/G can be considered a risk factor for chronic periodontitis and LAgP.

  13. Association of Interleukin-17 polymorphism (-197G/A) in chronic and localized aggressive periodontitis.

    Science.gov (United States)

    Chaudhari, Harshal Liladhar; Warad, Shivaraj; Ashok, Nipun; Baroudi, Kusai; Tarakji, Bassel

    2016-01-01

    Interleukin 17(IL-17) is a pro-inflammatory cytokine produced mainly by Th17 cells. The present study was undertaken to investigate a possible association between IL-17 A genetic polymorphism at (-197A/G) and susceptibility to chronic and localized aggressive periodontitis (LAgP) in an Indian population. The study was carried out on 105 subjects, which included 35 LAgP patients, 35 chronic periodontitis patients and 35 healthy controls. Blood samples were drawn from the subjects and analyzed for IL-17 genetic polymorphism at (-197A/G), by using the polymerase chain reaction-restriction fragment length polymorphism method. A statistically significant difference was seen in the genotype distribution among chronic periodontitis patients, LAgP patients and healthy subjects. There was a significant difference in the distribution of alleles among chronic periodontitis patients, LAgP patients and healthy subjects. The odds ratio for A allele versus G allele was 5.1 between chronic periodontitis patients and healthy controls, and 5.1 between LAgp patients and healthy controls. Our study concluded that IL-17 A gene polymorphism at (-197A/G) is linked to chronic periodontitis and LAgP in Indian population. The presence of allele A in the IL-17 gene polymorphism (-197A/G) can be considered a risk factor for chronic periodontitis and LAgP.

  14. RET single nucleotide polymorphism in Indonesians with sporadic Hirschsprung’s disease

    Directory of Open Access Journals (Sweden)

    Saryono

    2010-08-01

    Full Text Available The tyrosine kinase receptor RET, which is the protein product of the RET gene, is involved in the development of the mammalian nervous system that causes Hirschsprung’s disease (HSCR. RETs are cell surface molecules that are expressed in cells derived from the neural crest. The purpose of this study was to investigate the polymorphism of the RET gene in HSCR in the Yogyakarta population. Genomic DNA was extracted from surgically removed bowel tissues of 54 unrelated HSCR patients. Exon 2 of the RET gene was amplified by polymerase chain reaction (PCR and analyzed by restriction fragment length polymorphism (RFLP. Molecular results were compared with clinical performance of Hirschsprung patients. RET polymorphism was detected in exon 2 in all of the 54 Indonesian HSCR patients. The allelic distribution of the c135GàA polymorphism in the RET exon 2 indicated that the A allele was more frequent in patients than in control individuals (chi-square test, p= 0.001. Thus the RET variant allele A is over-represented in patients affected with the HSCR phenotype. Polymorphism of exon 2 of the RET gene was found in sporadic Hirschsprung’s disease in the Yogyakarta population, which suggests that the RET gene plays important roles in the pathogenesis of HSCR.

  15. RET single nucleotide polymorphism in Indonesians with sporadic Hirschsprung’s disease

    Directory of Open Access Journals (Sweden)

    Saryono Saryono

    2016-02-01

    Full Text Available The tyrosine kinase receptor RET, which is the protein product of the RET gene, is involved in the development of the mammalian nervous system that causes Hirschsprung’s disease (HSCR. RETs are cell surface molecules that are expressed in cells derived from the neural crest. The purpose of this study was to investigate the polymorphism of the RET gene in HSCR in the Yogyakarta population. Genomic DNA was extracted from surgically removed bowel tissues of 54 unrelated HSCR patients. Exon 2 of the RET gene was amplified by polymerase chain reaction (PCR and analyzed by restriction fragment length polymorphism (RFLP. Molecular results were compared with clinical performance of Hirschsprung patients. RET polymorphism was detected in exon 2 in all of the 54 Indonesian HSCR patients. The allelic distribution of the c135GàA polymorphism in the RET exon 2 indicated that the A allele was more frequent in patients than in control individuals (chi-square test, p= 0.001. Thus the RET variant allele A is over-represented in patients affected with the HSCR phenotype. Polymorphism of exon 2 of the RET gene was found in sporadic Hirschsprung’s disease in the Yogyakarta population, which suggests that the RET gene plays important roles in the pathogenesis of HSCR.

  16. TC2 C776G polymorphism studies in patients with oral cancer in the Polish population

    Directory of Open Access Journals (Sweden)

    Katarzyna Malinowska

    2016-11-01

    Full Text Available The first signs of oral cancer may resemble developing infections in the mucous membranes, with throat cancer symptoms being similar to those of upper respiratory tract infections. This greatly hinders rapid diagnosis and treatment. Better knowledge of the changes occurring in the metabolism of folic acid can help in understanding the carcinogenesis affecting DNA methylation and genome stability. Polymorphisms in genes encoding enzymes involved in this pathway may influence enzyme activity and thereby interfere with the concentrations of homocysteine and S-adenosylmethionine, which are important for DNA synthesis and cellular methylation reactions. The aim of the study was to determine the risk of oral cancer associated with the TC2 C776G polymorphism, as determined in 119 patients. Genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. The test genotype was found to correspond to the Hardy-Weinberg (HW equilibrium (p > 0.05. In our population G/G homozygosity of C776G TC2 gene polymorphism increases the risk of oral cancer; OR (odds ratio: 4.3875; 95% CI (confidence interval: 2.0518-9.319; p = 0.001. Regarding C/G genotype of the C776G TC2 gene, polymorphism also increases the risk of developing this cancer; OR 2.4146 95% CI: 1.2803-4.5541; p = 0.01.

  17. Identification of polymorphisms in the RNase3 gene and the association with allergic rhinitis.

    Science.gov (United States)

    Kang, Inhong; An, Xue-hua; Oh, Yeon-Kyun; Lee, Sang Heon; Jung, Ha Min; Chae, Soo-Cheon; Lee, Jae Hoon

    2010-03-01

    Eosinophil cationic protein (ECP), a potent cytotoxic molecule, is released by activated eosinophils. ECP has been suggested to be involved in tissue remodeling of allergic diseases. The ECP (RNase3) gene is a candidate gene in atopic diseases. RNase3 polymorphisms have been reported to have an association with atopy. We determined whether polymorphisms in the RNase3 gene are associated with allergic rhinitis in a Korean population. The Taqman assay, restriction fragment length polymorphism (PCR-RFLP), and high-resolution melt (HRM) were used for genotyping. Three single nucleotide polymorphisms (SNPs; g.-550A>G, g.371G>C, and g.499G>C) were identified. The genotype of the SNPs was analyzed in patients with allergic rhinitis and controls without allergic rhinitis. The genotype and allele frequencies were compared between both groups. The genotype frequencies of the g.-550A>G and g.371G>C SNPs were not significantly different between patients with allergic rhinitis and controls (P > 0.05). However, in patients with allergic rhinitis, the genotype and allele frequencies of the g.499G>C SNP of RNase 3 were significantly different from those of the control group (P associated with allergic rhinitis (P = 0.048), while the G-G-G haplotype was negatively associated with allergic rhinitis (P = 0.004). Our study suggests that RNase3 polymorphisms are potentially associated with susceptibility to allergic rhinitis.

  18. Paraoxonase activity and genetic polymorphisms in northern Han Chinese workers exposed to organophosphate pesticides.

    Science.gov (United States)

    Zhang, Xiaofeng; Sui, Hong; Li, Haibo; Zheng, Jing; Wang, Fengqian; Li, Baixiang; Zhang, Yang

    2014-02-01

    Paraoxonase (PON1) is one of the major players in the detoxification of organophosphates (OPs). This study presents our investigation into the effect of OPs on serum PON1 activity and the distribution of common PON1 polymorphisms in Han Chinese workers with repeated high exposure to OP pesticides, and the factors modulating PON1 activity. In all, 400 participants, including 180 workers exposed to OP pesticides occupationally, and 220 controls were investigated. Serum PON1 and cholinesterase (ChE) activity were measured, and genotyping was done using polymerase chain reaction-restriction fragment length polymorphism. The association between PON1 activity and PON1 polymorphisms, and the influencing factors of PON1 activity, were analyzed. The results revealed that repeated OP exposures significantly decreased serum PON1 and ChE activity (Ppesticide exposures significantly affected serum PON1 activity in the study population. Therefore, the results of this investigation indicate PON1 polymorphisms and pesticide exposures may be important risk predictors for OP poisoning in the Han Chinese population, who display very high frequencies of the M allele and R allele for PON1 polymorphisms at the positions 55 and 192, respectively.

  19. [Leptin gene C2549A polymorphism in minority Hui and Uygur children with obesity].

    Science.gov (United States)

    Zhang, Ji-Hong; Zeng, Wen-Juan; Xu, Pei-Ru; Zhang, Wei-Ping

    2014-01-01

    To investigate the relationship of leptin gene polymorphism with obesity in ethnic minority Hui and Uygur children in China. Sixty-eight ethnic minority (35 Hui and 33 Uygur) children with obesity and 69 age-matched minority (36 Hui and 33 Uygur) children without obesity were recruited from six primary schools in the sub-urban areas of Urumqi. Venous blood was sampled from all subjects after fasting for 12 hours. Leptin gene C2549A polymorphism was determined by polymerase chain reaction (PCR) and restriction fragment length polymorphism methods. Blood concentrations of lipids, leptin and insulin were measured with biochemical methods and radioimmunoassys, respectively. In the 137 children tested, the prevalence of AA, AC and CC genotype was 9.5%, 33.6% and 56.9%, respectively. A allele frequency was significantly different between the two ethnic (i.e. Hui and Uygur) groups (P0.05). Blood leptin levels were not significantly different between obese and non-obese children with an AA+AC or CC genotype in both ethnic groups (P>0.05). Leptin gene polymorphisms exist in Hui and Uygur children. The C2549A polymorphism is not significantly associated with the prevalence of obesity in both Hui and Uygur children.

  20. Angiotensin II type 1 receptor (A1166C gene polymorphism and essential hypertension in Egyptian population

    Directory of Open Access Journals (Sweden)

    Marium M. Shamaa

    2016-09-01

    Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used f